Development and characterization of new inhibitors of the human and mouse hematopoietic prostaglandin D2 synthases

Article abstract of DOI:10.1021/jm100194a

The hematopoietic prostaglandin D₂ synthase has a proinflammatory effect in a range of diseases, including allergic asthma, where its product prostaglandin D₂ (PGD₂) has a role in regulating many of the hallmark disease characteristics. Here we describe the development and characterization of a novel series of hematopoietic prostaglandin D₂ synthase inhibitors with potency similar to that of known inhibitors. Compounds N-benzhydryl-5-(3-hydroxyphenyl)thiophene-2- carboxamide (compound 8) and N-(1-amino-1-oxo-3-phenylpropan-2-yl)-6-(thiophen- 2-yl)nicotinamide (compound 34) demonstrated low micromolar potency in the inhibition of the purified enzyme, while only 34 reduced Toll-like receptor (TLR) inducible PGD₂ production in both mouse primary bone marrow-derived macrophages and the human megakaryocytic cell line MEG-01S. Importantly, 34 demonstrated a greater selectivity for inhibition of PGD ₂ synthesis versus other eicosanoids that lie downstream of PGH ₂ (PGE₂ and markers of prostacyclin (6-keto PGF _1?) and thromboxane (TXB₂)) when compared to the known inhibitors HQL-79 (compound 1) and 2-phenyl-5-(1H-pyrazol-3-yl)thiazole (compound 2). Compound 34 therefore represents a selective hematopoietic prostaglandin D₂ synthase inhibitor.

Full text of DOI:10.1021/jm100194a

5536 J. Med. Chem. 2010, 53, 5536–5548
DOI: 10.1021/jm100194a
Development and Characterization of New Inhibitors of the Human and Mouse Hematopoietic
Prostaglandin D2 Synthases
Angelika N. Christ,†,§ Larisa Labzin,†,§ Gregory T. Bourne,† Hirotada Fukunishi,‡ Jane E. Weber,† Matthew J. Sweet,†
Mark L. Smythe,† and Jack U. Flanagan*,†
†Institute for Molecular Bioscience, The University of Queensland, Queensland, 4072, Australia, and ‡Research Center,
Shiseido Company Ltd., 2-2-1 Hayabuchi, Tsuzuki-ku, Yokohama 224-8558, Japan. §These authors contributed equally to this work.
Received February 12, 2010
The hematopoietic prostaglandin D2 synthase has a proinflammatory effect in a range of diseases,
including allergic asthma, where its product prostaglandin D2 (PGD2) has a role in regulating many of
the hallmark disease characteristics. Here we describe the development and characterization of a novel
series of hematopoietic prostaglandin D2 synthase inhibitors with potency similar to that of known
inhibitors. Compounds N-benzhydryl-5-(3-hydroxyphenyl)thiophene-2-carboxamide (compound 8)
and N-(1-amino-1-oxo-3-phenylpropan-2-yl)-6-(thiophen-2-yl)nicotinamide (compound 34) demon-
strated low micromolar potency in the inhibition of the purified enzyme, while only 34 reduced Toll-like
receptor (TLR) inducible PGD2 production in both mouse primary bone marrow-derived macrophages
and the human megakaryocytic cell line MEG-01S. Importantly, 34 demonstrated a greater selectivity
for inhibition of PGD2 synthesis versus other eicosanoids that lie downstream of PGH2 (PGE2 and
markers of prostacyclin (6-keto PGF1R) and thromboxane (TXB2)) when compared to the known
inhibitors HQL-79 (compound 1) and 2-phenyl-5-(1H-pyrazol-3-yl)thiazole (compound 2). Compound
34 therefore represents a selective hematopoietic prostaglandin D2 synthase inhibitor.
Introduction
toxicity and the more seldom cardiovascular complications
associated with prostacyclin loss.6 Targeting individual syn-
thases downstream of cyclooxygenase represents a strategy to
avoid these complications.
Prostaglandins (PGa) are a family of structurally related eico-
sanoids that have important roles in homeostasis but also con-
tribute to the pathology of numerous inflammatory diseases.1
The cyclooxygenase enzymes catalyze the conversion of arachi-
donic acid to PGH2, which is converted to other prostanoid
species including PGD2, PGE2, PGF2R, prostacyclin (PGI2),
and thromboxane (TX) A2 by the action of specific synthases.
Each prostanoid has different biological activities;2 for example,
during inflammation PGE2 is a major mediator of pain, fever,
and swelling,3 whereas PGD2 is a major proinflammatory medi-
ator of the allergic response.4 PGI2 and TXA2 largely have
opposing biological activities; PGI2 prevents platelet aggrega-
tion and promotes dilation of blood vessels, while TXA2
promotes platelet aggregation and blood vessel constriction.
Consequently, cyclooxygenase inhibition affects a number of
biological processes with adverse effects5 such as the gastric
PGD2 is active in both the central nervous system and peri-
pheral tissues, with roles in body temperature regulation, sleep-
wake regulation, relaxation of smooth muscle, tactile pain res-
ponse, bronchoconstriction, and inflammation. In mouse mod-
els of asthma and allergic disease, the prostanoid has a sub-
stantial proinflammatory effect, regulating many hallmark
characteristics including eosinophilia, airways hyperreactivity,
mucus production, and Th2 cytokine levels.7-9 Moreover, inhi-
bition of PGD2 synthesis and PGD2 signaling blockade had
a suppressive effect on neuroinflammation in mouse models
of Krabbe’s disease.10 In contrast to these proinflammatory
effects, PGD2 and its cyclopentenone PG derivatives also have
anti-inflammatory properties, with functions in inflammation
resolution.11
Isomerization of the cyclooxygenase product PGH2 to
PGD2 is performed by two genetically distinct PGD2 synthase
(PGDS) enzymes, brain-type PGDS and hematopoietic
PGDS(see refs 12and 13for reviews). The former is a member
of the lipocalin superfamily, termed L-PGDS, while the latter,
termed H-PGDS, is the only vertebrate member of the
glutathione transferase (GST) σ class and requires glutathione
(GSH) to perform the isomerization reaction. Other members
*To whom correspondence should be addressed. Current address:
Auckland Cancer Society Research Centre, University of Auckland,
Grafton, Auckland 1032, New Zealand. Phone: þ64 9 373 7599, extension
86155. Fax: þ64 9 373 7571. E-mail: j.flanagan@auckland.ac.nz.
aAbbreviations: PG, prostaglandin; H-PGDS, hematopoietic prostaglan-
din D2 synthase; L-PGDS, lipocalin-type prostaglandin D2 synthase; GST,
glutathione transferase; GSH, glutathione; H-site, hydrophobic site; CDNB,
1-chloro-2,4-dinitrobenzene; DMSO, dimethyl sulfoxide; TLR, Toll-like
receptor; MeCN, acetonitrile; TFA, trifluoroacetic acid; DCM, dichloro-
methane; EtOAc, ethyl acetate; DIEA, diisopropylethylamine; MeOH,
methanol; EtOH, ethanol; DMF, N,N-dimethylformamide; HBTU, O-
benzotriazol-1-yl-N,N,N0,N0-tetramethyluronium hexafluorophosphate; Py-
BrOP, benzotriazole-1-yloxytripyrrolidinophosphonium hexafluoropho-
sphate; DIEA, N,N-diisopropylethylamine; Pd(PPh3)4, tetrakis(triphenyl-
phosphine)palladium(0); CsF, cesium fluoride; CuI, copper(I) iodide;
MgSO4, magnesium sulfate.
of the σ class include GSTs from squid14 and chicken,15
a
cephalopod lens S-crystallin16, and a PGD2 synthase from the
parasite Onchocerca volvulus.17 The divergence in biochemical
activity and likely in vivo function exhibited by the σ class
GSTs is also reflected in the differences in tissue distribution.
r
pubs.acs.org/jmc
Published on Web 07/20/2010
2010 American Chemical Society

