A caffeic acid-ferulic acid hybrid compound attenuates lipopolysaccharide-mediated inflammation in BV2 and RAW264.7 cells

Article abstract of DOI:10.1016/j.bbrc.2019.06.005

In the present study, we synthesized and evaluated the anti-inflammatory effects of the two component hybrids, caffeic acid (CA)-ferulic acid (FA), FA-Tryptamine (Trm), CA-Piperonyl Triazol (PT) and FA-PT. Of these five hybrids, CA-FA had the most potent

Full text of DOI:10.1016/j.bbrc.2019.06.005

Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications
journal homepage: www.elsevier.com/locate/ybbrc
A caffeic acid-ferulic acid hybrid compound attenuates
lipopolysaccharide-mediated inflammation in BV2 and
RAW264.7 cells
Mi-Youn Kwon a, Sang-Min Kim a, Jiwon Park a, JuWon Lee a, Hyeongjin Cho b,
,
, *
Haneul Lee c, Cheolmin Jeon c, Jeong-Ho Park c **, Inn-Oc Han a
a Department of Physiology and Biophysics, College of Medicine, Inha University, Incheon, South Korea
b Department of Chemistry, Inha University, Incheon, South Korea
c Department of Chemical & Biological Engineering, Hanbat National University, Daejeon, South Korea
a r t i c l e i n f o
a b s t r a c t
Article history:
In the present study, we synthesized and evaluated the anti-inflammatory effects of the two component
hybrids, caffeic acid (CA)-ferulic acid (FA), FA-Tryptamine (Trm), CA-Piperonyl Triazol (PT) and FA-PT. Of
these five hybrids, CA-FA had the most potent inhibitory effect on butyrylcholinesterase (BuChE) activity.
The CA containing hybrids, CA-FA, CA-Trm, and CA-PT, dose-dependently inhibited LPS-induced nitric
oxide (NO) generation in BV2 cells, whereas FA-PT, FA-Trm, CA, FA, Trm, and PT did not. Although CA-FA,
CA-Trm and CA-PT had similar inhibitory effects on LPS-induced NO generation, CA-FA best protected
BV2 cells from LPS-induced cell death. CA-FA, but not CA or FA, dose-dependently inhibited LPS-induced
up-regulations of NO synthase (iNOS) and cyclooxygenase-2 (COX-2) protein expressions in BV2 and
RAW264.7 cells. Furthermore, CA-FA inhibited LPS-induced iNOS, COX-2, interleukin-6, and interleukin-
Received 19 May 2019
Accepted 1 June 2019
Available online xxx
Keywords:
Phenolic acid
INOS
Lipopolysaccharide
1
b
mRNA expressions in BV2 cells. CA-FA also inhibited the LPS-induced phosphorylations of STAT3, Akt,
and I B and selectively inhibited LPS-induced NF- B activation. Overall, our data suggest that CA-FA has
BuChE inhibitory effects and down-regulates inflammatory responses by inhibiting NF- B, which in-
k
k
k
dicates CA-FA be viewed as a potential therapeutic agent for the treatment of inflammatory diseases of
the peripheral system and central nervous systems.
© 2019 Published by Elsevier Inc.
1. Introduction
phenolic acids. CA has been extensively investigated in various
physiological and pathological processes. For example, it has been
Polyphenols are universally distributed in foods (fruit, vegeta-
bles, and beverages) and in plants [1], and phenolic acids are one of
the most abundant polyphenols in food and beverages. Phenolic
acids are easily absorbed in the intestine, circulate in human
plasma as conjugated forms (mainly as glucuronate and sulfate
derivatives), and are well metabolized in man [2e5]. Notably, di-
etary phenolic acids have many therapeutic properties including
antioxidant activity [6]. Caffeic acid (3,4-dihydroxycinnamic acid,
CA) and ferulic acid (hydroxycinnamic acid, FA) are representative
members of the naturally occurring hydroxycinnamic acid class of
shown to suppress bacterial lipopolysaccharide (LPS)-induced
inflammation in primary bovine mammary epithelial cells and
macrophage cells [7,8]. FA also has various biological effects, which
include anti-oxidation and anti-inflammatory effects [9], and has
been proposed as a potential therapeutic for free radical-induced
diseases such as diabetes, cancers, Alzheimer's disease, and car-
diovascular diseases [9e12]. Recent research interest in the thera-
peutic applications of polyphenols has resulted in a search for
combinations of agents that are more effective and less toxic than
their constituent parts at therapeutic doses.
Hybrid drugs, that is, drugs produced by covalently linking
known existing pharmacophores, are being investigated with a
view toward improving treatment efficiencies, though hybridiza-
tion achieved using a metabolically stable linker might be expected
to result in pharmacologically distinct entities rather than drugs
displaying a combination of the pharmacologic properties of their
* Corresponding author. Department of Physiology and Biophysics, College of
Medicine, Inha University, 100 Inha Ro, Nam-Gu, Incheon, 22212, South Korea.
