Simple synthesis of modafinil derivatives and their anti-inflammatory activity

Article abstract of DOI:10.3390/molecules170910446

Simple synthesis of modafinil derivatives and their biological activity are described. The key synthetic strategies involve substitution and coupling reactions. We determined the anti-inflammatory effects of modafinil derivatives in cultured BV2 cells by measuring the inhibition of nitrite production and expression of iNOS and COX-2 after LPS stimulation. It was found that for sulfide analogues introduction of aliphatic groups on the amide part (compounds 11a-d) resulted in lower anti-inflammatory activity compared with cyclic or aromatic moieties (compounds 11e-k). However, for the sulfoxide analogues, introduction of aliphatic moieties (compounds 12a-d) showed higher anti-inflammatory activity than cyclic or aromatic fragments (compounds 12e-k) in BV-2 microglia cells.

Full text of DOI:10.3390/molecules170910446

Molecules 2012, 17, 10446-10458; doi:10.3390/molecules170910446
OPEN ACCESS
molecules
ISSN 1420-3049
www.mdpi.com/journal/molecules
Article
Simple Synthesis of Modafinil Derivatives and Their
Anti-inflammatory Activity
Jae-Chul Jung 1, Yeonju Lee 1, Jee-Young Son 2, Eunyoung Lim 2, Mankil Jung 2 and
Seikwan Oh 1,*
1
Department of Neuroscience and Tissue Injury Defense Research Center, School of Medicine,
Ewha Womans University, Seoul 158-710, Korea
2
Department of Chemistry, Yonsei University, Seoul 120-749, Korea
* Author to whom correspondence should be addressed; E-Mail: skoh@ewha.ac.kr.
Received: 2 July 2012; in revised form: 10 August 2012 / Accepted: 14 August 2012 /
Published: 3 September 2012
Abstract: Simple synthesis of modafinil derivatives and their biological activity are
described. The key synthetic strategies involve substitution and coupling reactions. We
determined the anti-inflammatory effects of modafinil derivatives in cultured BV2 cells by
measuring the inhibition of nitrite production and expression of iNOS and COX-2 after
LPS stimulation. It was found that for sulfide analogues introduction of aliphatic groups on
the amide part (compounds 11a–d) resulted in lower anti-inflammatory activity compared
with cyclic or aromatic moieties (compounds 11e–k). However, for the sulfoxide analogues,
introduction of aliphatic moieties (compounds 12a–d) showed higher anti-inflammatory
activity than cyclic or aromatic fragments (compounds 12e–k) in BV-2 microglia cells.
Keywords: modafinil; anti-inflammation; nitric oxide; S-alkylation; coupling reaction
1. Introduction
Modafinil in racemic form is proving clinically useful in the treatment of narcolepsy, a neurological
disorder marked by uncontrollable attacks of daytime sleepiness [1]. Since the discovery of (±)-2-
(diphenylmethylsulfinyl)acetamide by Laboratoire L. Lafon, modafinil and its derivatives (Figure 1)
have stimulated significant interest due to their potential biological activities [2]. It is experimentally
used in the treatment of Alzheimer's disease, myotonic dystrophy, multiple sclerosis-induced fatigue,
jet-lag, and cognitive impairment in schizophrenia [3–5].

Molecules 2012, 17
Figure 1. Structures of modafinic acid (1), modafinil (2) and andrafinil (3).
10447
O
S
O
O
S
O
O
S
O
OH
OH
NH2
N
H
Modafinic acid (1)
Modafinil (2)
Andrafinil (3)
Since modafinil has been used as a psychostimulant for the treatment of narcolepsy, most research
on the action mechanism of modafinil has focused on its monoaminergic effects, showing that modafinil
stimulates the dopamine, serotonin, and norepinephrine pathways in the brain. In addition, modafinil is
known to inhibit hepatic cytochrome P450 activities and has a neuroprotective function [6–8]. It might also
be useful to treat attention deficit hyperactivity disorder (ADHD), and cancer-related fatigue [9,10].
Recently, other therapeutic applications of modafinil include Parkinson’s disease, and cocaine
dependence and withdrawal [11–13]. A link between systemic inflammation and dementia was first
hypothesized after discovery of up-regulated inflammatory processes localized to Alzheimer’s disease
pathology in post-mortem brain specimens [14]. Given the role of glia in mediating neurodegeneration,
a great deal of effort has been made to develop novel treatment for Parkinson’s disease by targeting
glia and associated inflammatory factors [15,16]. These results led us to investigate the pharmacological
activity of modafinil derivatives on the inflammation.
Recent reports described a simple synthesis of racemic or single isomer modafinil and its
derivatives, including their screening assay for their biological properties [3,4]. The Prisinzano group
reported asymmetric synthesis and elucidation of the absolute configuration of the enantiomers of
modafinil [17]. The Olivo group has developed a preparation of (S)-modafinil in 68% yield via
microbial (Bacillus subtilis) oxidation and subsequent amidation of benzhydrylsulfanyl acetic acid [18].
The Coquerel group demonstrated an enantioselective synthesis of modafinil and its derivatives using
an enantioselective oxidation with stoichiometric chiral oxaziridine in 66% yield [19]. The Woster
group has described polyaminohydroxamides and polyaminobenzamides as isoform selective histone
deacetylase (HDAC) inhibitors [20].
In the context of our medicinal research program dealing with the synthesis of biologically active
modafinil derivatives, we wish to report a simple synthesis of modafinil analogues from benzophenone
through intramolecular ring cyclization, O-alkylation, and coupling reaction. Biological activities of
these modafinil analogues for suppression of LPS-induced NO generation and the expression of
inflammation-related enzymes were measured in BV2 cells. These results suggest that modafinil
derivatives can also be developed as potential anti-inflammatory agents.
Scheme 1 reveals our overall retro-synthetic approach for these target molecules. The benzothiol
group skeleton is an essential structural feature for the modafinil moieties of narcolepsy agents.
They have traditionally been constructed by substitution and hydrolysis in acidic media. The key
intermediate 5 was obtained by S-alkylation of benzhydrol (6), which could be oxidized to generate
modafinil (2). Acids 7 and 1 were treated with azide and then oxidized to generate modafinil derivatives.

