Design, synthesis, and structure-activity relationship of trypanosoma brucei leucyl-tRNA synthetase inhibitors as antitrypanosomal agents

Article abstract of DOI:10.1021/jm101225g

African trypanosomiasis, caused by the proto zoal pathogen Trypanosoma brucei (T. brucei), is one of the most neglected tropical diseases that are in great need of new drugs. We report the design and synthesis of T. brucei leucyl-tRNA synthetase (TbLeuRS) inhibitors and their structure-activity relationship. Benzoxaborole was used as the core structure and C(6) was modified to achieve improved affinity based on docking results that showed further binding space at this position. Indeed, compounds with C(7) substitutions showed diminished activity due to clash with the eukaryote specific I4ae helix while substitutions at C(6) gave enhanced affinity. TbLeuRS inhibitors with IC ₅₀ as low as 1.6 μM were discovered, and the structure-activity relationship was discussed. The most potent enzyme inhibitors also showed excellent T. brucei parasite growth inhibition activity. This is the first time that TbLeuRS inhibitors are reported, and this study suggests that leucyl-tRNA synthetase (LeuRS) could be a potential target for antiparasitic drug development.

Full text of DOI:10.1021/jm101225g

ARTICLE
pubs.acs.org/jmc
Design, Synthesis, and Structure-Activity Relationship of
Trypanosoma brucei Leucyl-tRNA Synthetase Inhibitors as
Antitrypanosomal Agents
Dazhong Ding,†,^ Qingqing Meng,†,^ Guangwei Gao,† Yaxue Zhao,† Qing Wang,† Bakela Nare,§
Robert Jacobs,§ Fernando Rock,|| Michael R. K. Alley,|| Jacob J. Plattner,|| Guoqiang Chen,‡ Dawei Li,† and
Huchen Zhou*,†
†School of Pharmacy and ‡School of Medicine, Shanghai Jiao Tong University, Shanghai, China
§SCYNEXIS, Inc., P.O. Box 12878, Research Triangle Park, NC 27709-2878, United States
Anacor Pharmaceuticals Inc., 1020 East Meadow Circle, Palo Alto, California 94303, United States
ABSTRACT: African trypanosomiasis, caused by the proto-
zoal pathogen Trypanosoma brucei (T. brucei), is one of the
most neglected tropical diseases that are in great need of new
drugs. We report the design and synthesis of T. brucei leucyl-
tRNA synthetase (TbLeuRS) inhibitors and their structure-
activity relationship. Benzoxaborole was used as the core
structure and C(6) was modified to achieve improved affinity
based on docking results that showed further binding space at
this position. Indeed, compounds with C(7) substitutions
showed diminished activity due to clash with the eukaryote
specific I4ae helix while substitutions at C(6) gave enhanced
affinity. TbLeuRS inhibitors with IC50 as low as 1.6 μM were discovered, and the structure-activity relationship was discussed. The
most potent enzyme inhibitors also showed excellent T. brucei parasite growth inhibition activity. This is the first time that TbLeuRS
inhibitors are reported, and this study suggests that leucyl-tRNA synthetase (LeuRS) could be a potential target for antiparasitic drug
development.
’ INTRODUCTION
investigation, was reported as an antifungal agent by inactivating
fungal LeuRS.9 We propose aaRS as a class of new targets in
antiprotozoal drug discovery, and their inhibitor design should
contribute to the discovery of antiprotozoal agents with mechan-
ism of action that is likely to be different from that of current
clinically used drugs.
LeuRS is responsible for charging leucine to its cognate tRNA
correctly. This enzyme has a catalytic site where leucine is
covalently attached to the 20-hydroxy group of the 30-terminal
adenosine and an editing site where proofreading happens to
preferentially hydrolyze an incorrect amino acid or release the
correctly charged tRNA to fulfill its role in ribosomal protein
synthesis.10,11 The search for inhibitors directed toward the
synthetic active sites of aaRSs has been undergoing for more
than a decade.5-7 Recently, the discovery of 1 and its mechanism
of action demonstrated for the first time the feasibility of
targeting the editing site.9 Compound 1 has a benzoxaborole
core structure with a boronic acid embedded in a five-membered
ring. The sp2 hybridized boron atom possesses an empty
p-orbital that accepts electrons from the hydroxyl groups of the
terminal adenosine and forms an adduct with the tRNA. The
African trypanosomiasis, also called sleeping sickness, is one of
the most neglected tropical diseases that are in great need of new
drug discovery and development.1 The causative pathogen,
Trypanosoma brucei, belongs to the kinetoplastid family and is
transmitted via the bite of the tsetse fly. The disease is a daily
threat to over 60 million people in 36 countries of sub-Saharan
Africa. The four currently used drugs against trypanosomiasis are
suramin, pentamidine, melarsoprol, and eflornithine.2 Because of
the lack of efficacy in late stage infection, high toxicity, and
potential development of resistance, discovery of drugs in new
chemical class with new mechanism of action is highly desired.3,4
Aminoacyl-tRNA synthetase (aaRS) enzymes have been a
focus of antimicrobial research. These enzymes play critical roles
in protein synthesis by catalyzing the attachment of specific amino
acids to their cognate tRNAs. Thus, inhibition of aaRS will halt
protein synthesis and attenuate microorganism growth.5-7 Mu-
pirocin, an isoleucyl-tRNA synthetase (IleRS) inhibitor, has been
used as an antibacterial drug in clinical application. 2-(3-{[4-
Bromo-5-(1-fluorovinyl)-3 -methylthiophen-2-ylmethyl]amino}
propylamino)-1H-quinolin-4-one (REP8839), which is a bacter-
ial methionyl-tRNA synthetase (MetRS) inhibitor, is in clinical
trials.8 Recently, 1 (AN2690) (Figure 1), which is under clinical
Received: September 27, 2010
Published: February 15, 2011
r
2011 American Chemical Society
1276
dx.doi.org/10.1021/jm101225g J. Med. Chem. 2011, 54, 1276–1287
|

Journal of Medicinal Chemistry
ARTICLE
Scheme 1. Synthesis of 7- and 6-Substituted
Benzoxaborolesa
Figure 1. Chemical structures of 1 and the covalent adduct between
compound 42 and the terminal AMP of tRNA.
benzoxaborole-tRNA adduct is illustrated in Figure 1 by com-
pound 42. Thus, tRNA is trapped in the editing site and the
enzyme function is abolished. In this study, we hope to investi-
gate if benzoxaboroles can effectively inhibit T. brucei LeuRS and
affect parasite growth. There has not been any successful report
of parasitic aaRS inhibitors in the past. Moderately active
inhibitors of Brugia malayi asparaginyl-tRNA synthetase
(AsnRS), resulting from a virtual screening, have been
reported,12 but the structure-activity relationship or antiparasi-
tic effect was not described.
In this report, a homology model of T. brucei LeuRS was built
as the basis of structure-guided inhibitor design and the enzyme
was cloned and expressed for the first time. Substitutions at C(6)
of the benzoxaborole core gave favorable activity, and their
structure-activity relationship was further studied. Enzyme
inhibitors with IC50 as low as 1.6 μM were discovered, and these
enzyme inhibitors were demonstrated to inhibit T. brucei parasite
growth. This work suggests that LeuRS may serve as a potential
target in the exploration of new antitrypanosomal agents with
new mechanism of action.
a Reagents and conditions: (a) Ph3PCH2COOCH2CH3Br, NaH, THF,
0 ꢀC to room temp; (b) PtO2 3H2O, H2, room temp; (c) DIBAL, THF,
3
0 ꢀC to room temp; (d) acetophenone, NaOH, EtOH/H2O, room
temp.
Scheme 2. Synthesis of 6-OH Benzoxaborolea
’ CHEMISTRY
Compounds discussed in this study belong to two categories,
those derived from formyl benzoxaboroles and those derived
from hydroxyl benzoxaboroles.
The 7-formylbenzoxaborole and 6-formylbenzoxaborole 1a
and 1b were prepared from the corresponding dimethylbromo-
benzenes according to the procedure we reported previously.13
Wittig reaction on 7-formylbenzoxaborole 1a gave R,β-unsatu-
rated ester 2a, which was subsequently reduced under catalytic
hydrogenation to give ester 3a. Compound 4a was prepared from
3a after reduction with DIBAL. Chalcone compound 5a was
prepared from aldehyde 1a by aldol condensation. Compounds
with 6-substitutions, 2b, 3b, 4b, and 5b, were synthesized from
6-formylbenzoxaborole 1b following similar procedures de-
scribed above (Scheme 1).
The 6-hydroxybenzoxaborole intermediate 11 was prepared
from 2-bromo-4-fluorobenzaldehyde 6.14 The formyl group was
protected with ethylene glycol, which was necessary for achieving
good yield in the following step of neucleophilic replacement of
fluorine by benzyl alcohol to result in compound 8. Metal-
halogen exchange using butyllithium followed by in situ trapping
with triisopropylborate resulted in the boronylation of com-
pound 8; subsequent acidification gave boronic acid 9. Com-
pound 9 was reduced with NaBH4 to give benzoxaborole 10
which underwent hydrogenation in the presence of Pd/C to give
compound 11 (Scheme 2).
a Reagents and conditions: (a) ethylene glycol, p-TsOH, toluene, reflux;
(b) BnOH, NaH, DMF, 0 to 65 ꢀC; (c) n-BuLi, B(iPrO)3, -78 ꢀC to
room temp; (d) HCl; (e) NaBH4, THF, 0 ꢀC; (f) H2, Pd/C, CH3OH,
room temp.
bromoacetates to give derivatives as exemplified by benzyl ether
12, alkyl ether 21, and R-alkoxyacetate 26. Diaryl ethers such as
compound 13 were prepared from phenol 11 using NaH as the
base under elevated temperature (70 ꢀC). Treatment of phenol
11 with R-bromoacetamides under the condition of K2CO3 with
NaI as catalyst gave R-bromoacetamides as shown by compound
35 as an example. Carbamates such as compound 27 were
prepared from phenol 11 by coupling with corresponding
isocyanates in the presence of Et3N (Scheme 3).