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15 5537
The highest levels of expression for the mammalian H-PGDS
include the spleen and bone marrow,18 while the chicken GST
isoform is expressed in the liver, kidney, and intestine,18 and the
squid GST transcript was found predominantly in the digestive
gland.16 Moreover, as mammalian L-PGDS expression ap-
pears to be mostly restricted to the central nervous system,
testis, and heart,13 PGD2 synthesis in peripheral tissues is likely
to be through the H-PGDS GSH dependent mechanism.
The GSTs are a family of detoxifying enzymes that can
catalyze the conjugation of glutathione (GSH) to many com-
pounds bearing electrophilic functional groups.19 The σ class
enzymes exist as cytosolic homodimers and have a similar
tertiary structure and active site topology, despite low sequence
identity, compared to the other classes.20 The monomer can be
divided into two domains, with the active site existing at the
domain interface. The mixed R/β N-terminal domain contains
the GSH binding site (G site), while the all helical C-terminal
domain contributes to the PGH2 binding site/hydrophobic
substrate binding site (H site).21,22 A key feature of the con-
jugation reaction catalyzed by GSTs is the enzyme’s ability to
activate GSH, forming and stabilizing the more reactive thiolate
anion. In both the cephalopod and mammalian enzyme, an
N-terminal Tyr hydroxyl is involved in the process.14,22
Compound 1 (Figure 1) was recently characterized as an
inhibitor of human H-PGDS23 and exhibited a therapeutic
effect when used in animal models of allergic disease24,25 and
neuroinflammation.10 The X-ray crystal structure of H-PGDS
with 1 and GSH bound was also determined (PDB code 2CVD)
and identified the inhibitor binding site as the putative PGH2
binding site/H site. A cryptic binding site required to accom-
modate the inhibitors diphenyl moiety was also exposed.23 More
recently, a fragment-based drug design approach identified a
number of new H-PGDS inhibitors, including compounds 2
and 3 that bind within the active site cavity without inducing a
conformational change.26 The specificity of these previously
reported H-PGDS inhibitors has been assessed in a limited way
however. In this study, we developed and characterized a novel
series of potent and selective H-PGDS inhibitors that may have
applications in allergy-related diseases.
Figure 1. (a) Structures of H-PGDS inhibitors. (b) Structure based
alignment. Compound 1 is rendered as orange sticks, compound 2 as
gray sticks, and compound 3 as white sticks. Key active site residues are
colored green and taken from the crystal structure with compound 1
bound (2CVD). The alternative positions of Trp104 are shown. Trp104a
(green) represents the side chain position with compound 1bound, while
Trp104b (purple) illustrates the side chain position in the structures with
compounds 2and 3bound. Atoms interacting with an ordered water are
displayed as spheres, and the interactions are indicated by dashed lines.
Of compounds 1, 2, and 3, only compound 2 interacts with the water
molecule. The figure was created with PyMol (www.pymol.org).
Results
Biochemical Characterization of Inhibitors. A range of dis-
tinct H-PGDS inhibitors have recently been reported (com-
pound 1,23 compounds 2 and 3,26 and compound 4,27
Figure 1a), and their binding modes were determined by
X-ray crystallography. All compounds were revealed to bind
in the prostaglandin binging site, and notably, a cryptic pocket
was identified in the X-ray crystal structure of 1 that accom-
modates a ligand phenyl group and is created by displacement of
the Trp104 side chain. By contrast, the compounds developed
by fragment based drug design (compounds 2 and 3) were more
planar, did not induce the cryptic pocket, and identified a
hydrogen bond donor site in an ordered water molecule, a site
not used by 1 (Figure 1b). We characterized compounds 1, 2, 3,
and 4 with respect to the H-PGDS CDNB conjugating activity;
the data are presented in Table 1. These data indicate that
the previously identified H-PGDS inhibitors, compounds 1, 2,
and 3, are low to submicromolar inhibitors of the CDNB
conjugation reaction. Compound 2 is more potent than either
1 or 3, while the smaller compound 4 is a weaker inhibitor still.
Notably, compounds 2 and 3 exhibit the same rank order
against CDNB as against another surrogate substrate, mono-
chlorobimane,26 while the IC50 for 1 (3.8 μM) is similar to that
reported for inhibition of PGD2 synthesis by the purified
enzyme (IC50 of 6 μM).23
To explore the possibility of blending these two inhibitor
classes, a structure based alignment of 1, 2, and 3 (PDB codes
2CVD for 1, 2VCX for 2, and 2VD1, for 3) was generated by
a CR based superposition of the monomers (Figure 1b). The
H-PGDS active site was previously described as transition-
ing from a clearly defined inner cavity to a broad, peripheral
solvent exposed component.26 The molecular alignment
demonstrated that the phenyl group of 1 occupying the inner
cavity superimposed well with the buried aromatic centers of
2 and 3, while the two other rings of 2 and 3 traversed the
broader solvent exposed region also occupied by the piper-
azine and alkyl linker of 1. This indicated the potential for
replacement of the piperazine and alkyl chain of 1 with a
biphenyl moiety, a concept also supported by 5, which
contains an arrangement of aromatic centers likely to extend
beyond the active site space occupied by the substructure
common to 2 and 3, thus capturing the unique interaction
between the diphenyl moiety of 1 and the cryptic binding
pocket in the PGH2 binding site, on a biphenyl scaffold.

5538 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15
Table 1. Variation of the Diphenyl Containing Seriesa
Christ et al.
a Inhibition data were determined using the CDNB conjugating activity of purified recombinant human H-PGDS enzyme. IC50 values were calculated
from triplicate experiments and are presented as IC50 ( standard error of the mean. I50 is percent inhibition at 50 μM and is presented as the mean (
standard error of triplicate experiments. “-” indicates that IC50 values could not be retrieved under the assay conditions.
A low molecular weight fragment that weakly inhibited the
CDNB conjugating activity of H-PGDS (approximately
26% at 50 μM), suitable for attachment of a diphenyl group,
was identified in 6, and docking calculations using the protein
structure 2CVD predicted that the composite compound, 8,
was likely to adopt a binding mode similar to that of 1. Few of
the interactions identified for compounds 2 and 3,26 however,
were likely to be made (Figure 2). Clashes were observed in
the predicted binding mode between the benzyl ring in the
cryptic pocket and Thr159, between the amide carbonyl and
Leu199, and between the phenol ring and Met11, while a
hydrogen bond was predicted between the side chain carbo-
nyl of Gln36 and the phenol OH of 8. An interaction with this
residue was also observed with the benzylic acid and alcohol
moieties of 3, although these were to the side chain amino
group of Gln36. It was unclear if these predicted clashes
represent a barrier to ligand binding.
A range of compounds exploring substitutions on the
biphenyl moiety were synthesized around a core fragment
represented by 7, and their ability to inhibit purified H-PGDS
was tested against the enzyme’s GSH conjugating activity;
the results are presented in Table 1. An IC50 of 0.7 μM was
retrieved for the most potent compound, 8, with the next
strongest being 9 (IC50=1.9 μM). These results demonstrate
the importance of a hydrogen bond interaction between the
ligand and target site, an interaction was also supported by a
striking reduction in I50 values in the absence of a donor moiety
(compound 10). Interestingly, a thiazole substitution of the

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15 5539
mouse primary bone marrow-derived macrophages (BMM)
responding to the Toll-like receptor (TLR) 4 agonist lipo-
polysaccharide (LPS) and the human megakaryocyte cell line
MEG-01S responding to PMA differentiation, followed by
stimulation with the calcium ionophore A23187. As PGD2 is
produced by both H-PGDS and the genetically distinct
L-PGDS, quantitative RT-PCR was first used to assess rela-
tive mRNA levels as an indicator of enzyme expression in these
cell lines. Figure 3 shows that H-PGDS mRNA was expressed
at much higher levels than L-PGDS (1000ꢀ) in both mouse
BMM and human MEG-01S cells (Figure 3A, Figure 3B).
Others have reported that LPS, a TLR4 agonist, induces
L-PGDS expression in macrophages,28,29 and we confirmed
that finding here (Figure 3D) and showed that H-PGDS was
also regulatedby LPS(Figure 3C). Nonetheless, theincreasein
L-PGDS mRNA expression in response to LPS was very
modest in comparison to the high basal expression of H-PGDS
in BMM. We conclude thatH-PGDS is likely the major PGDS
expressed by both human MEG-01S cells and mouse BMM,
implying that this enzyme is likely to be the dominant source of
PGD2 production in these cell types.
A selection of compounds was screened for their ability to
inhibit PGD2 production in LPS/TLR4-activated BMM
(Figure 4A). Only compounds 19 and 34 significantly in-
hibited LPS-inducible PGD2 production in these cells. Both of
these compounds had phenylalanine substituted aromatic cores
but differed in that 19 had a thiophene-phenol core while 34
possessed a pyridyl-thiophene unit. Strikingly compound 8,
which contained a diphenyl group similar to 1, showed no
inhibitory activity in cells under the conditions tested. Neither
19 nor 34 affected BMM viability at 10 μM, as assessed by MTT
assay (Figure 4B), although at 100 μM, 19 greatly reduced cell
viability, while compound 34 again showed no cytotoxicity
(Figure 4B). Compounds 1 and 2, identified by others as
H-PGDS inhibitors,24-26 had modest but significant effects at
reducing BMM cell viability at 100 μM (Figure 4B).
Compound 34 was further characterized along with the
H-PGDS inhibitors 123 and 226 in LPS-activated BMM; the
results are presented in Figure 5. Compound 34 inhibited
PGD2 production dose-dependently in the submicromolar
range (Figure 5A). The EC50 estimated for compound 34
(∼0.29 μM) was comparable to that estimated for compound
2 (EC50 ≈ 0.16 μM) and was ∼30-fold better than that esti-
mated for 1. The specificities of 34,2,and1were then assessed by
comparing effects on LPS-inducible PGE2, the hydrated pros-
tacyclin derivative 6-keto PGF1R, and the thromboxane A2
derivative TXB2 production from BMM (Figure 5B,C,D).
Compound 1 showed no differential effect in inhibition of
PGD2 versus PGE2, 6-keto PGF1R, or TXB2, while compound
2 showed only a modest difference. In contrast, compound 34
demonstrated a striking selectivity, inhibiting PGD2 levels at less
than 1 μM, while PGE2, 6-keto PGF1R, and TXB2 inhibition
was only observed above 10 μM. Taken together, these data
demonstrate that compound 34 displays selectivity and affinity
not otherwise observed for other H-PGDS inhibitors. Further-
more, compounds 2 and 34 also inhibited A23187-inducible
PGD2 production from PMA-differentiated MEG-01S human
megakaryocytes dose-dependently, while 1 displayed modest
activity at 100 μM (Figure 6A). None of the compounds tested
(compound 1, 2, or 34) affected MEG-01S cell viability
(Figure 6B), suggesting that inhibition of PGD2 production
occurred through enzyme inhibition.
Figure 2. Superimposition of the top ranking binding mode pre-
dicted by GOLD for compound 8 (orange ball and stick) onto the
crystal structure of compound 1 (green stick) bound to the H-PGDS
active site. Figure created with PyMol (www.pymol.org).
central thiophene ring caused an 11-fold reduction in IC50 (11,
10.8 μM), and potency was further decreased in the absence of
a hydrogen bond donor group (12), as seen by the decrease in
I50 values, further supporting the essential nature of this
hydrogen bond interaction. Replacement of the central five-
membered ring with a benzyl group did not improve the I50
(13). The position and orientation of the hydrogen bond
interaction appear to be restricted, as inclusion of a methylene
spacer (14) caused a substantial decrease in I50 and an acceptor
function (15) reduced it further. Restricting the orientation of
the donor group (16) also reduced I50.
The phenol-thiophene scaffold of 8 was further investi-
gated by the addition of a range of amino acids that included
Gly, Leu, Phe, Tyr, and Trp, and the results for compounds
17-21 (Table 2) demonstrate that an amino acid is tolerated
and that an aromatic moiety is preferred, with increases in
potency up to approximately 6-fold with respect to the Gly
substitution (17). Notably, compounds 20 and 21 indicate a
positive effect of a hydrogen bond donor group at this
position. The phenyl thiophene core was further modified
by the addition of a cyclohexyl group, compound 22, and
exhibited only weak H-PGDS inhibition.
The central thiophene ring of 19 was replaced by a phenyl
(23) and retrieved a comparable IC50 (3.7 μM vs 4.6 μM,
respectively; Table 2), and this substitution did not alter the
preference for an aromatic amino acid component (compounds
24, 25, 26, 27, and28). Replacement of the phenol with an indole
hydrogen bond donor group (compound 29) caused a severe
reduction in inhibition. Furthermore, the introduction of an
additional donor group on the central phenyl group (com-
pounds 30 and 31) did not improve the potency of compound
23, although 31 did clearly demonstrate that substitutions on the
2 position of the central ring are detrimental to activity, giving
an I50 of only 20%. Reorientation of the biphenyl core also
caused a severe reduction in activity (compound 32), illustrating
that the para substituted biphenyl moiety is important for ligand
binding. As a biphenyl moiety is well tolerated in the presence of
an amino acid, two alternative ring combinations were tested
(33, 34), with 34 retrieving an IC50 of 1.2 μM (comparable with
24 and 20), indicating that a phenol hydroxyl group is not
essential for strong activity.
Cell-Based Screening Assays. We next assessed the ability
of a selection of potent compounds to inhibit inducible
PGD2 production in two inflammation-relevant cell models,
PGD2 is the product of a biosynthetic pathway, the first step
of which is the release of arachidonic acid from the plasma