Molecules 2012, 17
Scheme 1. Retrosynthetic analysis of the modafinil (2) and its derivatives 4.
10448
S-alkylation
X-R
OH
S
S
5
OH
Coupling
Reaction
Oxidation
O
O
O
2 X-R: NH2
6
4 X-R: O-alkyl, N-alkyl
2. Results and Discussion
2.1. Chemistry
To generate key fragment 5, which is well known as a pharmacophore for psycostimulant agents,
commercially available benzhydrol (6) was treated with Lawesson’s reagent in toluene under nitrogen
atmosphere to give 7 in 73% yield [21]. Substitution of thiol 7 was performed with chloroacetonitrile
in the presence of potassium carbonate in acetone to give nitrile 8 in 77% yield. Compound 7 was
treated with potassium hydroxide in ethanol via oxidative hydration to give acetamide 9 in 75% yield.
Subsequent oxidation of acetamide 9 was accomplished with 30%-H2O2 in acetic acid in order to
afford modafinil (2) in 67% yield (Scheme 2).
Scheme 2. Synthesis of modafinil.
c
NH2
S
R
O
9
6
7
8
R = OH
R = SH
R = SCH2CN
a
b
e
f
d
g
OH
NH2
S
S
O
O
O
5
2
Reagents and conditions: (a) Lawesson’s reagent, toluene, reflux, N2, 3 h, 73%; (b) chloroacetonitrile,
K2CO3, acetone, 6 h, 77%; (c) KOH, ethanol, reflux, 6 h, 75%; (d) thioglycolic acid, TFA, 3 h,
90%; (e) SOCl2, benzene, reflux, 2 h; and then NH4OH, dichloromethane, rt 2 h, 83%; (f) H2O2,
acetic acid, 40 °C, overnight, 67%; (g) H2O2, cat-H2SO4, MeOH, rt 16 h; and then NH4OH,
dichloromethane, rt 2 h.

Molecules 2012, 17
10449
On the other hand, direct alkylation of benzhydrol (6) with thioglycolic acid in TFA gave acid 5 in
90% yield. In an attempt to prepare modafinil (2) from benzhydrylsulfanyl acetic acid 5 it was treated
with H2O2 in acidic media and then treated with NH4OH in dichloromethane, but this reaction was
unsatisfactory, and for the most part the starting material was recovered. Acid 5 was however smoothly
transformed into acetamide 9 in 83% yield through treatment with thionyl chloride and ammonium
hydroxide in a two step process [22]. Oxidation of compound 9 was accomplished with H2O2 in acetic
acid at 40 °C to generate modafinil (2) in 67% yield (Scheme 2).
Esterification of acid 5 was performed by concentrated H2SO4 in ethanol to give ester 10 in 92%
yield. Compound 5 was also treated with 30%-H2O2 in the presence of conc. H2SO4 in methanol to
afford the sulfonate, which was subsequently hydrolyzed using aqueous sodium hydroxide in ethanol
to generate acid 1 in 70% yield. Acids 5 and 1 were finally treated with various amines (alkyl amines:
methylamine, allylamine, n-decylamine, t-decylamine, 1-(3-aminopropyl)pyrrolidinone, cyclohexylamine;
heterocyclic amines: tetrahydrofurfurylamine, and furfurylamine, and anilines: aniline, 4-ethylaniline,
N,N-dimethyl-p-phenylenediamine) in the presence of 1-hydroxybenzotriazole (HOBt), and
ethyl(dimethylaminopropyl)-carbodiimide (EDC) in DMF to give modafinil derivatives 11a–k and
12a–k, respectively (Scheme 3).
Scheme 3. Synthesis of modafinil derivatives.
a, R2 = Me
b, R2 = C10H21
c, R2 = C14H29
d, R2 = CH2CH=CH2
O
O
S
S
H2N-R2
b
R1
NH-R2
e, R2 =
5 R1 = OH
10 R1 = OEt
a
11a-k
O
CH2
f, R2 =
O
c
g, R =
CH CH CH -
N
2
2
2
2
h, R2 =
i, R2 =
j, R2 =
O
S
O
O
S
O
H2N-R2
b
NH-R2
OH
N
1
12a-k
O
k, R2 =
CH2
Reagents and conditions: (a) conc.-H2SO4, EtOH, reflux, 16 h, 92%; (b) H2N-R2, HOBt, EDC,
DMF, 63% to 91%; (c) 30%-H2O2, conc’d-H2SO4, 2-propanol, MeOH, rt 2 h; and then NaOH, H2O,
EtOH, rt 2 h, 70%.

Molecules 2012, 17
10450
2.2. Biology
Nitrite was used as a measure of NO production as a marker of inflammation induction. The in vitro
suppression of LPS-induced NO generation of the prepared modafinil derivatives was evaluated by the
published test method [23] and the results are summarized in Figure 2. Chen et al. have reported that
aspirin and indomethacin both decrease NOS activity and nitrite/nitrate formation in platelets [24].
Aspirin was used as reference anti-inflammatory agent in this experiment. Most of the modafinil
derivatives inhibited nitrite accumulation in LPS-stimulated microglia BV-2 cells to some extent, with
the aliphatic derivatives 12a–d exhibiting the greatest inhibitory activity for LPS-induced NO
generation. Interestingly, compounds 11a–d (with aliphatic groups and without sulfoxide) showed very
low activity in inhibition of NO production at 1–5 µM concentrations in LPS-stimulated BV-2 cells
(Figure 2).
Figure 2. Effect of modafinil derivatives 11a–k, 12a–k and aspirin (ASA) on nitrite
production in LPS-stimulated BV-2 microglia cells. Cells were treated with 100 ng/mL
LPS, and then various concentrations of test compounds (1 µM, 5 µM, and 10 µM) were
added for 24 h at 37 °C. Values indicate nitrite production from culture supernatants of
LPS-treated cells with or without compounds. Data represent the mean ± standard
deviation of three observations. * p < 0.05 in comparison with LPS treated group.
1
5
 M
 M
1 2 0
1 0 0
8 0
6 0
4 0
2 0
0
1 0  M
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
S h a m
L P S
A S A
1 1 a
1 1 b
1 1 c
1 1 d
1 1 e
1 1 f
1 1 g
1 1 h
1 1 i
1 1 j
1 1 k
1
5
 M
 M
1 2 0
1 0 0
8 0
6 0
4 0
2 0
0
1 0  M
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
S h a m
L P S
2
1 2 a
1 2 b
1 2 c
1 2 d
1 2 e
1 2 f
1 2 g
1 2 h
1 2 i
1 2 j
1 2 k

