Oligonucleotide-selenide conjugate: Synthesis and its inducible sequence-specific alkylation of DNA

Article abstract of DOI:10.1016/j.bmc.2009.11.026

Oligonucleotide-selenium conjugate was designed and synthesized and its sequence-specific cross-linking ability was investigated. The selenide derivatives can generate covalent interstrand cross-linking with its complementary strand through the formation

Full text of DOI:10.1016/j.bmc.2009.11.026

Bioorganic & Medicinal Chemistry 18 (2010) 4149–4153
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Oligonucleotide-selenide conjugate: Synthesis and its inducible
sequence-specific alkylation of DNA
Yuhao Du a, Xiaocheng Weng a, Jing Huang a, Dan Zhang a, Heng Ma a, Dong Chen a, Xiang Zhou a,c,d,
,
*
Jean-François Constant b,
*
a College of Chemistry and Molecular Sciences, Minist Educ, Key Lab Biomed, Wuhan University, Hubei, Wuhan 430072, PR China
b DCM-UMR 5250, ICMG-FR2607, Université Joseph Fourier, BP 53, 38041 Grenoble Cédex 9, France
c State Key Laboratory of Bio-Organic & Natural Products Chemistry, Shanghai Institute of Organic Chemistry Chinese Academy of Sciences, PR China
d State Key Laboratory of Natural and Biomimetic Drugs and State Key Laboratory of Applied Organic Chemistry, PR China
a r t i c l e i n f o
a b s t r a c t
Article history:
Oligonucleotide-selenium conjugate was designed and synthesized and its sequence-specific cross-link-
ing ability was investigated. The selenide derivatives can generate covalent interstrand cross-linking with
its complementary strand through the formation of o-QM intermediate induced by periodate oxidation. A
cross-linking reaction yield of up to 50% was obtained. Hydroxyl radical footprinting experiment revealed
that the quinone appendage specifically alkylated the cytosine base extending the duplex formed
between the conjugate and the target strand.
Received 26 October 2009
Accepted 11 November 2009
Available online 17 November 2009
Keywords:
Oligonucleotide conjugate
Oxidation induction
Selenide
Ó 2009 Elsevier Ltd. All rights reserved.
DNA cross-linking
Quinone methides
1. Introduction
as antitumor drugs, are poorly selective and highly toxic. There-
fore, in recent years, attention has shifted towards improving the
Sequence-selective interstrand cross-linking (ISC) between
complementary duplexes or triplexes1–3 is a topic of intense re-
search interest, due to its potential applications in basic research
and clinical use. This strategy is expected to inhibit transcription
and expression of specific genes using antisense strategies, and it
is developing as a tool for site-directed chemical modification that
may induce point mutations in the genetic code.4
The DNA cross-linking reaction is the primary mechanism for
the cytotoxic activity of many clinical antitumor drugs, such as
nitrogen mustards, platinum agents and mitomycin C.5 The basic
principle of cross-linking includes the incorporation of a reactive
functional group into the DNA by covalent bonding. This non-
reversible covalent bond formation between two DNA strands
can disrupt the maintenance and replication of tumor cells DNA
and eventually lead to cell death.6 Unfortunately, many existing
alkylating and cross-linking agents have functional groups with
high intrinsic reactivity and of considerable instability. These
agents are also susceptible to nucleophilic attack by a number of
naturally-occurring chemicals such as water, amino and sulfidryl
groups. In addition, these agents, even those already used clinically
target selectivity of cross-linking agents.
The ideal solution to such problems is the use of drugs that can
be brought selectively close to the target, and whose cross-linking
activity can be induced by a trigger, such as photo-irradiation,
enzymatic or chemical stimulus.
The inducible formation of o-quinone methide (o-QM) as a pre-
cursor of antitumor agents has been reported by many groups be-
cause o-QM motif is highly reactive with DNA.7 Our group has
reported several efficient DNA ISC agents derived from an o-QM
intermediate induced by a biphenol quaternary ammonium struc-
ture,8 a biphenol selenide structure9 and a bis (catechol) quater-
nary ammonium structure.10 In this communication we now
report the successful production of a sequence-selective alkylating
agent that can be induced with high efficiency under mild oxida-
tive conditions.