’ RESULTS AND DISCUSSION
We first cloned and expressed the full length T. brucei LeuRS
using pET21a vector in E. coli strain BL21(DE3)-RIPL. Attempts
to obtain an X-ray crystal structure of T. brucei LeuRS have been
Compound 11 was treated with NaH at 0 ꢀC and then coupled
with the corresponding benzyl bromides, alkyl bromides, or R-
1277
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
Scheme 3. Synthesis of Representative Derivatives from
6-OH Benzoxaborolea
Figure 2. (a) Homology model of T. brucei LeuRS CP1 domain
(orange) based on C. albicans LeuRS structure (cyan) (PDB code
2WFG). The arrow points to the inserted eukaryote specific helix. (b)
Amino acid residues that line the editing pocket. TbLeuRS is in orange,
and residues are all labeled. CaLeuRS is in cyan. Identical residues are
not labeled, and different residues are indicated in parentheses. Ligand
from 2WFG is represented by a gray line.
a Reagents and conditions: (a) NaH, DMF, 0 ꢀC; (b) NaH, DMF, 0 to
70 ꢀC, 36 h; (c) K2CO3, DMSO, NaI (cat.), 90 ꢀC, 36 h; (d) Et3N, DMF,
0 ꢀC to room temp, 48 h.
unsuccessful, so a homology model of T. brucei LeuRS editing
domain (CP1) was constructed using Candida albicans LeuRS
(CaLeuRS) CP1 domain (PDB code 2WFG) as the template
(Figure 2a).15 They shared a sequence identity of 36% (249 aa,
rmsd of 0.24 Å on C(R)), and both possess very similar core
structures consisting of seven β-sheets and three R-helices.
Similar to CaLeuRS, TbLeuRS has an eukaryote specific I4ae
helix15 that partially blocks the entrance of the editing pocket by
the two residues: Lys465 and Tyr469 (Figure 2b), which results
in a half-closed binding pocket compared to the open pocket in
prokaryote LeuRS such as E. coli LeuRS. The conserved active
site features found in TbLeuRS include the “threonine-rich
region” (T287 and T292), the “GTG region” (G386, T387,
G388), and a strictly conserved catalytic aspartic acid (D400)
(Figure 2b). Overall, the TbLeuRS editing site is very similar to
CaLeuRS, but a limited number of residue variations also exist
(Figure 2b). Among the 29 amino acid residues that line the
editing pocket, variations were seen at eight residues.
The benzoxaborole-AMP adduct, which does not include the
whole tRNA, was docked into the editing pocket of T. brucei
LeuRS by taking a similar binding pose as the benzoxaborole-
AMP complexed in CaLeuRS.15 Inspection of this pose sug-
gested that substituents at C(7) might clash with the eukaryote
helix, whereas substituents at C(6) vectoring toward a well-
defined pocket could provide improvements in affinity. These
predictions were explored via the compounds depicted in
Table 1. The 7-substituted benzoxaboroles including ester,
alcohol, and chalcone structures showed minimal inhibitory
activity, while 6-substituted analogues showed improved activity.
Compound 3b with an ethyl propionate substitution from C(6)
was the most active with an IC50 of 16.7 μM, which was slightly
lower than that of the parent compound 1c (IC50 = 22.1 μM).
Similar to C(7), the model showed minimal space near C(5) and
C(3), so we did not explore these two positions either. Thus, we
next focused on the exploration of the effect of a variety of
6-substitutions on enzyme inhibition activity.
Encouraged by the inhibitory activity of compound 3b, we
synthesized its close analogue, ester 26, which showed a 4-fold
improvement of activity with IC50 of 3.5 μM (Table 2). The
docking model of compound 26 (Figure 3) showed the forma-
tion of a hydrogen bond between its carbonyl and Arg289, with a
predicted O-N distance of 2.738 Å. The pocket is rather small
and hydrophobic, lined by nonpolar amino acid residues includ-
ing Pro398, Ala443, Ile468, and Ala464 which showed favorable
interactions with the terminal ethyl group of compound 26
(Figure 3). The carboxylic acid 18 showed completely dimin-
ished activity, suggesting the necessity of a nonpolar terminal
group. The aldehyde 19 and its acetal 17 also showed diminished
activity.
In order to probe the binding properties of the above-
mentioned binding pocket, we designed and synthesized a variety
of 6-O substituted compounds as shown in Table 2.
The parent phenol 11 showed IC50 of 30.9 μM. Benzyloxy
compounds 10 and 12 showed comparable activity with IC50
1278
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
Table 1. Exploration of the Effect of 6- versus 7-Substitutions
on T. brucei LeuRS Inhibition
Table 2. Exploration of the Effect of Different 6-O Substitu-
tions on T. brucei LeuRS Inhibition
values of 30.6 and 25.6 μM. Quinolinyl compound 13 gave lower
activity (IC50 = 63.0 μM). Pyridyl compound 14, phthalimide 15,
and cyclohexyl compound 16 completely lost activity. Com-
pound 20 with a relatively long chain and a bulky terminal tert-
butyl group completely lost activity as well. On the other hand,
the shorter alkyl substitutions in compounds 21-24 gave IC50
values ranging from 13.0 to 54.3 μM, with the butyl (24) having
the weakest activity. Carbamates such as 27 and 28 were also
explored, and their activity is similar to the activity of benzyl
compounds 10 and 12. These observations suggest that the
binding pocket may have a limited space, so bulky or rigid
structures result in steric clash and diminished affinity while
relatively adaptable chain structures are preferred, which is not
surprising considering the rather small and half closed editing
pocket of T. brucei LeuRS. We previously reported14 a series of
C(6)-L-phenyl substituted benzoxaboroles including benzyl
ether 10 and carbamate 27. These compounds showed poor
inhibitory activity against TbLeuRS, which corroborates with the
above observation of the binding pocket. Their antitrypanosomal
activity is due to unknown cellular targets, which is currently
under investigation.
Led by the promising activity of ester 26, we further explored
the effect of different ester groups (Table 3). Methyl ester 29 has
comparable activity as ethyl ester 26, but tert-butyl ester 30 has a
2-fold reduced activity. Further analysis of the docking model of
compound 26 (Figure 3) revealed the existence of space near the
R-carbon of the ester. So R-substituted esters 31-34 were
synthesized with the aim to improve activity. It was found that
methyl-substituted compound 31 showed improved activity
(IC50 = 2.8 μM) and ethyl compound 32 showed further
improved activity (IC50 = 1.6 μM). Dimethyl substitution also
gave improved activity (33, IC50 = 2.1 μM), while a larger phenyl
substituent gave much reduced activity (34, IC50 = 41.7 μM),
indicating the space around R-C is limited as shown by the
docking model (Figure 3).
We further explored the effect of replacing the ester bond with
the more stable amide bond. The amide analogue of ester 26,
compound 35, showed 22-fold reduced activity. At the same
time, tert-butylamide 36 has completely reduced activity
1279
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
Table 3. Effect of Different Esters, Amides, and Ketones on T.
brucei LeuRS Inhibition
Figure 3. Binding of ester 26 (ligand in cyan sticks and binding site
residues in cyan lines) and R-substituted ketone 42 (ligand in orange
sticks and binding site residues in orange lines) in the editing pocket of
TbLeuRS. Compounds 26 and 42 are shown as covalent adducts with the
terminal AMP of tRNA. The boron atom is shown in green for clarity.
compared to its ester analogue 30. It is not clear why amide bond
gave much reduced activity, and investigation of the docking
model did not explain the phenomenon.
As an effort to improve the stability of the lead ester
compounds while retaining their activity, corresponding ketones
were designed and synthesized (Table 3). First, ketones 37 and
38, which are analogues of ethyl ester 26 and methyl ester 29,
were found to have 9-fold and 8-fold reduced activity. Next, R-
substituents were installed in compounds 39-45 to capture
additional hydrophobic interactions. Addition of methyl or ethyl
substituents resulted in significant enhancement of activity, as
demonstrated by compounds 39-41 (IC50 = 2.5, 2.9, 3.8 μM).
Thus, the R-substituted ketones successfully achieved activity
similar to that of the most potent ester compounds. To further
explore the effect of different alkyl groups at R-C, acetone
compounds 41-45 which vary in the size of R-substituents were
synthesized. It was found that methyl (41, IC50 = 3.8 μM) and
ethyl (43, IC50 = 3.5 μM) gave the best activity while dimethyl
(42, IC50 = 5.0 μM) and isopropyl (45, IC50 = 4.5 μM) gave
slightly reduced activity. When the length of the alkyl chain
further increases, compound 44 with n-propyl group showed an
almost 10-fold decrease of activity (IC50 = 31.4 μM). This
observation corroborates with the dimension of space around
R-C in the docking model (Figure 3). Enlargement of the
terminal alkyl chain (46, IC50 = 67.6 μM) also resulted in further
diminished activity compared to compound 37. Finally, it is
worth mentioning that conversion of the ketone (39) carbonyl to
hydroxyl (47) led to complete loss of activity. At the same time,
removal of the carbonyl resulted in complete loss of activity as
shown by comparison of methyl ether 25 (IC50 > 100 μM) to
methyl ester 29 (IC50 = 3.6 μM). These observations suggested
the importance and steric/geometry constraint of a hydrogen
bond between Arg289 and the carbonyl, as depicted in the
docking model of compounds 26 and 42 in the enzyme pocket
(Figure 3).
compounds with enzyme inhibitory IC50 below 10 μM, parasite
growth inhibition IC50 values in the range 0.37-12.93 μM were
observed (Table 4). The R,R-dimethyl ketone 42 showed the
highest potency (IC50 = 0.37 μM), while its methyl (41, IC50
2.09 μM), ethyl (43, IC50 = 3.76 μM), and isopropyl (45, IC50
=
=
2.74 μM) analogues showed near 10-fold decrease in potency,
although these R-substituted ketones have similar enzyme in-
hibitory activity. On the other hand, R-substituted ethyl esters 31,
32, and 33, which have improved enzyme inhibitory activity
compared to the unsubstituted ester 26, were found to show near
Next, we tested if these TbLeuRS inhibitors could effectively
inhibit the parasite growth in vitro and if they are toxic against
mammalian cells. These inhibitors generally showed good po-
tency against bloodstream form of T. brucei parasites. For
1280
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
Table 4. T. brucei Parasite Growth Inhibition by the T. brucei
time that effective protozoal aaRS inhibitors and their structure-
activity relationship were reported.