Molecules 2012, 17
10451
2.3. Reduction of the Level of Pro-Inflammatory Enzyme Expression
Modafinil derivatives exerted an anti-inflammatory effect on LPS-induced responses accompanied
by the expression of pro-inflammatory enzymes in cells. BV2 cells were collected after activation by
LPS (100 ng/mL) with or without modafinil derivatives (1 µM, 5 µM, and 10 µM) for 24 h. The
mRNA expression levels of the iNOS and COX-2 were reduced by treatment with modafinil
derivatives 11c, 11e, 11h and 12b–d (Figure 3). Interestingly, modafinil derivatives 12b–d highly
suppressed the LPS-induced iNOS expression. These results indicated that modafinil derivatives have
anti-inflammatory effects on the expression of LPS-induced pro-inflammatory enzymes in cultured cells.
Figure 3. Effects of modafinil derivatives and aspirin (ASA) on inflammation-related
enzyme mRNA expression in LPS-treated BV2 cells. Cells were treated by 100ng/ml LPS
with or without modafinil derivatives or aspirin (1 µM, 5 µM, and 10 µM) for 24 h.
Expression of iNOS and COX-2 was measured by PCR analysis.
Aspirin
Moda.11e
Moda.11h
Moda.11c
iNOS
COX-2
LPS
ASA
-
-
LPS
#11c
-
-
+
-
+
1
+
5
+
10
LPS
#11e
-
-
+
-
+
+
5
+
10
LPS
#11h
-
-
+
-
+
+
5
+
+
-
+
1
+
5
+
10
1
1
10
Moda.12b
Moda.12c
Moda.12d
iNOS
COX-2
LPS
#12b
-
-
+
-
+
1
+
5
+
10
LPS
#12c
-
-
+
-
+
1
+
5
+
10
LPS
#12d
-
-
+
-
+
1
+
5
+
10
3. Experimental
3.1. General Procedures
Reactions requiring anhydrous conditions were performed with the usual precautions for rigorous
exclusion of air and moisture. Tetrahydrofuran was distilled from sodium benzophenone ketyl prior to
use. Thin layer chromatography (TLC) was performed on precoated silica gel G and GP uniplate from
Analtech and visualized with 254-nm UV light. Flash chromatography was carried out on silica gel 60
1
[Scientific Adsorbents Incorporated (SAI), particle size 32–63 µm, pore size 60 Å]. H-NMR and
13C-NMR spectra were recorded on a Bruker DPX 250 instrument at 250 MHz and 63 MHz,
respectively. The chemical shifts are reported in parts per million (ppm) downfield from
tetramethylsilane, and J values are in Hz. Infrared (IR) spectra were obtained on an ATI Mattson FT/IR
spectrometer. Mass spectra were recorded with a Waters Micromass ZQ LC-Mass system and high
resolution mass spectra (HRMS) were measured with a Bruker BioApex FTMS system by direct
injection using an electrospray interface (ESI). When necessary, chemicals were purified according to
the reported procedures [25].