5540 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15
Table 2. Variation of the Phenyl Thiophene Seriesa
Christ et al.

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15 5541
Table 2. Continued
a Inhibition data were determined using the CDNB conjugating activity of purified recombinant human H-PGDS enzyme. IC50 values were calculated
from triplicate experiments and are presented as IC50 ( standard error of the mean. I50 is percent inhibition at 50 μM and is presented as the mean (
standard error of triplicate experiments. “-” indicates that IC50 values could not be retrieved under the assay conditions.
Figure 4. Identification of H-PGDS inhibitors with activity in BMM.
BMM were treated with 10 μM compound and LPS (10 ng/mL) for 24
h (A). The average PGD2 production from three independent experi-
ments plus SEM is shown: (/) p < 0.05 versus LPS treatment alone
(Student’s t test). Compounds that showed significant inhibition of
Figure 3. H-PGDS is the predominant PGDS expressed by mouse
PGD2 synthesis were used to treat BMM at three doses (10, 30, 100 μM)
BMM and human MEG-01S cells. Quantitative RT-PCR data from
in the presence of LPS for 24 h, and cell viability was measured by MTT
BMM (A) and MEG-01S cells (B) show the relative mRNA expres-
sion levels of H-PGDS versus L-PGDS in unstimulated cells. Data
represent the average of three independent experiments plus SEM.
BMM were treated with LPS over a 24 h time course, and relative
mRNA expression for H-PGDS (C) and L-PGDS (D) was quanti-
assay (B). Data show the average of four independent experiments plus
SEM: (/) p < 0.05, (///) p < 0.001 versus LPS treatment alone (one
sample t test where the hypothetical mean is 100).
may also have a negative impact on PGD2 production in cells;
tated. Data show the average plus SEM for three independent
therefore, we screened our compounds against purified COX1
experiments: (//) p < 0.01, (///) p < 0.001 (Student’s t test).
and COX2 (Figure 7). Both 34 and a representative from
membrane by phospholipases,30 followed by conversion to the
H-PGDS/L-PGDS substrate PGH2 by the cyclooxygenase en-
zymes COX1 and COX2. Inhibition of COX1 and/or COX2
the diphenyl series (8) were tested along with 2 and the well-
characterized COX inhibitor indomethacin. No inhibition of
either COX isoform was observed for the H-PGDS inhibitors,

5542 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15
Christ et al.
Figure 5. Characterization of prostaglandin inhibition in BMM. BMM were treated with increasing concentrations (0-100 μM) of compounds 1, 2,
and 34 with appropriate vehicle controls (ethanol for 1, DMSO for 35 and 2) and with LPS for 24 h. PGD2 (A), PGE2 (B), prostacyclin derivative
6-keto PGF1R (C), and thromboxane A2 derivative TXB2 (D) levels in cell culture supernatants were quantified by EIA. Data show the average of
three independent experiments plus SEM: (/) p < 0.05, (//) p < 0.01; (///) p < 0.001 (Student’s t test) versus vehicle þ LPS control.
while indomethacin significantly inhibited the activity of both
COX1 and COX2. These data further support the selectivity for
inhibition of PGD2 synthesis of this series of compounds, and
altogether, the data indicate that 34 likely blocks PGD2 synth-
esis by H-PGDS enzyme inhibition.
matory effects.24,25 Recent studies on H-PGDS in mouse models
of neuroinflammation10 and muscle necrosis42 also suggest a
proinflammatory role for this enzyme in other pathologies. Thus,
development of compounds for both receptor and synthase
targets will provide unique opportunities to modulate the effects
of PGD2 and is supported by the clinical use of ramatroban, a
receptor antagonist,43 and tranilast, a modest H-PGDS inhibi-
tor,44 in the control of allergic responses, as well as the thera-
peutic effect of HQL-79 in animal models of allergic disease.24,25
We have been interested in the exploitation of privileged
substructures45-47 and have used a structure guided approach
to develop novel H-PGDS inhibitors based on known inhibi-
tory chemotypes, represented by 123 and 2.26 Compound 8 was
created by the fusion of a diphenyl moiety similar to that of 1 to
a weak fragment inhibitor 6. In doing so, we demonstrated
potent inhibition of purified recombinant human H-PGDS,
comparable to that of the H-PGDS inhibitor compound 2 and
stronger than that of compounds 1 and 3. While this outcome
clearly demonstrates that an effective inhibitor can be devel-
oped from the two different moieties and may also favor
exposure of a cryptic pocket, it did not exhibit activity in cells.
Strikingly, an inhibitor with potency comparable to that of
compounds 2and 3could also be achieved without the diphenyl
moiety and predicted phenol hydroxyl interaction with Gln36,
as seen with 34. In contrast to compound 8, compound 34
Discussion
PGD2 is the major eicosanoid produced by mast cells after
IgE-dependent activation31 and is readily detected in nasal
and bronchial lavage fluids of patients with asthma,32 allergic
rhinitis,33 atopic dermatitis,34,35 and allergic conjunctivitis.36 It
triggers a range of biological effects consistent with a patholo-
gical role in asthma and allergy, including airways eosinophilia,
obstruction, hypersensitivity, and mucus hypersecretion.8,9,37,38
These inflammatory effects are mediated by interaction with the
D prostanoid receptor (DP1) and chemoattractant receptor-
homologous molecule expressed on T helper type 2 cell (CR-
TH2), or DP2. Consistent with a proinflammatory function for
PGD2 in these settings, antagonists of the DP1 and DP2 recep-
tors were therapeutic in animal models of allergic disease.4,7 The
D2 prostanoid is synthesized by H-PGDS and L-PGDS, two
structurally unrelated enzymes,13,21,39,40 that also differ in tissue
expression profiles (refs 12, 13, and 18 and references therein).
H-PGDS is highly expressed in mast cells,41 and as such, it repre-
sents an alternative target for modulation of PGD2 proinflam-

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15 5543
Figure 7. Characterization of COX1 and COX2 inhibiton. Two
novel H-PGDS inhibitors, compounds 8 and 34, were assayed for
possible inhibition of purified COX1 and COX2 isoforms at 1, 10,
and 100 μM, along with the known inhibitor of COX 1 and COX2,
indomethacin. Data represent the average of three independent
experiments plus SEM: (/) p < 0.05 (one sample t test where the
hypothetical mean is 100).
in this study (2ꢀ) to those previously reported (6.5ꢀ)26 also
supports this. Notably, the less potent H-PGDS inhibitor, com-
pound 1, showed differences in efficacy across the cell types
used, having a greater effect in mouse macrophage over human
megakaryocyte. The human and mouse H-PGDS isoforms
exhibit 80% sequence identity, with residues contributing to
the active site cavity being mostly conserved. Three positions
that vary between the two enzymes include Glu41Lys, Ser44-
Pro, and Phe163Leu (human vs mouse). The Glu41Lys and
Ser44Pro substitutions occur in the R2 helix, a secondary struc-
ture element associated with GSH binding, while the Phe163-
Leu residue contributes to the cryptic pocket and is in proximity
to the buried phenyl group of compound 1. This variation may
alter the interaction of compound 1 with the cryptic pocket and
contribute to the difference in efficacy observed between mouse
and human cells.
Prostaglandin E synthase, prostacyclin synthase, thrombo-
xane synthase, and H-PGDS all use the COX product PGH2 as
a precursor for their own prostanoid products, and loss of these
downstream prostaglandins is a likely cause of side effects asso-
ciated with COX inhibitors.6,48 Thus, analysis of the effects of
H-PGDS inhibitors on the production of other prostaglandins,
prostacylcins, and thromboxanes is clearly warranted. We add-
ressed this issue by measuring inducible PGD2 versus PGE2,
PGI2 (by measuring its derivative 6-keto PGF1R), andTXA2 (by
measuring its derivative TXB2) production in LPS-activated
BMM and demonstrated that 34 showed selectivity for inhibit-
ing PGD2 production, while that for other reported H-PGDS
inhibitors was more modest. The selective inhibition of LPS-
inducible PGD2 synthesis was also supported by the absence of
COX1 and COX2 inhibition.
Figure 6. Characterization of prostaglandin inhibition in MEG-
01S human megakaryocytes. PMA differentiated MEG-01S were
treated with compounds 1, 2, and 34 across a range of concentra-
tions (0-100 μM) for 30 min prior to 30 min treatment with 5 μM
calcium ionophore A23187. PGD2 levels in cell culture supernatants
were quantitated by EIA (A). Data represent the average of three
independent experiments plus SEM: (/) p < 0.05, (//), p < 0.01,
(///) p < 0.001 (Student’s t test) versus vehicle þ ionophore con-
trol. The effect of the compounds on MEG-01S cell viability was
measured by MTT assay after 24 h of treatment across the con-
centration range, 0-100 μM, of compounds (B). Data represent the
average of four independent experiments plus SEM.
demonstrated inhibition of PGD2 synthesis in intact cells, with
a dose dependent profile similar to that of the recently reported
H-PGDS inhibitor compound 2. Where inhibition of PGD2
synthesis was observed in cells, the data were in agreement with
rank ordering based on enzyme assay data; IC50 values retrieved
for compounds 1, 2, and 34 ranked them in order of potency
2 > 34 > 1, an order consistent with their EC50 in cells. While
these compounds appear slightly more active in the cellular
assay, for example, compound 34 is 4-fold more potent in cell-
based assays than in enzyme assays with a similar dose depen-
dent activity in human and mouse cell types, this is likely due to
the different assay systems employed. Comparison of the rela-
tive differences in IC50 values retrieved for compounds 2 and 3
The induction of L-PGDS in macrophages by LPS has been
previously characterized,28,29 and weconfirmedthose findings
herebyexaminingL-PGDSmRNA levelsacrossan LPStime-
course. While L-PGDS silencing indicated that enzyme as the