LeuRS Inhibitorsa
compd
T. brucei IC50 (μM)
L929 (μg/mL)
’ EXPERIMENTAL SECTION
NMR spectra were recorded on MercuryPlus 400 (Varian), Mercury
300 (Varian), or AVANCE 400 (Bruker) spectrometers. Chemical shifts
are expressed in parts per million (δ) relative to residual solvent as an
internal reference. High resolution mass spectra were obtained on a
Micromass GCT (electron ionization) or an Agilent 6530 Accurate Mass
Q-TOF LC-MS (electrospray ionization). High performance liquid
chromatography analysis was performed on a Agilent 1200 with a flow
rate of 1 mL/min and a gradient of 90% H2O/10% MeCN to 100%
MeCN in 15, 20, or 25 min using a DAD detector. An Agilent Eclipse
XDB-C18 column (4.6 mm ꢀ 150 mm, 5 μm) was used. Purity was
based on the integrated UV chromatogram (220 and 254 nm). All
compounds have purity of >95%. Column chromatography was per-
formed using Huanghai silica gel (300-400 mesh). Melting points were
measured on a SGW X-4 melting point apparatus. Radioactivity was
measured using a scintillation counter (Beckman LS 6500). Brewer’s
yeast tRNA was purchased from Roche.
26
0.72
1.22
>10
>10
>10
>10
>10
>10
>10
>10
>10
>10
>10
>10
29
30
2.61
31
3.00
32
11.32
5.49
33
39
8.25
40
12.93
2.09
41
42
0.37
43
3.76
45
2.74
suramb
pentc
0.005
0.026
a L929: IC50 against L929 mouse lung fibroblast cells. μg/mL is used as
the measurement unit, and >10 μg/mL approximately converts to >40
μM. b Suramin. c Pentamidine.
(E)-[3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-7-yl)]acrylic
Acid Ethyl Ester (2a). To a solution of aldehyde 1a (400 mg, 2.47
mmol) and (ethyloxycarbonylmethyl)triphenylphosphonium bromide
(1.06 g, 2.47 mmol) in THF (25 mL) was added NaH (60% in mineral
oil, 99 mg, 2.47 mmol) at -5 ꢀC. The reaction mixture was stirred at
room temperature for 12 h before another portion of NaH (50 mg, 1.24
mmol) was added at 0 ꢀC and stirred at room temperature for 8 h. The
reaction was quenched with water, acidified to pH 2-3, extracted with
EtOAc, and dried over Na2SO4. The residue after rotary evaporation
was purified by column chromatography and recrystallization (hexane/
10-fold decreased antiparasitic potency (IC50 = 3.00, 11.32, 5.49
μM) compared with 26 (IC50 = 0.72 μM). The indiscrepancy
between enzymatic and cellular assays is often observed in
medicinal chemistry research, which is generally caused by
membrane permeability, serum binding properties, and off-target
interactions of the compounds. Further detailed study of these
properties would help provide better understanding in this regard.
It is also worth pointing out that a number of compounds showed
better cellular IC50 values than enzymatic values. This could be
caused by the nature of the inhibition mechanism. Benzoxaborole
LeuRS inhibitors are irreversible (half-life of 424 min for 1) slow-
tight-binding inhibitors due to the covalent locking of tRNA.9,15
So enzyme inhibition is highly dependent on the enzyme-
inhibitor preincubation time9,15 (17-fold decrease of Ki when
preincubation time increased from 2 to 20 min for 1),9 which
renders the inhibitory IC50 a relative measurement that can only
be used to rank compounds under a designated assay condition.
Caution should be taken when it is being related to cellular IC50
values, where lengthened incubation time (72 h) is involved. This
represents a different scenario from that of the synthetic site-
targeting inhibitors. Lastly, the compounds showed excellent
toxicity profile against mammalian cells with IC50 against L929
cells (mouse lung fibroblast cells) above 10 μg/mL
(approximately above 40 μM). Taken together, these observa-
tions suggest that TbLeuRS may serve as a promising target for
the development of chemotherapies against trypanosomiasis.
In summary, the potential of using TbLeuRS as a target for the
development of antitrypanosomal agents was explored. LeuRS
enzyme from T. brucei was cloned and expressed, and its
homology model was built based on C. albicans LeuRS structure.
Subsequent structure-guided design and synthesis of 6-OH
benzoxaborole-derived inhibitors with different size or polarity
of substituent groups were carried out. Alkyl esters, identified as
the first leads, were further modified to amide and ketone
analogues with the aim to improve the in vivo stability. While
amides showed reduced activity, ketones proved to be equipo-
tent compounds. The most potent TbLeuRS inhibitor we
discovered showed IC50 = 1.6 μM. They also inhibited T. brucei
parasite growth in vitro with IC50 as low as 0.37 μM. It is the first
1
EtOAc) to obtain 200 mg of compound 2a (34.9%). H NMR (300
MHz, DMSO-d6): δ 9.33 (s, 1H), 8.10 (d, 1H, J = 16.2 Hz), 7.82 (d, 1H,
J = 10 Hz), 7.52 (t, 1H, J = 7.5 Hz), 7.44 (m, 1H), 6.81 (d, 1H, J = 16.2
Hz), 5.02 (s, 2H), 4.19 (q, 2H, J = 7.1 Hz), and 1.26 (t, 3H, J = 7.2 Hz).
13C NMR (100 MHz, CD3OD): δ 168.8, 155.9, 144.9, 138.9, 132.3,
125.9, 123.7, 120.1, 71.9, 61.5, 14.6. HRMS-EI: [M]þ C12H13BO4 calcd
232.0907, found 232.0909. Mp: 151-152 ꢀC. HPLC: purity 98.9% (220
nm, 10.7 min/15 min).
[3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-7-yl)]propionic
Acid Ethyl Ester (3a). To a solution of compound 2a (1.20 g, 5.17 mmol)
in methanol (10 mL) was added PtO2 3H2O (73 mg, 0.26 mmol), and the
3
reaction mixture was vacuumed and filled with hydrogen. After stirring
overnight at room temperature, the reaction mixture was filtered and
evaporated in vacuo to obtain 1.16 g of compound 3a (96.0%). 1H NMR
(400 MHz, CD3OD): δ 7.34 (t,1H, J = 7.6 Hz), 7.18 (d, 1H, J = 7.6 Hz),
7.11 (d, 1H, J = 7.2 Hz), 5.02 (s, 2H), 4.06 (q, 2H, J = 7.2 Hz), 3.05 (t, 2H,
J = 7.6 Hz), 2.61 (t, 2H, J = 7.6 Hz), and 1.19 (t, 3H, J = 7.2 Hz). 13C NMR
(100 MHz, CD3OD): δ 174.9, 155.7, 146.1, 132.2, 128.2, 120.1, 72.1,
61.4, 37.1, 30.9, 14.5. HRMS-EI: [M]þ C12H15BO4 calcd 234.1063,
found 234.1060. Mp: 93-95 ꢀC. HPLC: purity 98.7% (220 nm, 10.2 min/
15 min).
7-(3-Hydroxypropyl)-1,3-dihydro-1-hydroxy-2,1-benzox-
aborole (4a). To a solution of compound 3a (500 mg, 2.15 mmol) in
THF (20 mL) was added dropwise DIBAL (1.0 M in hexane, 12.9 mL,
12.9 mmol) at 0 ꢀC. The reaction mixture was stirred overnight at room
temperature and quenched with 1 M HCl at 0 ꢀC. The mixture was
extracted with EtOAc, washed with brine, and dried over Na2SO4. After
rotary evaporation, the residue was purified by column chromatography
1
to obtain 270 mg of compound 4a (65.5%). H NMR (400 MHz,
CD3OD, Na added): δ 7.03 (m, 1H), 6.91 (m, 1H), 6.83 (m, 1H), 4.81
(s, 2H), 3.48 (m, 2H), 2.77 (m, 2H), and 1.84 (m, 2H). 13C NMR (100
MHz, CD3OD): δ 155.5, 147.9, 132.1, 128.1, 119.6, 72.1, 62.5, 35.9,
31.8. HRMS-ESI: [M - H]- C10H12BO3 calcd 191.0879, found 191.0882.
Mp: 91-93 ꢀC. HPLC: purity 99.1% (220 nm, 10.5 min/20 min).
1281
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
(E)-[3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-7-yl)-1-
phenyl]propenone (5a). To a mixture of acetophenone (0.22 mL,
1.85 mmol), ethanol (5 mL), and water (8 mL) was added NaOH (296
mg, 7.41 mmol). After the mixture was stirred for for 5 min, aldehyde
1a (300 mg, 1.85 mmol) was added. The reaction mixture was stirred
at room temperature overnight before the pH was adjusted to ∼2 with
1 M HCl. The mixture was evaporated, extracted with EtOAc, and
dried over anhydrous Na2SO4. The residue after rotary evaporation
was purified by column chromatography and recrystallization (hexane/
oil, 16.2 g, 408 mmol) in portions. The reaction mixture was stirred for 4
h at 65 ꢀC and then treated with cold water (500 mL). After extraction
with EtOAc, the organic layer was washed with water and brine and dried
over Na2SO4. The residue after rotary evaporation was purified by flash
column over silica gel to give compound 8 (43.3 g, 64.0%).
