Development of a selective modulator of aryl hydrocarbon (Ah) receptor activity that exhibits anti-inflammatory properties

Article abstract of DOI:10.1021/tx100045h

The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that mediates the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin. However, the role of the AHR in normal physiology is still an area of intense investigation. For example, thi

Full text of DOI:10.1021/tx100045h

Chem. Res. Toxicol. 2010, 23, 955–966
955
Development of a Selective Modulator of Aryl Hydrocarbon (Ah)
Receptor Activity that Exhibits Anti-Inflammatory Properties
Iain A. Murray,† Gowdahalli Krishnegowda,‡ Brett C. DiNatale,† Colin Flaveny,†
Chris Chiaro,† Jyh-Ming Lin,§ Arun K. Sharma,‡ Shantu Amin,‡ and Gary H. Perdew*,†
Department of Veterinary and Biomedical Sciences and Center for Molecular Toxicology and Carcinogenesis,
The PennsylVania State UniVersity, UniVersity Park, PennsylVania 16802, Department of Pharmacology,
Penn State College of Medicine, Hershey, PennsylVania 17033, and Department of Biochemistry and
Molecular Biology, Penn State College of Medicine, Hershey, PennsylVania 17033
ReceiVed February 5, 2010
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that mediates the toxicity
of 2,3,7,8-tetrachlorodibenzo-p-dioxin. However, the role of the AHR in normal physiology is still an
area of intense investigation. For example, this receptor plays an important role in certain immune
responses. We have previously determined that the AHR can mediate repression of acute-phase genes in
the liver. For this observation to be therapeutically useful, selective activation of the AHR would likely
be necessary. Recently, the selective estrogen receptor ligand WAY-169916 has also been shown to be
a selective AHR ligand. WAY-169916 can efficiently repress cytokine-mediated acute-phase gene
expression (e.g., SAA1) yet fail to mediate a dioxin response element-driven increase in transcriptional
activity. The goals of this study were to structurally modify WAY-169916 to block binding to the estrogen
receptor and increase its affinity for the AHR. A number of WAY-169916 derivatives were synthesized
and subjected to characterization as AHR ligands. The substitution of a key hydroxy group for a methoxy
group ablates binding to the estrogen receptor and increases its affinity for the AHR. The compound
1-allyl-7-trifluoromethyl-1H-indazol-3-yl]-4-methoxyphenol (SGA 360), in particular, exhibited essentially
no AHR agonist activity yet was able to repress cytokine-mediated SAA1 gene expression in Huh7 cells.
SGA 360 was tested in a 12-O-tetradecanoylphorbol-13-acetate (TPA)-mediated ear inflammatory edema
model using C57BL6/J and Ahr-/- mice. Our findings indicate that SGA 360 significantly inhibits TPA-
mediated ear swelling and induction of a number of inflammatory genes (e.g., Saa3, Cox2, and Il6) in
C57BL6/J mice. In contrast, SGA 360 had no effect on TPA-mediated ear swelling or inflammatory
gene expression in Ahr-/- mice. Collectively, these results indicate that SGA 360 is a selective Ah receptor
modulator (SAhRM) that exhibits anti-inflammatory properties in vivo.
of an acute phase response is generally believed to be an
adaptive response in the short term that aids in the reaction to
infection and other inflammatory insults. SAA has been sug-
gested as an excellent marker for systemic inflammation, in part
because up to a 1000-fold increase in transcription of these genes
has been observed. However, recent studies of the biological
activity of SAA suggest that it may also be a mediator of
inflammation. SAA binds to FPRL1, RAGE, and TLR2 recep-
tors; activation of these receptors leads to enhanced inflamma-
tory signaling through activation of NFKB and AP1 (2-4).
Prolonged production of SAA can lead to an array of adverse
effects, such as accumulation of fibrils leading to amyloidosis
(5). Therefore, repression of the acute phase response in the
liver would be an important therapeutic target for a diverse array
of chronic inflammatory diseases.
Introduction
An important aspect of systemic inflammation is the induction
of an acute phase response in the liver. Circulating cytokines
such as tumor necrosis factor-R (TNFA1) or interleukin 1ꢀ
(IL1B) are elevated during sepsis or chronic inflammatory
diseases. Inflammatory signaling within hepatocytes results in
the induction of a series of genes that includes C-reactive
protein, LPS binding protein, complement C3, tissue plasmi-
nogen activator, and serum amyloid A (SAA) (1). There are
four members of this latter gene family in rodents, Saa1 through
4, with Saa1 and Saa2 being the primary genes that contribute
to the inducible circulating pool of SAA in serum. The induction
* To whom correspondence should be addressed. CMTC, 309 LSB, The
Pennsylvania State University, University Park, PA. Phone: 814-865-0400.
Fax: 814-863-1696. E-mail: ghp2@psu.edu.
The AHR is a ligand activated basic-helix-loop-helix/Per-
ARNT-Sim transcription factor that is responsible for the toxicity
of TCDD (commonly referred to as dioxin). Upon ligand
binding, the AHR, bound to hsp90, translocates into the nucleus
where ARNT displaces hsp90 and heterodimerizes with the
AHR (6). The ligand-bound AHR/ARNT complex is then able
to bind to a dioxin responsive element (DRE) in the promoter
of a wide range of genes involved in drug metabolism (e.g.,
Cyp1a1) as well as growth and metabolism (e.g., Ereg, Snai2).
The physiological role of the AHR continues to be an active
† The Pennsylvania State University.
‡ Department of Pharmacology, Penn State College of Medicine.
§ Department of Biochemistry and Molecular Biology, Penn State College
of Medicine.
1 Abbreviations: TNFA, tumor necrosis factor-R; IL1B, interleukin 1ꢀ;
SAA, serum amyloid A; NFKB, nuclear factor-κ B; AHR, Ah receptor;
ARNT, AHR nuclear translocator; DRE, dioxin responsive element;
CYP1A1, cytochrome P450 1A1; TH1or TH2, T lymphocyte helper type 1
and 2; SAhRM, selective AHR modulator; ER, estrogen receptor; THF,
tetrahydrofuran; DMSO, dimethyl sulfoxide; TPA, 12-O-tetradecanoylphor-
bol-13-acetate; E2, estradiol; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin;
GR, glucocorticoid receptor; R-NF, R-naphthoflavone.
10.1021/tx100045h  2010 American Chemical Society
Published on Web 04/28/2010