5544 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15
Christ et al.
main source of PGD2 upon LPS stimulation of a macrophage
derived cell line,29 our transcriptional profiling and inhibition
studies support H-PGDS as the main source of PGD2 synthesis
in isolated mouse bone marrow derived macrophages activated
similarly. Notably, residual PGD2 synthesis was observed in
both cell types for compounds 1, 2, and 34, suggesting that
under the conditions tested, some PGD2 synthesis may occur
through a H-PGDS independent pathway and is consistent
with low expression of L-PGDS. Thus, these compounds
represent novel reagents for probing the function of H-PGDS
activity in both normal physiological and disease states.
Cell Culture. All bone marrow-derived macrophages (BMM)
were obtained by culturing bone marrow cells from the femurs of 6-
to 8-week-old C57BL/6 male mice in RPMI 1640 medium (Invitro-
gen Life Technologies, Carlsbad, CA) supplemented with 10% fetal
calf serum (Invitrogen), 20 U/mL penicillin and 20 μg/mL strepto-
mycin (Invitrogen), 2 mM L-glutamine (Glutamax-1, Invitrogen) in
the presence of 104 U/mL (100 ng/mL) recombinant human CSF-1
(a gift from Chiron, Emeryville, CA) on bacteriological plastic plates
for 7 days. The human megakaryocytic cell line MEG-01S was
obtained from the American Type Culture Collection. MEG-01S
cells were maintained in the same media as for BMM but was addi-
tionally supplemented with 1 mM sodium pyruvate (Invitrogen).
Determination of mRNA Expression by Quantitative PCR
(qPCR). RNA was extracted from 3ꢀ106 cells and cDNA syn-
thesized as described previously.50 Briefly, RNA was extracted
using RNeasy kits (Qiagen, Valencia, CA), contaminating genomic
DNA removed using RNeasy on-column DNase (Qiagen), and
cDNA was synthesized using Superscript III (Invitrogen) and
oligo(dT) primer. Transcript abundance was quantitated using
gene-specific primer pairs and the SYBR green system (Applied
Biosystems, Foster City, CA) relative to hypoxanthine guanine
phosphoribosyl transferase (HPRT) levels using the power δ Ct
method. Primer efficiencies for the respective human and mouse
H-PGDS and L-PGDS primer pairs were measured over a cDNA
dilution series and were used to normalize expression such that
comparisons could be made of mRNA levels for H-PGDS versus
L-PGDS (for human and mouse). Primer pairs used were human
H-PGDS gene (forward TCACCAGAGCCTAGCAATAGCA,
reverse CTGCCCAAGGAAAACATGACA); human L-PGDS
gene (forward CCTGACCTCCACCTTCCTCA, reverse TCGG-
TCTCCACCACTGACAC); human HPRT gene (forward TCA-
GGCAGTATAATCCAAAGATGGT, reverse AGTCTGGCT-
TATATCCAACACTTCC); mouse H-pgds gene (forward AAG-
CACCTCGCCTTCTGAAA, reverse CAGTAGAAGTCTGC-
CCAGGTTACAT); mouse L-pgds gene (forward CAGAGGG-
CTGGTCACATGGT, reverse AGGCAAAGCTGGAGGGT-
GTAG); mouse Hprt gene (forward GCAGTACAGCCCCAAA-
ATGG, reverse AACAAAGTCTGGCCTGTATCCAA).
Prostaglandin Release from Cells. BMM were seeded over-
night at 2 ꢀ 105 cells/mL in 24-well plates before treatment with
compound at either 10 or 0.1-100 μM for 24 h in the presence or
absence of lipopolysaccharide (LPS) from Salmonella minnesota
(Sigma-Aldrich) at a final concentration of 10 ng/mL. MEG-
01S was seeded at 2 ꢀ 105 cells/mL and stimulated with PMA
(phorbol 12-myristate 13-acetate) (Sigma-Aldrich) at a final
concentration of 0.1 μM for 16 h. Compound (0.3-100 μM)
was added 30 min prior to stimulation with 5 μM calcium
ionophore A23187 (Sigma-Aldrich) for 30 min. All compounds
were dissolved in DMSO and diluted in cell culture medium such
that the final concentration of DMSO did not exceed 0.1%.
Supernatants were collected, and samples were analyzed for
PGD2 using prostaglandin D2 MOX Express EIA kits, for
PGE2 using prostaglandin E2 Express EIA kits, for the prosta-
cyclin derivative 6-keto PGF1R using the 6-keto prostaglandin
Experimental Section
Materials. Glutathione, 1-chloro-2,4-dinitrobenzene, indo-
methacin, and nocodazole were purchased from Sigma-Aldrich
Pty Ltd. (Castle Hill, NSW, Australia). Compound 1 was
obtained from Cayman Chemical (Ann Arbor, MI). Compound
2 was purchased at Ryan Scientific (Mt. Pleasant, SC).
Protein Expression and Purification. Human H-PGDS was
expressed and purified as described previously.18 Briefly,
H-PGDS was expressed in Escherichia coli strain BL21 DE3
transformed with the pET17b HPGDS expression construct,
grown overnight at 37 °C in 250 mL of Luria-Bertani medium
supplemented with 100 μg/mL ampicillin. After 24 h, without
induction, bacteria were harvested by centrifugation at 5000g
for 20 min at 4 °C; cell pellets were kept at -70 °C until required.
Cells were resuspended in 25 mL of ice-cold phosphate buffered
saline (PBS), pH 7.4, containing 1 mM DTT, 0.5% Triton
X-100, and EDTA-free protease inhibitor tablets (F. Hoffmann-
La Roche, Dee Why, NSW, Australia), and incubated with
rotation for 30 min at 4 °C. Cells were then lysed by sonication
at 90-100 W over 3 ꢀ 1 min intervals while incubating on ice;
the lysate was then clarified by centrifugation at 18000g for
10 min at 4 °C.
The supernatant was then applied to a GSTPrep FF 16/10
column pre-equilibrated with PBS, pH 7.4, and 1 mM DTT, at
0.4 mL/min using an AKTA explorer 100 (GE Healthcare,
Rydalmere, NSW, Australia), then washed with 5 column
volumes of the same buffer at 1 mL/min. Bound H-PGDS was
eluted in 5 column volumes of 15 mM reduced glutathione in 50
mM Tris, pH 9.0, at 0.5 mL/min and dialyzed against 100
volumes of 5 mM Tris/HCl, pH 8.0. The protein was concen-
trated to 20 mg/mL, as determined by the method of Bradford49
using an Amicon Ultra-4 centrifugal filter device (Millipore,
North Ryde, NSW, Australia) following the manufacturer’s
recommendations. Glycerol was added to a final concentration
of 10% (v/v) prior to storage at -20 °C.
Enzyme Assays. The H-PGDS catalyzed conjugation of GSH
and CDNB was used as the biochemical assay for enzyme
inhibition. Reactions were performed in 96-well plate format,
and product formation was followed at A340 nm over a 10 min
interval at 25 °C using a POWERWAVE XS microplate scan-
ning spectrophotometer (Bio-Tek Instruments, Winooski, VT).
Reactions were performed in 0.1 M Tris HCl, pH 8.0, containing
2 mM MgCl2, 1 mM CDNB, 2 mM GSH, 2.5 ng/μL purified
H-PGDS, and 10% (v/v) ethanol in a 200 μL reaction volume.
IC50 values were calculated from rates of conjugation activity
determined at eight concentration points bracketing the IC50,
where compound solubility allowed, and were corrected for
background activity at the same solvent concentrations. All
compounds were made up in 100% DMSO and diluted with 0.1
M Tris HCl, pH 8.0, with 2 mM MgCl2. I50 and IC50 values were
determined at a final DMSO composition of no greater than 4%
v/v for all compounds. Nonlinear regression analysis and IC50
calculations were performed using GraphPad Prism, version
4.0c. COX1 and COX2 enzyme assays were performed using the
colorimetric COX (ovine) inhibitor screening assay kit (Cayman
Chemical) according to the manufacturer’s instructions.
F
1R EIA kit and the thromboxane A2 derivative TXB2 using the
thromboxane B2 Express EIA kit (Cayman Chemical) according
to the manufacturer’s instructions.
Cell Viability Assays. BMM were seeded at 1 ꢀ 105 cells/well
in 96-well plates and treated for 24 h with LPS (10 ng/mL) and
compounds at 10, 30, and 100 μM. MEG-01S was PMA differ-
entiated overnight before compounds were added for a further 24 h
at 10, 30, and 100 μM. Cell viability was measured by MTT (Sigma-
Aldrich) assay as described previously.51
Chemical Methods. General Procedure. Nuclear magnetic reso-
nance spectra were recorded at 400 MHz (1H)/100 MHz (13C) on a
Varian Gemini-400. 1Hand13C chemical shifts (δ) are given in parts
per million (ppm) using residual protonated solvent (DMSO-d6) as
an internal standard. Coupling constants are given in hertz (Hz).
The following abbreviations are used: s=singlet, d=doublet, t=
triplet, m = multiplet, bs = broad signal. Low resolution mass