** Corresponding author.
E-mail address: iohan@inha.ac.kr (I.-O. Han).
https://doi.org/10.1016/j.bbrc.2019.06.005
0006-291X/© 2019 Published by Elsevier Inc.
Please cite this article as: M.-Y. Kwon et al., A caffeic acid-ferulic acid hybrid compound attenuates lipopolysaccharide-mediated inflammation
in BV2 and RAW264.7 cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.06.005

2
M.-Y. Kwon et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
constituent parts [13]. Hybridization can synergize, amplify,
modify, or abrogate the effects of individual components [14]. We
previously reported that a hybrid composed of covalently linked
acetyl-protected CA and piperonyl piperazine (PP) inhibited LPS-
were then dissolved in a DMSO:EtOH (1:1 vol/vol) solution, and
absorbances at 595 nm were read using a microplate reader. Results
are expressed as percentages of untreated controls.
induced inflammation by inhibiting NF-kB in RAW264.7 cells at
2.6. Nitrite measurement
concentrations substantially lower than those required for inhibi-
tion by CA or PP [15]. In the present study, our intension was to
design anti-inflammatory CA containing hybrids. We found a CA-FA
hybrid exhibited stronger anti-inflammatory effects than those
expected based on the effects of CA or FA alone in the BV2 micro-
glial and RAW264.7 macrophage cell-lines.
Nitrite level, an index of NO production, was measured in
cultured cell supernatants using the Griess method [15]. In brief,
cells were stimulated with LPS (100 ng/ml) and/or control or hybrid
compounds. Nitrite accumulations in culture media were measured
by adding equal volumes of Griess reagent (1% sulphanilamide, 0.1%
naphthylenediamine 5% phosphoric acid) and culture medium.
Optical densities were measured at 550 nm (OD 550) using a
microplate reader. A standard curve was generated using a con-
2. Materials and methods
2.1. Reagents
centration ladder of sodium nitrite (10e100 mM) in culture
medium.
Except where otherwise noted, all reagents were purchased
from Sigma-Aldrich (St. Louis, MO).
2.7. RT-PCR and quantitative real-time PCR
2.2. Synthesis of hybrid compounds
Total RNA from BV2 cells was extracted with TRIzol™ (Invi-
trogen, Carlsbad, CA) and reverse-transcribed into cDNA using Su-
perScript II. PCR was performed using specific mouse primers as
described below. Gene expressions values were expressed with
respect to the housekeeping gene GAPDH. PCR was conducted in
CA-FA: Acetylated caffeic acid (ACA) and linker 2-(2-
aminoethoxy) ethanol were coupled with 1-Ethyl-3-(3-
dimethylaminopropyl)carbodiimide
(EDC)
and
N-Hydrox-
ysuccinimide (NHS) to obtain linker-acetyl CA. Activated AcFA
treated with SOCl2 was coupled with linker-acetyl CA in the pres-
ence of DMAP to give rise to CA-FA.
15
m
l of reaction mixture containing 1.5 mM magnesium chloride
(MgCl2), 250
mM deoxy-nucleoside triphosphate, 1.25 units Taq
DNA polymerase, 10 pmol of primer, and 25 ng of DNA templates.
PCR products were electrophoresed in 1% agarose gel in Tris/Borate/
EDTA (TBE) buffer. Gels were observed and photographed under UV
light. mRNA expressions were quantified by measuring the incor-
poration of fluorescent SYBR green into double-stranded DNA
(iCycleriQ, Bio-Rad). Relative mRNA levels were calculated from
sample PCR profiles using the threshold cycle (Ct) method. To
correct for total cDNA differences, Ct values of endogenous controls
(input DNA) were subtracted from those of samples.
CA-Trm: ACA and propargyl amine were coupled with EDC and
4-Dimethylaminopyridine (DMAP) to obtain propargylated ACA.
Tryptamine (Trm) azide was synthesized by converting the amine
group of Trm to an azide group. The two intermediates, AC alkyne
and Trm azide, were coupled using a click-reaction using a copper
catalyst to synthesize a CA-Trm using triazole as a linker.
FA-Trm: Acetylated ferulic acid (FA) and propargyl amine were
coupled with EDC and DMAP to obtain propargylated acetyl FA. The
two intermediates, FA alkyne and Trm azide, were coupled by a
click-reaction using a copper catalyst to synthesize a FA-Trm using a
triazole as a linker.
PCR primers used in this study.
CA-PT: Piperonyl azide was obtained by reacting piperonyl
bromide with NaN3, which was followed by a click reaction with
propargylated ACA to obtain CA-PT.
FA-PT: Propargylated acetyl ferulic acid (FA) and piperonyl azide
were coupled by a click-reaction using a copper catalyst to syn-
thesize FA-PT using triazole as a linker.