956 Chem. Res. Toxicol., Vol. 23, No. 5, 2010
Murray et al.
area of investigation and was first explored through examination
of the phenotype of Ahr null mice. These mice exhibit a number
of defects, such as immune system dysfunction, poor liver
vasculature development, and reduced fecundity (7). This latter
phenotype appears to be due to multiple defects that result in
lower conception rate, smaller litter size, and low pup survival
rates (8). The lack of AHR expression alters maturation of
follicles apparently due to a lack of estradiol synthesis (9).
Cardiovascular effects, such as a systemic hypertension and
hypoxemia conditions, have been observed in Ahr null mice,
dependent on altitude (10).
Perhaps the area of AHR biology that has received the most
recent attention is the ability of the AHR to influence T cell
differentiation. The AHR can play a role in the balance of TH1
and TH2 cells, and this was established through the use of an
AHR agonist M50367 that mediates a preference for increased
TH1 versus TH2 cells (11, 12). M50367 exposure in mice leads
to a decreased response in an allergic experimental model.
Differentiation of na¨ıve T-cells leads to enhanced AHR expres-
sion and supports the concept that the AHR mediates key steps
in this process. Interleukin 17 (IL17)-producing T helper cells
(Th17) are a proinflammatory subset of T helper cells that play
a critical role in the experimental development of autoimmune
diseases, such as collagen-induced arthritis (13). The AHR plays
an important role in the development of Th17 cells in both in
vitro and in vivo experimental models (14, 15). Furthermore,
the AHR appears to regulate STAT1 activation during T cell
differentiation into Th17 cells (16). How the AHR activation
occurs under physiologic conditions is unknown, and whether
these effects are mediated by endogenous ligands remains to
be determined.
There are numerous reports indicating that prolonged activa-
tion of the AHR via exposure to high levels of an AHR agonist
leads to enhanced inflammatory signaling (17). However, more
recent studies have revealed that the AHR can mediate anti-
inflammatory responses as well, through interference with
NFKB signaling or repression of IL6 induction (18, 19). We
have recently demonstrated that the AHR can attenuate cytokine-
mediated induction of the acute phase response gene expression
in the liver (20). This appears to be a selective response
considering that the AHR fails to influence the induction of Il8
or Nfkbia. However, sustained activation of the AHR by
xenobiotic agonists can lead to toxicity through a predominantly
dioxin responsive element-mediated mechanism (21). Therefore,
we tested the hypothesis that the AHR could be selectively
activated by an appropriate ligand to repress cytokine-mediated
induction of the acute phase response, yet fail to significantly
induce gene expression through binding to its cognate response
element. This goal was accomplished through the identification
of the selective estrogen receptor ligand, WAY- 169916, as a
selective2 AHR modulator3 (SAhRM) (22). However, because
of the dual AHR/estrogen receptor (ER) specificity of this
compound, there is a need to find compounds that exhibit
enhanced selectivity for the AHR. In this article, structure-activity
studies were performed to modify the structure of WAY-169916
in order to enhance its affinity for the AHR and increase its
AHR-mediated efficacy following modification. The following
properties of the AHR were examined: to maintain SAhRM
potential (i.e., mediate Saa1 gene repression) in the absence of
DRE-mediated signaling; to exhibit cross-species SAhRM
activity; and to diminish or ablate ER binding status. One
compound was synthesized, SGA 360, which met all of these
criteria and proved useful in selectively modulating AHR
activity in vivo.
Materials and Methods
Chemistry. Melting points were recorded on a Fischer-Johns
melting point apparatus and are uncorrected. NMR spectra were
recorded using a Bruker Avance 500 MHz spectrometer. Chemical
shifts were recorded in ppm downfield from the internal standard.
The signals are quoted as s (singlet), d (doublet), t (triplet), m
(multiplet), and dt (doublet of triplet). MS analyses were run on a
Hewlett-Packard Model 5988A instrument. Thin-layer chromatog-
raphy (TLC) was developed on aluminum-supported precoated silica
gel plates (EM industries, Gibbstown, NJ). Column chromatography
was conducted on silica gel (60-200 mesh). The indazole deriva-
tives were synthesized by following a previously described method
with minor modifications (23) as detailed below.
Synthesis of 2-Fluoro-N-methoxy-N-methyl-3-(trifluoro-
methyl)benzamide (9). To a solution of 2-fluoro-3-(trifluoro-
methyl)benzoic acid (compound 6, 5.0 g, 24.02 mmol) in anhydrous
tetrahydrofuran (THF) (100 mL) were added 2-chloro-4,6-dimethoxy-
1,3,5-triazine (compound 7, 5.06 g, 28.81 mmol) and N-methyl-
morpholine (7.92 mL, 72.06 mmol). A white precipitate was formed
at room temperature during 1 h of stirring, and then N,O-
dimethylhydroxylamine hydrochloride (2.5 g, 24.02 mmol) was
added. The mixture was stirred at room temperature for an additional
8 h, quenched with water (50 mL), and extracted with ethyl acetate
(3 × 100 mL). The combined organic layers were washed with
saturated solution of sodium carbonate, followed by 1 N hydro-
chloric acid, and brine. The organic layer was dried over anhydrous
sodium sulfate and evaporated in vacuo to yield 9 (5.2 g, 86%) as
1
a viscous oil. H NMR (500 MHz, CDCl3) δ 7.72-7.31 (m, 3H),
3.56 (s, 3H), 3.39 (s, 3H); ESI-MS 252 [M + H]+.
Synthesis of 2,4-Dimethoxyphenyl[(2-fluoro-3-(trifluoro-
methyl)phenyl]methanone (10). 2,4-Dimethoxyphenylmagnesium
bromide (60 mL, 0.5 M in THF, 29.88 mmol) was added to a
solution of compound 9 (2.5 g, 9.96 mmol) in anhydrous THF (50
mL) at 0 °C. The reaction mixture was stirred for 2 h at 0 °C and
quenched with 5% hydrochloric acid in ethanol (20 mL). The
solvents were removed under reduced pressure, extracted with ethyl
acetate, washed with water, dried over anhydrous magnesium
sulfate, and evaporated in Vacuo. The crude product was purified
by silica gel column chromatography, using ethyl acetate/hexanes
(1:9) as eluent, to obtain 10 (2.6 g, 81%) as a white solid; mp 78-80
1
°C. H NMR (500 MHz, CDCl3) δ 7.84-7.71 (m, 3H), 7.34 (t,
1H, J ) 7.5 Hz), 6.61 (dd, 1H, J ) 2.5 and 9.0 Hz), 6.46 (d, 1H,
J ) 2.5 Hz), 3.90 (s, 3H), 3.64 (s, 3H); ESI-MS 329 [M + H]+.
Synthesis of 3,4-Dimethoxyphenyl[(2-fluoro-3-(trifluoro-
methyl)phenyl]methanone (11). Following an identical procedure
and purification as those described above for 10, we used 3,4-
dimethoxyphenylmagnesium bromide to give 11 (2.4 g, 75%) as a
white solid; mp 101-103 °C. 1H NMR (500 MHz, CDCl3) δ
7.79-7.82 (m, 1H), 7.71-7.74 (m, 1H), 7.57 (d, 1H, J ) 2.0 Hz),
7.40 (t, 1H, J ) 7.5 Hz), 7.30 (dt, 1H, J ) 8.5 and 2.0 Hz), 6.91
(d, 1H, J ) 8.5 Hz), 3.98 (s, 3H), 3.97 (s, 3H); ESI-MS 329 [M +
H]+.
Synthesis of 3-(2,4-Dimethoxyphenyl)-7-(trifluoromethyl)-
1H-indazole (12). To a solution of compound 10 (2.0 g, 6.09 mmol)
in anhydrous pyridine (20 mL) was added anhydrous hydrazine
(0.29 g, 9.0 mmol), and the reaction mixture was irradiated in a
microwave apparatus for 1 h at 250 W and 100 °C. The solvent
was evaporated under reduced pressure, extracted with ethyl acetate,
washed with water, dried over anhydrous sodium sulfate, and
concentrated to provide product 12 (1.85 g. 94%) as a white solid;
mp 134-136 °C. 1H NMR (500 MHz, DMSO-d6) δ,13.58 (s, 1H),
7.91 (d, 1H, J ) 8.0 Hz), 7.74 (d, 1H, J ) 7.5 Hz), 7.46 (d, 1H,
2 The term selective is used to describe an AHR (or ER) ligand that
exhibits a subset of altered transcriptional activities. The term is not used
to infer that a given AHR ligand does not interact with other proteins.
3 A SAhRM is defined as an AHR ligand that is not capable of mediating
a dioxin responsive element driven transcription yet is able to mediate other
activities such as repression of cytokine mediated acute-phase gene
expression.