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15 5545
spectral data were recorded on a API2000 (TOF MS ESþ) instru-
ment (Applied Biosystems). High resolution mass spectral data
were obtained on a PE Sciex API QSTAR Pulsar (ES-qTOF)
(Perkin-Elmer, Waltham, MA) instrument using ACP (acyl carrier
protein) (65-74) (C47H75N12O16 (M þ H), 1063.5424) and reser-
pine (C33H40N2O9 (M þ H), 609.2812) as internal references. Reso-
lution for the instrument was set between 10 000 and 12 000 for all
standards. Analytical reversed-phase high performance liquid chro-
moatography (HPLC) was performed on a Gemini C18 column
(4.6 mm ꢀ 250 mm) (Phenomenex, Lane Cove, NSW, Australia).
Preparative reversed phase HPLC was performed on a Gemini
10 μm C18 column (22 mm ꢀ 250 mm) (Phenomenex) or Jupiter
diluted with dichloromethane (40 mL) and water (20 mL). After
the mixture was vigorously shaken, the mixture was filtered
through Celite with DCM/EtOAc (100 mL, 1:1). The organic
layer was separated, dried over MgSO4, and the solvent was
removed under reduced pressure. Preparative HPLC, followed
by freeze-drying, gave the pure product as a white solid material.
General Procedure Hydrolysis. Hydrolysis of the pure frac-
tions was performed with 1 M lithium hydroxide (LiOH) in
tetrahydrofuran (THF) for 16 h. The solvent was removed under
reduced pressure, providing the compound with a free acid.
General Procedure Amine Coupling. The functionalized car-
boxylic acid (1 equiv) and benzhydrylamine (2 equiv) were placed in
a reaction vessel under nitrogen atmosphere. PyBrOP (2 equiv) was
added neat together with DIEA (2.2 equiv) and DMF. The mixture
was stirred for 24 h at room temperature. Solvent was removed by
evaporation using a GeneVac Atlas HT-8 speed evaporation
system. Preparative HPLC of the final product followed by lyophi-
lization gave a white powder (>95% by analytical HPLC). Pre-
parative separations were achieved using a linear gradient (1%/min)
of buffer B in A (A = aqueous 0.045% TFA; B = 90% CH3CN,
10% H2O, 0.045% aqueous TFA) at a flow rate of 20 mL/min.
Analytical HPLC was achieved using a linear gradient (3%/min) of
buffer B in A (A = aqueous 0.045% TFA; B = 90% CH3CN, 10%
H2O, 0.045% aqueous TFA) at a flow rate of 1 mL/min.
˚
10 μm, 300 A C18 column (21.2 mm ꢀ 250 mm) (Phenomenex).
Separations were achieved using linear gradients of buffer B in A
(A = 0.1% aqueous TFA; B = 90% CH3CN, 10% H2O, 0.09%
TFA) at a flow rate of 1 mL/min (analytical) and 20 mL/min
(preparative).
Rink amide resin (sv = 0.65 mmol/g), 2-(1H-benzotriazol-1-
yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU),
and all NR-Fmoc-amino acids were peptide synthesis grade pur-
chased from IRIS Biotech (Marktredwitz, Germany). Dichloro-
methane, diisopropylethylamine, N,N-dimethylformamide, and
trifluoroacetic acid were obtained from Auspep (Parkville, VIC,
Australia). HPLC grade acetonitrile and methanol were pur-
chased from Labscan (Gliwice, Poland). All other reagents
and solvents were purchased from Sigma-Aldrich, Alfa Aesar
(Lancashire, England), Combi-Blocks (San Diego, CA), Oak-
wood Products (West Columbia, SC), Frontier Scientific (Logan,
UT), Boron Molecular (Noble Park, VIC, Australia), and Trans
World Chemicals (Rockville, MD).
N-Benzhydryl-5-(3-hydroxyphenyl)thiophene-2-carboxamide
(8) was prepared according to method B except using 3-hydro-
xyphenylbronic acid (2.35 mmol) and methyl 5-bromothiophene-2-
carboxylate (2.39 mmol). Preparative HPLC of the final product
followed by lyophilization gave a white powder (>95% purity by
1
analytical HPLC). Yield: 3.7 mg, 23.5%. H NMR (400 MHz,
General Procedure A (On-Resin Synthesis). Preparation of
Biaryls. For formation of resin-bound bromide, functionalized
Rink amide polystyrene resin (0.325 mmol, 0.5 g) was deriva-
tized with Fmoc-AA using in situ neutralization/HBTU activa-
tion protocols for Fmoc chemistry.
DMSO-d6): δ 6.34 (d, J=8.8 Hz, 1H), 6.74 (dd, J=2 Hz, J=9.6
Hz, 1H), 7.03 (d, J = 3.6 Hz, 1H), 7.11 (dd, J=2 Hz, J = 8.4 Hz,
1H), 7.21 (t, J=7.8 Hz, 1H), 7.23 -7.36 (m, 10H), 7.44 (d, J=4Hz,
1H), 7.97 (d, J=4 Hz, 1H), 9.26 (d, J=8.8 Hz, 1H), 9.64 (bs, 1H).
13C NMR (100 MHz, DMSO-d6): δ 160.9, 158.4, 148.4, 142.5 (2C),
138.7, 134.7, 130.8, 130.3, 128.8 (4C), 128.1 (4C), 127.5 (2C), 124.5,
117.0, 116.1, 112.8, 56.7. ESI-HRMS calculated for C24H19NO2S
[M þ H]þ: 386.1215. Found: 386.1229.
For formation of biaryl, bromo-functionalized resin (0.325
mmol) was placed in a reaction vessel under nitrogen atmo-
sphere. DME (5 mL) was degassed and added to the resin,
followed by addition of neat Pd(PPh3)4 (81 mg, 0.07 mmol). A
solution of the boronic acid (1.3 mmol) in degassed EtOH
(1 mL) was added to the resin, and the mixture was agitated
for 5 min; CsF (162 mg, 1.3 mmol) was added neat. The mixture
was agitated 16 h at 60 °C before excess reagents were removed
by filtration, and the resin was washed with DMF (3ꢀ) and
DCM (3ꢀ) to yield resin bound compound.
5-(3-Aminophenyl)-N-benzhydrylthiophene-2-carboxamide (9)
was prepared according to method B except using 3-aminophenyl-
bronic acid (2.35 mmol) and methyl 5-bromothiophene-2-carbox-
ylate (2.39 mmol). Preparative HPLC of the final product followed
by lyophilization gave a white powder (>95% purity by analytical
HPLC). Yield: 25.3 mg, 5.0%. 1H NMR (400 MHz, DMSO-d6): δ
6.35 (d, J = 8.4 Hz, 1H), 6.88 (dd, J=3.2 Hz, J=7.2 Hz, 1H), 7.18
(d, J=1.6 Hz, 1H), 7.24-7.28 (m, 4H), 7.30-7.37 (m, 10H), 7.46
(d, J=4 Hz, 1H), 7.99 (d, J= 4.4 Hz, 1H), 9.29 (d, J=8.8 Hz, 1H).
13C NMR (100 MHz, DMSO-d6): δ 160.8, 148.9, 148.1, 142.4 (2C),
138.9, 138.2, 134.4, 130.6, 130.2, 128.8 (4C), 128.1 (4C), 127.6 (2C),
118.4, 115.1, 114.1, 57.8. ESI-HRMS calculated for C24H20N2OS
[M þ H]þ: 385.1338. Found: 385.1345.
General Procedure for Amide Bond Coupling. All amide bond
couplings were chemically synthesized using Fmoc protecting
groups and in situ HBTU activation protocols.
Cleavage off Resin. The resin was dried for several hours
under reduced pressure and placed in a cleavage vessel. The resin
was treated with a mixture of TFA/H2O 92:8 for an hour. TFA was
blown off under nitrogen atmosphere, and the dry cleaved crude
product was redissolved in solvent A/B and separated from the
resin. Preparative HPLC of the final product followed by lyophili-
zation gave a white powder (>95% by analytical HPLC). Pre-
parative separations were achieved using a linear gradient (1%/min)
of buffer B in A (A = aqueous 0.045% TFA; B = 90% CH3CN,
10% H2O, 0.045% aqueous TFA) at a flow rate of 20 mL/min.
Analytical HPLC was achieved using a linear gradient (3%/min)
of buffer B in A (A = aqueous 0.045% TFA; B = 90% CH3CN,
10% H2O, 0.045% aqueous TFA) at a flow rate of 1 mL/min.
Compounds obtained were determined to be >95% pure by
analytical HPLC.
General Procedure B (Solution Based Synthesis). Preparation
of Biaryls. A mixture of organoboronic acid (2.35 mM) and an
ester bromide (2.39 mmol) was dissolved in toluene (15 mL), and
then CsF (1.51 g, 10.0 mmol) was added. The catalyst Pd(PPh3)4
(35 mg, 0.03 mmol) and CuI (4%, 15 mg, 0.02 mmol) were
added, and the flask was evacuated and refilled with argon five
times. The mixture was stirred at 80 °C overnight and then
N-(2-Amino-2-oxoethyl)-5-(3-hydroxyphenyl)thiophene-2-car-
boxamide (17) was prepared according to method A except using
Fmoc-protected glycine (1.3 mmol), 5-bromo-2-thiophenecarboxy-
lic acid (0.975 mmol), and 3-hydroxyphenylboronic acid (1.3
mmol). Preparative HPLC of the final product followed by lyophi-
lization gave a white powder (>95% purity by analytical HPLC).
Yield: 14 mg, 15.6%. 1H NMR (400 MHz, DMSO-d6): δ 3.77 (d,
J = 6 Hz, 2H), 6.75 (dd, J = 2.4 Hz, J = 8.2 Hz, 1H), 7.03 (d, J =
4 Hz, 1H), 7.11 (dd, J=1.6Hz,J=7.8 Hz, 1H), 7.22 (t, J=15.6 Hz,
1H), 7.37 (bs, 1H), 7.43 (d, J=3.6 Hz, 1H), 7.74 (d, J=4 Hz, 1H),
8.7 (t, J = 12 Hz, 1H), 9.64 (bs, 1H). 13C NMR (100 MHz, DMSO-
d6): δ 171.3, 161.7, 158.4, 148.1, 138.7, 134.7, 130.8, 129.9, 124.5,
116.9, 116.1, 112.7, 42.6. ESI-HRMS calculated for C13H12N2O3S
[M þ H]þ: 277.0647. Found: 277.0634.
N-(1-Amino-4-methyl-1-oxopentan-2-yl)-5-(3-hydroxyphenyl)-
thiophene-2-carboxamide (18) was prepared according to method
A except using Fmoc-protected leucine (1.3 mmol), 5-bromo-2-
thiophenecarboxylic acid (0.975 mmol), and 3-hydroxyphenyl-
boronic acid (1.3 mmol). Preparative HPLC of the final product