Forward Primer
Reverse Primer
iNOS
COX-2
ACTTCCGAGTGTGGAACTCG
GCTGTACAAGCAGTGGCAAA
GGAGAAGCTGT GGCAGCTA
CCGGAGAGGAGACTTCACAG
GACCCTCACACTCAGATCAT
TCATTGACCTCAACTACATGGT
TGGCTACTTCCTCCAGGATG
GTCTGGAGTGGGAGGCACT
GCTGATGTACCAGTTGGGGA
TGGTCTTGGTCCTTAGCCAC
TTGAAGAGAACCTGGGAGTA
CTAAG CAGTTGGTGGTGCAG
IL-1
IL-6
b
TNF-
a
GAPDH
2.3. Cholinesterase assay
2.8. Immunoblotting
The acetylcholinesterase (AChE) and butyrylcholinesterase
(BuChE) inhibitory activities of hybrid compounds were deter-
mined using the Ellman method as previously described [16].
Total cell protein was prepared by lysing cells in buffer
(10 mM Tris, 140 mM NaCl, 1% Triton, 0.5% SDS and protease in-
hibitors, pH 8.0). Prepared protein samples (20e40 mg) were
2.4. Cell cultures
separated by SDS-PAGE and transferred to HybondTM-ECL™
nitrocellulose membranes (Amersham Biosciences, Piscataway,
NJ). Antibodies used were from Santa Cruz Biotechnology (Santa
Cruz, CA), except antibodies against iNOS (BD Biosciences, San
Jose, CA), COX-2 (Cayman Chemicals, Ann Arbor, Mi), glyceral-
dehyde 3-phosphate dehydrogenase (GAPDH) (Cell Signaling
Technology, Danvers, MA), ERK1/2 (Cell Signaling Technology), p-
JNK (Invitrogen), JNK (Cell Signaling Technology), p-P38 (Cell
Signaling Technology). Membranes were incubated with anti-
bodies overnight at 4 ꢀC. After washing with TBST (50 mM Tris,
150 mM NaCl, and 0.05% Tween 20, pH 7.6), membranes were
incubated in a buffer containing HRP-conjugated secondary an-
tibodies (1:10,000 dilution in TBST) for 1 h at room temperature.
Murine BV2 microglial cells have been used as a model for
in vitro studies of activated microglia cells. BV2 and RAW264.7 cells
were maintained at 37 ꢀC in Dulbecco's modified Eagle's medium
(DMEM) supplemented with 10% FBS (Hyclone, Logan, Utah),
streptomycin and penicillin in a 5% CO2 atmosphere.
2.5. Cell viability
Cell viabilities were measured using an MTT assay, as described
previously [15]. In brief, cells were prepared into the wells of 24-
well plates. MTT solution (50
ml) was added, and cells were incu-
bated in the dark for 4 h at 37 ꢀC. The formazan crystals produced
Please cite this article as: M.-Y. Kwon et al., A caffeic acid-ferulic acid hybrid compound attenuates lipopolysaccharide-mediated inflammation
in BV2 and RAW264.7 cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.06.005

M.-Y. Kwon et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Protein bands were detected using an ECL detection reagent
(Amersham Biosciences).
2.10. Transfection and the NF-kB reporter gene assay
NF-kB reporter (Clontech, Mountain View, CA) contained three
copies of the
k
B-binding sequence fused to the firefly luciferase
2.9. Streptavidin-agarose pull-down assay
gene. Briefly, RAW 264.7 cells in 12-well plates (5 x 105/well) were
transfected with Lipofectamine Plus. Luciferase activity was
assayed 24 h after transfection. Transfection efficiencies were
Biotin pull-down assays were performed as described previ-
ously, with minor modifications [17]. The procedure allows for
quantitative binding of transactivators or molecules of interest to a
specific probe, that is, a 20-nucleotide sequence containing the
normalized by cotransfected b-galactosidase plasmid. Biolumines-
cence was measured using a luminometer (TD-20/20).
NF-kB
binding
site
(50-GCTAGGGGGATTTTCCCTCT-30)
at
position ꢁ957/-977 of iNOS promoter. Two complementary DNAs
were synthesized and biotinylated by Bioneer Corporation (Korea)
and annealed to generate a double-stranded probe. Binding assays
2.11. Electrophoretic mobility shift assay (EMSA
Nuclear protein extracts were prepared as described previously
[15] A double-stranded DNA oligonucleotide probe containing the
were performed by incubating 500
mg of nuclear protein extracts
with 2 g of biotinylated DNA probe and 25
m
ml of streptavidin-
consensus NF-kB binding site (Promega, Madison, WI) was labeled
conjugated agarose beads for 1 h. DNA-protein complexes were
analyzed by Western blotting using the indicated antibodies.
by polynucleotide kinase (New England Biolabs, Beverly, MA) and
purified using Sephadex G-25 spin columns. Aliquots of nuclear
Fig. 1. The chemical structures and BuChE activities of CA-Trm, FA-Trm, CA-PT, FA-PT, and CA-FA. The structures of CA-PP (A), CA, FA, PT, and Trm (B) are shown. Hybrid compounds,
CA-Trm, FA-Trm, CA-PT and CA-FA were synthesized from CA, FA, PT or Trm as described in Materials and Methods (C). The AChE and BuChE inhibitory activities of hybrids were
measured (D).