Ah Receptor SelectiVe Ligand Inhibits Inflammation
Chem. Res. Toxicol., Vol. 23, No. 5, 2010 957
1
J ) 8.0 Hz), 7.27 (t, 1H, J ) 7.5 Hz), 6.77 (d, 1H, J ) 2.0 Hz),
6.69-6.66 (m, 1H), 3.86 (s, 3H), 3.80 (s, 3H); ESI-MS 322.9 [M
+ H]+.
52-54 °C. H NMR (500 MHz, acetone-d6) δ 8.59 (d, 1H, J )
8.5 Hz), 8.03 (d, 1H, J ) 8.5 Hz), 7.99 (d, 1H, J ) 7.5 Hz), 7.47
(t, 1H, J ) 8.0 Hz), 6.68 (dd, 1H, J ) 8.5 and 2.5 Hz), 6.64 (d,
1H, J ) 2.5 Hz), 6.21-6.12 (m, 1H), 5.27 (d, 1H, J ) 5.5 Hz),
5.23 (dd, 1H, J ) 10.5 and 1.0 Hz), 5.07 (dd, 1H, J ) 17.0 and
1.0 Hz), 3.87 (s, 3H)]; ESI-MS 349 [M + H]+.
Synthesis of 3-(3,4-Dimethoxyphenyl)-7-(trifluoromethyl)-
1H-indazole (13). Microwave irradiation of compound 11 under
conditions identical to those described above for 12 yielded product
13 (1.83 g, 93%) as a white solid; mp 175-177 °C. 1H NMR (500
MHz, DMSO-d6) δ 8.36 (d, 1H, J ) 8.0 Hz), 7.80 (d, 1H, J ) 7.0
Hz), 7.53 (dd, 1H, J ) 8.0 and 2.0 Hz), 7.49 (d, 1H, J ) 2.0 Hz),
7.37 (t, 1H, J ) 7.5 Hz), 7.13 (d, 1H, J ) 8.5 Hz), 3.88 (s, 3H),
3.84 (s, 3H); ESI-MS 322.9 [M + H]+.
Biology. ERr Competition Assay. The ER-R Competitor Assay,
Green (Invitrogen) was performed following the manufacturer’s
instructions. Briefly, compounds and DMSO vehicle were diluted
to twice their final assay concentrations in PanVera supplied ES2
screening buffer and added to 60 × 150 mm borosilicate glass cell
culture tubes. A master mix was made of screening buffer with
human recombinant ERR added, for a final concentration of 6 pmol/
µL, and ES2 fluoromone added, for a final concentration of 400
nM. The master mix was added to diluted test compounds in a 1:1
volume, mixed gently, and incubated in the dark at room temper-
ature for 2 h. Samples were then measured for fluorescence
polarization using the PanVera Beacon 2000 polarization instrument
with 485 nm excitation and 530 nm emission filters at 25 °C. Results
shown are the mean of samples performed in triplicate.
Synthesis of 1-Allyl-3-(2,4-dimethoxyphenyl)-7-(trifluoro-
methyl)-1H-indazole (2) and 2-Allyl-3-(2,4-dimethoxyphenyl)-
7-(trifluoromethyl)-2H-indazole (3). Sodium hydride (60% in oil,
0.21 g, 5.12 mmol) was added slowly to a solution of compound
12 (1.5 g, 4.66 mmol) in anhydrous N,N-dimethylformamide (15
mL) at room temperature. The reaction mixture was stirred for 30
min at ambient temperature to 60 °C. Allyl bromide (1.36 g, 11.26
mmol) was then added, and the reaction mixture was stirred for an
additional 4 h at 60 °C. The mixture was poured into ice cold water,
the solid product was separated by filtration, washed with water,
and the isomers were purified by silica gel column chromatography
eluting with 1% ethyl acetate in hexanes to provide products 2 and
3 as white solids. Product 2 [0.68 g (40%); mp 96-98 °C. 1H NMR
(500 MHz, CDCl3) δ 7.88 (d, 1H, J ) 8.0 Hz), 7.73 (d, 1H, J )
7.0 Hz), 7.50-7.48 (m, 1H), 7.16 (t, 1H, J ) 7.5 Hz), 6.63-6.61
(m, 2H), 6.13-6.08 (m, 1H), 5.19 (d, 2H, J ) 11.5 Hz), 5.16 (dd,
1H, J ) 6.5 and 8.0 Hz), 5.06 (dd, 1H, J ) 1.5 and 17 Hz), 3.87
(s, 3H), 3.80 (s, 3H)]; ESI-MS 363 [M + H]+. Product 3 [0.51 g
(30%); mp 73-75 °C. 1H NMR (500 MHz, CDCl3) δ 7.60 (d, 2H,
J ) 7.5 Hz), 7.22 (d, 1H, J ) 8 Hz), 7.05 (t, 1H, J ) 7.5 Hz),
6.65-6.61 (m, 2H), 6.05-5.99 (m, 1H), 5.11 (dd, 1H, J ) 1.5 and
10 Hz), 5.02-4.92 (m, 3H), 3.90 (s, 3H), 3.75 (s, 3H)]; ESI-MS
363 [M + H]+.
Synthesis of 1-Allyl-3-(3,4-dimethoxyphenyl)-7-(trifluoro-
methyl)-1H-indazole (4) and 2-Allyl-3-(3,4-dimethoxyphenyl)-
7-(trifluoromethyl)-2H-indazole (14). Subjecting compound 13 to
reaction conditions identical to those described above for compound
12 in the synthesis of 2 and 3, yielded products 4 and 14 as white
solids. Product 4 [0.76 g (45%), viscous oil]. 1H NMR (500 MHz,
CDCl3) δ 8.21 (d, 1H, J ) 7.5 Hz), 7.80 (d, 1H, J ) 7.5 Hz),
7.47-7.44 (m, 2H), 7.27 (t, 1H, J ) 7.5 Hz), 7.04 (d, 1H, J ) 8.0
Hz), 6.16-6.09 (m, 1H), 5.25-5.23 (m, 2H), 5.21 (dd, 1H, J )
10.5 and 1.5 Hz), 5.07 (dd, 1H, J ) 17.0 and 1.5 Hz), 4.02 (s,
3H), 3.98 (s, 3H)]; ESI-MS 363 [M + H]+. Product 14 [0.56 g
(33%); mp 86-88 °C. 1H NMR (500 MHz, CDCl3) δ 7.77 (d, 1H,
J ) 8.5 Hz), 7.67 (d, 1H, J ) 7.0 Hz), 7.15-7.10 (m, 2H), 7.06
(d, 1H, J ) 8.5 Hz), 7.03 (d, 1H, J ) 2.0 Hz), 6.23-6.14 (m, 1H),
5.28 (dd, 1H, J ) 10.0 and 1.0 Hz), 5.13-5.11 (m, 2H), 5.06 (dd,
1H, J ) 17.5 and 1.0 Hz), 4.01 (s, 3H), 3.93 (s, 3H)]; ESI-MS 363
[M + H]+.
Cell Culture. All cell lines utilized except for MCF-7 cells were
maintained in modified Eagle’s R-minimum essential medium
(Sigma), supplemented with 1000 units/mL penicillin, 100 µg/mL
streptomycin (Sigma), and 8% fetal bovine serum (Hyclone) under
standard conditions. Huh 7 cells were obtained from Curt Omiecin-
ski (Penn State University). MCF-7 cells were obtained from ATCC.
Cell-Based Luciferase Reporter Assays. The DRE-driven
luciferase reporter cell lines, human HepG2 40/6 and mouse
H1L1.1c2, were used to assess AHR transcriptional activity (24, 25).
The latter cell line was kindly provided by Michael Denison
(University of California, Davis). Luciferase activity was measured
using the Promega Luciferase Assay system (Madison, WI).
Quantitation of mRNA Levels. Total RNA was isolated from
cells using TRI reagent (Sigma) following the manufacturer’s standard
protocol and converted to cDNA using High Capacity cDNA Archive
Kit from Applied Biosystems. The levels of CYP1A1 and SAA1 were
determined by real-time qPCR using iQ SYBR Green supermix reagent
(BioRad) and a MyIQ single-color PCR detection system (Bio-Rad).
Primer sequences utilized have been previously described or are
listed below (19). PCR primers (Integrated DNA Technologies,
Coralville, IA) used in this study are as follows human L13a
(forward) CCTGGAGGAGAAGAGGAAAGAGA and human
L13a (reverse) GAGGACCTCTGTGTATTTGTCAA; human SAA1
(forward) AGGCTCAGACAAATACTTCCATGC and human SAA1
(reverse) TCTCTGGCATCGCTGATCACTTCT; human CYP1A1
(forward) TCTTCCTTCGTCCCCTTCAC and human CYP1A1
(reverse) TGGTTGATCTGCCACTGGTT; mouse Il1b (forward)
ATACTGCCTGCCTGAAGCTCTTGT and mouse Il1b (reverse)
AAGGGCTGCTTCCAAACCTTTGAC; mouse Saa3 (forward)
ATGCCAGAGAGGCTGTCCAGAAGT and mouse Saa3 (reverse)
TATCTTTTAGGCAGGCCAGCAGGT; mouse L13a (forward)
TTCGGCTGAAGCCTACCAGAAAGT and mouse L13a (re-
verse) GCATCTTGGCCTTTTTCCGTT; mouse Cox2 (forward)
TTGCTGTACAAGCAGTGGCAAAGG and mouse Cox2 (reverse)
TGCAGCCATTTCCTTCTCTCCTGT; mouse Il10 (forward)
TGAATTCCCTGGGTGAGAAGCTGA and mouse Il10 (reverse)
TGGCCTTGTAGACACCTTCCTCTT. In all cases, melting point
analysis revealed the amplification of a single product. Data
acquisition and analysis were achieved using MyIQ software (Bio-
Rad, Hercules, CA). Quantification was achieved through com-
parison against target-specific standard curves, and data represent
the mean fluorescence normalized to that of the control gene
ribosomal protein L13a to yield a relative mRNA level.
Synthesis of 4-[1-Allyl-7-trifluoromethyl-1H-indazol-3-yl]ben-
zene-1,3-diol (1). To a solution of compound 8 (0.5 g, 0.38 mmol)
in 5 mL of methylene chloride/cyclohexane (6:1) was added boron
tribromide (1.0 M in methylene chloride, 11.02 mL, 11.04 mmol)
at -30 °C. The reaction was allowed to warm to room temperature
over 5 h. The reaction was quenched with 2 mL of methanol and
diluted with methylene chloride. The organic phases were washed
with saturated sodium bicarbonate solution, dried over anhydrous
sodium sulfate, and concentrated in Vacuo. The residue was purified
by silica gel column chromatography eluting with 1% methanol in
methylene chloride to obtain product 10 (210 mg, 45%) as a white
1
solid; mp 113-115 °C). H NMR (500 MHz, acetone-d6) δ 8.55
(d, 1H, J ) 8.5 Hz), 7.96 (d, 1H, J ) 7.5 Hz), 7.93 (d, 1H, J ) 8.5
Hz),, 7.44 (t, 1H, J ) 8 Hz), 6.57 (dd, 1H, J ) 2.5 and 8.5 Hz),
6.54(d, 1H, J ) 2.5 Hz), 6.16-6.09 (m, 1H), 5.23-5.18 (m, 3H),
5.05 (dd, 1H, J ) 1.5 and 17 Hz); ESI-MS 335 [M + H]+.
Synthesis of 2-[1-Allyl-7-trifluoromethyl-1H-indazol-3-yl]-4-
methoxyphenol (5). Following an identical procedure and purifica-
tion as those described above for 1, except for using 1 equiv (0.38
mmol) boron tribromide gave 5 (0.22 g, 47%) as a white solid; mp
AHR Competition Binding Assay. The AHR photoaffinity
ligand 2-azido-3-[125I]-7,8-dibenzo-p-dioxin was synthesized as
described (26). Liver cytosolic extract from B6.Cg-Ahrtm1BraTg (Alb-
cre, Ttr-AHR)1Ghp (expressing the human AHR in hepatocytes)
was utilized in a photoaffinity ligand competition binding assay as
previously described (27, 28).