Molecules 2012, 17
10452
3.2. General Procedure for the Preparation of Compounds 11a–k and 12a–k via Condensation of
Acids 1, 5 and Amines
To a stirred solution of acids (1 or 5; 0.077 mmol) and HOBt (20.8 mg, 0.154 mmol) EDC (29.5 mg,
0.154 mmol) in DMF (4 mL) was added at room temperature and the mixture was stirred for 30 min at
same temperature. The appropriate amine (0.077 mmol) was added by syringe to the reaction mixture
which was then stirred at room temperature for 1 h. The reaction mixture was diluted with ethyl acetate
(10 mL) and washed with brine (10 mL). The organic layer was separated, dried over anhydrous
MgSO4, filtered and concentrated under reduced pressure. The product was purified by flash column
chromatography on silica gel (n-hexane/EtOAc = 2:1, v/v) to give 11a–k and 12a–k.
2-Benzyhydrylsulfanyl-N-methylacetamide (11a). White solid. mp 99.0 °C; Rf = 0.27 (ethyl acetate/
n-hexane = 1:1, v/v); IR
(CHCl3, KBr): 2922, 2850, 1736, 1493, 1449, 1269, 1143, 1125, 1050,
max
1030, 970, 750 cm−1; 1H-NMR (CDCl3): δ 7.42–7.21 (m, 10H), 6.60 (s, 1H), 5.12 (s, 1H), 3.11 (s, 2H),
2.75–2.73 (d, J = 4.8 Hz, 3H); 13C-NMR (CDCl3): δ 169.1, 140.6, 128.9, 128.4, 127.8, 55.3, 36.2,
26.7; LC-MS (ESI+) m/z 294 - [M+Na].
2-Benzyhydrylsulfanyl-N-decylacetamide (11b). White liquid. Rf = 0.4 (ethyl acetate/n-hexane = 1:2,
v/v); IR max (CHCl3, KBr): 3466, 3300, 3005, 2926, 2129, 1742, 1600, 1496, 1451, 1384, 1280, 1158,
1117, 1055, 995, 754, cm−1; 1H-NMR (CDCl3): δ 7.41–7.21 (m, 10H), 6.65 (s, 1H), 5.11 (s, 1H), 3.24–3.16
(q, J = 4.2 Hz, 2H), 3.11 (s, 2H), 1.27 (brs, 16H), 0.91–0.86 (t, J = 3.8 Hz, 3H); 13C-NMR (CDCl3): δ
168.3, 140.6, 129.0, 128.4, 127.8, 55.3, 40.0, 36.4, 32.1, 31.1, 29.5, 27.2, 22.9, 14.3; LC-MS (ESI+)
m/z 420 - [M+Na].
2-Benzyhydrylsulfanyl-N-tetradecylacetamide (11c). White solid. mp 52.2 °C; Rf = 0.43 (ethyl acetate/
n-hexane = 1:2, v/v); IR
(CHCl3, KBr): 3302, 2963, 2925, 1658, 1600, 1516, 1450, 1412, 1324,
max
1248, 1077, 1030, 833, 750 cm−1; 1H-NMR (CDCl3): δ 7.42–7.21 (m, 10H), 6.64 (s, 1H), 5.11 (s, 1H),
13
3.24–3.16 (q, J = 4.5 Hz, 2H), 3.11 (s, 2H), 1.26 (brs, 24H), 0.90–0.85 (t, J = 4.0 Hz, 3H); C-NMR
(CDCl3): δ 167.7, 140.6, 129.0, 128.4, 127.8, 55.3, 40.0, 36.4, 32.1, 31.1, 29.8, 29.6, 27.2, 22.9, 14.1;
LC-MS (ESI+) m/z 476 - [M+Na].
N-Allyl-2-benzyhydrylsulfanylacetamide (11d). Light yellow liquid. Rf = 0.47 (ethyl acetate/n-hexane
= 1:1, v/v); IR
(CHCl3, KBr): 3297, 3026, 2924, 1650, 1541, 1493, 1450, 1410, 1318, 1162, 1077,
max
1
1030, 750 cm−1; H-NMR (CDCl3): δ 7.42–7.21 (m, 10H), 6.71 (s, 1H), 5.89–5.73 (m, 1H), 5.23–5.14
(m, 3H), 3.85–3.80 (t, J = 5.1 Hz, 2H), 3.13 (s, 2H); 13C-NMR (CDCl3): δ 168.3, 140.5, 134.0, 128.4,
127.8, 127.1, 116.8, 42.3, 36.3, 31.1; LC-MS (ESI+) m/z 320 - [M+Na].
2-Benzyhydrylsulfanyl-N-cyclohexylacetamide (11e). White solid. mp 120.9 °C; Rf = 0.67 (ethyl acetate/
n-hexane = 1:1, v/v); IRmax (CHCl3, KBr): 3291, 3061, 3027, 2928, 2853, 1643, 1548, 1494, 1450,
1
1325, 1246, 1153, 1077, 1030, 986, 891, 749 cm−1; H-NMR (CDCl3): δ 7.69–7.24 (m, 10H), 6.59
(s, 1H), 5.11 (s, 1H), 3.77–3.74 (m, 1H), 3.07 (s, 2H), 1.74–1.67 (q, J = 6.5 Hz, 4H), 1.35–1.23
(m, 6H); 13C-NMR (CDCl3): δ 167.2, 140.4, 128.9, 128.4, 127.7, 55.0, 48.5, 36.3, 33.1, 29.8, 25.6;
LC-MS (ESI+) m/z 362 - [M+Na].

Molecules 2012, 17
10453
2-Benzyhydrylsulfanyl-N-(tetrahydrofuran-2-ylmethyl)acetamide (11f). White solid. mp 117.8 °C;
Rf = 0.3 (ethyl acetate/n-hexane = 1:1, v/v); IR max (CHCl3, KBr): 3304, 3060, 3027, 2926, 2870, 1651,
1
1531, 1494, 1450, 1384, 1304, 1078, 1030, 922, 750 cm−1; H-NMR (CDCl3): δ 7.43–7.20 (m, 10H),
6.99 (s, 1H), 5.20 (s, 1H), 3.99–3.75 (m, 3H), 3.58–3.52 (m, 1H), 3.19–3.09 (m, 3H), 2.02–1.87
13
(m, 4H); C-NMR (CDCl3): δ 168.5, 140.3, 128.8, 128.4, 127.6, 68.2, 54.8, 43.5, 36.1, 29.8, 25.9;
LC-MS (ESI+) m/z 364 - [M+Na].
2-Benzyhydrylsulfanyl-N-[3-(2-oxo-pyrrolidin-1-yl)-propyl]acetamide (11g). Light yellow liquid. Rf = 0.3
(dichloromethame/methanol = 10:1, v/v); IR
(CHCl3, KBr): 3293, 3060, 3027, 2928, 2870, 1738,
max
1660, 1539, 1494, 1450, 1383, 1292, 1248, 1078, 1030, 751 cm−1; H-NMR (CDCl3): δ 7.46–7.21
1
(m, 11H), 5.30 (s, 1H), 3.39–3.08 (m, 8H), 2.43–2.36 (t, J = 5.0 Hz, 2H), 2.08–1.96 (m, 2H),
13
1.71–1.61 (m, 2H); C-NMR (CDCl3): δ 175.8, 169.0, 140.6, 128.7, 128.5, 127.5, 54.7, 47.3, 40.8,
36.4, 36.1, 30.9, 26.8, 18.0; LC-MS (ESI+) m/z 405 - [M+Na].
2-Benzyhydrylsulfanyl-N-phenylacetamide (11h). White solid. mp 98.9 °C; Rf = 0.43 (ethyl acetate/
n-hexane = 1:2, v/v); IR
(CHCl3, KBr): 3301, 3060, 3019, 2913, 1659, 1601, 1540, 1495, 1442,
max
1319, 1242, 1074, 1029, 747 cm−1; H-NMR (CDCl3): δ 8.45 (s, 1H), 7.49–7.08 (m, 15H), 5.19
(s, 1H), 3.23 (s, 2H); 13C-NMR (CDCl3): δ 166.7, 140.3, 137.7, 129.2, 129.0, 128.5, 127.9, 124.8,
119.9, 54.3, 37.2; LC-MS (ESI+) m/z 356 - [M+Na].
1
2-Benzyhydrylsulfanyl-N-(4-ethylphenyl)acetamide (11i). White solid. mp 90.4 °C; Rf = 0.5 (ethyl
acetate/n-hexane = 1:2, v/v); IR
(CHCl3, KBr): 3440, 2922, 2850, 1738, 1495, 1450, 1384, 1282,
max
1153, 1117, 1053, 1032, 967, 752, 704 cm−1; H-NMR (CDCl3): δ 7.42–7.26 (m, 12H), 7.21 (s, 1H),
7.17–7.14 (d, J = 7.1 Hz, 2H), 5.18 (s, 1H), 3.23 (s, 2H), 2.66–2.57 (q, J = 4.9 Hz, 2H), 1.25–1.12
(t, J = 4.2 Hz, 3H); 13C-NMR (CDCl3): δ 166.4, 140.8, 140.2, 135.2, 128.9, 128.4, 128.3, 127.8, 120.0,
55.2, 37.1, 28.4, 15.8; LC-MS (ESI+) m/z 384 - [M+Na].
1
2-Benzyhydrylsulfanyl-N-(4-dimethylaminophenyl)acetamide (11j). Light yellow solid. mp 131.8 °C;
Rf = 0.53 (ethyl acetate/n-hexane = 1:1, v/v); IR
(CHCl3, KBr): 3304, 2918, 1651, 1600, 1519,
max
1450, 1384, 1324, 1248, 1125, 1029, 947, 816, 749 cm−1; 1H-NMR (CDCl3): δ 8.29 (s, 1H), 7.44–7.24
(m, 12H), 6.73–6.70 (d, J = 7.5 Hz, 2H), 5.12 (s, 1H), 3.23 (s, 2H), 2.93 (s, 6H); 13C-NMR (CDCl3): δ
166.1, 140.4, 128.4, 127.8, 127.2, 121.8, 113.2, 41.1, 37.0, 29.8; LC-MS (ESI+) m/z 399- [M+Na].
2-Benzyhydrylsulfanyl-N-(furan-2-ylmethyl)acetamide (11k). Light yellow solid. mp 89.6 °C; Rf = 0.27
(ethyl acetate/n-hexane = 1:2, v/v); IR
(CHCl3, KBr): 3291, 3059, 3026, 2923, 1648, 1559, 1541,
max
1522, 1508, 1491, 1449, 1419, 1385, 1313, 1195, 1147, 1078, 1016, 748 cm−1; H-NMR (CDCl3): δ
1
7.37–7.19 (m, 11H), 6.96 (m, 1H), 6.35–6.33 (t, J = 7.2 Hz, 1H), 6.25–6.23 (d, J = 5.0 Hz, 1H), 5.08
13
(s, 1H), 4.40–4.38 (d, J = 5 Hz, 2H), 3.10 (s, 2H); C-NMR (CDCl3): δ 168.3, 151.2, 142.5, 140.4,
128.9, 128.5, 127.8, 110.7, 107.8, 55.0, 36.9, 36.2; LC-MS (ESI+) m/z 360 - [M+Na].
2-Benzyhydrylsulfinyl-N-(furan-2-ylmethyl)acetamide (12a). White liquid. Rf = 0.08 (ethyl acetate/
n-hexane = 2:1, v/v); IR
(CHCl3, KBr): 2961, 2926, 1736, 1494, 1451, 1282, 1117, 1053, 1031,
max
967, 753 cm−1; 1H-NMR (CDCl3): δ 7.50–7.34 (m, 10H), 7.09 (s, 1H), 5.21 (s, 1H), 3.46–3.40 (d, J = 4.6 Hz,