Please cite this article as: M.-Y. Kwon et al., A caffeic acid-ferulic acid hybrid compound attenuates lipopolysaccharide-mediated inflammation
in BV2 and RAW264.7 cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.06.005

4
M.-Y. Kwon et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
proteins (20
m
g) were incubated with labeled oligonucleotides in
1-piperonylpiperazine (PP) (CA-PP) hybrid displays anti-
inflammatory effects in RAW264.7 macrophage cells (Fig. 1A)
[15]. We generated derivatives of CA-PP using different combina-
tions of CA and ferulic acid (FA), tryptamine (Trm), or piperonyl
triazole (PT) (Fig. 1B). CA-PT was produced by changing the piper-
azine of the linker in CA-PP to triazole (linker modification); FA-PT
was produced by converting CA to FA in CA-PT (the moiety I
modification of CA-PT in Fig. 1A); CA-Trm was synthesized by
converting the piperonyl structure in CA-PT to Trm (moiety II
modification of CA-PP); FA-Trm was generated by replacing CA to
FA in CA-Trm (moiety I modification of CA-PP); and CA-FA was
produced by linking CA and FA using 2- (2-aminoethoxy) ethanol as
a linker (Fig. 1C).
Since many phenolic compounds and their derivatives have
cholinesterase inhibitory effects [18], we measured AChE and
BuChE activities of hybrid compounds and compared these
with those of galantamin (a well-described cholinesterase in-
hibitor) [19] (Fig. 1D). FA-containing hybrid molecules, that is,
CA-FA, FA-Trm, and FA-PT all demonstrated BuChE inhibition
binding buffer (50 mM KCl, 12.5 mM HEPES pH 7.6, 6.25 mM MgCl2,
0.05 mM EDTA, 0.5% Nonidet P-40, 0.5 mM DTT, 5% glycerol and
2 mg poly-[dI-dC]) for 30 min on ice. Samples were then electro-
phoresed on 4.5% polyacrylamide gel containing 2% glycerol at
200 V for 1.5 h at room temperature. Gels were then dried and
exposed to x-ray film (Kodak, Rochester, NY) using an intensifying
screen at ꢁ80 ꢀC.
2.12. Statistical analysis
The analysis was conducted using the unpaired Student's t-test.
Results are presented as the means SDs of three separate experi-
ments. Statistical significance was accepted for p values < 0.05.
3. Results
3.1. Acetylcholinesterase (AChE) and butyrylcholinesterase (buChE)
activities of CA-FA, CA-Trm, CA-PT, FA-PT, and FA-Trm
but CA-FA was the most effective (IC50 ¼ 10.4 þ 0.9
mM for
BuChE).
We previously showed that the caffeic acid (CA) and
Fig. 2. LPS-induced nitrite production and cytotoxicities of CA-Trm, FA-Trm, CA-PT, FA-PT, and CA-FA and of their component compounds in BV2 cells. BV2 cells were pre-treated
with the indicated concentrations of CA, FA, PT, Trm, CA-Trm, FA-Trm, CA-PT, or CA-FA for 2 h and then stimulated with 0.1 g/ml LPS. Nitrite levels in the culture medium were
m
measured after 24 h of LPS treatment (A). Cell viabilities were determined using MTT assays, and results are expressed as percentages versus untreated controls (B). *represents
significantly different from the untreated control. **represents significantly different from LPS-treated BV2 cells.
Please cite this article as: M.-Y. Kwon et al., A caffeic acid-ferulic acid hybrid compound attenuates lipopolysaccharide-mediated inflammation
in BV2 and RAW264.7 cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.06.005

M.-Y. Kwon et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
3.2. The effects of CA, FA, Trm, PT and their hybrids on LPS-induced
NO generation and cytotoxicity in BV2 cells
in BV2 cells, whereas in RAW 264.7 cells, CA-FA inhibited LPS-
induced iNOS expression but not COX-2 expression (Fig. 3A). At
the same concentrations, CA and FA failed to inhibit the LPS-
induced up-regulations of iNOS and COX-2 in BV2 and
RAW264.7 cells.