958 Chem. Res. Toxicol., Vol. 23, No. 5, 2010
Scheme 1. Synthesis of Indazole Derivativesa
Murray et al.
a Reagents and conditions: (i) N-methylmorpholine, THF, RT, 1 h; (ii) N,O-dimethylhydroxylamine hydrochloride, RT, 8 h; (iii) 2,4-dimethoxyphenyl-
magnesium bromide, THF, 0 °C, 2 h; (iv) 3,4-dimethoxyphenylmagnesium bromide, THF, 0 °C, 2 h; (v) anhydrous H2NNH2, pyridine, microwave, 250W,
100 °C, 1 h; (vi) NaH, DMF, RT to 60 °C, 30 min, allyl bromide, 60 °C, 4 h; (vii) 1 equiv BBr3, CH2Cl2/cyclohexane, -60 °C to RT, 5 h; (viii) 1 equiv
BBr3, CH2Cl2/cyclohexane, -60 °C to RT, 5 h.
Electrophoretic Mobility Shift Assay (EMSA). DRE-specific
EMSAs were performed using in vitro translated human AHR and
ARNT as previously described (28).
SAA Repression Assay. Huh7 cells were treated with SGA
compounds for 1 h prior to the addition of 2 ng/mL of IL1B for
6 h. RNA was isolated and SAA1 mRNA levels determined as
previously described (20).
it with 2,4-dimethoxyphenylmagnesium bromide. Microwave
irradiation of 10 in the presence of anhydrous hydrazine gave
an excellent yield (94%) of compound 12, which, on treatment
with allyl bromide in the presence of sodium hydride, resulted
in a mixture of desired indazole derivatives 2 and 3. A similar
reaction sequence led to the formation of a mixture of
compounds 4 and 14. The two isomers in each case were
separated by silica gel column chromatography. Compound 1
(WAY-169916) was obtained by treating compound 2 with
excess of boron tribromide, while selective demethylation of 2
using 1 equiv of boron tribromide led to an exclusive formation
of monohydroxy derivative 5.
In Vivo Ear Edema Model. Ear inflammation was induced in
anesthetized 6 week-old male C57BL6/J mice (wild-type or Ahr-/-
)
through topical application of 1.5 µg of 12-O-tetradecanoylphorbol-
13-acetate (TPA) in 50 µL of vehicle (HPLC-grade acetone)
(Sigma) to the right ear. Anti-inflammatory properties of SGA 360
were examined through topical application of 30 µg of SGA 360
in 50 µL of vehicle immediately followed by the administration of
TPA. In all cases, the left ear received the vehicle alone. Six hours
after the induction of inflammation, animals were euthanized by
carbon dioxide asphyxiation, and the degree of inflammation was
assessed. Edema thickness was measured using a micrometer, and
edema weight was determined following the isolation of a 7 mm
ear punch. Total RNA was isolated from ear punches, and RNA
concentration was determined via spectrophotometry at λ 260 and
280 nm. Total RNA was reverse transcribed to cDNA using High
Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA).
Statistical Analysis. One-way ANOVA was followed by Tukey’s
multiple comparison test and was used to compare treatments using
GraphPad Prism v5.0.
The structures of 1-allyl and 2-allyl substituted isomers 4 and
14 are similar and cannot be determined by proton NMR spectra
analysis alone (Figures S1 and S2, Supporting Information).
Therefore, each proton was assigned on the basis of the coupling
pattern and 1H-1H COSY spectra. All of the carbon atoms were
assigned with the aid of HSQC experiments and the coupling
between the fluorine of the trifluoromethyl group and C7, and
C6 with its distinguished quartet pattern and coupling constant.
The tertiary carbons assignment was determined with the help
of HMBC experiments. In order to determine the position of
the allyl substitution, we measured the possible NOE effects
between the allyl protons and dimethoxyphenyl group, but the
results were not conclusive. The position of the allyl substitution
was verified by HMBC experiments. The assignment of these
two isomers is listed in Tables 1 and 2. We observed that the
H10 proton at the 2-allyl group interacted with C11, C12, and C3
carbons (Figure S3, Supporting Information). However, the H10
proton at the 1-allyl substitution did not couple with the C3
carbon but interacted with C11, C12, and C8 carbons (Figure S4,
Results
Synthesis of Indazole Derivatives. The synthesis of indazole
derivatives 1-5 was carried out as outlined in Scheme 1. Amide
9 was synthesized from 2-fluoro-3-(trifluoromethyl)benzoic acid
following literature methods (29, 30). Conversion of compound
9 to benzophenone derivative 10 was accomplished by treating

Ah Receptor SelectiVe Ligand Inhibits Inflammation
Chem. Res. Toxicol., Vol. 23, No. 5, 2010 959
Table 1. 1H and 13C Assignments of 1-Allyl-3-(3,4-dimethoxyphenyl)-7-(trifluoromethyl)-1H-indazole
proton assignment
chemical shift δ (ppm) multi
N/A
carbon-13 assignment
protona
coupling constant
C-13b
C3
C4
C5
C6
C7
C8
C9
chemical shift δ (ppm)
coupling constant
H3
H4
H5
H6
N/A
8.19
7.28
7.79
N/A
124.8
d, 1H
t, 1H
d, 1H
J ) 7.40 Hz
J ) 7.40 Hz
J ) 7.40 Hz
125.35
119.69
125.42
112.75
136.32
145.62
123.95
q, J ) 6.16 Hz
q, J ) 32.75 Hz
CF3
q, J ) 272.09 Hz
Allyl Group
H10
H11
H12
H12′
5.25
6.17-6.09
5.21
br d, 2H
m, 1H
dd,1H
J ) 5.12 Hz
C10
C11
C12
53.45
133.48
116.9
J ) 10.5 Hz; J ) 1.3 Hz;
J ) 17.3 Hz; J ) 1.3 Hz
5.07
dd, 1H
Phenyl Group
H1′
H2′
H3′
H4′
H5′
H6′
3′-OMe
4′-OMe
N/A
7.44
N/A
N/A
7.04
7.45
3.99
4.01
N/A
d, 1H
N/A
N/A
J ) 1.95 Hz
N/A
N/A
J ) 8.05 Hz
J ) 8.05 Hz; J ) 1.95 Hz
C1′
C2′
C3′
C4′
C5′
C6′
3′-OMe
4′-OMe
124.61
111.11
149.48
149.39
111.34
120.61
56.02
N/A
d, 1H
dd, 1H
s, 3H
s, 3H
56.06
b
a Proton NMR was measured at 500 MHz with CDCl3 as the solvent. 13C NMR was measured at 125 MHz with CDCl3 as the solvent.
Table 2. 1H and 13C Assignments of 2-Allyl-3-(3,4-dimethoxyphenyl)-7-(trifluoromethyl)-1H-indazole
proton assignment
chemical shift δ (ppm) multi.
N/A
carbon-13 assignment
protona
coupling constant
C-13b
C3
chemical shift δ (ppm)
coupling constant
H3
H4
H5
H6
N/A
7.78
7.14
7.66
N/A
137.03
125.05
120.09
124.63
118.57
143.5
d, 1H
br t, 1H
dt, 1H
J ) 8.33 Hz
J ) 7.76 Hz
J ) 7.04 Hz; J ) 0.90 Hz
C4
C5
C6
C7
C8
C9
CF3
q, J ) 5.19 Hz
q, J ) 32.7 Hz
122.5
124.06
q, J ) 273.5 Hz
Allyl Group
J ) 5.03 Hz; J ) 1.53 Hz
H10
H11
H12
H12′
5.12
6.23-6.15
5.28
dt, 2H
m, 1H
dq, 1H
dq, 1H
C10
C11
C12
53.49
133.43
117.9
J ) 10.29 Hz; J ) 1.02 Hz
J ) 17.29 Hz; J ) 1.31 Hz
5.06
Phenyl Group
H1′
H2′
H3′
H4′
H5′
H6′
3′-OMe
4′-OMe
N/A
7.03
N/A
N/A
7.07
7.11
3.93
4.00
N/A
d, 1H
N/A
N/A
J ) 1.9 Hz
N/A
C1′
C2′
C3′
C4′
C5′
C6′
3′-OMe
4′-OMe
121.21
112.57
149.94
149.28
111.48
122.56
56.04
N/A
N/A
dd, 1H
d, 1H
s, 3H
s, 3H
J ) 8.35 Hz; J ) 1.9 Hz
J ) 8.35 Hz; J ) 1.9 Hz
56.09
b
a Proton NMR was measured at 500 MHz with CDCl3 as the solvent. 13C NMR was measured at 125 MHz with CDCl3 as the solvent.
1
Supporting Information). These long-range H-13C couplings
subjected to an ERR competition assay that measures the ability
of a compound to displace a fluorescent ER ligand. Fluoromone
bound to the ER tumbles slowly in solution, giving a higher
polarization reading (mP). Compounds that compete with the
fluoromone away from the ER result in free fluoromone that
tumbles faster and provide a lower mP value. Nonspecific
binding effects can be seen by the shift of mP from ERR and
fluoromone alone to the addition of 1% DMSO in the reaction
(roughly 10% drop in mP). The addition of estradiol (E2) at
higher concentrations displaces the fluoromone and represents
maximum competition (Figure 2A). SGA 293, 315, and 360
show minimal ERR competition at 10 µM doses, less than that
of 1 nM E2. Only WAY-169916 demonstrated a highly
significant level of binding to the ERR. The marginal level of
binding observed with SGA 360 was explored further through
provide direct evidence to support our assignment.
Structural Modification of WAY-169916 Blocks Estrogen
Receptor Binding and Fails to Influence ER-Mediated
Transcriptional Activity. In a previous study, we have
demonstrated that WAY-169916 (1) is a selective activator of
the AHR (22). However, WAY-169916 is also a potent selective
ligand for the estrogen receptor (31). We hypothesized that
alteration of a critical hydroxyl group in the para position of
the phenyl ring to a methoxy group on the benzene ring would
result in greatly reduced affinity for the ER and enhanced affinity
for the AHR. To achieve this goal and to perform a structure-
activity study that would focus on making an effective selective
AHR ligand, four derivatives of WAY-169916 were synthesized
(Figure 1). WAY-169916, SGA 293, 315, and 360 were