2. Results and discussion
2.1. Chemistry
3-(4-Hydroxyphenyl) propionic acids 1 (Scheme 1),11 subjected
to successive hydroxyl group protection, bromination, substitution
and deprotection, yielded the acid derivative 2. Treatment of
* Corresponding authors. Tel.: +86 27 61056559; fax: +86 27 87336380 (X.Z.).
E-mail addresses: xzhou@whu.edu.cn (X. Zhou), Jean-francois.Constant@ujf-gre
noble.fr (J.-F. Constant).
the acid
2 with N-hydroxysuccinimide in the presence of
0968-0896/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2009.11.026

4150
OH
Y. Du et al. / Bioorg. Med. Chem. 18 (2010) 4149–4153
OH
OH
OH
SePh
SePh
SePh
e
a - d
Oligo 4
Oligo 5
3'-TCCTTTTTTTCT
5'-TAMRA-GAACTCTAGGAAAAAAAGACTAAG-3'
O
O
O
N
COOH
COOH
O
2
3
1
OH
SePh
f
O
O-
5'
N
H
O
P O
O
TCTTTTTTTCCT
4
4
Figure 1. Denatured PAGE (20%) was used to identify the concentration depen-
dence DNA cross-linking (NaIO4 oxidation). Oligonucleotides 4 and 5 (2 M in each
strand) were annealed in 20 mM PBS, pH 7.4, 30 °C, and treated with the following
concentrations of NaIO4. Lane 1: none; Lane 3: 1 mM NaIO4; Lane 4: 5 mM NaIO4;
Lane 5: 10 mM NaIO4; Lane 6: 20 mM NaIO4; Lane2: 39-mer oligonucleotide used as
a molecular weight marker.
l
Scheme 1. Synthesis of compounds 1–4. Reagents and conditions: (a) b-(4-
hydroxyphenyl) propionic acid, K2CO3, (CH3)2SO4, acetone, rt, 95%; (b) (CH2O)n,
HBr, CH3COOH, 61%; (c) (PhSe)2, Zn, NaH2PO4, H2O, CH3CN, rt, 90%; (d) BBr3, CH2Cl2,
45%; (e) AcOEt, NHS, DCC; (f) NaCO3/NaHCO3 buffer, pH 7.5.
that phenyl selenide derivatives were capable of cross-linking
DNA through the formation of o-QM.9
In control experiment, no cross-link product could be observed
for the partially-complementary oligonucleotide 6 50-d(GAACTCT
AGGTAAAAATTACTAAG), (Fig. 2).
N,N0-dicyclohexylcarbodiimide yielded the activated ester 3. This
in turn was used for coupling to oligonucleotides modified at the
50 terminus with a hexamethyleneamino linker. The final product
4 was then purified by reverse-phase chromatography and con-
firmed by UV and MALDI-TOF mass spectrometry.11 A target DNA
strand, 50-d(GAACTCTAGGAAAAAAAGACTAAG) 5, was also pre-
pared and labeled at the 50 terminus with TAMRA (TAMRA = 6-
carboxytetramethylrhodamine, succinimidyl ester). The 50 amino
linker derivative and other oligonucleotides were synthesized
using the standard procedures of solid-phase phosphoramidite
chemistry.