Morphological examinations conducted under an optical mi-
croscope indicated that LPS induced BV2 cell death in 24 h. CA-FA
pretreatment at 30 mM significantly protected against LPS-
We compared the effects of hybrid compounds on LPS-
induced nitrite production in BV2 cells. Cells were treated
with the indicated concentrations of hybrids or control com-
pounds, that is, CA, FA, Trm, or PT, for 2 h prior to LPS (100 ng/
ml) stimulation for 24 h. LPS-induced nitrite production was
dose-dependently suppressed by CA containing hybrids (CA-FA,
CA-Trm, and CA-PT) but not by CA, FA, Trm, PT, FA-PT or FA-Trm
induced cell death (Fig. 3B), but CA or FA failed to do so. Further-
more, LPS increased the mRNA expressions of iNOS, COX-2, IL-6, IL-
(Fig. 2A). CA-FA, CA-Trm, and CA-PT at 40
LPS-induced NO production in RAW264.7 cells (data not
shown).
m
M also suppressed
1
b
, and TNF-
inhibited the LPS-induced expressions of iNOS, COX-2, IL-6, and IL-
at 6 and 24 h (Fig. 3C and D).
a in 6 and 24 h in BV2 cells and CA-FA, but not CA or FA,
1b
The cytoprotective effects of hybrids in the presence of LPS were
examined in BV2 cells. Treatments with hybrids or control com-
pounds did not significantly affect cell viability or proliferation at
the all concentrations tested, excepting FA-PT and FA-Trm, which
increased cell proliferation (Fig. 2B). LPS caused cell death after
activation and CA-FA strongly and dose-dependently suppressed
LPS-induced BV2 cell death (Fig. 2B). CA-Trm and CA-PP minimally
suppressed LPS-induced cell death at concentrations of 30 and
3.4. CA-FA suppressed the LPS-induced phosphorylations of STAT3,
Akt, and I and NF- B activation.
kB
a
k
We next examined the effect of CA-FA on the activations of
MAPKs, STAT3, and Akt, that is, the signaling mediators involved in
the regulation of pro-inflammatory molecules in response to LPS, in
RAW264.7 cells. Neither CA-FA, CA, nor FA influenced the LPS-
induced phosphorylations of ERK1/2, p38, or JNK after 30 min,
2 h, or 6 h of LPS-stimulation (Fig. 4A). However, CA-FA, but not CA
or FA, significantly inhibited the LPS-induced phosphorylations of
STAT3 and Akt at 2 h and 6 h, respectively (Fig. 4A). LPS-induced
40 mM and 20, 30, and 40 mM, respectively.
3.3. CA-FA inhibited the upregulation of pro-inflammatory
molecules at the protein and mRNA levels
I
k
B
a
degradation was not significantly affected by CA-FA, CA, or
FA, whereas CA-FA significantly inhibited LPS-induced increases in
phosphorylation (Fig. 4B). In addition, the LPS-mediated
activation of NF- B luciferase reporter activity was markedly sup-
pressed by CA-FA but not by CA or FA (Fig. 4C). The inhibitory
BV2 or RAW264.7 cells were treated with indicated concentra-
tions of CA-FA, CA, or FA for 2 h prior to LPS stimulation (100 ng/
mL). LPS-induced the protein expressions of iNOS and COX-2 in 24 h
and these increases were dose-dependently suppressed by CA-FA
IkBa
k
Fig. 3. Inhibition of the LPS-induced inductions pro-inflammatory molecules by CA-FA. (A) BV2 (left panel) or RAW264.7 (right panel) cells were pre-treated with the indicated
concentrations of CA-FA, CA, or FA for 2 h and then treated with 0.1 g/mL LPS for 24 h iNOS, COX-2 and GAPDH protein levels were measured by Western blotting. (B ~ D) BV2 cells
were pre-treated with 30 M of CA-FA, CA, or FA for 2 h and then stimulated with 0.1 g/ml LPS. Phenotypes of control, CA-FA, CA, or FA treated cells, treatment with or without LPS
were observed under a phase-contrast microscope after 24 h of LPS treatment (B). Total RNA was prepared at 24h, and the mRNA levels of iNOS, COX-2, IL-6, TNF- , and IL-1 were
determined by RT-PCR. GAPDH mRNA served as a control (C). mRNA levels of iNOS, COX-2, IL-1 , and IL-6 were measured by quantitative real-time PCR (D). *represents significantly
reduced vs. LPS-treated cells. Western blots and RT-PCR results are representative of 3 independent experiments.