Compound 8 (20 g, 59.7 mmol) and B(i-PrO)3 (15.7 mL, 68.6
mmol) were dissolved in anhydrous THF (400 mL) and cooled to
-80 ꢀC under nitrogen. To this solution was added dropwise 1.6 M
n-BuLi (42.87 mL, 68.6 mmol) over 1 h. The mixture was allowed to
warm to room temperature gradually and stirred overnight. After 6 M
HCl (100 mL) was added and the mixture was stirred for 2 h, the mixture
was evaporated and extracted with EtOAc and dried over Na2SO4. The
residue after rotary evaporation was purified by crystallization to give
compound 9 (13.4 g, 88.1%).
1
EtOAc) to obtain 240 mg of compound 5a (49.1%). H NMR (300
MHz, DMSO-d6): δ 9.39 (s, 1H), 8.14 (m, 5H), 7.68 (t, 1H, J = 7.4
Hz), 7.58 (t, 3H, J = 8 Hz), 7.48 (m, 1H) and 5.05 (s, 2H). 13C NMR
(100 MHz, CD3OD) δ 192.8, 156.2, 145.3, 139.6, 139.4, 134.2, 132.4,
129.7, 127.4, 124.8, 123.9, 71.9. HRMS-EI: [M]þ C16H13BO3 calcd
264.0958, found 264.0964. Mp: 136-137 ꢀC. HPLC: purity 97.1%
(220 nm, 10.7 min/15 min).
Compound 9 (23 g, 89.8 mmol) was dissolved in THF (300 mL) and
cooled to 0 ꢀC. To this solution was added NaBH4 (4.3 g, 114 mmol) in
portions. The reaction mixture was stirred for 1 h and then treated with 1
M HCl. After evaporation, the residue was extracted with EtOAc and the
organic layer was washed with water and brine and dried over Na2SO4.
The residue after rotary evaporation was purified by flash column over
(E)-[3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yl)]acrylic
Acid Ethyl Ester (2b). Compound 2b (153 mg, 62.5%) was prepared
1
following a similar procedure to compound 2a. H NMR (300 MHz,
DMSO-d6): δ 9.26 (s, 1H), 7.96 (s, 1H), 7.85 (dd, 1H, J = 8.1 and 1.5 Hz),
7.70 (d, 1H, J = 16.2 Hz), 7.46 (d, 1H, J = 7.8 Hz), 6.59 (d, 1H, J = 16.2 Hz),
5.02 (s, 2H), 4.19 (q, 2H, J = 7.2 Hz), and 1.26 (t, 3H, J = 7.2 Hz) ppm. 13C
NMR (100 MHz, CDCl3) δ 167.2, 155.6, 144.6, 133.4, 130.4, 130.1, 121.5,
117.9, 71.2, 60.5, 14.2. HRMS-ESI: [M þ Na]þ C12H13BO4Na calcd
255.0805, found 255.0848. Mp: 129-131 ꢀC. HPLC: purity 99.6% (254
nm, 15.4 min/20 min).
1
silica gel to give compound 10 (21 g, 97.0%). H NMR (300 MHz,
DMSO-d6): δ 9.15 (s, 1H), 7.48-7.28 (m, 7H), 7.13 (dd, 1H, J = 8.4
and 2.4 Hz), 5.12 (s, 2H), and 4.91 (s, 2H). 13C NMR (75 MHz,
CDCl3): δ 158.5, 146.4, 137.2, 128.8, 128.1, 127.7, 122.2, 119.8, 114.6,
71.3, 70.5. HRMS-EI: [M]þ C14H13BO3 calcd 240.0958, found
240.0963. Mp: 118-119 ꢀC. HPLC: purity 97.9% (254 nm, 10.1
min/15 min).
[3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yl)]propionic
Acid Ethyl Ester (3b). Compound 3b (89 mg, 90.0%) was prepared
6-Hydroxyl-1,3-dihydro-1-hydroxy-2,1-benzoxaborole
(11). Compound 10 (21 g, 87.5 mmol) was dissolved in MeOH
(250 mL). To this solution under nitrogen was added 10% Pd/C (1.5
g). The reaction mixture was vacuumed and backfilled with hydro-
gen 3 times, then stirred overnight at room temperature. After
filtration and rotary evaporation, the residue was purified by
recrystallization (hexane/EtOAc) to give compound 11 (12.7 g,
1
following a similar procedure to compound 3a. H NMR (300 MHz,
DMSO-d6):δ9.10 (s, 1H), 7.55 (s, 1H), 7.32 (m, 2H), 4.94 (s, 2H), 4.03 (q,
2H, J = 7.2 Hz), 2.89 (t, 2H, J = 7.5 Hz), 2.61 (t, 2H, J = 7.5 Hz), and 1.14 (t,
3H, J = 7.2 Hz). 13C NMR (100 MHz, CDCl3) δ 172.9, 151.7, 139.5, 131.4,
130.1, 121.1, 71.0, 60.5, 36.1, 30.8, 14.2. HRMS-ESI: [M þ Na]þ
C12H15BO4Na calcd 257.0961, found 257.0973. Mp: 76-78 ꢀC. HPLC:
purity 95.0% (220 nm, 9.3 min/15 min).
1
97.0%). H NMR (400 MHz, DMSO-d6): δ 9.30 (s, 1H), 9.04 (s,
6-(3-Hydroxypropyl)-1,3-dihydro-1-hydroxy-2,1-benzox-
aborole (4b). Compound 4b (53.6 mg, 65.0%) was prepared follow-
ing a similar procedure to compound 4a. 1H NMR (400 MHz,
CD3OD): δ 7.49 (s, 1H), 7.31 (m, 2H), 5.04 (s, 2H), 3.56 (t, 2H, J =
8.8 Hz), 2.72 (t, 2H, J = 9.6 Hz), and 1.83 (m, 2H). 13C NMR (100 MHz,
CD3OD): δ 153.0, 142.2, 132.5, 131.0, 122.1, 72.2, 62.2, 35.8, 32.9.
HRMS-ESI: [M þ Na]þ C10H13BO3Na calcd 193.1036, found 193.1058.
Mp: 214-218 ꢀC. HPLC: purity 97.2% (220 nm, 6.9 min/20 min).
(E)-[3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yl)-1-
phenyl]propenone (5b). Compound 5b (105 mg, 32.3%) was
1H), 7.18 (d, 1H, J = 8.0 Hz), 7.09 (d, 1H, J = 2.0 Hz), 6.87 (dd, 1H,
J = 8.1 and 2.4 Hz), and 4.86 (s, 2H). 13C NMR (100 MHz, CDCl3):
δ 208.0, 158.3, 147.1, 123.9, 120.5, 117.5, 71.9. HRMS-EI: [M]þ
C7H7BO3 calcd 150.0488, found 150.0483. Mp: 133-135 ꢀC.
HPLC: purity 95.7% (254 nm, 9.4 min/20 min).
6-(2-Fluorobenzyloxy)-1,3-dihydro-1-hydroxy-2,1-benzox-
aborole (12). Compound 11 (150 mg, 1.0 mmol) was dissolved in
DMF (10 mL) and cooled to 0 ꢀC. To this solution under nitrogen were
added in sequence NaH (60% in mineral oil, 160 mg, 4.0 mmol) and
1-(chloromethyl)-2-fluorobenzene (0.485 mL, 4.0 mmol). The reaction
mixture was stirred for 2 h and then treated with 1 M HCl (10 mL). After
extraction with EtOAc, the organic layer was washed with water and brine
and dried over Na2SO4. The residue after rotary evaporation was purified
by column chromatography over silica gel to give compound 12 (143.6
mg, 55.7%). 1H NMR (300 MHz, DMSO-d6): δ 9.13 (s, 1H), 7.58-7.12
(m, 7H), 5.16 (s, 2H) and 4.92 (s, 2H). 13C NMR (100 MHz, CDCl3):
δ157.9, 146.3, 129.6, 129.5, 124.1, 124.0, 122.0, 119.4, 115.3, 115.1, 114.2,
70.9, 63.9. HRMS-EI: [M]þ C14H12BFO3 calcd 258.0864, found
258.0865. Mp: 129-131 ꢀC. HPLC: purity 98.7% (254 nm, 16.3 min/
20 min).
6-Quinolin-2-yloxy-1,3-dihydro-1-hydroxy-2,1-benzoxa-
borole (13). Compound 11 (100 mg, 0.667 mmol) was dissolved in
DMF (10 mL) and cooled to 0 ꢀC. To this solution under nitrogen were
added in sequence NaH (60% in mineral oil, 80 mg, 2.00 mmol) and
2-chloroquinoline (119 mg, 0.734 mmol). The reaction mixture was
stirred for 36 h at 70 ꢀC and then treated with 1 M HCl (10 mL). After
extraction with EtOAc the organic layer was washed with water and brine
and dried over anhydrous Na2SO4. The residue after rotary evaporation
was purified by column chromatography over silica gel to give
1
prepared following a similar procedure to compound 5a. H NMR
(400 MHz, CDCl3): δ 8.06 (m, 3H), 7.92 (d, 1H, J = 15.9 Hz), 7.77 (d,
1H, J = 7.8 Hz), 7.56 (m, 4H), 7.41 (d, 1H, J = 8.4 Hz), 5.42 (s, 1H),
and 5.15 (s, 2H). 13C NMR (100 MHz, CDCl3): δ 190.9, 155.9, 144.9,
137.8, 133.7, 132.8, 131.1, 130.1, 128.5, 128.3, 121.6, 121.5, 71.2.