2.3. Determination of the alkylation site
To identify the specific reactive sites of the complex, the cross-
linked product was purified by gel electrophoresis and subjected to
a highly effective method of footprinting based on Hopkins’ hydro-
xyl radical cleavage of DNA.13 Interstrand modification is revealed
by the contrast in scission fragmentation from the native strand
and the cross-linked DNA. The first base extended from the duplex,
C20, was alkylated by the quinone appendage (Fig. 3). Selective
alkylation of cytosine is consistent with previous reports showing
that a quinone methide intermediate modifies the N3 position of
cytosine14 with a more than 10-fold preference over purines.15
2.2. DNA cross-link
Oligonucleotide derivative 4 was first annealed to its comple-
mentary strand 5 and then treated with multiple concentrations
of sodium periodate (NaIO4), a mild oxidative agent that does not
react with proteins and nucleotides,11 prior to analysis by 20%
denaturing polyacrylamide gel electrophoresis. Treatment of the
annealed duplex with sodium periodate led to the formation of a
slowly migrating band in the gel. The electrophoresis velocity of
the new high molecular weight products was similar to that of a
39-mer oligonucleotide used as a molecular weight marker, indi-
cating the formation of cross-linked products consistent with the
covalent attachment of the complementary duplex (Fig. 1).
The oxidation-dependent activation described above is consis-
tent with previously reported mechanisms.12 This target-selective
ISC reaction proceeded via an electrophilic intermediate as o-QM
formed under oxidative conditions (Scheme 2). No high molecular
weight species were observed in the absence of oxidant (Lane 1). In
addition, the transient intermediate generated upon oxidation
could be trapped by ethyl vinyl ether (EVE), a trapping agent for
o-QM, to produce the expected QM-EVE adducts.9 The strategy of
using a non-reactive precursor 4 can prevent the side effects
caused by the intrinsic high reactivity of functional groups in some
other alkylating agents. The most effective point is that the cross-
linking reaction can only take place when specifically induced after
suitable binding with the target. After hybridization of 4 and 5, the
ISC was dependent on the concentration of NaIO4 added to the
medium. Reaction yields of up to 50% (Lane 6, determined by den-
sitometry) were obtained at a moderate oxidant concentration
(20 mM). This is consistent with our previously published results
3. Conclusion
In conclusion, we have synthesized oligonucleotide-selenium
conjugate and have demonstrated its capability to perform highly
efficient and selective DNA cross-linking reactions without incur-
ring chemical instability. The selenide derivatives can perform
ISC through the formation of o-QM induced by periodate oxidation.
Future efforts will focus on the biological applications of the new
cross-linking motifs in antisense strategies or site-directed chemi-
cal modification of cytosine.
4. Experimental section
4.1. 3-(4-Methoxyphenyl)propionic acid methyl ester, 1a16
Commercially available 3-(4-hydroxyphenyl)propionic acids
(1.68 g, 10 mmol) was dissolved in 40 mL acetone and methyl sul-
fate (5 mL). Then solid carbonate potassium (6.90 g, 50 mmol) was
added and the mixture was refluxed for 48 h. The reaction mixture
was filtered through a short pad of silica gel, and the filtrate was
concentrated to afford 3-(4-methoxyphenyl)propionic acid methyl
ester (1a) (1.84 g, 95% yield) as a colorless liquid. 1H NMR (CDCl3) d
2.60 (t, J = 8.0 Hz, 2H), 2.89 (t, J = 8.0 Hz, 2H), 3.66 (s, 3H), 3.78
(s, 3H), 6.83 (d, J = 8.6 Hz, 2H), 7.13 (d, J = 8.6 Hz, 2H).

Y. Du et al. / Bioorg. Med. Chem. 18 (2010) 4149–4153
4151
nuc :
OH
R
OH
O
R
OH
R
SePh NaIO4
SePh
O-
nuc
R
Scheme 2. Proposed mechanism for interstrand cross-link (ISC) formation.
127.56, 128.10, 129.02, 129.07, 130.28, 132.34, 134.23, 134.28,
134.34. HRMS (ESI) m/z, calcd for C18H20NaO3Se (M+Na)+ calcd
387.0470. Found 387.0468.
4.4. 3-(4-Hydroxy-3-phenylselanylmethyl-phenyl)-propionic
acid (2)
Under nitrogen atmosphere, at 0 °C, BBr3 (neat, 0.26 mL,
2.88 mmol) was added gradually to a solution of 1c (182 mg,
0.5 mmol) in freshly distilled CH2Cl2 (10 mL). After the mixture
was stirred for 2 h at room temperature, the solution was poured
into a large amount of ice-water and extracted with ethyl acetate.