960 Chem. Res. Toxicol., Vol. 23, No. 5, 2010
Murray et al.
Figure 3. Assessment of AHR agonist or antagonist transcriptional
activity in human cells mediated by the SGA compounds. (A) HepG2
40/6 stable reporter cell line was treated with 2 nM TCDD or 10 µM
of each SGA compound for 4 h, and the cells were lysed and DRE-
driven luciferase activity determined. (B) HepG2 40/6 cells were treated
as indicated for 4 h, RNA was isolated, and CYP1A1 and rL13a mRNA
levels were determined using real-time RT-PCR. (C) Co-treatment of
HepG2 40/6 cells with SGA compounds and 2 nM TCDD for 4 h
followed by measurement of luciferase activity. Data represent the mean
( SEM. Statistically significant changes that are marked with an asterisk
are relative to the control (n ) 3/treatment group; * P < 0.05).
Figure 1. Structures of indazole derivatives; compounds 1 (WAY-
169916); 2 (SGA 293); 3 (SGA 294); 4 (SGA 360); and 5 (SGA 315).
the addition of SGA 360 to the assay in the absence of ER
resulted in a modest level of inhibition in the assay (Figure S5,
Supporting Information). Whether SGA 360 can bind to ERꢀ
was also tested; while both WAY-169916 and E2 exhibited a
marked level of binding, SGA 360 failed to bind to ERꢀ (Figure
2C). This would indicate that SGA 360 is not a ligand for the
estrogen receptor.
Since SGA 360 is a derivative of a selective ER ligand, we
wanted to test whether SGA 360 could act as an ER antagonist
and block E2 mediated induction of the progesterone receptor
B gene, an ER target gene. MCF-7 cells were treated with E2
in the presence or absence of SGA 360 for 4 h and the level of
progesterone receptor B mRNA assessed. The results indicate
that SGA 360 has no statistically significant effect of the
induction of progesterone receptor B gene expression (Figure
S6, Supporting Information).
SGA Compounds Fail to Stimulate AHR-Dependent
DRE-Mediated Transcription Activity and Exhibit Antago-
nist4 Activity. The ability of the SGA compounds to induce
AHR-mediated agonist activity was tested in the HepG2 40/6
cell line, which contains a stably integrated DRE-driven
luciferase vector. None of the SGA compounds tested displayed
a significant level of reporter activity (Figure 3A). The ability
of SGA compounds to induce CYP1A1 transcription in Hep G2
40/6 cells was also assessed through quantitative PCR (Figure
3B). Interestingly, SGA 293, WAY-169916, and SGA 360
actually repressed constitutive CYP1A1 expression. In contrast,
SGA 315 induced a significant increase in CYP1A1 mRNA
levels, although considerably lower than 10 nM TCDD. Next,
Figure 2. Structural modification of WAY-169916 blocks binding to
the estrogen receptor. (A) Estrogen receptor R fluorescence polarization
assays were performed on each SGA compound. (B) A dose-response
estrogen receptor R fluorescence polarization assay experiment was
performed on SGA 360. (C) Estrogen receptor ꢀ fluorescence polariza-
tion assays were performed.
a dose-response experiment (Figure 2B). SGA 360 failed to
exhibit a dose dependent decrease in polarization, with 10 nM
and 10 µM yielding the same level of inhibition. Furthermore,
4 An AHR antagonist is an AHR ligand that is not capable of inducing
AHR mediated activities.

Ah Receptor SelectiVe Ligand Inhibits Inflammation
Chem. Res. Toxicol., Vol. 23, No. 5, 2010 961
Figure 4. Assessment of AHR-driven transcriptional activity in a mouse
reporter cell line mediated by the SGA compounds. H1L1.1c2 cells were
treated with 1 nM TCDD or 10 µM of each SGA compound for 4 h, and
cells were lysed and DRE-driven luciferase activity determined.
Figure 5. SGA 315 is capable of activating AHR/ARNT DNA binding
in an EMSA. Each SGA compound was tested for its ability to induce
AHR/ARNT binding to a DRE containing oligonucleotide. The AHR
agonist ꢀ-naphthoflavone (ꢀ-NF) was utilized as a positive control.
Figure 6. SGA compounds vary in their ability to compete with the
photoaffinity ligand in a competition AHR binding assay. Increasing
amounts of the compounds labeled in each graph were added to mouse
liver cytosol expressing the human AHR in the presence of the
photoaffinity ligand (420 pM). After exposure to UV light, samples
were subjected to tricine SDS-PAGE and transferred to the membrane,
and radioactive bands were excised and counted in a γ counter.
the ability of these compounds to antagonize AHR agonist
mediated transcriptional activity was assessed using the HepG2
40/6 reporter cell line. In a dose dependent manner, all SGA
compounds were capable of attenuating TCDD-mediated induc-
tion of luciferase activity (Figure 3C), with SGA 315 exhibiting
the highest level of competition. In the literature, certain AHR
ligands have exhibited species selectivity in their ability to
behave as AHR agonists (32). If studies are to be performed
using these compounds in vivo, their ability to regulate AHR
activity needs to be explored in rodent cell lines. Therefore,
we tested the ability of the SGA compounds to exhibit agonist
activity in Hepa 1.1 cells (Figure 4). SGA 315 was capable of
inducing significant agonist activity as observed in Hep G2 cells.
Several of the SGA compounds appear to exhibit antagonistic
activity, blocking the ability of an agonist to mediate transac-
tivation of Cyp1a1. Such antagonism could occur through three
distinct mechanisms, the first being the mediation of AHR/
ARNT heterodimer formation and subsequent binding to a DRE,
without any increase in gene transcription. The second pos-
sibility is that they are not capable of inducing heterodimer
formation. The third mechanism is mediating heterodimer
formation that fails to bind to a DRE. To examine this issue
further, an EMSA was performed with the SGA compounds,
and only SGA 315 was capable to significantly induce AHR
binding to a DRE (Figure 5). This would indicate that SGA
293, 294, and 360 are not able to facilitate AHR/ARNT
dimerization capable of binding to a DRE.
assay was used. This assay utilizes the photoaffinity ligand,
2-azido-3-[125I]iodo-7,8-dibenzo-p-dioxin, in the presence or
absence of a competitor ligand. Each SGA compound tested
effectively competed with the photoaffinity ligand (Figure 6).
Both SGA 315 and SGA 360 exhibited a much greater ability
to compete for AHR binding sites than WAY-169916, suggest-
ing a higher affinity for the AHR relative to the parent
compound.
SGA Compounds Repress Cytokine-Mediated SAA1
Induction in an AHR-Dependent Manner. We have recently
demonstrated that WAY-169916 is capable of repressing SAA1
induction in Huh7 cells in an AHR-dependent manner (22).
Huh7 cells were treated with SGA compounds for 1 h prior to
exposure to IL1B for 3 h. Each SGA compound at a 10 µM
concentration was tested in this assay, and all were found to
repress IL1B-mediated induction of SAA1 (Figure 7). SGA 315,
which exhibits some agonist activity, yielded the greatest level
of repression.
SAhRM SGA360 Exhibits Anti-Inflammatory Activity
in Vivo. The cell culture-based data assessing the anti-
inflammatory properties of the putative SAhRM SGA360 clearly
suggest the capacity of SGA360 to suppress inflammatory SAA1
signaling in an AHR-dependent manner through a mechanism
that does not require AHR binding to its cognate response
SGA Compounds Are Direct Ligands for the AHR. In
order to demonstrate that SGA compounds directly interact with
the ligand-binding pocket of the AHR, a competition binding

962 Chem. Res. Toxicol., Vol. 23, No. 5, 2010
Murray et al.
element; consequently, SGA360 fulfills the criteria of a SAhRM
under cell culture conditions. While cell culture data is informa-
tive, it is descriptive of the effect in an isolated and homoge-
neous cell population and may not accurately convey an in vivo
physiological response. Therefore, we further investigated the
anti-inflammatory activity of SGA360 in an in vivo murine
model of inflammation. The phorbol ester (TPA)-induced ear
edema model is a well established model utilized to examine
the anti-inflammatory efficacy of test substances and was used
here to determine the capacity of SGA360 to suppress inflam-
matory responses. Six week old male C57/B6J mice (wild-type
or Ahr -/-) were exposed to 1.5 µg of TPA or 30 µg of SGA360
in combination with TPA through topical application to the right
ear, while the left ear received the vehicle (acetone) alone.
Following 6 h of exposure, the degree of TPA-induced inflam-
mation and the effect of SGA360 were assessed by edema
quantification and quantitative PCR (Figures 8 and 9). Physical
measurement of ear thickness and the wet weight of 7 mm ear
punches (Figure 8A) revealed that 6 h of topical exposure to
1.5 µg of TPA is sufficient to evoke a marked inflammatory
response and subsequent edema. Exposure to SGA360 im-
Figure 7. All of the SGA compounds are able to inhibit IL1B-
mediated SAA1 gene expression. Huh7 cells were pretreated with
each SGA compound for 1 h prior to the addition of 2 ng/mL IL1B.
After 3 h, RNA was isolated and the level of SAA1 and rL13a mRNA
determined. Data represent the mean ( SEM. Statistically significant
changes that are marked with an asterisk are relative to IL1B
treatment alone (n ) 3/treatment group; * P < 0.05; ** P < 0.01;
*** P < 0.001).
Figure 8. SGA360 exhibits anti-inflammatory properties in vivo. Ear inflammation was induced in anesthetized 6-week-old male C57/B6J mice
(wild-type or Ahr-/-) through topical application of 1.5 µg of TPA in 50 µL of vehicle (acetone) to the right ear. Anti-inflammatory properties of
SGA360 were examined through topical application of 30 µg of SGA360 in 50 µL of vehicle immediately followed by the administration of TPA.
In all cases, the left ear received vehicle alone. The degree of inflammation was assessed after 6 h by measuring ear edema thickness using a
micrometer and ear edema wet weight following the removal of a 7 mm diameter ear punch. Data represent (A) mean edema thickness (mm) and
mean edema weight (mg) ( SEM. (B) Mean percentage change in edema thickness and weight relative to vehicle-treated ( SEM (n ) 3/treatment
group; * P < 0.05; ** P < 0.01; *** P < 0.001).