HRMS-ESI: [M þ Na]þ C16H13BO3Na calcd 287.0856, found
287.0886. Mp: 146-148 ꢀC. HPLC: purity 95.4% (220 nm, 10.6
min/15 min).
6-Benzyloxy-1,3-dihydro-1-hydroxy-2,1-benzoxaborole
(10). To a solution of compound 6 (50 g, 246 mmol) in toluene (500
mL) were added ethylene glycol (74.8 g, 1207 mmol) and p-toluene-
sulfonic acid monohydrate (2.5 g, 13 mmol). After heating to reflux
and being stirred for 4 h, the mixture was washed with saturated
NaHCO3, water, and brine and dried over Na2SO4. The residue after
rotary evaporation was purified by flash column over silica gel to give
compound 7 (53.6 g, 87.8%) as a viscous oil.
Compound 7 (50.5 g, 204 mmol) was dissolved in DMF (400 mL)
and cooled to 0 ꢀC. To this solution under nitrogen were added in
sequence benzyl alcohol (24.2 g, 224 mmol) and NaH (60% in mineral
1282
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
1
compound 13 (24.8 mg, 13.5%). H NMR (300 MHz, DMSO-d6): δ
HRMS-EI: [M]þ C9H9BO4 calcd 192.0594, found 192.0595. Mp:
84-86 ꢀC. HPLC: purity 96.8% (220 nm, 7.6 min/15 min).
tert-Butyl N-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-
yl)ethylcarbamate(20). Compound 20 was prepared following a
similar procedure to compound 12. Yield: 26.0%. 1H NMR (400 MHz,
DMSO-d6): δ 9.13 (s, 1H), 7.30 (d, 1H, J = 8.4 Hz), 7.22 (d, 1H, J = 2.4
Hz), 7.04 (m, 2H), 4.91 (s, 2H), 3.95 (t, 2H, J = 6 Hz), 3.29 (q,2H, J =
5.6 and 10.4 Hz), and 1.38 (s, 9H). 13C NMR (75 MHz, CDCl3): δ
158.1, 156.0, 146.5, 122.1, 119.4, 114.1, 79.7, 70.9, 67.4, 40.1, 28.4.
HRMS-EI: [M]þ C14H20BNO5 calcd 293.1435, found 293.1442. Mp:
89-91 ꢀC. HPLC: purity 97.3% (220 nm, 20.6 min/25 min).
6-Ethoxy-1,3-dihydro-1-hydroxy-2,1-benzoxaborole
(21). Compound 21 was prepared following a similar procedure
to compound 12. Yield: 65.0%. 1H NMR (300 MHz, DMSO-d6): δ
9.13 (s, 1H), 7.29 (d, 1H, J = 8.1 Hz), 7.20 (d, 1H, J = 2.4 Hz), 7.03
(dd, 1H, J = 8.1 and 2.4 Hz), 4.91 (s, 2H), 4.02 (q, 2H, J = 7.0 Hz),
and 1.33 (t, 3H, J = 7.2 Hz). 13C NMR (75 MHz, CDCl3): δ 158.5,
145.7, 122.0, 119.8, 113.9, 70.9, 63.7, 14.8. HRMS-EI: [M]þ
C9H11BO3 calcd 178.0801, found 178.0802. Mp: 80-82 ꢀC.
HPLC: purity 95.8% (220 nm, 17.9 min/20 min).
9.21 (s, 1H), 8.42 (d, 1H, J = 9 Hz), 7.95 (d, 1H, J = 8.4 Hz), 7.65-7.27
(m, 7H), and 5.04 (s, 2H). 13C NMR (75 MHz, CDCl3): δ 161.7, 163.1,
149.7, 146.0, 140.0, 129.8, 127.2, 125.5, 124.8, 124.3, 122.3, 122.2, 112.3,
70.9. HRMS-EI: [M]þ C16H12BNO3 calcd 277.0910, found 277.0907.
Mp: 173-175 ꢀC. HPLC: purity 95.0% (254 nm, 9.9 min/15 min).
6-(Pyridin-2-ylmethoxy)-1,3-dihydro-1-hydroxy-2,1-ben-
zoxaborole (14). Compound 14 was prepared following a similar
procedure to compound 12. Yield: 50.0%. 1H NMR (300 MHz, DMSO-
d6): δ 9.14 (s, 1H), 8.59-8.56 (m, 2H), 7.46-7.42 (m, 2H), 7.33 (d,
1H, J = 8.4 Hz), 7.29 (d, 1H, J = 2.4 Hz), 7.15 (dd, 1H, J = 8.4 and 2.4
Hz), 5.21 (s, 2H), and 4.92 (s, 2H). 13C NMR (75 MHz, CDCl3): δ
159.1, 150.0, 149.8, 148.0, 123.4, 123.3, 123.2, 120.2, 115.6, 115.5, 72.0,
69.2. HRMS: [M]þ C13H12BNO3 calcd 241.0910, found 241.0911. Mp:
167-170 ꢀC. HPLC: purity 95.9% (220 nm, 6.1 min/15 min).
2-[3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxyl)-
propyl]isoindole-1,3-dione (15). Compound 15 was prepared
following a similar procedure to compound 12. Yield: 53.6%. 1H
NMR (300 MHz, DMSO-d6): δ 9.01 (s, 1H), 7.84 (d, 4H, J = 2.7
Hz), 7.24 (d, J = 8.4 Hz, 1H), 7.17 (d, J = 2.4 Hz, 1H), 6.87 (dd, 1H, J =
8.4 and 2.4 Hz), 4.89 (s, 2H), 4.01 (t, 2H, J = 6.2 Hz), 3.77 (t, 2H, J = 6.5
Hz), and 2.12-2.02 (m, 2H). 13C NMR (75 MHz, CDCl3): δ 168.4,
158.0, 145.9, 133.9, 131.9, 123.2, 121.8, 119.2, 113.6, 70.9, 65.7, 35.4,
28.1. HRMS-EI: [M]þ C18H16BNO5 calcd 337.1121, found 337.1122.
Mp: 159-162 ꢀC. HPLC: purity 96.4% (220 nm, 17.4 min/20 min).
6-Cyclohexylmethoxy-1,3-dihydro-1-hydroxy-2,1-benzox-
aborole (16). Compound 16 was prepared following a similar proce-
dure to compound 12. Yield: 66.0%. 1H NMR (300 MHz, DMSO-d6): δ
9.08 (s, 1H), 7.29 (d, 1H, J = 8.4 Hz), 7.23 (d, 1H, J = 2.4 Hz), 7.03 (dd,
1H, J = 8.4 and 2.7 Hz), 4.90 (m, 2H), 3.78 (d, 2H, J = 6.3 Hz), and 1.83-
1.01 (m, 11H). 13C NMR (75 MHz, CDCl3): δ 158.7, 145.6, 121.9,
119.4, 113.8, 73.8, 71.0, 37.6, 29.8, 26.5, 25.7. HRMS-EI: [M]þ
C14H19BO3 calcd 246.1427, found 246.1433. Mp: 126-127 ꢀC. HPLC:
purity 99.7% (220 nm, 14.1 min/20 min).
6-(2,2-Dimethoxyethoxy)-1,3-dihydro-1-hydroxy-2,1-ben-
zoxaborole (17). Compound 17 was prepared following a similar
procedure to compound 12. Yield: 51.0%. 1H NMR (400 MHz, DMSO-
d6): δ 9.11 (s, 1H), 7.31 (d, 1H, J = 8.4 Hz), 7.25 (d, 1H, J = 2.4 Hz), 7.08
(dd, 1H, J = 8.4 and 2.4 Hz), 4.91 (s, 2H), 4.69 (t, 1H, J = 4.8 Hz), 3.98 (d,
2H, J = 5 Hz) and 3.35 (s, 6H). 13C NMR (75 MHz, CDCl3): δ 158.0,
146.4, 122.1, 119.8, 114.2, 102.1, 70.9, 67.8, 54.1. HRMS-EI: [M]þ
C11H15BO5 calcd 238.1013, found 238.1015. Mp: 102-104 ꢀC. HPLC:
purity 97.2% (220 nm, 10.9 min/15 min).
[2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)]ace-
tic Acid (18). To a solution of compound 26 (50 mg, 0.21 mmol) in
THF (3 mL) was added lithium hydroxide monohydrate (16.8 mg, 0.4
mmol) in water (1 mL). The reaction mixture was stirred at room
temperature for 40 h and then acidified with 1 M HCl (5 mL). The white
solid was filtered and washed with water and dried to give compound 18
(36.6 mg, 88.0%). 1H NMR (400 MHz, DMSO-d6): δ 12.99 (s, 1H), 9.15
(s, 1H), 7.32 (d, 1H, J = 8.1 Hz), 7.19 (d, 1H, J = 2.4 Hz), 7.05 (dd, 1H, J =
8.4 and 2.4 Hz), 4.92 (s, 2H), and 4.67 (s, 2H). 13C NMR (75 MHz,
CDCl3): δ 170.1, 158.3, 147.8, 122.9, 119.5, 114.9, 70.7, 65.3. HRMS-EI:
[M]þ C9H9BO5 calcd 208.0543, found 208.0544. Mp: 166-167 ꢀC.
HPLC: purity 97.8% (220 nm, 4.1 min/15 min).
6-Propoxy-1,3-dihydro-1-hydroxy-2,1-benzoxaborole
(22). Compound 22 was prepared following a similar procedure to
1
compound 12. Yield: 64.0%. H NMR (400 MHz, DMSO-d6): δ
9.10 (s, 1H), 7.29 (d, 1H, J = 8.4 Hz), 7.23 (d, 1H, J = 2.4 Hz), 7.03
(dd, 1H, J = 8.1 and 2.4 Hz), 4.91 (s, 2H), 3.92 (t, 2H, J = 6.8 Hz),
1.78-1.68 (m, 2H), and 0.98 (t, 3H, J = 7.2 Hz). 13C NMR (75
MHz, CDCl3): δ 158.7, 145.6, 121.9, 119.7, 114.0, 70.9, 69.8, 22.6,
10.5. HRMS-EI: [M]þ C10H13BO3 calcd 192.0958, found 192.0959.
Mp: 80-81 ꢀC. HPLC: purity 99.2% (220 nm, 19.5 min/20 min).