Molecules 2012, 17
10454
1H), 3.18–3.12 (d, J = 4.6 Hz, 1H), 2.80–2.78 (d, J = 3.5 Hz, 3H); 13C-NMR (CDCl3): δ 164.9, 135.0,
129.7, 129.6, 129.0, 128.8, 72.3, 52.7, 26.6; LC-MS (ESI+) m/z 310 - [M+Na].
2-Benzyhydrylsulfanyl-N-decylacetamide (12b). White solid. mp 90.1 °C; Rf = 0.4 (ethyl acetate/
n-hexane = 1:1, v/v); IR
(CHCl3, KBr): 3027, 2960, 2925, 1733, 1493, 1451, 1269, 1137, 1051,
max
1029, 750 cm−1; 1H-NMR (CDCl3): 7.50–7.31 (m, 10H), 7.07 (s, 1H), 5.19 (s, 1H), 3.45–3.39 (d, J = 4.9 Hz,
1H), 3.31–3.22 (q, J = 4.3 Hz, 2H), 3.15–3.09 (d, J = 4.3 Hz, 1H), 1.26 (brs, 16H), 0.90–0.85 (t,
J = 3.5 Hz, 3H); 13C-NMR (CDCl3): δ 164.2, 134.9, 134.3, 129.7, 129.1, 128.8, 71.6, 52.5, 40.1, 32.1,
31.1, 29.7, 29.6, 27.1, 20.6, 14.3; LC-MS (ESI+) m/z 436 - [M+Na].
2-Benzyhydrylsulfinyl-N-tetradecylacetamide (12c). White solid. mp 93.1 °C; Rf = 0.43 (ethyl acetate/
n-hexane = 1:1, v/v); IR
(CHCl3, KBr): 3298, 3061, 3027, 2127, 1951, 1736, 1599, 1494, 1450,
max
1368, 1274, 1124, 1027, 998, 752 cm−1; H-NMR (CDCl3): δ 7.51–7.33 (m, 10H), 7.08 (s, 1H), 5.20
(s, 1H), 3.45-3.40 (d, J = 4.8 Hz, 1H), 3.30–3.21 (q, J = 3.6 Hz, 2H), 3.15–3.09 (d, J = 3.6 Hz, 1H),
1.25 (brs, 24H), 0.90–0.85 (t, J = 3.2 Hz, 3H); 13C-NMR (CDCl3): δ 164.1, 135.0, 134.2, 130.8, 129.7,
128.9, 71.6, 52.6, 40.1, 32.1, 31.1, 29.7, 29.5, 27.1, 22.9, 14.4; LC-MS (ESI+) m/z 492 - [M+Na].
1
N-Allyl-2-benzyhydrylsulfinylacetamide (12d). Light yellow liquid. Rf = 0.17 (ethyl acetate/n-hexane =
1:1, v/v); IR
(CHCl3, KBr): 3493, 3285, 3063, 2924, 1662, 1563, 1495, 1451, 1413, 1316, 1161,
max
1031, 751 cm−1; 1H-NMR (CDCl3): δ 7.50–7.31 (m, 10H), 7.19 (s, 1H), 5.90–5.75 (m, 1H), 5.28–5.11
(m, 3H), 3.91–3.87 (t, J = 5.1 Hz, 2H), 3.48–3.43 (d, J = 3.9 Hz, 1H), 3.19–3.14 (d, J = 3.9 Hz, 1H);
13C-NMR (CDCl3): δ 164.2, 134.9, 134.2, 133.6, 129.7, 129.6, 129.1, 116.9, 52.7, 42.3, 31.1; LC-MS
(ESI+) m/z 336 - [M+Na].
2-Benzyhydrylsulfinyl-N-cyclohexylacetamide (12e). White solid. mp 96.5 °C; Rf = 0.27 (ethyl
acetate/n-hexane = 1:1, v/v); IR
(CHCl3, KBr): 3271, 3062, 2929, 2854, 2242, 1651, 1549, 1495,
max
1451, 1384, 1324, 1260, 1152, 1126, 1041, 985, 909, 891, 732 cm−1; H-NMR (CDCl3): δ 7.51–7.31
(m, 10H), 7.09 (s, 1H), 5.22 (s, 1H), 3.86–3.79 (m, 1H), 3.44–3.39 (d, J = 3.8 Hz, 1H), 3.13–3.08 (d,
J = 4.2 Hz, 1H), 1.70–1.56 (q, J = 3.5 Hz, 4H), 1.40–1.13 (m, 6H); 13C-NMR (CDCl3): δ 163.1, 134.9,
129.7, 129.4, 128.6, 71.3, 52.4, 48.8, 32.7, 29.8, 24.8; LC-MS (ESI+) m/z 378 - [M+Na].
1
2-Benzyhydrylsulfinyl-N-(tetrahydrofuran-2-ylmethyl)acetamide (12f). White liquid. Rf = 0.1 (ethyl
acetate/n-hexane = 2:1, v/v); IR
(CHCl3, KBr): 3287, 3064, 2926, 2871, 2243, 1738, 1667, 1556,
max
1495, 1451, 1383, 1304, 1257, 1136, 1080, 1031, 911, 732 cm−1; H-NMR (CDCl3): δ 7.53–7.27 (m,
1
11H), 5.28 (s, 1H), 4.03–3.99 (m, 1H), 3.88–3.82 (q, J = 3.8 Hz, 1H), 3.78–3.73 (q, J = 3.5 Hz, 1H),
13
3.49–3.42 (m, 2H), 3.19–3.10 (m, 2H), 2.04–1.86 (m, 4H); C-NMR (CDCl3): δ 164.5, 135.2, 129.4,
128.9, 128.7, 71.3, 68.2, 52.9, 52.6, 43.6, 28.8, 25.9; LC-MS (ESI+) m/z 380 - [M+Na].
2-Benzyhydrylsulfinyl-N-[3-(2-oxo-pyrrolidin-1-yl)-propyl]acetamide (12g). White liquid. Rf = 0.2
(MC/MeOH = 10:1, v/v); IR max (CHCl3, KBr): 3448, 3063, 2927, 1662, 1560, 1495, 1450, 1294, 1031,
1
751 cm−1; H-NMR (CDCl3): δ 7.52–7.21 (m, 11H), 5.28 (s, 1H), 3.44–3.19 (m, 8H), 2.41–2.35 (t,
13
J = 3.5 Hz, 2H), 2.07–1.98 (m, 2H), 1.75–1.67 (m, 2H); C-NMR (CDCl3): δ 175.8, 164.2, 135.3,
129.4, 128.9, 128.6, 71.5, 54.1, 47.4, 39.9, 36.7, 31.0, 26.7, 18.0; LC-MS (ESI+) m/z 421 - [M+Na].