The organic phase was washed with brine, dried over anhydrous
Na2SO4, and evaporated to dryness. The residue was purified by
column chromatography (dichloromethane/ethyl ether = 1:1) to
give the desired product as a yellow oil (76 mg, 45% yield). 1H
NMR (CD3OD) d 2.39 (t, J = 8.0 Hz, 2H), 2.68 (t, J = 8.0 Hz, 2H),
4.08 (s, 2H), 6.68 (m, 2H), 6.87 (m, 1H), 7.22 (m, 3H), 7.45 (m,
2H); HRMS (ESI) m/z, calcd for C16H16NaO3Se (M+Na)+ calcd
359.0157. Found 359.0153.
Figure 2. Denatured PAGE (20%) was used to identify the concentration depen-
dence DNA cross-linking (NaIO4 oxidation). Lane 1: oligonucleotides 4 and 5 (2
in each strand), Lane 2: oligonucleotides 4 and partially-complementary oligonu-
cleotide 6 (2 M in each strand) were annealed in 20 mM PBS, pH 7.4, 30 °C, and
lM
l
treated with 20 mmol NaIO4; Lane 3: 39-mer oligonucleotide served as a molecular
weight marker.
4.5. Conjugate 419
4.2. 3-(4-Methoxy-3-bromethylphenyl)-propionic acid methyl
ester, 1b17
To an ice-cold solution of 30 mL ethyl acetate including acid 2
(108 mg, 10 mM) and N-hydroxysuccinimide (NHS) (34 mg,
10 mM), a solution of N,N0-dicyclohexylcarbodimide (DCC) (62 mg,
10 mM) in 15 mL ethyl acetate was added dropwise. After stirring
for 16 h, the mixture was allowed to warm up to room temperature.
The precipitate was filtered off, and filtrate was evaporated in vac-
uum to yield the activated NHS ester. The ester was directly used
for the conjugation reaction without further purification.
A solution consisting of 12 mL glacial acetic acid, 1a (1.94 g,
10 mmol) and paraformaldehyde (0.45 g, 15 mmol) was heated at
70 °C for 15 min. Then 3.5 mL 33% HBr in acetic acid was added
dropwise during 5 min. After 20 min at this temperature, the mix-
ture was cooled to 0 °C for 12 h. The reaction mixture was then
poured into cold water, and extracted with ethyl acetate three
times. All organic phase was combined and washed with saturated
aqueous NaHCO3, and concentrated in vacuo. The residue was puri-
fied by column chromatography (cyclohexane/ethyl acetate = 4:1)
to yield the desired product as a white solid (1.74 g, 61% yield).
1H NMR (CDCl3) d 2.60 (t, J = 8.0 Hz, 2H), 2.88 (t, J = 8.0 Hz, 2H),
3.67 (s, 3H), 3.87 (s, 3H), 4.53 (s, 2H), 6.80 (d, J = 5.1 Hz, 1H), 7.14
(t, J = 7.8 Hz, 2H); 13C NMR (CDCl3) d 29.27, 30.16, 36.03, 51.83,
55.90, 111.33, 126.28, 130.13, 131.02, 132.90, 156.22, 173.47.
HRMS (ESI) m/z, calcd for C12H15O3 (MꢀBr)+ calcd 207.1016. Found
207.1018.
The appropriate oligonucleotide containing a 50-hexamethyle-
neamino linker (80 nmol) in NaHCO3/Na2CO3 buffer (100 mM, pH
7.5, 30 lL) was mixed with an equal volume of NHS ester in DMF
and incubated at ambient temperature for 12 h. The desired conju-
gate 4 was then isolated after purification by reverse-phase chroma-
tography with a C-18 column and a gradient of 5–50% acetonitrile in
an aqueous solution of triethylammonium acetate (50 mM, pH 7)
over 25 min (1 mL/min). ESI-MS, calcd 4041.4, found 4041.69.