5546 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15
Christ et al.
followed by lyophilization gave a white powder (>95% purity by
analytical HPLC). Yield: 23 mg, 21.3%. H NMR (400 MHz,
lyophilization gave a white powder (>95% purity by analytical
HPLC). Yield: 4.0 mg, 3.1%. 1H NMR (400 MHz, DMSO-d6): δ
3.12 (dd, J = 4.4 Hz, J=14.6 Hz, 1H), 3.22 (dd, J=10 Hz, J =
14.8 Hz, 1H), 4.68 (ddd, J = 4.4 Hz, J = 7 Hz, J = 10 Hz, 1H),
6.78 (dd, J = 2.4 Hz, J = 8 Hz, 1H), 6.96 (t, J = 13.6 Hz, 1H),
7.01-7.10 (m, 4H), 7.18 (d, J=2.4 Hz, 1H), 7.25 (d, J=7.6 Hz,
1H), 7.28 (dd, J = 0.8 Hz, J=7.4 Hz, 1H), 7.54 (bs, 1H), 7.63 (d,
J=5.1 Hz, 2H), 7.66 (d, J=5.7 Hz, 1H), 7.86 (dd, J=1.6 Hz,
J=5.7 Hz, 2H), 8.40 (d, J=8 Hz, 1H), 9.54 (bs, 1H), 10.73 (s, 1H).
13C NMR (100 MHz, DMSO-d6): δ 174.2, 166.2, 158.3, 143.3,
141.0, 136.5, 133.4, 130.5, 128.5 (2C), 127.8, 126.7 (2C), 124.0,
121.3, 119.0, 118.6, 118.0, 114.0, 111.7, 111.2, 54.8, 28.0. ESI-
HRMS calculated for C24H21N3O3 [M þ H]þ: 400.1661. Found:
400.1682.
N-(1-Amino-1-oxo-3-phenylpropan-2-yl)-6-(thiophen-2-yl)nico-
tinamide (34) was prepared according to method A except using
Fmoc-protected phenylalanine (1.3 mmol), 6-bromopyridine-3-
carboxylic acid (0.975 mmol), and 2-thiopheneboronic acid (1.3
mmol). Preparative HPLC of the final product followed by lyophi-
lization gave a white powder (>95% purity by analytical HPLC).
Yield: 7.5 mg, 6.57%. 1H NMR (400 MHz, DMSO-d6): δ 2.94 (dd,
J=10.8 Hz, J=30 Hz, 1H), 3.12 (dd, J=9.2 Hz, J=30 Hz, 1H),
4.64 (ddd, J = 8.4 Hz, J=9.2 Hz, J = 10.8 Hz, 1H), 7.12 (bs, 1H),
7.13-7.34 (m, 6H), 7.58 (bs, 1H), 7.69 (dd, J=1.2 Hz, J=4.8 Hz,
1H), 7.87 (dd, J = 1.2 Hz, J = 3.6 Hz, 1H), 7.97 (d, J = 8.1 Hz,
1H), 8.13 (dd, J = 2 Hz, J = 8.4 Hz, 1H), 8.71 (d, J = 8.4 Hz, 1H),
8.83 (d, J=0.8 1H). 13C NMR (100 MHz, DMSO-d6): δ 173.6,
164.9, 154.2, 149.1, 144.0, 138.9, 136.6, 130.2, 129.6 (2C), 129.1,
128.5 (2C), 128.1, 127.1, 126.7, 118.4, 55.1, 37.7. ESI-HRMS calcu-
lated for C19H17N3O2S [M þ H]þ: 352.1119. Found: 352.1109.
1
DMSO-d6): δ 0.87 (dd, J = 15.6 Hz, J = 6.4 Hz, 6H), 1.51 (m,
1H), 1.61 (m, 2H), 4.39 (m, 1H), 6.72 (dd, J = 4.8 Hz, J = 8.6 Hz,
1H), 6.97 (bs, 1H), 7.03 (d, J = 2.5 Hz, 1H), 7.11 (dd, J = 2.5 Hz,
J = 8 Hz, 1H), 7.21 (t, J = 9.3 Hz, 1H), 7.42 (bs, 1H), 7.43 (d, J =
4 Hz, 1H), 7.86 (d, J = 4 Hz, 1H), 8.42 (d, J = 8.4 Hz, 1H), 9.62
(bs, 1H). 13C NMR (100 MHz, DMSO-d6): δ 174.6, 161.3, 158.4,
148.1, 138.8, 134.8, 130.8, 130.1, 124.5, 116.9, 116.0, 112.7, 51.9,
41.0, 24.9, 23.5, 21.8. ESI-HRMS calculated for C17H20N2O3S
[M þ H]þ: 333.1273. Found: 333.1253.
N-(1-Amino-1-oxo-3-phenylpropan-2-yl)-5-(3-hydroxyphenyl)-
thiophene-2-carboxamide (19) was prepared according to meth-
od A except using Fmoc-protected phenylalanine (1.3 mmol),
5-bromo-2-thiophenecarboxylic acid (0.975 mmol), and 3-hy-
droxyphenylboronic acid (1.3 mmol). Preparative HPLC of the
final product followed by lyophilization gave a white powder
(>95% purity by analytical HPLC). Yield: 18.33 mg, 15.41%.
1H NMR (400 MHz, DMSO-d6): δ 2.93 (dd, J = 13.8 Hz, J = 30
Hz, 1H), 3.06 (dd, J = 13.8 Hz, J = 30 Hz, 1H), 4.57 (ddd, J =
8.4 Hz, J = 13.8 Hz, J = 13.8 Hz, 1H), 6.72 (dd, J = 4.8 Hz, J =
8 Hz, 1H), 7.01 (d, J = 2 Hz, 1H), 7.07-7.27 (m, 7H), 7.3 (bs,
1H), 7.32 (d, J = 1.6 Hz, 1H), 7.4 (d, J = 4 Hz, 1H), 7.55 (bs,
1H), 7.8 (d, J = 4 Hz, 1H), 8.56 (d, J = 8.4 Hz, 1H), 9.62 (bs,
1H). 13C NMR (100 MHz, DMSO-d6): δ 173.6, 161.2, 158.3,
148.1, 138.9, 138.7, 134.7, 130.7, 130.0, 129.6 (2C), 128.5 (2C),
126.7, 124.5, 116.9, 116.0, 112.7, 55.1, 37.7. ESI-HRMS calcu-
lated for C20H18N2O3S [M þ H]þ: 367.1116. Found: 367.1128.
N-(1-Amino-3-(4-hydroxyphenyl)-1-oxopropan-2-yl)-5-(3-hy-
droxyphenyl)thiophene-2-carboxamide (20) was prepared ac-
cording to method A except using Fmoc-protected tyrosine
(1.3 mmol), 5-bromo-2-thiophenecarboxylic acid (0.975 mmol),
and 3-hydroxyphenylboronic acid (1.3 mmol). Preparative
HPLC of the final product followed by lyophilization gave a
white powder (>95% purity by analytical HPLC). Yield: 29.97
mg, 24.15%. 1H NMR (400 MHz, DMSO-d6): δ 2.81 (dd, J =
13.7 Hz, J = 30 Hz, 1H), 2.97 (dd, J = 14 Hz, J = 30 Hz, 1H),
4.48 (ddd, J = 8.4 Hz, J = 13.7 Hz, J = 14 Hz, 1H), 6.60 (d, J =
8 Hz, 2H), 6.73 (dd, J = 2.4 Hz, J = 8 Hz, 1H), 7.01 (d, J = 4
Hz, 1H), 7.05 (bs, 1H), 7.07-7.10 (m, 3H), 7.2 (t, J = 15.6 Hz,
1H), 7.41 (d, J = 4 Hz, 1H), 7.5 (bs, 1H), 7.8 (d, J = 4 Hz, 1H),
8.49 (d, J = 8.4 Hz, 1H), 9.12 (bs, 1H), 9.63 (bs, 1H). 13C NMR
(100 MHz, DMSO-d6): δ 173.7, 161.2, 158.3, 156.1, 148.1, 139.1,
134.7, 130.7, 130.5 (2C), 130.1, 128.9, 124.5, 116.9, 116.0, 115.3
(2C), 112.7, 55.4, 37.2. ESI-HRMS calculated for C20H18N2O4S
[M þ H]þ: 383.1065. Found: 383.1080.
Acknowledgment. We thank Alun Jones, Manager, Mass
Spectrometry, Institute for Molecular Bioscience, The
Australian Research Council Special Research Centre for
Functional and Applied Genomics, and the Cooperative
Research Centre for Chronic Inflammatory Disease for
equipment access. This work was supported by Australian
National Health and Medical Research Council Project
Grant 455949 and the Australian Research Council.
Supporting Information Available: Additional experimental
procedures and analytical data. This material is available free of
charge via the Internet at http://pubs.acs.org.
References
N-(1-Amino-3-(1H-indol-3-yl)-1-oxopropan-2-yl)-5-(3-hydro-
xyphenyl)thiophene-2-carboxamide (21) was prepared according
to method A except using Fmoc-protected tryptophan (1.3
mmol), 5-bromo-2-thiophenecarboxylic acid (0.975 mmol),
and 3-hydroxyphenylboronic acid (1.3 mmol). Preparative
HPLC of the final product followed by lyophilization gave a
white powder (>95% purity by analytical HPLC). Yield: 10.6
mg, 8.1%. 1H NMR (400 MHz, DMSO-d6): δ 3.06 (dd, J = 10
Hz, J = 14.5 Hz, 1H), 3.18 (dd, J = 4 Hz, J = 14.5 Hz, 1H), 4.62
(ddd, J = 4 Hz, J = 10 Hz, J = 12.8 Hz, 1H), 6.72 (dd, J = 2.2
Hz, J = 8.4 Hz, 1H), 6.95 (t, J = 15.2 Hz, 1H), 7.02 -7.09 (m,
4H), 7.16 (d, J = 2.4 Hz, 1H), 7.19 (t, J = 15.6 Hz, 1H), 7.28 (dd,
J = 2 Hz, J = 8.2 Hz, 1H), 7.4 (d, J = 4 Hz, 1H), 7.56 (bs, 1H),
7.67 (d, J = 8 Hz, 1H), 7.8 (d, J = 3.6 Hz, 1H), 8.49 (d, J = 8.4
Hz, 1H), 9.62 (bs, 1H), 10.74 (d, J = 2 Hz, 1H). 13C NMR (100
MHz, DMSO-d6): δ 174.0, 161.2, 158.3, 148.0, 138.5, 138.1,
136.5, 134.9, 131.1, 130.0, 127.9, 124.4, 123.9, 121.8, 119.0,
117.3, 116.1, 113.1, 112.0, 111.3, 55.3, 28.1. ESI-HRMS calcu-
lated for C22H19N3O3S [M þ H]þ: 406.1225. Found: 406.1239.
N-(1-Amino-3-(1H-indol-3-yl)-1-oxopropan-2-yl)-30-hydroxy-
biphenyl-4-carboxamide (24) was prepared according to method
A except using Fmoc-protected tryptophan (1.3 mmol), 4-bromo-
benzoic acid (0.975 mmol), and 3-hydroxyphenylboronic acid
(1.3 mmol). Preparative HPLC of the final product followed by
(1) Simmons, D. L.; Botting, R. M.; Hla, T. Cyclooxygenase isozymes:
the biology of prostaglandin synthesis and inhibition. Pharmacol.
Rev. 2004, 56, 387–437.
(2) Helliwell, R. J.; Adams, L. F.; Mitchell, M. D. Prostaglandin
synthases: recent developments and a novel hypothesis. Prosta-
glandins, Leukotrienes Essent. Fatty Acids 2004, 70, 101–113.
(3) Sugimoto, Y.; Narumiya, S. Prostaglandin E receptors. J. Biol.
Chem. 2007, 282, 11613–11617.
(4) Pettipher, R.; Hansel, T. T. Antagonists of the prostaglandin D2
receptor CRTH2. Drug News Perspect. 2008, 21, 317–322.
(5) FitzGerald, G. A. COX-2 in play at the AHA and the FDA. Trends
Pharmacol. Sci. 2007, 28, 303–307.
(6) Francois, H.; Athirakul, K.; Howell, D.; Dash, R.; Mao, L.; Kim,
H. S.; Rockman, H. A.; Fitzgerald, G. A.; Koller, B. H.; Coffman,
T. M. Prostacyclin protects against elevated blood pressure and
cardiac fibrosis. Cell Metab. 2005, 2, 201–207.
(7) Arimura, A.; Yasui, K.; Kishino, J.; Asanuma, F.; Hasegawa, H.;
Kakudo, S.; Ohtani, M.; Arita, H. Prevention of allergic inflam-
mation by a novel prostaglandin receptor antagonist, S-5751.
J. Pharmacol. Exp. Ther. 2001, 298, 411–419.
(8) Matsuoka, T.; Hirata, M.; Tanaka, H.; Takahashi, Y.; Murata, T.;
Kabashima, K.; Sugimoto, Y.; Kobayashi, T.; Ushikubi, F.; Aze,
Y.; Eguchi, N.; Urade, Y.; Yoshida, N.; Kimura, K.; Mizoguchi,
A.; Honda, Y.; Nagai, H.; Narumiya, S. Prostaglandin D2 as a
mediator of allergic asthma. Science 2000, 287, 2013–2017.
(9) Fujitani, Y.; Kanaoka, Y.; Aritake, K.; Uodome, N.; Okazaki-
Hatake, K.; Urade, Y. Pronounced eosinophilic lung inflammation