Molecules 2012, 17
10455
2-Benzyhydrylsulfinyl-N-phenylacetamide (12h). White solid. mp 100.7 °C; Rf = 0.1 (ethyl acetate/
n-hexane = 1:2, v/v); IR
(CHCl3, KBr): 2922, 2851, 1736, 1676, 1601, 1552, 1498, 1445, 1384,
max
1327, 1247, 1123, 1029, 906, 755 cm−1; H-NMR (CDCl3): δ 9.14 (s, 1H), 7.56–7.11 (m, 15H), 5.22
1
13
(s, 1H), 3.69–3.63 (d, J = 3.6 Hz, 1H), 3.28–3.23 (d, J = 3.6 Hz, 1H); C-NMR (CDCl3): δ 162.3,
155.7, 141.7, 133.8, 131.2, 129.2, 128.7, 124.9, 120.4, 67.7, 44.1; LC-MS (ESI+) m/z 372 - [M+Na].
2-Benzyhydrylsulfinyl-N-(4-ethylphenyl)acetamide (12i). White solid. mp 168.1 °C; Rf = 0.38 (ethyl
acetate/n-hexane = 1:1, v/v); IR
(CHCl3, KBr): 3259, 3190, 3121, 3062, 2962, 2924, 2852, 1675,
max
1608, 1544, 1514, 1451, 1413, 1325, 1119, 1032, 908, 834 cm−1; H-NMR (CDCl3): δ 7.71–7.35 (m,
12H), 7.26 (s, 1H), 7.15–7.12 (d, J = 7.5 Hz, 2H), 5.26 (s, 1H), 3.68–3.62 (s, 1H), 3.26–3.20 (d, J = 4.5 Hz,
1H), 2.67–2.57 (q, J = 3.7 Hz, 2H), 1.22 (t, J = 3.3 Hz, 3H); 13C-NMR (CDCl3): δ 162.3, 141.0, 135.9,
134.1, 129.7, 129.2, 129.0, 128.6, 120.6, 71.8, 51.7, 28.6, 15.9; LC-MS (ESI+) m/z 400 - [M+Na].
1
2-Benzyhydrylsulfinyl-N-(4-dimethylaminophenyl)acetamide (12j). Yellow solid. mp 184.3 °C; Rf = 0.17
(ethyl acetate/n-hexane = 1:1, v/v); IR
(CHCl3, KBr): 3288, 3063, 2922, 1666, 1603, 1519, 1450,
max
1326, 1223, 1163, 1124, 1031, 946, 818, 749 cm−1; H-NMR (CDCl3): δ 9.03 (s, 1H), 7.52–7.33 (m,
12H), 6.68–6.64 (d, J = 7.1 Hz, 2H), 5.31 (s, 1H), 3.64–3.59 (d, J = 3.4 Hz, 1H), 3.38–3.29 (d, J = 3.4 Hz,
1H), 2.91 (s, 6H); 13C-NMR (CDCl3): δ 161.8, 148.0, 134.8, 129.8, 129.5, 129.0, 128.9, 121.8, 113.1,
71.3, 52.7, 41.1; LC-MS (ESI+) m/z 415 - [M+Na].
1
2-Benzyhydrylsulfinyl-N-(furan-2-ylmethyl)-acetamide (12k). Yellow liquid. Rf = 0.2 (ethyl acetate/
n-hexane = 1:1, v/v); IR
(CHCl3, KBr): 3298, 3062, 3030, 2927, 2856, 1730, 1660, 1554, 1539,
max
1495, 1452, 1384, 1315, 1030, 749 cm−1; H-NMR (CDCl3): δ 7.53 (s, 1H), 7.41–7.26 (m, 11H),
6.34–6.32 (t, J = 6.8 Hz, 1H), 6.28–6.27 (d, J = 6.8 Hz, 1H), 5.16 (s, 1H), 4.65–4.57 (q, J = 4.5 Hz,
1H), 4.38–4.30 (q, J = 4.1 Hz, 1H), 3.52–3.46 (d, J = 3.8 Hz, 1H), 3.12–3.06 (d, J = 3.8 Hz, 1H);
13C-NMR (CDCl3): δ 164.3, 152.8, 142.4, 134.7, 130.0, 129.0, 128.8, 110.7, 108.0, 71.3, 51.8, 36.7;
LC-MS (ESI+) m/z 376 - [M+Na].
1
3.3. Biology
3.3.1. BV-2 Microglia Culture
The murine BV-2 microglia cell line was maintained in DMEM supplemented with 10% FBS and
penicillin/streptomycin at 37 °C in a humidified incubator under 5% CO2. For all experiments, cells
were plated at a density of 1 × 105 cells/mL in 24-well plates and then treated with 100 ng/mL LPS
alone or with various concentrations of compounds for 24 h at 37 °C.
3.3.2. Nitrite Assay
The Griess reaction was used to perform nitrite assays as indication of nitrite accumulation in the
medium. BV2 cells were incubated with LPS (lipopolysaccharide, 100 ng/mL) and various
concentrations of modafinil derivatives and aspirin for 24 h at 37 °C. After induction of inflammation
by LPS in cells, the levels of generated nitrite would be elevated. The culture media was then mixed
with an equal volume of reagent (1 part 0.1% N-1-naphthylethylenediamine dihydrochloride, 1 part 1%