6-Isopropoxy-1,3-dihydro-1-hydroxy-2,1-benzoxaborole
(23). Compound 23 was prepared following a similar procedure to
compound 12. Yield: 61.5%. 1H NMR (300 MHz, DMSO-d6): δ 9.10
(s, 1H), 7.27 (d, 1H, J = 8.4 Hz), 7.23 (d, 1H, J = 2.4 Hz), 7.01 (dd, 1H,
J = 8.1 and 2.4 Hz), 4.90 (s, 2H), 4.63-4.53 (m, 1H), and 1.27 (d, 6H,
J = 6 Hz). 13C NMR (75 MHz, CDCl3): δ 157.4, 145.6, 122.1, 121.1, 115.6,
70.9, 70.2, 22.0. HRMS-EI: [M]þ C10H13BO3 calcd 192.0958, found
192.0960. Mp: 62-65 ꢀC. HPLC: purity 95.3% (220 nm, 14.4 min/15 min).
6-Butoxy-1,3-dihydro-1-hydroxy-2,1-benzoxaborole
(24). Compound 24 was prepared following a similar procedure to
compound 12. Yield: 22.0%. 1H NMR (300 MHz, DMSO-d6): δ 9.09 (s,
1H), 7.29 (d, 1H, J = 8.4 Hz), 7.23 (d, 1H, J = 2.4 Hz), 7.03 (dd, 1H, J =
8.1 and 2.4 Hz), 4.91 (s, 2H), 3.90 (t, 2H, J = 6.6 Hz), 1.70 (m, 2H),
1.44(m, 2H), and 0.94 (t, 3H, J = 7.5 Hz). 13C NMR (75 MHz, CDCl3):
δ 158.7, 145.7, 122.0, 119.8, 113.9, 70.9, 67.9, 31.3, 19.2, 13.8. HRMS-
EI: [M]þ C11H15BO3 calcd 206.1114, found 206.1115. Mp: 92-94 ꢀC.
HPLC: purity 96.3% (254 nm, 16.9 min/20 min).
6-(2-Methoxyethoxy)-1,3-dihydro-1-hydroxy-2,1-benzox-
aborole (25). Compound 25 was prepared following a similar
procedure to compound 12. Yield: 43.3%. 1H NMR (400 MHz,
acetone-d6): δ 8.01 (s, 1H), 7.32 (d, 1H, J = 8.4 Hz), 7.26 (d, 1H, J =
2.4 Hz), 7.07 (dd, 1H, J = 8.4 and 2.4 Hz), 4.95 (s, 2H), 4.14 (t, 2H, J =
4.8 Hz), 3.71 (t, 2H, J = 4.8 Hz) and 3.36 (s, 3H). 13C NMR (100 MHz,
CDCl3): δ 158.1, 145.9, 121.9, 119.7, 113.9, 70.9, 70.8, 67.3, 59.0.
HRMS-EI: [M]þ C10H13BO4 calcd 208.0907, found 208.0911. Mp:
68-70 ꢀC. HPLC: purity 95.5% (220 nm, 13.3 min/20 min).
[2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)]
acetaldehyde (19). To a solution of compound 17 (38 mg, 0.16
mmol) in acetone (2 mL) was added 6 M HCl (0.3 mL). The reaction
mixture was stirred at 30 ꢀC for 24 h. The residue after evaporation
was purified by recrystallization (hexane/EtOAc) to give compound
Ethyl
[2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-
yloxy)]acetate (26). It was prepared following a similar procedure
to compound 12. Yield: 61.0%. 1H NMR (300 MHz, DMSO-d6): δ 9.14
(s, 1H), 7.32 (d, 1H, J = 8.1 Hz), 7.19 (d, 1H, J = 2.4 Hz), 7.06 (dd, 1H,
J = 8.4 and 2.7 Hz), 4.92 (s, 2H), 4.77 (s, 2H), 4.17 (q, 2H, J = 7.2 Hz),
and 1.21 (t, 3H, J = 6.9 Hz). 13C NMR (75 MHz, CDCl3): δ 169.0,
157.3, 146.8, 122.2, 119.8, 114.0, 70.9, 65.5, 61.4, 14.1. HRMS-EI: [M]þ
C11H13BO5 calcd 236.0856, found 236.0857. Mp: 96-97 ꢀC. HPLC:
purity 96.3% (254 nm, 13.3 min/20 min).
1
19 (25.3 mg, 82.5%). H NMR (400 MHz, acetone-d6): δ 9.82 (s,
1H), 7.35 (d, 1H, J = 8.0 Hz), 7.23 (d, 1H, J = 2.4 Hz), 7.12 (dd, 1H,
J = 8.1 and 2.4 Hz), 4.96 (s, 2H), and 4.79 (s, 2H). 13C NMR (75 MHz,
CDCl3): δ 198.7, 157.8, 147.5, 122.6, 118.9, 114.6, 73.1, 70.3.
1283
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
Methyl [2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-
yloxy)]acetate (27). It was prepared following a similar procedure
to compound 12. Yield: 61.9%. H NMR (400 MHz, DMSO-d6): δ
following a similar procedure to compound 12. Yield: 61.0%. 1H NMR
(300 MHz, CDCl3): δ 7.23 (d, 1H, J = 8.1 Hz), 7.16 (d, 1H, J = 2.4 Hz),
7.04 (dd, 1H, J = 8.4 and 2.7 Hz), 5.04 (s, 2H), 4.25 (q, 2H, J = 6.9 Hz),
1.60 (s, 6H), and 1.26 (t, 3H, J = 7.2 Hz). 13C NMR (75 MHz, CDCl3):
δ 174.3, 154.7, 147.3, 123.6, 121.8, 120.1, 79.3, 70.9, 61.5, 25.3, 14.0.
HRMS-EI: [M]þ C13H17BO5 calcd 264.1169, found 264.1170. Mp:
63-66 ꢀC. HPLC: purity 97.7% (220 nm, 9.5 min/15 min).
1
9.15 (s, 1H), 7.32 (d, 1H, J = 8.4 Hz), 7.19 (d, 1H, J = 2.4 Hz), 7.06 (dd,
1H, J = 8.4 and 2.7 Hz), 4.92 (s, 2H), 4.80 (s, 2H), and 3.70 (s, 3H). 13C
NMR (75 MHz, CDCl3): δ 169.5, 157.2, 146.9, 122.2, 119.5, 113.7,
70.9, 65.3, 52.2. HRMS-EI: [M]þ C10H11BO5 calcd 222.0699, found
222.0701. Mp: 102-104 ꢀC. HPLC: purity 96.4% (220 nm, 11.9 min/
20 min).
tert-Butyl [2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-
6-yloxy)]acetate (28). This compound was prepared following a
similar procedure to compound 12. Yield: 37.5%. 1H NMR (400 MHz,
DMSO-d6): δ 9.14 (s, 1H), 7.32 (d, 1H, J = 8.1 Hz), 7.18 (d, 1H, J = 2.4
Hz), 7.04 (dd, 1H, J = 8.4 and 2.7 Hz), 4.92 (s, 2H), 4.65 (s, 2H), and
1.42 (s, 9H). 13C NMR (75 MHz, CDCl3): δ 188.1, 157.3, 146.7, 122.1,
119.4, 113.8, 82.4, 70.9, 66.7, 27.9. HRMS-EI: [M]þ C13H17BO5 calcd
264.1169, found 264.1170. Mp: 107-108 ꢀC. HPLC: purity 98.3%
(220 nm, 9.1 min/15 min).
1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yl N-Phenyl-
carbamate (29). Compound 11 (100 mg, 0.667 mmol) was dis-
solved in DMF (10 mL) and cooled to 0 ꢀC. To this solution under
nitrogen were added in sequence Et3N (0.28 mL, 2 mmol) and
isocyanatobenzene (0.85 mL, 6.67 mmol). The reaction mixture was
stirred for 2 d at room temperature and then treated with 1 M HCl (10
mL). After extraction with EtOAc, the organic layer was washed with
water and brine and dried over Na2SO4. The residue after rotary
evaporation was purified by column chromatography over silica gel to
give compound 29 (32 mg, 18.0%). 1H NMR (300 MHz, DMSO-d6): δ
10.23 (s, 1H), 9.25 (s, 1H), 7.53-7.02 (m, 8H), and 5.00 (s, 2H). 13C
NMR (75 MHz, CDCl3): δ 150.5, 149.9, 145.4, 137.7, 128.8, 124.6,
123.4, 122.9, 121.8, 118.7, 70.8. HRMS-ESI: [M þ Na]þ C14H12BNO4-
Na calcd 292.0757, found 292.0802. Mp: 178-180 ꢀC. HPLC: purity
95.2% (254 nm, 13.9 min/20 min).
Ethyl
[2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-
yloxy)]-2-phenylacetate (34). This compound was prepared fol-
1
lowing a similar procedure to compound 12. Yield: 60.0%. H NMR
(300 MHz, CDCl3): δ 7.62-7.56 (m, 2H), 7.44-7.12 (m, 6H), 5.67 (s,
1H), 5.03 (s, 2H), 4.30-4.10 (m, 2H), and 1.20 (t, 3H, J = 7.2 Hz). 13C
NMR (75 MHz, CDCl3): δ 169.9, 156.8, 146.9, 135.4, 128.9, 128.7,
127.1, 122.3, 120.5, 115.3, 78.8, 70.9, 61.7, 13.9. HRMS-EI: [M]þ
C17H17BO5 calcd 312.1169, found 312.1175. Mp: 94-97 ꢀC. HPLC:
purity 97.6% (220 nm, 13.9 min/15 min).