Article
and Th2 cytokine release in human lipocalin-type prostaglandin D
synthase transgenic mice. J. Immunol. 2002, 168, 443–449.
(10) Mohri, I.; Taniike, M.; Taniguchi, H.; Kanekiyo, T.; Aritake, K.;
Inui, T.; Fukumoto, N.; Eguchi, N.; Kushi, A.; Sasai, H.; Kanaoka,
Y.; Ozono, K.; Narumiya, S.; Suzuki, K.; Urade, Y. Prosta-
glandin D2-mediated microglia/astrocyte interaction enhances
astrogliosis and demyelination in twitcher. J. Neurosci. 2006, 26,
4383–4393.
(11) Trivedi, S. G.; Newson, J.; Rajakariar, R.; Jacques, T. S.; Hannon,
R.; Kanaoka, Y.; Eguchi, N.; Colville-Nash, P.; Gilroy, D. W.
Essential role for hematopoietic prostaglandin D2 synthase in the
controlofdelayedtypehypersensitivity. Proc. Natl. Acad. Sci. U.S.A.
2006, 103, 5179–5184.
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15 5547
lipocalin-type prostaglandin D synthase and prostaglandin D2 in
macrophages. Am. J. Physiol.: Lung Cell. Mol. Physiol. 2009, 296,
L771–L779.
(29) Joo, M.; Kwon, M.; Sadikot, R. T.; Kingsley, P. J.; Marnett, L. J.;
Blackwell, T. S.; Peebles, R. S., Jr.; Urade, Y.; Christman, J. W.
Induction and function of lipocalin prostaglandin D synthase in
host immunity. J. Immunol. 2007, 179, 2565–2575.
(30) Funk, C. D. Prostaglandins and leukotrienes: advances in eicosa-
noid biology. Science 2001, 294, 1871–1875.
(31) Lewis, R. A.; Soter, N. A.; Diamond, P. T.; Austen, K. F.; Oates,
J. A.; Roberts, L. J., 2nd. Prostaglandin D2 generation after
activation of rat and human mast cells with anti-IgE. J. Immunol.
1982, 129, 1627–1631.
(12) Kanaoka, Y.; Urade, Y. Hematopoietic prostaglandin D synthase.
Prostaglandins, Leukotrienes Essent. Fatty Acids 2003, 69,
163–167.
(13) Urade, Y.; Hayaishi, O. Biochemical, structural, genetic, physio-
logical, and pathophysiological features of lipocalin-type
prostaglandin D synthase. Biochim. Biophys. Acta 2000,
1482, 259–271.
(14) Ji, X.; von Rosenvinge, E. C.; Johnson, W. W.; Tomarev, S. I.;
Piatigorsky, J.; Armstrong, R. N.; Gilliland, G. L. Three-dimen-
sional structure, catalytic properties, and evolution of a sigma class
glutathione transferase from squid, a progenitor of the lens S-
crystallins of cephalopods. Biochemistry 1995, 34, 5317–5328.
(15) Thomson, A. M.; Meyer, D. J.; Hayes, J. D. Sequence, catalytic
properties and expression of chicken glutathione-dependent pros-
taglandin D2 synthase, a novel class sigma glutathione S-transfer-
ase. Biochem. J. 1998, 333, 317–325.
(16) Tomarev, S. I.; Zinovieva, R. D.; Guo, K.; Piatigorsky, J. Squid
glutathione S-transferase. Relationships with other glutathione S-
transferases and S-crystallins of cephalopods. J. Biol. Chem. 1993,
268, 4534–4542.
(17) Sommer, A.; Rickert, R.; Fischer, P.; Steinhart, H.; Walter, R. D.;
Liebau, E. A dominant role for extracellular glutathione S-trans-
ferase from Onchocerca volvulus is the production of prostaglandin
D2. Infect. Immun. 2003, 71, 3603–3606.
(18) Jowsey, I. R.; Thomson, A. M.; Flanagan, J. U.; Murdock, P. R.;
Moore, G. B.; Meyer, D. J.; Murphy, G. J.; Smith, S. A.; Hayes,
J. D. Mammalian class sigma glutathione S-transferases: catalytic
properties and tissue-specific expression of human and rat GSH-
dependent prostaglandin D2 synthases. Biochem. J. 2001, 359, 507–
516.
(19) Hayes, J. D.; Flanagan, J. U.; Jowsey, I. R. Glutathione trans-
ferases. Annu. Rev. Pharmacol. Toxicol. 2005, 45, 51–88.
(20) Oakley, A. J. Glutathione transferases: new functions. Curr. Opin.
Struct. Biol. 2005, 15, 716–723.
(21) Kanaoka, Y.; Ago, H.; Inagaki, E.; Nanayama, T.; Miyano, M.;
Kikuno, R.; Fujii, Y.; Eguchi, N.; Toh, H.; Urade, Y.; Hayaishi, O.
Cloning and crystal structure of hematopoietic prostaglandin D
synthase. Cell 1997, 90, 1085–1095.
(32) Murray, J. J.; Tonnel, A. B.; Brash, A. R.; Roberts, L. J., 2nd;
Gosset, P.; Workman, R.; Capron, A.; Oates, J. A. Release of
prostaglandin D2 into human airways during acute antigen chal-
lenge. N. Engl. J. Med. 1986, 315, 800–804.
(33) Naclerio, R. M.; Meier, H. L.; Kagey-Sobotka, A.; Adkinson,
N. F., Jr.; Meyers, D. A.; Norman, P. S.; Lichtenstein, L. M.
Mediator release after nasal airway challenge with allergen. Am.
Rev. Respir. Dis. 1983, 128, 597–602.
(34) Bochner, B. S.; Charlesworth, E. N.; Lichtenstein, L. M.; Derse,
C. P.; Gillis, S.; Dinarello, C. A.; Schleimer, R. P. Interleukin-1 is
released at sites of human cutaneous allergic reactions. J. Allergy
Clin. Immunol. 1990, 86, 830–839.
(35) Charlesworth, E. N.; Kagey-Sobotka, A.;Schleimer, R. P.; Norman,
P. S.; Lichtenstein, L. M. Prednisone inhibits the appearance of
inflammatory mediators and the influx of eosinophils and basophils
associated with the cutaneous late-phase response to allergen.
J. Immunol. 1991, 146, 671–676.
(36) Proud, D.; Sweet, J.; Stein, P.; Settipane, R. A.; Kagey-Sobotka,
A.; Friedlaender, M. H.; Lichtenstein, L. M. Inflammatory medi-
ator release on conjunctival provocation of allergic subjects with
allergen. J. Allergy Clin. Immunol. 1990, 85, 896–905.
(37) Honda, K.; Arima, M.; Cheng, G.; Taki, S.; Hirata, H.; Eda,
F.; Fukushima, F.; Yamaguchi, B.; Hatano, M.; Tokuhisa, T.;
Fukuda, T. Prostaglandin D2 reinforces Th2 type inflammatory
responses of airways to low-dose antigen through bronchial