Molecules 2012, 17
10456
sulfanilamide in 5% phosphoric acid) in 96-well plates. The absorbance was determined at 540 nm
using a microplate reader. Data are reported as the mean  the standard deviation of three observations.
3.3.3. Polymerase Chain Reaction for iNOS and COX-2
BV2 cells were stimulated with LPS in the absence or presence of modafinil derivatives for 24 h.
Total RNA was isolated from cells using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the
manufacturer’s instructions. For cDNA synthesis, 2 µg of total RNA was reverse-transcribed using the
SuperScript First-Strand Synthesis System (Invitrogen). cDNA was amplified by polymerase chain
reaction (PCR) using primers for iNOS and COX-2; cDNA was amplified by polymerase chain reaction
(PCR) using primers for iNOS (F: GTGTTCCACCAGGAGATGTTG, R: CTCCT GCCCACTGAGTTCGTC)
and COX-2 (F: AAGACTTGCCAGGCTGAACT, R: CTT CTGC AGTCCAGGTTCAA). PCR products
were separated by 1% agarose gel electrophoresis and visualized by ethidium bromide staining.
4. Conclusions
In conclusion, we have demonstrated a new and practical synthetic route to modafinil (2) using
readily available inexpensive reagents and simple reaction conditions that do not require any special
equipment or techniques. We expect that this method will prove to be useful for the practical
preparation of modafinil and modification of its derivatives. We have found that the modafinil
derivatives 11a–k and 12a–k exhibited anti-inflammatory evidenced by lowering of LPS-stimulated
nitrite production in BV2 microglial cells. The anti-inflammatory activity of modafinil derivatives is
better than that of aspirin in these cultured cells. Interestingly, the sulfoxide analogues 12a–k showed
more favorable activity than the sulfide analogues 11a–k. In case of sulfide analogues, introduction of
an aliphatic group on the amide part in 11a–d resulted in lower anti-inflammatory activity compared
with cyclic or aromatic moieties (compounds 11e–k). However, for the sulfoxide analogues,
introduction of aliphatic moieties (compounds 12a–d) resulted in higher anti-inflammatory activity
than cyclic or aromatic fragments (compounds 12e–k).
Acknowledgements
This work was supported by the Korea Research Foundation Grant (MRC, 2010-0029355) funded
by the Korean Government (MEST).
References
1. Ballon, J.S.; Feifel, D. A systematic review of modafinil: Potential clinical uses and mechanisms
of action. J. Clin. Psychiatry 2006, 67, 554–566.
2. Lafon, L. Acetamide derivatives. U.S. Patent 4,177,290, 1979.
3. Chatterjie, N.; Stables, J.P.; Wang, H.; Alexander, G.J. Anti-narcoleptic agent modafinil and its
sulfone: A novel facile synthesis and potential anti-epileptic activity. Neurochem. Res. 2004, 29,
1481–1486.
4. De Risi, C.; Ferraro, L.; Pollini, G.P.; Tanganelli, S.; Valente, F.; Veronese, A.C. Efficient synthesis
and biological evaluation of two modafinil analogues. Bioorg. Med. Chem. 2008, 6, 9904–9910.