Ethyl-[2-(1,3-dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)]
acetamide (35). Compound 11 (100 mg, 0.667 mmol) was dissolved
in DMSO (10 mL). To this solution under nitrogen were added
potassium carbonate (368 mg, 2.667 mmol), a catalytic amount of
NaI, and 2-chloro-N-ethylacetamide (398 mg, 2.667 mmol). The
reaction mixture was stirred for 36 h at 90 ꢀC and then treated with 1
M HCl (10 mL). After extraction with EtOAc, the organic layer was
washed with water and brine and dried over anhydrous Na2SO4. The
residue after rotary evaporation was purified by column chromatography
over silica gel and recrystallization (hexane/EtOAc) to give compound
35 (34 mg, 22.2%). 1H NMR (400 MHz, DMSO-d6): δ 9.17 (s, 1H),
8.09 (t, 1H, J = 6 Hz), 7.33 (d, 1H, J = 8.4 Hz), 7.24 (d, 1H, J = 2.4 Hz),
7.10 (dd, 1H, J = 8.4 and 2.7 Hz), 4.92 (s, 2H), 4.45 (s, 2H), 3.19-3.11
(m, 2H), and 3.04 (t, 3H, J = 7.2 Hz). 13C NMR (75 MHz, CDCl3): δ
168.4, 166.7, 147.2, 122.3, 118.7, 114.8, 70.8, 67.5, 33.8, 14.4. HRMS-EI:
[M]þ C11H14BNO4 calcd 235.1016, found 235.1017. Mp: 118-119 ꢀC.
HPLC: purity 96.1% (220 nm, 4.6 min/15 min).
1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yl N-Cyclo-
hexylcarbamate (30). This compound was prepared following a
similar procedure to compound 29. Yield: 13.0%. 1H NMR (300 MHz,
acetone-d6): δ 8.09 (s, 1H), 7.42-7.37 (m, 2H), 7.19 (dd, 1H, J = 8.4
and 2.1 Hz), 6.65 (m, 1H), 5.00 (s, 2H), 3.46 (m, 1H), and 1.98-1.15
(m, 10H). 13C NMR (100 MHz, CDCl3): δ 156.7, 152.0, 147.2, 125.9,
123.9, 123.2, 72.1, 51.7, 34.1, 26.6, 26.2. HRMS-ESI: [M þ Na]þ
C14H18BNO4 calcd 298.1227, found 298.1249. Mp: 198-200 ꢀC.
HPLC: purity 99.8% (220 nm, 10.6 min/20 min).
N-tert-Butyl-2-(1,3-dihydro-1-hydroxy-2,1-benzoxaborol-
6-yloxy)acetamide (36). This compound was prepared following a
similar procedure to compound 35. Yield: 35.4%. 1H NMR (400 MHz,
DMSO-d6): δ 9.13 (s, 1H), 7.41 (s, 1H), 7.32 (d, 1H, J = 8.4 Hz), 7.22 (s,
1H), 7.07 (d, 1H, J = 8.4 Hz), 4.92 (s, 2H), 4.39 (s, 2H), and 1.29 (s,
9H). 13C NMR (75 MHz, CDCl3): δ 167.5, 156.6, 147.2, 122.2, 118.7,
114.9, 70.9, 67.8, 51.3, 28.6. HRMS-EI: [M]þ C13H18BNO4 calcd
263.1329, found 263.1330. Mp: 149-150 ꢀC. HPLC: purity 97.8%
(220 nm, 13.5 min/20 min).
Ethyl
[2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-
1-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)pentan-
2-one (37). This compound was prepared following a similar proce-
dure to compound 12. Yield: 33.6%. 1H NMR (400 MHz, acetone-d6): δ
9.14 (s, 1H), 7.33 (d, 1H, J = 8.1 Hz), 7.19 (d, 1H, J = 2.4 Hz), 7.08 (dd,
1H, J = 8.4 and 2.7 Hz), 4.96 (s, 2H), 4.73 (s, 2H), 2.57 (t, 2H, J = 7.2
Hz), 1.66-1.55 (m, 2H), and 0.92 (t, 3H, J = 7.6 Hz). 13C NMR (100
MHz, CDCl3): δ 207.8, 157.4, 146.8, 122.4, 119.6, 114.1, 72.9, 70.9,
40.9, 16.6, 13.7. HRMS-ESI: [M þ H]þ C12H16BO4 calcd 235.1141,
found 235.1163. Mp: 107-109 ꢀC. HPLC: purity 97.9% (220 nm, 11.2
min/15 min).
yloxy)]propanoate (31). This compound was prepared following
a similar procedure to compound 12. Yield: 57.0%. 1H NMR (300 MHz,
DMSO-d6): δ 9.18 (s, 1H), 7.31 (d, J = 8.1 Hz, 1H), 7.14 (d, J = 2.4 Hz,
1H), 7.02 (dd, J = 8.4 and 2.7 Hz, 1H), 4.95-4.87 (m, 3H), 4.19-4.08
(m, 2H), 1.51 (d, J = 6.6 Hz, 3H), and 1.17 (t, J = 7.2 Hz, 3H). 13C NMR
(75 MHz, CDCl3): δ 172.3, 157.1, 146.6, 122.2, 120.2, 114.7, 72.7,
70.8, 61.4, 18.5, 14.1. HRMS-EI: [M]þ C12H15BO5 calcd 250.1012,
found 250.1014. Mp: 65-67 ꢀC. HPLC: purity 97.3% (220 nm, 16.6
min/20 min).
Ethyl
[2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-
1-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)butan-
2-one (38). This compound was prepared following a similar proce-
dure to compound 12. Yield: 30.0%. 1H NMR (300 MHz, CDCl3): δ
7.24 (d, 1H, J = 8.1 Hz), 7.09 (d, 1H, J = 2.4 Hz), 7.05 (dd, 1H, J = 8.4
and 2.7 Hz), 5.02 (s, 2H), 4.57 (s, 2H), 2.60 (q, 2H, J = 7.2 Hz), and 1.08
(t, 3H, J = 7.5 Hz). 13C NMR (100 MHz, CDCl3): δ 208.4, 157.4, 146.9,
122.4, 119.6, 113.9, 72.7, 70.9, 32.4, 7.1. HRMS-ESI: [M þ Na]þ
C11H13BO4Na calcd 243.0805, found 243.0839. Mp: 83-85 ꢀC. HPLC:
purity 95.4% (220 nm, 9.6 min/15 min).
yloxy)]butanoate (32). This compound was prepared following a
similar procedure to compound 12. Yield: 62.5%. 1H NMR (300 MHz,
DMSO-d6): δ 9.17 (s, 1H), 7.31 (d, 1H, J = 8.1 Hz), 7.16 (d, 1H, J = 2.4
Hz), 7.03 (dd, 1H, J = 8.4 and 2.7 Hz), 4.91 (s, 2H), 4.73 (t, 1H, J = 5.4
Hz, 1H), 4.20-4.09 (m, 2H), 1.96-1.83 (m, 2H), 1.17 (t, 3H, J = 6.9
Hz), and 1.00 (t, 3H, J = 7.2 Hz). 13C NMR (75 MHz, CDCl3): δ 171.8,
157.5, 146.6, 122.2, 120.2, 114.9, 77.9, 70.9, 61.2, 26.1, 14.1, 9.6. HRMS-
EI: [M]þ C13H17BO5 calcd 264.1169, found 264.1168. Mp: 90-92 ꢀC.
HPLC: purity 97.8% (220 nm, 18.1 min/20 min).
2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)
pentan-3-one (39). This compound was prepared following a similar
procedure to compound 12. Yield: 38.0%. 1H NMR (400 MHz, CDCl3):
Ethyl
[2-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-
yloxy)]-2-methylpropanoate (33). This compound was prepared
1284
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
δ 7.21 (d, 1H, J = 8.1 Hz), 7.06 (d, 1H, J = 2.4 Hz), 6.98 (dd, 1H, J = 8.4
and 2.7 Hz), 5.00 (s, 2H), 4.67 (q, 1H, J = 6.8 Hz), 2.73-2.61 (m, 1H),
2.49-2.39 (m, 1H), 1.47 (d, 3H, J = 6.8 Hz), and 0.99 (t, 3H, J = 7.2 Hz).
13C NMR (75 MHz, CDCl3): δ 213.2, 157.3, 146.9, 122.7, 120.1, 114.9,
79.5, 71.1, 30.5, 18.1, 7.3. HRMS-EI: [M]þ C12H15BO4 calcd 234.1063,
found 234.1065. Mp: 72-74 ꢀC. HPLC: purity 96.4% (280 nm, 12.1
min/15 min).
C13H17BO4Na calcd 271.1118, found 271.1155. Mp: 58-59 ꢀC. HPLC:
purity 96.6% (220 nm, 12.8 min/15 min).
1-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)-4-
methylpentan-2-one (46). This compound was prepared follow-
ing a similar procedure to compound 12. Yield: 45.0%. 1H NMR (400
MHz, DMSO-d6): δ 9.12 (s, 1H), 7.31 (d, 1H, J = 8.0 Hz), 7.15 (d, 1H, J
= 2.8 Hz), 7.03 (dd, 1H, J = 8.4 and 2.4 Hz), 4.95 (s, 2H), 4.78 (s, 2H),
2.40 (d, 2H, J = 7.2 Hz), 2.12-2.02 (m, 1H), and 0.88 (d, 6H, J = 6.8
Hz). 13C NMR (100 MHz, CDCl3): δ 207.2, 157.3, 146.8, 122.3, 119.5,
113.9, 73.1, 70.9, 47.8, 24.1, 22.6. HRMS-ESI: [M þ H]þ C13H18BO4
calcd 249.1298, found 249.1317. Mp: 107-108 ꢀC. HPLC: purity 98.9%
(220 nm, 12.3 min/15 min).