m
m
m
a
b
b
Please cite this article as: M.-Y. Kwon et al., A caffeic acid-ferulic acid hybrid compound attenuates lipopolysaccharide-mediated inflammation
in BV2 and RAW264.7 cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.06.005

6
M.-Y. Kwon et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. Inhibitions of LPS-induced Akt and STAT3 phosphorylations and NF-
then stimulated with 0.1 g/ml LPS. Total cell lysates were prepared after 30 min, 2 h, or 6 h of LPS treatment, and levels of unphosphorylated- and phosphorylated-ERK1/2, -p38,
-JNK, Akt, -STAT3 were evaluated by Western blotting using specific antibodies. (B) RAW264.7 cells were pre-treated with 30 M of CA-FA, CA, or FA and stimulated with 0.1 g/ml
LPS. Phospho-I and I levels were assessed by Western blotting after 30 min or 2 h of LPS treatment. (C) RAW264.7 cells were transfected with a NF- B-luciferase reporter
plasmid, treated with CA-FA, CA, or FA (30 M) and/or LPS (0.1 mg/ml), and luciferase activities (relative light units) were measured 24 h of LPS treatment. (D ~ F) RAW264.7 cells
were pre-treated with CA-FA, CA, or FA for 2 h and then with 0.1
g/mL LPS. Nuclear extracts were prepared after 30 min or 2h of LPS treatment and DNA binding to a32P-labeled NF-
B probe was measured using an electrophoretic mobility shift assay (D). Nuclear extracts were prepared after 24 h of LPS treatment. The binding of proteins to the iNOS promoter-
kB activation by CA-FA. (A) RAW264.7 cells were pre-treated with 30 mM of CA-FA, CA, or FA for 2 h and
m
m
m
k
B
a
k
B
a
k
m
m
k
derived, biotinylated NF-
k
B probe was assessed using streptavidin-agarose pull-down assays, and this was followed by Western blotting for p65, c-Rel, p50, and RelB (E). Graphs
B pull-down assay. Ex-
represent densitometric quantification of p65, c-Rel, p50, and RelB (F). Nuclear extract (NE) input represents 2% of nuclear extract used for biotineNFe
k
periments are representative of 3 independent experiments. *denotes significantly different from untreated controls. **represents significantly reduced as compared with LPS-
treated cells. denotes significantly decreased from untreated controls.
regulation of NF-
k
B by CA-FA was further examined using elec-
4. Discussion
trophoretic mobility shift assays (EMSAs), and CA-FA, but not CA or
FA, was found to significantly reduce the LPS-induced DNA binding
Covalently joined chemical entities often display new or more
potent activities than their components [20]. In this study, we
compared the effects of CA-FA, CA-Trm, CA-PT, FA-PT, or FA-Trm
hybrids on the inflammatory responses of BV2 microglial and
RAW264.7 macrophage cells. CA-FA, CA-Trm, and CA-PT potently
inhibited LPS-induced NO generation in BV2 cells whereas at the
same concentration CA was ineffective, though CA has been shown
of NF-
B binding sites, and the distal binding site (ꢁ957/-977) is impor-
tant for LPS response. Thus, we measured the binding activities of
NF- B/Rel family proteins (p65, p50, c-Rel and RelB) to a bio-
tinylated oligonucleotide corresponding to the distal NF- B site of
kB (Fig. 4D). Mouse iNOS promoter contains two putative NF-
k
k
k
iNOS promoter. LPS was found to increase the DNA bindings of p65,
p50, c-Rel, and RelB after 6 h of treatment, and CA-FA inhibited the
DNA bindings of p65, p50, and c-Rel, whereas CA or FA had no effect
(Fig. 4E and F).
to inhibit the LPS-induced activation of NF-
mammary epithelial cells [7]. In the present study, CA (at ꢂ 100
had no inhibitory effect on LPS-induced NO generation in these two
kB in primary bovine
mM)
Please cite this article as: M.-Y. Kwon et al., A caffeic acid-ferulic acid hybrid compound attenuates lipopolysaccharide-mediated inflammation
in BV2 and RAW264.7 cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.06.005

M.-Y. Kwon et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
cell lines (data not shown). In our previous work, an acetyl-CA
References
(ACA) and 1-piperonylpiperazine (PP) hybrid had an anti-
inflammatory effect in RAW264.7 cells, and the same concentra-
tions ACA and PP were ineffective. However, CA-PP was cytotoxic at
[1] K. Herrmann, Occurrence and content of hydroxycinnamic and hydrox-
ybenzoic acid compounds in foods, Crit. Rev. Food Sci. Nutr. 28 (1989)
315e347.
ꢃ 30
m
M in BV2 and RAW264.7 cells [15]. The present study was
[2] M. Nardini, F. Natella, C. Scaccini, A. Ghiselli, Phenolic acids from beer are
absorbed and extensively metabolized in humans, J. Nutr. Biochem. 17 (2006)
14e22.
[3] A. Scalbert, G. Williamson, Dietary intake and bioavailability of polyphenols,
J. Nutr. 130 (2000) 2073Se2085S.
undertaken to design more potent combinations of nontoxic anti-
inflammatory CA hybrids effective in microglia and macrophages.