Molecules 2012, 17
10457
5. Zhou, J.; He, R.; Johnson, K.M.; Ye, Y.P.; Kozikowski, A.P. Piperidine-based nocaine/modafinil
hybrid ligands as highly potent monoamine transporter inhibitors: Efficient drug discovery by
rational lead hybridization. J. Med. Chem. 2004, 47, 5821–5824.
6. Robertson, P.; DeCory, H.H.; Madan, A.; Parkinson, A. In vitro inhibition and induction of
human hepatic cytochrome P450 enzymes by modafinil. Drug Metab. Dispos. 2000, 28, 664–671.
7. van Vliet, S.A.; Blezer, E.L.; Jongsma, M.J.; Vanwersch, R.A.; Olivier, B.; Philippens, I.H. Exploring
the neuroprotective effects of modafinil in a marmoset Parkinson model with immunohistochemistry,
magnetic resonance imaging and spectroscopy. Brain Res. 2008, 1189, 219–228.
8. van Vliet, S.; Vanwersch, R.A.; Jongsma, M.J.; van der Gugten, J.; Olivier, B.; Philippens, I.H.
Neuroprotective effects of modafinil in a marmoset Parkinson model: Behavioral and
neurochemical aspects. Behav. Pharmacol. 2006, 17, 453–462.
9. Swanson, J.M.; Greenhill, L.L.; Lopez, F.A.; Sedillo, A.; Earl, G.Q.; Jiang, J.G.; Biederman, J.
Modafinil film-coated tablets in children and adolescents with attention-deficit/hyperactivity
disorder: Results or randomized, double-blind, placebo-controlled, fixed-dose astudy followed by
abrupt discontinuation. J. Clin. Psychiatry 2006, 67, 137–147.
10. Campos, M.P.; Hassan, B.J.; Riechelmann, R.; Del Giglio, A. Cancer-related fatigue: A review.
Rev. Assoc. Med. Bras. 2011, 57, 211–219.
11. Kraft, G.H.; Brown, J. Modafinil for fatigue in MS: A randomized placebo-controlled double-blind
study. Neurology 2005, 65, 1995–1997.
12. Nieves, A.V.; Lang, A.E. Treatment of excessive daytime sleepiness in patients with Parkinson’s
disease with modafinil. Clin. Neuropharmacol. 2002, 25, 111–114.
13. Vocci, F.J.; Elkashef, A. Pharmacotherapy and other treatments for cocaine abuse and dependence.
Curr. Opin. Psychiatry 2005, 18, 265–270.
14. Rogers, J.; Luber-Narod, J.; Styren, S.D.; Civin, W.H. Expression of immune system-associated
antigens by cells of the human central nervous system; relationship to the pathology of
Alzheimer’s disease. Neurobiol. Aging 1988, 9, 339–349.
15. Castano, A.; Herrera, A.J.; Cano, J.; Machado, A. The degenerative effect of a single intranigral
injection of LPS on the dopaminergic system is prevented by dexamethasone, and not mimicked
by rh-TNF-alpha, IL-1beta and IFN-gamma. J. Neurochem. 2001, 81, 150–157.
16. Kang, J.M.; Jung J.C.; Kim, H.; Lim, H.; Jang, S.; Oh, S. Neuroprotective effect of
benzylideneacetophenone derivative on the MPTP model of neurodegeneration in mice.
Arch. Pharm. Res. 2008, 31, 1098–1107.
17. Osorio-Lozada, A.; Prisinzano, T.; Olivo, H.F. Synthesis and determination of the absolute
stereochemistry of the enantiomers of adrafinil and modafinil. Tetrahedron: Asymmetry 2004, 15,
3811–3815.
18. Olivo, H.F.; Osorio-Lozada, A. Peeples, T.L. Microbial oxidation/amidation of benzhydrylsulfanyl
acetic acid. Synthesis of (+)-modafinil. Tetrahedron: Asymmetry 2004, 16, 3507–3511.
19. Ternois, J.; Guillen, F.; Plaquevent, J.C.; Coquerela, G. Asymmetric synthesis of modafinil and its
derivatives by enantioselective oxidation of thioethers: Comparison of various methods including
synthesis in ionic liquids. Tetrahedron: Asymmetry 2007, 18, 2959–2964.

Molecules 2012, 17
10458
20. Varghese, S.; Senanayake, T.; Murray-Stewart, T.; Doering, K.; Fraser, A.; Casero, R.A.;
Woster, P.M. Polyaminohydroxamic acids and polyaminobenzamides as isoform selective histone
deacetylase inhibitors. J. Med. Chem. 2008, 51, 2447–2456.
21. Cao, J.; Prisinzano, T.E.; Okunola, O.M.; Kopajtic, T.; Shook, M.; Katz, J.L.; Newman, A.H.
SARs at the monoamine transporters for a novel series of modafinil analogues. ACS Med. Chem.
Lett. 2010, 2, 48–52.
22. He, R.; Kurome, T.; Giberson, K.M.; Johnson, K.M.; Kozikowski, A.P. Further structure-activity
relationship studies of piperidine-based monoamine transporter inhibitors: Effects of piperidine
ring stereochemistry on potency. Identification of norepinephrine transporter selective ligands and
broad-spectrum transporter inhibitors. J. Med. Chem. 2005, 48, 7970–7979.
23. Lawinski, M.; Sledzinski, Z.; Kubasik-Juraniec, J.; Spodnik, J.H.; Wozniak, M.; Boguslawski, W.
Does resveratrol prevent free radical-induced acute pancreatitis? Pancreas 2005, 31, 43–47.
24. Chen, L.; Salafranca, M.N.; Mehta, J.L. Cyclooxigenase inhibition decreases nitric oxide synthase
activity in human platelets. Am. J. Physiol. 1997, 273, H1854–H1859.
25. Perrin, D.D.; Armarego, L.F.; Perrin, D.R. Purification of Laboratory Chemicals; Pergamon Press:
New York, NY, USA, 1980; p. 106.
Sample Availability: Contact the authors.
© 2012 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article
distributed under the terms and conditions of the Creative Commons Attribution license
(http://creativecommons.org/licenses/by/3.0/).