4.6. Cross-linking reaction of oligonucleotides 4 and 5
4.3. 3-(4-Methoxy-3-phenylselanylmethyl-phenyl)-propionic
acid methyl ester, 1c18
Cross-linking reaction was performed with oligonucleotides 4
and 5 annealed in PBS buffer (9
30 °C. Then NaIO4 in PBS solution was added at the final volume
of 10 L and a final concentration of 2 M duplex. The mixture
was incubated at 30 °C and the reaction was quenched after 24 h
with the addition of 10 L formamide deionized. The reaction
lL, 20 mM, pH 7.4) for 10 min at
To a solution of NaH2PO4 (6.0 g, 43.5 mmol) in 6.0 mL of water,
1b (0.58 g, 2 mmol) and (PhSe)2 (0.473 g, 1.5 mmol) dissolved in
6 mL CH3CN were added. Under vigorous stirring, Zn powder
(0.26 g, 4 mmol) was added. After stirring for 1.5 h at room tem-
perature, the mixture was hydrolyzed and extracted with ethyl
acetate. The organic phase was evaporated to dryness and the solid
was purified via silica gel column chromatography (cyclohexane/
ethyl acetate = 8:1) to give product 1c as a yellow oil (655 mg,
90% yield). 1H NMR (CDCl3) d 2.49 (t, J = 8.0 Hz, 2H), 2.78 (t,
J = 8.0 Hz, 2H), 3.66 (s, 3H), 3.78 (s, 3H), 4.08 (s, 2H), 6.76 (m,
2H), 7.01 (d, J = 7.8 Hz, 1H), 7.24 (m, 3H), 7.45 (m, 2H); 13C NMR
l
l
l
products were then analyzed on a 20% denaturing polyacrylamide
gel electrophoresis.
4.7. Hydroxyl radical cleavage of DNA by Fe(II)ꢁEDTA20
The cross-linked products were isolated by polyacrylamide gel
electrophoresis.1 The Fe(II)ꢁEDTA cleavage reactions were con-
ducted as previously described by Hopkins.2 Cross-linked DNA
(CDCl3)
d 27.17, 30.23, 36.16, 51.82, 55.74, 110.86, 127.44,

4152
Y. Du et al. / Bioorg. Med. Chem. 18 (2010) 4149–4153
Figure 3. Densitomeric scans representing hydroxyl radical-generated footprints of hybridized and cross-linked DNA. (A) Fragmentation of a control sample. (B)
Fragmentation of the alkylated product.
(10 pmol) was treated with a solution of 500
1 mM EDTA, 10 mM sodium ascorbate, 0.1 M H2O2, 10 mM phos-
phate buffer (pH 7.7) in a total volume of 10 L for 1 min at room
temperature, and quenched by the addition of 1 L of 0.1 M thio-
lM (NH4)2Fe(SO4)2,
References and notes
1. Zhou, Q.; Rokita, S. E. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 15452.
2. Halila, S.; Velasco, T.; Clercq, P. D.; Madder, A. Chem. Commun. 2005, 936.
3. (a) Nagatsugi, F.; Kawasaki, T.; Usui, D.; Maeda, M.; Sasaki, S. J. Am. Chem. Soc.
1999, 121, 6753; (b) Peng, X.; Hong, I. S.; Li, H.; Seidman, M. M.; Greenberg, M.
M. J. Am. Chem. Soc. 2008, 130, 10299.
l
l
urea. Samples were lyophilized and analyzed by denaturing PAGE.
4. Woolf, T. M. Nat. Biotechnol. 1998, 16, 341.
5. Rajski, S. R.; Williams, R. M. Chem. Rev. 1998, 98, 2723.
Acknowledgments
6. (a) Sherman, S. E.; Lippard, S. J. Chem. Rev. 1987, 87, 1153; (b) Ferlin, M. G.;
Dalla Via, L.; Gia, O. M. Bioorg. Med. Chem. 2004, 12, 771; (c) Parker, L. L.;
Anderson, F. M.; O’Hare, C. C.; Lacy, S. M.; Bingham, J. P.; Robins, D. J.; Hartley, J.