Ah Receptor SelectiVe Ligand Inhibits Inflammation
Chem. Res. Toxicol., Vol. 23, No. 5, 2010 963
Figure 9. SGA 360 suppressed inflammatory gene expression in vivo. Ear inflammation was induced in anesthetized 6-week-old male C57/
B6J mice (wild-type or Ahr-/-) through topical application of 1.5 µg of TPA in 50 µL of vehicle (acetone) to the right ear. Anti-inflammatory
properties of SGA 360 were examined through the topical application of 30 µg of SGA 360 in 50 µL of vehicle prior to the administration
of TPA. In all cases, the left ear received the vehicle alone. Changes in inflammatory gene expression were assessed through quantitative
PCR using primers targeted against Cox2, Il6, Il1b, Saa3, and Il10. Data represent the mean mRNA levels normalized to constitutive ribosomal
protein L13 mRNA expression ( SEM (n ) 3/treatment group; * P < 0.05; ** P < 0.01; *** P < 0.001).

964 Chem. Res. Toxicol., Vol. 23, No. 5, 2010
Murray et al.
mediately prior to the administration of TPA significantly
diminished both of these inflammatory indicators in wild-type
mice by ∼50% (Figure 8B). Exposure to SGA360 alone was
indistinguishable from the vehicle-treated mice regarding ear
thickness and weight (data not shown). Contrary to the anti-
inflammatory effect of SGA360 observed in wild-type animals,
exposure of Ahr-/- animals to SGA360 and TPA revealed no
significant decrease in either edema thickness or wet weight,
thus indicating a requirement for AHR expression to mediate
the inhibitory effect of SGA360 on TPA-induced edema.
The observed in vivo diminishment of physical edema
parameters by SGA360 prompted us to examine the effect of
SGA360 upon pro-inflammatory gene expression. Using RNA
isolated from ear punches taken from animals exposed to the
vehicle, TPA, and SGA360/TPA, the mRNA expression levels
of cyclooxygenase-2 (Cox2), interleukin 6 (Il6), interleukin 1ꢀ
(Il1b), serum amyloid-associated-3 (Saa3), and interleukin 10
(Il10) were examined by quantitative PCR (Figure 9). Exposure
of C57BL6/J mice to TPA for 6 h stimulated the expression of
all gene targets examined relative to the vehicle-treated controls,
consistent with the appearance of edema. Application of
SGA360 immediately prior to TPA resulted in a significant
suppression of inflammatory gene expression. Cox2 mRNA was
reduced to near basal levels, while Il6, IL1b, Saa3, and Il10
were repressed by 70, 70, 90, and 75%, respectively, relative
to that of TPA treatment alone. In contrast, Ahr-/- mice under
the same treatment regime failed to demonstrate any significant
repression of the same inflammatory gene targets relative to
that of the TPA-treated animals alone (Figure 9). Interestingly,
with the exception of Saa3, the basal and TPA-induced levels
of the inflammatory gene targets were lower in Ahr-/- mice
than in their wild-type counterparts and thus consistent with
the slightly diminished onset of edema observed with Ahr-/-
animals. Such data demonstrates that the SAhRM SGA360 has
in vivo anti-inflammatory activity and emphasizes a requirement
of AHR to facilitate such potential.
nuclear receptors. In contrast, the transactivation and ligand
binding domains appear to be distinct regions in the AHR.
Whether the binding of a ligand to the AHR can influence
coactivator recruitment or AHR/ARNT DNA-binding is less
certain. In a recent study, we have shown that WAY-166916 is
both a selective estrogen and Ah receptor ligand, with higher
affinity for the estrogen receptor (22). A series of studies with
WAY-169916 have revealed that it exhibits minimal AHR
agonist activity yet is efficient at repressing acute phase gene
expression. WAY-169916 can be classified as a SAhRM, yet
its ability to act as a selective ligand for the ER limits its
usefulness in terms of studying AHR function. The goal of this
study was to develop a derivative of WAY-169916 that fails to
bind to the ER and exhibits greater affinity for the AHR. The
cocrystal structure of WAY-169916 occupying the estrogen
receptor ligand binding pocket reveals that the phenol of WAY-
169916 interacts with Glu-353 and Arg-394, and this interaction
is believed to be a key component of its high affinity for the
estrogen receptor (23). This notion, coupled with the concept
that polar groups usually decrease the affinity of ligands for
the AHR, lead to examining the effects of substituting methoxy
groups for hydroxyl groups in WAY-169916. The replacement
of one or two hydroxyl groups with methoxy groups leads to
almost total loss of estrogen receptor binding for SGA 315, 293,
and 360 (Figure 2). In order to be considered a SAhRM, the
SGA compound needed to exhibit a lack of agonist activity in
both mouse and human reporter cell lines. Both SGA 293 and
SGA 360 would meet this criterion, in contrast SGA 315 and
294 exhibited a statistically significant increase in AHR-
mediated reporter activity in cells. Furthermore, SGA 293 and
SGA 360 exhibited potential similar to that of repressed
cytokine-mediated induction of SAA1 gene expression. Exami-
nation of the relative affinity of each SGA compound in an AHR
competition ligand-binding assay revealed that SGA 360 has a
higher affinity for the human AHR than SGA 293. This would
indicate that the position of the methoxy groups around the
phenyl ring has a profound influence on their affinity for the
AHR. Nevertheless, both SGA 293 and SGA 360 met the goal
of this study to generate useful SAhRMs that fail to interact
with the ER.
Discussion
There are basically two types of selective nuclear receptor
ligands, the first class are ligands that induce receptor dimer-
ization, subsequently binding to their cognate response element
and mediating selective recruitment of coactivators/corepressors.
The second type of selective ligand induces dimerization but
fails to elicit binding to its response element. An example of
the latter is the identification of a selective glucocorticoid
receptor (GR) ligand (33). The discovery of selective GR ligands
(e.g., ZK 216348), in theory, could result in repression of
inflammation without many of the side effects of classical GR
activators. Studies with the estrogen receptor (ER) have
developed highly selective ligands that bind to the receptor and
selectively activate nuclear binding to other transcription factors
such as NFKB (23). In contrast, these ligands fail to induce
estrogen response element driven gene expression or estradiol-
mediated physiological effects, such as uterine weight gain (31).
One such ER selective ligand, WAY-169916, can effectively
inhibit the progression of rheumatoid arthritis in a rat model
system and inhibit inflammatory bowel disease in a transgenic
rat model (31, 34). The same line of reasoning used in these
studies was pursued in the development of selective AHR
ligands. However, as a bHLH-PAS protein the AHR has a
markedly different arrangement of functional domains compared
to nuclear receptors and thus may not be as amenable to being
selectively activated. For example, the AF2 transactivation
domain and ligand binding pocket are in close proximity in
Cell culture-based studies with Huh7 cells illustrating the
suppression of cytokine-mediated inflammatory gene expression
(e.g. SAA1) by Way-169916 (22, 31) and SGA 360 clearly
demonstrate the anti-inflammatory potential of SAhRMs. How-
ever, cell culture-based observations are limited in that they are
restricted to a single homogeneous population and thus may
not accurately reflect physiological responses. Inflammation is
a complex process requiring extensive interplay among numer-
ous cell types; thus, putative anti-inflammatory modulators
require in vivo examination. Verification of the anti-inflamma-
tory activity of the SAhRM SGA 360 was demonstrated using
the long established TPA-induced ear edema model. Further-
more, Ahr-/- animals, while responsive to TPA, proved to be
refractory to the anti-inflammatory activity of SGA 360, thus
implicating AHR in its mode of action. While the parent
compound Way-169916 can exert suppressive effects upon
inflammatory signaling through ER and AHR (22, 31), SGA
360 exhibits minimal ER binding, suggesting that the suppres-
sive action of SGA 360 may be solely mediated through AHR.
Pro-inflammatory gene expression (e.g., Cox2 and Il1b) medi-
ated by TPA was markedly repressed by SGA 360. The
mechanism of such AHR-dependent repression remains to be
elucidated but is likely to involve either protein-protein cross-
talk or the ability of a SAhRM to block DRE-mediated AHR