Although CA-Trm and CA-PT were similar to CA-FA in terms of LPS-
induced NO generation, they were either less effective or ineffective
at protecting BV2 cells from LPS-induced cell death. We and others
have previously shown over-activation by LPS causes the apoptosis
of microglia and macrophages [21e23]. Although NO is known to be
a major mediator of apoptosis in activated microglia, various other
inflammatory molecules contribute to microglial activation-induced
death [21]. Therefore, we found CA-FA offers greater promise as an
anti-inflammatory than CA-Trm of CA-PT. Furthermore, since CA and
FA are often found in coffee, fruit, and vegetables, and both have
antioxidant and anti-inflammatory effects, the therapeutic effect of
CA-FA is potentially close to those of natural plants. The ability to CA-
FA to inhibit BuChE may be important, as plasma and/or tissue levels
and the activities of BuChE and AChE are closely associated with
systemic inflammation and because cholinesterase inhibitors have
beenproposed to be potential anti-inflammatories [24,25]. However,
our results show that the abilities of hybrid compounds to inhibit
BuChE and their anti-inflammatory effects are not necessarily
correlated. Although the functional effects of BuChE inhibition by
CA-FA remain to be elucidated, our findings suggest that CA-FA has
potential use for the treatment of neurodegeneration because it in-
hibits inflammation and suppresses BuChE activity.
[4] L. Rondini, M.N. Peyrat-Maillard, A. Marsset-Baglieri, C. Berset, Sulfated ferulic
acid is the main in vivo metabolite found after short-term ingestion of free
ferulic acid in rats, J. Agric. Food Chem. 50 (2002) 3037e3041.
[5] S.M. Wittemer, M. Ploch, T. Windeck, S.C. Muller, B. Drewelow, H. Derendorf,
M. Veit, Bioavailability and pharmacokinetics of caffeoylquinic acids and fla-
vonoids after oral administration of Artichoke leaf extracts in humans, Phy-
tomedicine 12 (2005) 28e38.
[6] A.N. Li, S. Li, Y.J. Zhang, X.R. Xu, Y.M. Chen, H.B. Li, Resources and biological
activities of natural polyphenols, Nutrients 6 (2014) 6020e6047.
[7] M. Liu, S. Song, H. Li, X. Jiang, P. Yin, C. Wan, X. Liu, F. Liu, J. Xu, The protective
effect of caffeic acid against inflammation injury of primary bovine mammary
epithelial cells induced by lipopolysaccharide, J. Dairy Sci. 97 (2014)
2856e2865.
[8] M.C. Bufalo, I. Ferreira, G. Costa, V. Francisco, J. Liberal, M.T. Cruz, M.C. Lopes,
M.T. Batista, J.M. Sforcin, Propolis and its constituent caffeic acid suppress LPS-
stimulated pro-inflammatory response by blocking NF-kappaB and MAPK
activation in macrophages, J. Ethnopharmacol. 149 (2013) 84e92.
[9] N. Kumar, V. Pruthi, Potential applications of ferulic acid from natural sources,
Biotechnol.Rep.(Amst). 4 (2014) 86e93.
[10] R. Sultana, A. Ravagna, H. Mohmmad-Abdul, V. Calabrese, D.A. Butterfield,
Ferulic acid ethyl ester protects neurons against amyloid beta- peptide(1-42)-
induced oxidative stress and neurotoxicity: relationship to antioxidant ac-
tivity, J. Neurochem. 92 (2005) 749e758.
[11] L. Panneerselvam, K. Subbiah, A. Arumugam, J.G. Senapathy, Ferulic acid
modulates fluoride-induced oxidative hepatotoxicity in male Wistar rats, Biol.
Trace Elem. Res. 151 (2013) 85e91.
[12] B.M. Thyagaraju, Muralidhara, Ferulic acid supplements abrogate oxidative
impairments in liver and testis in the streptozotocin-diabetic rat, Zool. Sci. 25
(2008) 854e860.
[13] S. Fortin, G. Berube, Advances in the development of hybrid anticancer drugs,
Expert Opin. Drug Discov. 8 (2013) 1029e1047.
[14] T.W. Corson, N. Aberle, C.M. Crews, Design and applications of bifunctional
small molecules: why two heads are better than one, ACS Chem. Biol. 3 (2008)
677e692.
[15] S.Y. Park, J.S. Hwang, M. Jang, S.H. Lee, J.H. Park, I.O. Han, A novel caffeic acid-
1-piperonylpiperazine hybridization compound HBU-47 inhibits LPS-
mediated inflammation in RAW264.7 macrophage cells, Int. Immuno-
pharmacol. 19 (2014) 60e65.
[16] G.L. Ellman, K.D. Courtney, V. Andres Jr., R.M. Feather-Stone, A new and rapid
colorimetric determination of acetylcholinesterase activity, Biochem. Phar-
macol. 7 (1961) 88e95.