expression of macrophage-derived chemokine. J. Exp. Med.
2003, 198, 533–543.
(38) Aikawa, T.; Shimura, S.; Sasaki, H.; Ebina, M.; Takishima, T.
Marked goblet cell hyperplasia with mucus accumulation in the
airways of patients who died of severe acute asthma attack. Chest
1992, 101, 916–921.
(39) Inoue, T.; Irikura, D.; Okazaki, N.; Kinugasa, S.; Matsumura, H.;
Uodome, N.; Yamamoto, M.; Kumasaka, T.; Miyano, M.; Kai,
Y.; Urade, Y. Mechanism of metal activation of human hemato-
poietic prostaglandin D synthase. Nat. Struct. Biol. 2003, 10,
291–296.
(40) Shimamoto, S.; Yoshida, T.; Inui, T.; Gohda, K.; Kobayashi, Y.;
Fujimori, K.; Tsurumura, T.; Aritake, K.; Urade, Y.; Ohkubo, T.
NMR solution structure of lipocalin-type prostaglandin D
synthase: evidence for partial overlapping of catalytic pocket and
retinoic acid-binding pocket within the central cavity. J. Biol.
Chem. 2007, 282, 31373–31379.
(22) Pinzar, E.; Miyano, M.; Kanaoka, Y.; Urade, Y.; Hayaishi, O.
Structural basis of hematopoietic prostaglandin D synthase acti-
vity elucidated by site-directed mutagenesis. J. Biol. Chem. 2000,
275, 31239–31244.
(23) Aritake, K.; Kado, Y.; Inoue, T.; Miyano, M.; Urade, Y. Structur-
al and functional characterization of HQL-79, an orally selective
inhibitor of human hematopoietic prostaglandin D synthase.
J. Biol. Chem. 2006, 281, 15277–15286.
(41) Urade, Y.; Ujihara, M.; Horiguchi, Y.; Igarashi, M.; Nagata, A.;
Ikai, K.; Hayaishi, O. Mast cells contain spleen-type prostaglandin
D synthetase. J. Biol. Chem. 1990, 265, 371–375.
(42) Mohri, I.; Aritake, K.; Taniguchi, H.; Sato, Y.; Kamauchi, S.;
Nagata, N.; Maruyama, T.; Taniike, M.; Urade, Y. Inhibition of
prostaglandin D synthase suppresses muscular necrosis. Am. J.
Pathol. 2009, 174, 1735–1744.
(43) Terada, N.; Yamakoshi, T.; Hasegawa, M.; Tanikawa, H.; Maesako,
K.; Ishikawa, K.; Konno, A. The effect of ramatroban (BAY u 3405),
a thromboxane A2 receptor antagonist, on nasal cavity volume and
minimum cross-sectional area and nasal mucosal hemodynamics after
nasal mucosal allergen challenge in patients with perennial allergic
rhinitis. Acta Otolaryngol. Suppl. 1998, 537, 32–37.
(44) Ikai, K.; Ujihara, M.; Fujii, K.; Urade, Y. Inhibitory effect of
tranilast on prostaglandin D synthetase. Biochem. Pharmacol.
1989, 38, 2673–2676.
(24) Matsushita, N.; Aritake, K.; Takada, A.; Hizue, M.; Hayashi, K.;
Mitsui, K.; Hayashi, M.; Hirotsu, I.; Kimura, Y.; Tani, T.;
Nakajima, H. Pharmacological studies on the novel antiallergic
drug HQL-79: II. Elucidation of mechanisms for antiallergic and
antiasthmatic effects. Jpn. J. Pharmacol. 1998, 78, 11–22.
(25) Matsushita, N.; Hizue, M.; Aritake, K.; Hayashi, K.; Takada, A.;
Mitsui, K.; Hayashi, M.; Hirotsu, I.; Kimura, Y.; Tani, T.;
Nakajima, H. Pharmacological studies on the novel antiallergic
drug HQL-79: I. Antiallergic and antiasthmatic effects in various
experimental models. Jpn. J. Pharmacol. 1998, 78, 1–10.
(26) Hohwy, M.; Spadola, L.; Lundquist, B.; Hawtin, P.; Dahmen, J.;
Groth-Clausen, I.; Nilsson, E.; Persdotter, S.; von Wachenfeldt,
K.; Folmer, R. H.; Edman, K. Novel prostaglandin D synthase
inhibitors generated by fragment-based drug design. J. Med. Chem.
2008, 51, 2178–2186.
(45) Horton, D. A.; Bourne, G. T.; Smythe, M. L. The combinatorial
synthesis of bicyclic privileged structures or privileged substruc-
tures. Chem. Rev. 2003, 103, 893–930.
(27) Weber, J. E.; Oakley, A. J.; Christ, A. N.; Clark, A. G.; Hayes,
J. D.; Hall, R.; Hume, D. A.; Board, P. G.; Smythe, M. L.;
Flanagan, J. U. Identification and characterisation of new inhibi-
tors for the human hematopoietic prostaglandin D2 synthase. Eur.
J. Med. Chem. 2010, 45, 447–454.
(28) Joo, M.; Kwon, M.; Cho, Y. J.; Hu, N.; Pedchenko, T. V.; Sadikot,
R. T.; Blackwell, T. S.; Christman, J. W. Lipopolysaccharide-depen-
dent interaction between PU.1 and c-Jun determines production of
(46) Horton, D. A.; Severinsen, R.; Kofod-Hansen, M.; Bourne, G. T.;
Smythe, M. L. A versatile synthetic approach to peptidyl privileged
structures using a “safety-catch” linker. J. Comb. Chem. 2005, 7,
421–435.
(47) Severinsen, R.; Bourne, G. T.; Tran, T. T.; Ankersen, M.; Begtrup,
M.; Smythe, M. L. Library of biphenyl privileged substructures
using a safety-catch linker approach. J. Comb. Chem. 2008, 10,
557–566.

5548 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 15
Christ et al.
(48) Funk, C. D.; Fitzgerald, G. A. COX-2 inhibitors and cardiovas-
cular risk. J. Cardiovasc. Pharmacol. 2007, 50, 470–479.
(49) Bradford, M. M. A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of pro-
tein-dye binding. Anal. Biochem. 1976, 72, 248–254.
Sweet, M. J. Colony-stimulating factor-1 (CSF-1) delivers a
proatherogenic signal to human macrophages. J. Leukocyte Biol.
2009, 85, 278–288.
(51) Irvine, K. M.; Burns, C. J.; Wilks, A. F.; Su, S.; Hume, D. A.; Sweet,
M. J. A CSF-1 receptor kinase inhibitor targets effector functions and
inhibits pro-inflammatory cytokine production from murine macro-
phage populations. FASEB J. 2006, 20, 1921–1923.
(50) Irvine, K. M.; Andrews, M. R.; Fernandez-Rojo, M. A.; Schroder,
K.; Burns, C. J.; Su, S.; Wilks, A. F.; Parton, R. G.; Hume, D. A.;