Ah Receptor SelectiVe Ligand Inhibits Inflammation
Chem. Res. Toxicol., Vol. 23, No. 5, 2010 965
activity. While Cox2 is expressed within the epidermis in
response to TPA, the expression of cytokines, e.g., Il1b and
Il6, is likely to occur within the epidermis together with resident
and infiltrating immune cells. Thus, it is probable that SGA 360
exerts its anti-inflammatory action in multiple cell-types,
consistent with previous reports demonstrating a role for AHR
in modulating responses to inflammatory stimuli in both skin
and immune cells, such as TH1/2, TH17, and macrophages
(11, 14, 35, 36). It is noteworthy that the efficacy of SGA 360,
with regard to inhibition of TPA-induced edematosis, is of the
same magnitude as that observed with similar doses of gluco-
corticoids and nonsteroidal anti-inflammatory drugs (37). The
inhibition of inflammation by SAhRM ligands is consistent with
previous reports demonstrating a role for the high-affinity Ahrb-1
allele in dampening inflammatory signaling in skin following
exposure to pro-inflammatory stimuli (36). Such observations
may indicate that the production of endogenous AHR ligands
capable of limiting inflammatory responses in a SAhRM-like
fashion may be produced in vivo. For example, the arachidonic
acid derivative, 12(R)-HETE, an activator of AHR can be
produced in skin during inflammation and thus could contribute
to the regulation of AHR activity in skin cells (38). Interestingly,
sustained activation of AHR in keratinocytes promotes inflam-
matory signaling in mice (39). The contradictory nature of AHR
activity is likely to involve inflammatory cytokines (e.g., IL-6,
IL-18, and CCL20), which have a DRE-mediated regulatory
component (39, 40), and results in elevated expression in
response to potent AHR agonists or heightened AHR protein
levels. Although these cytokines were not examined in the
context of SGA 360 exposure, the inhibition of DRE binding
by SAhRMs similar to SGA 360 is likely to suppress such
activity and further contribute to its anti-inflammatory profile.
development, suggesting that an AHR antagonist could have
therapeutic potential in treating chronic inflammatory diseases
(15). The AHR can repress the expression of acute-phase genes,
which can be continuously up-regulated during chronic inflam-
matory diseases such as rheumatoid arthritis. Excessive produc-
tion of acute-phase gene products such as SAA can lead to
enhanced inflammation and amyloidosis; thus, attenuation of
the acute phase response in liver would be a second therapeutic
target that can be altered by selective activation or antagonism
of the AHR. The third possible target is the ability of a SAhRM
to inhibit estrogenic activity in breast cancer (43). Most likely,
if each of these relevant target diseases were to be treated with
an AHR ligand, a SAhRM would be the most logical choice,
as an AHR agonist will also modulate DRE-driven AHR
transcriptional activity that could lead to toxicity or alter drug
metabolism. Future studies are needed to test whether SGA 360
would be effective in treating chronic inflammatory diseases.
Acknowledgment. We thank Dr. Michael Denison for
H1L1.1c2 cells and Kelly Wagner for her technical assistance
for the SAA repression assay. We thank Marcia H. Perdew for
editorial assistance. This work was supported by NIEHS,
National Institutes of Health Grants ES04869. The NMR
instrumentation in this project is funded, in part, under a grant
from the Pennsylvania Department of Health using Tobacco
Settlement Funds. The Department specifically disclaims re-
sponsibility for any analyses, interpretations or conclusions.
Additional instrumentation support came from NIH 1 S10
RR021172.
Supporting Information Available: Copies of the 1H NMR
spectra for compounds 1, 2, 3, 4, 5, 10, 11, 12, 13, and 14;
copies of 13C NMR spectra (Figures S1 and S2) and partial
HMBC spectra (Figures S3 and S4) for compounds 4 and 14;
and Figures S5 and S6 provide additional data demonstrating
that SGA 360 does not interact with the ER. This material is
available free of charge via the Internet at http://pubs.acs.org.
When considering the regulation of AHR-mediated modula-
tion of transcription, it is important to clearly understand
differences between a SAhRM and an AHR antagonist and their
possible differences in activity, in a particular biological context.
For example, if one is interested in blocking a DRE-mediated
event such as the induction of CYP1A1, both an antagonist and
a SAhRM will exhibit the same apparent inhibitory activity. If
the goal were to block all direct AHR-mediated transcriptional
modulatory events, an AHR antagonist and a SAhRM would
yield very different results. Interestingly, an AHR antagonist is
defined in the literature as an AHR ligand that fails to induce
a DRE-mediated enhancement of gene expression. This is due
to the fact that the AHR was only recently shown to repress
gene transcription through protein-protein interactions (20, 41).
Thus, whether previously described AHR antagonists are pure
antagonists or SAhRMs will require further investigation. An
example of these concepts is the activity of R-naphthoflavone
(R-NF), which is considered a partial agonist/antagonist and is
often used as an antagonist to a full agonist such as TCDD.
This flavonoid exhibits a modest ability to induce CYP1A1
mRNA yet is similar to TCDD in its ability, at a relatively high
concentration, to inhibit SAA3 expression after cytokine exposure
(20). Thus, R-NF exhibits partial agonist/antagonist activity, yet
is capable of exhibiting full repression potential.
References
(1) Gabay, C., and Kushner, I. (1999) Acute-phase proteins and other
systemic responses to inflammation. N. Engl. J. Med. 340, 448–454.
(2) Cheng, N., He, R., Tian, J., Ye, P. P., and Ye, R. D. (2008) Cutting
edge: TLR2 is a functional receptor for acute-phase serum amyloid
A. J. Immunol. 181, 22–26.
(3) Okamoto, H., Katagiri, Y., Kiire, A., Momohara, S., and Kamatani,
N. (2008) Serum amyloid A activates nuclear factor-kappaB in
rheumatoid synovial fibroblasts through binding to receptor of
advanced glycation end-products. J. Rheumatol. 35, 752–756.
(4) Lee, M. S., Yoo, S. A., Cho, C. S., Suh, P. G., Kim, W. U., and Ryu,
S. H. (2006) Serum amyloid A binding to formyl peptide receptor-
like 1 induces synovial hyperplasia and angiogenesis. J. Immunol. 177,
5585–5594.
(5) Yan, S. D., Zhu, H., Zhu, A., Golabek, A., Du, H., Roher, A., Yu, J.,
Soto, C., Schmidt, A. M., Stern, D., and Kindy, M. (2000) Receptor-
dependent cell stress and amyloid accumulation in systemic amyloi-
dosis. Nat. Med. 6, 643–651.
(6) Beischlag, T. V., Luis Morales, J., Hollingshead, B. D., and Perdew,
G. H. (2008) The aryl hydrocarbon receptor complex and the control
of gene expression. Crit. ReV. Eukaryotic Gene Expression 18, 207–
250.
(7) McMillan, B. J., and Bradfield, C. A. (2007) The aryl hydrocarbon
receptor sans xenobiotics: endogenous function in genetic model
systems. Mol. Pharmacol. 72, 487–498.
(8) Baba, T., Mimura, J., Nakamura, N., Harada, N., Yamamoto, M.,
Morohashi, K., and Fujii-Kuriyama, Y. (2005) Intrinsic function of
the aryl hydrocarbon (dioxin) receptor as a key factor in female
reproduction. Mol. Cell. Biol. 25, 10040–10051.
(9) Barnett, K. R., Tomic, D., Gupta, R. K., Miller, K. P., Meachum, S.,
Paulose, T., and Flaws, J. A. (2007) The aryl hydrocarbon receptor
affects mouse ovarian follicle growth via mechanisms involving
estradiol regulation and responsiveness. Biol. Reprod. 76, 1062–1070.
The potential importance of developing SAhRMs or AHR
antagonists is becoming increasingly apparent. At least three
specific physiologically important targets modulated by AHR
activity have emerged. The first is the ability of the AHR to
modulate T cell differentiation and, in particular, their dif-
ferentiation into TH17 cells and an IL22 producing T cell sub-
population that is important in skin (14, 42). Studies in cell
culture reveal that an AHR antagonist can impair TH17 cell