A. Bioorg. Med. Chem. 2005, 13, 2389.
7. (a) Wang, P.; Song, Y.; Zhang, L. X.; He, H. P.; Zhou, X. Curr. Med. Chem. 2005, 12,
2893; (b) Freccero, M.; Valentin, C. D.; Sarzi-Amade, M. J. Am. Chem. Soc. 2003,
125, 3544; (c) Weinert, E. E.; Dondi, R.; Colloredo, S.; Frankenfield, K. N.;
Mitchell, C. H.; Freccero, M.; Rokita, S. E. J. Am. Chem. Soc. 2006, 128, 11940.
8. Wang, P.; Liu, R. P.; Wu, X. J.; Ma, H. J.; Cao, X. P.; Zhou, P.; Zhang, J. Y.; Weng, X.
C.; Zhang, X. L.; Qi, J.; Zhou, X. L.; Weng, H. J. Am. Chem. Soc. 2003, 125, 1116.
9. Weng, X. C.; Ren, L. G.; Weng, L. W.; Huang, J.; Zhu, S. G.; Zhou, X.; Weng, L. H.
Angew. Chem., Int. Ed. 2007, 46, 8020.
X.Z. thanks the NSFC (National Science Fund of China (Nos.
20672084, 20621502, 90813031 and 20802055), National Science
Fund for Distinguished Young Scholars (No. 20425206), the Culti-
vation Fund of the Key Scientific and Technical Innovation Project,
the Ministry of Education of China (No. 706040).
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bmc.2009.11.026.
10. Song, Z. B.; Weng, X. C.; Weng, L. W.; Huang, J.; Wang, X. L.; Bai, M. H.; Zhou, Y.
Y.; Yang, G. F.; Zhou, X. Chem. Eur. J. 2008, 14, 5751.

Y. Du et al. / Bioorg. Med. Chem. 18 (2010) 4149–4153
4153
11. (a) Burdine, L.; Gillette, T. G.; Lin, H. J.; Kodadek, T. J. Am. Chem. Soc. 2004, 126,
11442; (b) Liu, B.; Burdine, L.; Kodadek, T. J. Am. Chem. Soc. 2006, 128, 15228.
12. (a) Hong, I. S.; Greenberg, M. M. Org. Lett. 2004, 6, 5011; (b) Hong, I. S.;
Greenberg, M. M. J. Am. Chem. Soc. 2005, 127, 3692; (c) Hong, I. S.; Ding, H.;
Greenberg, M. M. J. Am. Chem. Soc. 2006, 128, 485; (d) Hong, I. S.; Greenberg, M.
M. J. Am. Chem. Soc. 2005, 127, 10510; (e) Hong, I. S.; Ding, H.; Greenberg, M. M.
J. Am. Chem. Soc. 2006, 128, 2230.
15. Pande, P.; Shearer, J.; Yang, J. H.; Greenberg, W. A.; Rokita, S. E. J. Am. Chem. Soc.
1999, 121, 6773.
16. Yang, D.; Wong, M. K.; Yan, Z. J. Org. Chem. 2000, 65, 4179.
17. Thompson, B. C.; Kim, Y. G.; McCarley, T. D.; Reynolds, J. R. J. Am. Chem. Soc.
2006, 128, 12714.
18. Bieber, L. W.; de Sa´, A. C. P. F. P.; Menezes, H.; Goncalves, S. M. C. Tetrahedron
Lett. 2001, 42, 4597.
13. Millard, J. T.; Weidner, M. F.; Kirchner, J. J.; Ribeiro, S.; Hopkins, P. B. Nucleic
Acids Res. 1991, 19, 1885.
19. Fischhaber, P. L.; Gall, A. S.; Duncan, J. A.; Hopkins, P. B. Cancer Res. 1999, 59,
4363.
14. Rokita, S. E.; Yang, J.; Panda, P.; Greenberg, W. A. J. Org. Chem. 1997, 62, 3010.
20. Woo, J.; Hopkins, P. B. J. Am. Chem. Soc. 1991, 113, 5457.