[17] S.Y. Hwang, J.H. Shin, J.S. Hwang, S.Y. Kim, J.A. Shin, E.S. Oh, S. Oh, J.B. Kim, J.K. Lee,
I.O. Han, Glucosamine exerts a neuroprotective effect via suppression of inflam-
mation in rat brain ischemia/reperfusion injury, Glia 58 (2010) 1881e1892.
[18] G. Garcia-Morales, M. Huerta-Reyes, M. Gonzalez-Cortazar, A. Zamilpa,
E. Jimenez-Ferrer, R. Silva-Garcia, R. Roman-Ramos, A. Aguilar-Rojas, Anti-
inflammatory, antioxidant and anti-acetylcholinesterase activities of Bou-
vardia ternifolia: potential implications in Alzheimer's disease, Arch Pharm.
Res. (Seoul) 38 (2015) 1369e1379.
MAPKs and NF-
genes, including iNOS and COX-2 [26]. In the present study, CA-FA
suppressed LPS-induced NF- B activation but not LPS-induced
MAPK activation, which suggests that the inhibition of NF- B ac-
tivity by CA-FA is independent of MAPKs. Instead, CA-FA inhibited
the LPS-induced activations of Akt and STAT3. The Akt pathway is
kB are important regulators of inflammatory
k
k
actively involved in the regulation of NF-
tions of IKK and I B [27], and we observed CA-FA inhibited LPS-
induced I B phosphorylation. For functional crosstalk between
STAT3 and NF- B, CA-FA may inhibit STAT3 to regulate the NF-
pathway or CA-FA may suppress STAT3 activation by inhibiting NF-
B. The results we obtained in a previous study indicated STAT3 is a
downstream target of NF- B and regulates iNOS transcription in
RAW264.7 cells [15], which suggests CA-FA inhibited STAT3 by
suppressing NF- B in BV2 or RAW264.7 cells.
kB via the phosphoryla-
a
k
k
k
kB
k
k
k
In summary, the present study demonstrates a two-component
hybrid of the well-described phenolic acids CA and FA, which are
commonly found in fruits, vegetables, and beverages, acts as a
BuChE inhibitor and anti-inflammatory in our LPS-induced BV2 and
RAW264.7 cell models of inflammation. We propose that CA-FA
may be further investigated as a potential treatment with mini-
mal side effects for neurodegenerative and other inflammation-
related diseases.
[19] D. Szwajgier, Anticholinesterase activity of phenolic acids and their de-
rivatives, Z. Naturforsch. C Biosci. 68 (2013) 125e132.
[20] M. Decker, Hybrid molecules incorporating natural products: applications in
cancer therapy, neurodegenerative disorders and beyond, Curr. Med. Chem.
18 (2011) 1464e1475.
[21] W.K. Kim, S.Y. Hwang, E.S. Oh, H.Z. Piao, K.W. Kim, I.O. Han, TGF-beta 1 re-
presses activation and resultant death of microglia via inhibition of phos-
phatidylinositol 3-kinase activity, J. Immunol. 172 (2004) 7015e7023.
[22] J.S. Hwang, J.M. An, H. Cho, S.H. Lee, J.H. Park, I.O. Han, A dopamine-alpha-
lipoic acid hybridization compound and its acetylated form inhibit LPS-
mediated inflammation, Eur. J. Pharmacol. 746 (2015) 41e49.
[23] B. Liu, K. Wang, H.M. Gao, B. Mandavilli, J.Y. Wang, J.S. Hong, Molecular
consequences of activated microglia in the brain: overactivation induces
apoptosis, J. Neurochem. 77 (2001) 182e189.
[24] W. Liu, A. Rabinovich, Y. Nash, D. Frenkel, Y. Wang, M.B.H. Youdim,
O. Weinreb, Anti-inflammatory and protective effects of MT-031, a novel
multitarget MAO-A and AChE/BuChE inhibitor in scopolamine mouse model
and inflammatory cells, Neuropharmacology 113 (2017) 445e456.
[25] U.N. Das, Acetylcholinesterase and butyrylcholinesterase as markers of low-
grade systemic inflammation, Ann. Hepatol. 11 (2012) 409e411.
[26] Q.W. Xie, Y. Kashiwabara, C. Nathan, Role of transcription factor NF-kappa B/
Rel in induction of nitric oxide synthase, J. Biol. Chem. 269 (1994) 4705e4708.
[27] D. Bai, L. Ueno, P.K. Vogt, Akt-mediated regulation of NFkappaB and the
essentialness of NFkappaB for the oncogenicity of PI3K and Akt, Int. J. Cancer
125 (2009) 2863e2870.
Declaration of interests
The authors declare no competing interests.
Conflicts of interest
The authors have no conflict of interest to declare.
Acknowledgements
This research was supported by an INHA UNIVERSITY Research
Grant.
Please cite this article as: M.-Y. Kwon et al., A caffeic acid-ferulic acid hybrid compound attenuates lipopolysaccharide-mediated inflammation
in BV2 and RAW264.7 cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.06.005