966 Chem. Res. Toxicol., Vol. 23, No. 5, 2010
Murray et al.
(10) Lund, A. K., Agbor, L. N., Zhang, N., Baker, A., Zhao, H., Fink,
G. D., Kanagy, N. L., and Walker, M. K. (2008) Loss of the aryl
hydrocarbon receptor induces hypoxemia, endothelin-1, and systemic
hypertension at modest altitude. Hypertension 51, 803–809.
(11) Negishi, T., Kato, Y., Ooneda, O., Mimura, J., Takada, T., Mochizuki,
H., Yamamoto, M., Fujii-Kuriyama, Y., and Furusako, S. (2005)
Effects of aryl hydrocarbon receptor signaling on the modulation of
TH1/TH2 balance. J. Immunol. 175, 7348–7356.
(12) Morales, J. L., Krzeminski, J., Amin, S., and Perdew, G. H. (2008)
Characterization of the antiallergic drugs 3-[2-(2-phenylethyl) ben-
zoimidazole-4-yl]-3-hydroxypropanoic acid and ethyl 3-hydroxy-3-
[2-(2-phenylethyl)benzoimidazol-4-yl]propanoate as full aryl hydro-
carbon receptor agonists. Chem. Res. Toxicol. 21, 472–482.
(13) Peck, A., and Mellins, E. D. (2009) Breaking old paradigms: Th17
cells in autoimmune arthritis. Clin. Immunol. 132, 295–304.
(14) Veldhoen, M., Hirota, K., Westendorf, A. M., Buer, J., Dumoutier,
L., Renauld, J. C., and Stockinger, B. (2008) The aryl hydrocarbon
receptor links TH17-cell-mediated autoimmunity to environmental
toxins. Nature 453, 106–109.
ligand affinity of human versus mouse aryl hydrocarbon receptor in
cultured cells. Mol. Pharmacol. 66, 129–136.
(28) Flaveny, C. A., Murray, I. A., Chiaro, C. R., and Perdew, G. H. (2009)
Ligand selectivity and gene regulation by the human aryl hydrocarbon
receptor in transgenic mice. Mol. Pharmacol. 75, 1412–1420.
(29) Nahm, S., and Weinreb, S. M. (1981) N-methoxy-N-methylamides
as effective acylating agents. Tetrahedron Lett. 22, 3815–3818.
(30) De Luca, L., Giacomelli, G., and Taddei, M. (2001) An easy and
convenient synthesis of Weinreb amides and hydroxamates. J. Org.
Chem. 66, 2534–2537.
(31) Chadwick, C. C., Chippari, S., Matelan, E., Borges-Marcucci, L.,
Eckert, A. M., Keith, J. C., Jr., Albert, L. M., Leathurby, Y., Harris,
H. A., Bhat, R. A., Ashwell, M., Trybulski, E., Winneker, R. C.,
Adelman, S. J., Steffan, R. J., and Harnish, D. C. (2005) Identification
of pathway-selective estrogen receptor ligands that inhibit NF-kappaB
transcriptional activity. Proc. Natl. Acad. Sci. U.S.A. 102, 2543–2548.
(32) Zhang, S., Qin, C., and Safe, S. H. (2003) Flavonoids as aryl
hydrocarbon receptor agonists/antagonists: effects of structure and cell
context. EnViron. Health Perspect. 111, 1877–1882.
(33) Schacke, H., Schottelius, A., Docke, W. D., Strehlke, P., Jaroch, S.,
Schmees, N., Rehwinkel, H., Hennekes, H., and Asadullah, K. (2004)
Dissociation of transactivation from transrepression by a selective
glucocorticoid receptor agonist leads to separation of therapeutic effects
from side effects. Proc. Natl. Acad. Sci. U.S.A. 101, 227–232.
(34) Keith, J. C., Jr., Albert, L. M., Leathurby, Y., Follettie, M., Wang,
L., Borges-Marcucci, L., Chadwick, C. C., Steffan, R. J., and Harnish,
D. C. (2005) The utility of pathway selective estrogen receptor ligands
that inhibit nuclear factor-kappa B transcriptional activity in models
of rheumatoid arthritis. Arthritis Res. Ther. 7, R427–4R38.
(35) Shi, L. Z., Faith, N. G., Nakayama, Y., Suresh, M., Steinberg, H.,
and Czuprynski, C. J. (2007) The aryl hydrocarbon receptor is required
for optimal resistance to Listeria monocytogenes infection in mice.
J. Immunol. 179, 6952–6962.
(15) Veldhoen, M., Hirota, K., Christensen, J., O’Garra, A., and Stockinger,
B. (2009) Natural agonists for aryl hydrocarbon receptor in culture
medium are essential for optimal differentiation of Th17 T cells. J.
Exp. Med. 206, 43–49.
(16) Kimura, A., Naka, T., Nohara, K., Fujii-Kuriyama, Y., and Kishimoto,
T. (2008) Aryl hydrocarbon receptor regulates Stat1 activation and
participates in the development of Th17 cells. Proc. Natl. Acad. Sci.
U.S.A. 105, 9721–9726.
(17) Kitamura, M., and Kasai, A. (2007) Cigarette smoke as a trigger for
the dioxin receptor-mediated signaling pathway. Cancer Lett. 252,
184–194.
(18) Tian, Y., Ke, S., Denison, M. S., Rabson, A. B., and Gallo, M. A.
(1999) Ah receptor and NF-kappaB interactions, a potential mechanism
for dioxin toxicity. J. Biol. Chem. 274, 510–515.
(36) De Souza, V. R., Cabrera, W. K., Galvan, A., Ribeiro, O. G., De
Franco, M., Vorraro, F., Starobinas, N., Massa, S., Dragani, T. A.,
and Ibanez, O. M. (2009) Aryl hydrocarbon receptor polymorphism
modulates DMBA-induced inflammation and carcinogenesis in phe-
notypically selected mice. Int. J. Cancer 124, 1478–1482.
(37) De Young, L. M., Kheifets, J. B., Ballaron, S. J., and Young, J. M.
(1989) Edema and cell infiltration in the phorbol ester-treated mouse
ear are temporally separate and can be differentially modulated by
pharmacologic agents. Agents Actions 26, 335–341.
(38) Chiaro, C. R., Patel, R. D., and Perdew, G. H. (2008) 12(R)-Hydroxy-
5(Z),8(Z),10(E),14(Z)-eicosatetraenoic acid [12(R)-HETE], an arachi-
donic acid derivative, is an activator of the aryl hydrocarbon receptor.
Mol. Pharmacol. 74, 1649–1656.
(39) Tauchi, M., Hida, A., Negishi, T., Katsuoka, F., Noda, S., Mimura,
J., Hosoya, T., Yanaka, A., Aburatani, H., Fujii-Kuriyama, Y.,
Motohashi, H., and Yamamoto, M. (2005) Constitutive expression of
aryl hydrocarbon receptor in keratinocytes causes inflammatory skin
lesions. Mol. Cell. Biol. 25, 9360–9368.
(40) Hollingshead, B. D., Beischlag, T. V., Dinatale, B. C., Ramadoss, P.,
and Perdew, G. H. (2008) Inflammatory signaling and aryl hydrocarbon
receptor mediate synergistic induction of interleukin 6 in MCF-7 cells.
Cancer Res. 68, 3609–3617.
(41) Beischlag, T. V., and Perdew, G. H. (2005) ER alpha-AHR-ARNT
protein-protein interactions mediate estradiol-dependent transrepression
of dioxin-inducible gene transcription. J. Biol. Chem. 280, 21607–
21611.
(42) Trifari, S., Kaplan, C. D., Tran, E. H., Crellin, N. K., and Spits, H.
(2009) Identification of a human helper T cell population that has
abundant production of interleukin 22 and is distinct from T(H)-17,
T(H)1 and T(H)2 cells. Nat. Immunol. 10, 864–871.
(43) Zhang, S., Lei, P., Liu, X., Li, X., Walker, K., Kotha, L., Rowlands,
C., and Safe, S. (2009) The aryl hydrocarbon receptor as a target for
estrogen receptor-negative breast cancer chemotherapy. Endocr. Relat.
Cancer 16, 835–844.
(19) Jensen, B. A., Leeman, R. J., Schlezinger, J. J., and Sherr, D. H. (2003)
Aryl hydrocarbon receptor (AhR) agonists suppress interleukin-6
expression by bone marrow stromal cells: an immunotoxicology study.
EnViron. Health 2, 16.
(20) Patel, R. D., Murray, I. A., Flaveny, C. A., Kusnadi, A., and Perdew,
G. H. (2009) Ah receptor represses acute-phase response gene
expression without binding to its cognate response element. Lab.
InVest. 89, 695–707.
(21) Bunger, M. K., Glover, E., Moran, S. M., Walisser, J. A., Lahvis,
G. P., Hsu, E. L., and Bradfield, C. A. (2008) Abnormal liver
development and resistance to 2,3,7,8-tetrachlorodibenzo-p-dioxin
toxicity in mice carrying a mutation in the DNA-binding domain of
the aryl hydrocarbon receptor. Toxicol. Sci. 106, 83–92.
(22) Murray, I. A., Morales, J. L., Flaveny, C. A., Dinatale, B. C., Chiaro,
C., Gowdahalli, K., Amin, S., and Perdew, G. H. (2010) Evidence for
ligand-mediated selective modulation of aryl hydrocarbon receptor
activity. Mol. Pharmacol. 77, 247–254.
(23) Steffan, R. J., Matelan, E., Ashwell, M. A., Moore, W. J., Solvibile,
W. R., Trybulski, E., Chadwick, C. C., Chippari, S., Kenney, T.,
Eckert, A., Borges-Marcucci, L., Keith, J. C., Xu, Z., Mosyak, L.,
and Harnish, D. C. (2004) Synthesis and activity of substituted
4-(indazol-3-yl)phenols as pathway-selective estrogen receptor ligands
useful in the treatment of rheumatoid arthritis. J. Med. Chem. 47, 6435–
6438.
(24) Long, W. P., Pray-Grant, M., Tsai, J. C., and Perdew, G. H. (1998)
Protein kinase C activity is required for aryl hydrocarbon receptor
pathway-mediated signal transduction. Mol. Pharmacol. 53, 691–700.
(25) Garrison, P. M., Tullis, K., Aarts, J. M., Brouwer, A., Giesy, J. P.,
and Denison, M. S. (1996) Species-specific recombinant cell lines as
bioassay systems for the detection of 2,3,7,8-tetrachlorodibenzo-p-
dioxin-like chemicals. Fundam. Appl. Toxicol. 30, 194–203.
(26) Poland, A., Glover, E., Ebetino, H., and Kende, A. (1986) Photoaffinity
labelling of the Ah receptor. Food Chem. Toxicol. 24, 781–787.
(27) Ramadoss, P., and Perdew, G. H. (2004) Use of 2-azido-3-[125I]iodo-
7,8-dibromodibenzo-p-dioxin as a probe to determine the relative
TX100045H