6-(2-Hydroxy-1-methylbutoxy)-1,3-dihydro-1-hydroxy-2,1-
benzoxaborole (47). Compound 39 (75 mg, 0.32 mmol) was
dissolved in MeOH (3 mL) and cooled to 0 ꢀC. To this solution was
added NaBH4 (18.1 mg, 0.48 mmol). The reaction mixture was stirred
for 2 h and then treated with saturated HCl (1 M). After evaporation, the
residue was extracted with EtOAc and the organic layer was washed with
water and brine. The residue after rotary evaporation was purified by
preparative TLC to give compound 47 (45 mg, 59.0%) as a viscous oil.
1H NMR (400 MHz, CD3OD): δ 7.23 (d, 1H, J = 8.1 Hz), 7.16 (d, 1H,
J = 2.4 Hz), 7.05 (dd, 1H, J = 8.4 and 2.7 Hz), 4.97 (s, 2H), 4.37-4.25
(m, 1H), 4.62-4.50 (m, 1H), 1.71-1.40 (m, 2H), 1.25 (t, 3H, J = 6 Hz),
and 1.02-0.95 (m, 3H). 13C NMR (100 MHz, CDCl3): δ 157.2, 146.5,
122.2, 121.0, 116.0, 75.9, 74.7, 70.9, 25.7, 15.7, 9.8. HRMS-ESI: [M þ
Na] C12H17BO4Na calcd 259.1118, found 259.1123. HPLC: purity
96.9% (220 nm, 11.6 min/15 min).
3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)
heptan-4-one (40). This compound was prepared following a
1
similar procedure to compound 12. Yield: 45.0%, as a viscous oil. H
NMR (400 MHz, CDCl3): δ 7.21 (d, 1H, J = 8.1 Hz), 7.07 (d, 1H, J = 2.4
Hz), 6.99 (dd, 1H, J = 8.4 and 2.7 Hz), 4.99 (s, 2H), 4.45-4.44 (m, 1H),
2.61-2.51 (m, 1H), 2.40-2.30 (m, 1H), 1.90-1.78 (m, 2H), 1.57-
1.47 (m, 2H), 1.03-0.98 (m, 3H), and 0.85-0.79 (m, 3H). 13C NMR
(100 MHz, CDCl3): δ 212.8, 157.7, 146.8, 122.5, 119.7, 115.1, 84.7,
71.0, 39.6, 25.8, 16.5, 13.8, 9.8. HRMS-EI: [M]þ C14H19BO4 calcd
262.1376, found 262.1375. HPLC: purity 95.3% (220 nm, 10.2 min/
15 min).
3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)butan-
2-one (41). This compound was prepared following a similar proce-
dure to compound 12. Yield: 62.3%. 1H NMR (400 MHz, CDCl3): δ
7.25 (d, 1H, J = 8.1 Hz), 7.10 (d, 1H, J = 2.4 Hz), 7.02 (dd, 1H, J = 8.4
and 2.7 Hz), 5.04 (s, 2H), 4.66 (q, 1H, J = 6.8 Hz), 2.19 (s, 3H), and 1.51
(d, 3H, J = 7.2 Hz). 13C NMR (75 MHz, CDCl3): δ 210.9, 157.2, 147.0,
122.7, 120.1, 114.9, 79.6, 71.1, 25.0, 17.8. HRMS-EI: [M]þ C11H13BO4
calcd 220.0907, found 220.0906. Mp: 90-92 ꢀC. HPLC: purity 97.1%
(220 nm, 9.9 min/15 min).
3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)-3-
methylbutan-2-one (42). This compound was prepared following
a similar procedure to compound 12. Yield: 25.6%, as a viscous oil. 1H
NMR (400 MHz, CDCl3): δ 7.20 (d, 1H, J = 8.1 Hz), 7.05 (d, 1H, J = 2.4
Hz), 6.93 (dd, 1H, J = 8.4 and 2.7 Hz), 5.00 (s, 2H), 2.27 (s, 3H), and
1.44 (s, 6H). 13C NMR (100 MHz, CDCl3): δ 221.2, 154.4, 147.3,
122.7, 121.9, 119.4, 84.2, 70.9, 24.4, 23.7. HRMS-ESI: [M þ H]þ
C12H16BO4 calcd 235.1141, found 235.1171. HPLC: purity 96.3% (220
nm, 11.5 min/15 min).
3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)pentan-
2-one (43). This compound was prepared following a similar proce-
dure to compound 12. Yield: 50.9%. 1H NMR (400 MHz, DMSO-d6): δ
9.14 (s, 1H), 7.31 (d, 1H, J = 8.1 Hz), 7.12 (d, 1H, J = 2.4 Hz), 7.04 (dd,
1H, J = 8.4 and 2.7 Hz), 4.91 (s, 2H), 4.67-4.61 (m, 1H), 2.14 (s, 3H),
1.91-1.78 (m, 2H), and 0.96 (t, 3H, J = 7.6 Hz). 13C NMR (100 MHz,
CDCl3): δ 210.9, 157.4, 146.7, 122.4, 119.7, 114.6, 84.5, 70.9, 25.5, 25.4,
9.6. HRMS-ESI: [M þ H]þ C12H16BO4 calcd 235.1141, found
235.1161. Mp: 68-70 ꢀC. HPLC: purity 96.6% (220 nm, 11.5 min/
15 min).
Molecular Modeling. The sequence of Trypanosoma brucei
LeuRS was retrieved from the protein knowledge base (Q386D9),
and amino acids 250-511 corresponding to the editing domain were
used in the modeling. Prime 2.0 (Schr€odinger, LLC) was used to
construct the homology model of T. brucei LeuRS editing domain using
the Candida albicans LeuRS editing domain (PDB code 2WFG)15 as the
template. Secondary structures were predicted with SSPro, and se-
quence alignment was manually adjusted. The homology model contain-
ing amino acids 254-507 was further refined using the Refinement
module with the emphasis on the loops and the active site residues.
Hydrogen atoms and hydrogen bonds were optimized with Protein
Preparation Wizard and checked with Procheck.16
The coordinates of benzoxaborole compounds in thebinding site were
generated based on the coordinates of (6-(ethylamino)-5-fluorobenzo-
[c][1,2]oxaborol-1(3H)-ol) (AN3018) complexed in C. albicans
LeuRS15 followed by minimization in MacroModel using OPLS_2005
force field and Polak-Ribiere conjugate gradient (PRCG) method with
termination threshold of 2000 steps or energy convergence gradient of
0.03 kJ/mol. The ligand and residues within 5 Å were set to be free.
3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)hexan-
2-one (44). This compound was prepared following a similar proce-
Residues between 5 and 10 Å were constrained by 200 kcal/(mol Å2)
3
force, and residues between 10 and 15 Å were set to be frozen.
Expression Construct. T. brucei LeuRS coding region was am-
plified by polymerase chain reaction from genomic DNA isolated from
T. brucei (TREU927) using the following primers: forward, 50-GA-
TAGTCATATGTCGACTGTACGACGTGAT; reverse, 50-GA-
TAGTGGATCCTGCCTTCTTGTCCGGAAAGGC. The PCR
product was digested with NdeI/BamHI and cloned into NdeI/BamHI
site of pET21a(þ) (Novagen, Gibbstown, NJ) with fused His tag at
the C-terminus. Correct construct was confirmed by sequencing
and used to transform E. coli BL21(DE3)-RIPL (Stratagene, La Jolla,
CA). The resulting colonies were selected for the ability of induced
expression by 0.1 mM IPTG at 37 ꢀC for 3 h as described by the
Novagen manual.
1
dure to compound 12. Yield: 50.4%, as a viscous oil. H NMR (300
MHz, CDCl3): δ 7.23 (d, 1H, J = 8.1 Hz), 7.07 (d, 1H, J = 2.4 Hz), 7.00
(dd, 1H, J = 8.4 and 2.7 Hz), 5.02 (s, 2H), 4.52-4.44 (m, 1H), 2.13 (s,
3H), 1.91-1.71 (m, 2H), 1.59-1.45 (m, 2H), and 0.94 (t, 3H, J = 7.2
Hz). 13C NMR (100 MHz, CDCl3): δ 210.9, 157.3, 146.6, 122.2, 119.2,
114.5, 83.1, 70.9, 34.1, 25.1, 18.4, 13.6. HRMS-ESI: [M þ Na]þ
C13H17BO4Na calcd 271.1118, found 271.1156. HPLC: purity 95.4%
(220 nm, 9.1 min/15 min).
3-(1,3-Dihydro-1-hydroxy-2,1-benzoxaborol-6-yloxy)-4-
methylpentan-2-one (45). This compound was prepared follow-
ing a similar procedure to compound 12. Yield: 16.0%. 1H NMR (400
MHz, CDCl3): δ 7.21 (d, 1H, J = 8.1 Hz), 7.06 (d, 1H, J = 2.4 Hz), 6.99
(dd, 1H, J = 8.4 and 2.7 Hz), 5.00 (s, 2H), 4.19 (d, 1H, J = 6 Hz), 2.22-
2.15 (m, 1H), 2.10 (s, 3H), 1.05 (d, 3H, J = 6.8 Hz), and 0.98 (d, 3H, J =
6.8 Hz). 13C NMR (100 MHz, CDCl3): δ 210.7, 157.8, 146.8, 122.4,
119.6, 114.8, 88.4, 70.9, 31.3, 26.2, 18.7, 17.9. HRMS-ESI: [M þ Na]þ
Protein Expression. LeuRS was expressed in LB medium with 50
μg/mL ampicillin as described by the Novagen manual. The expression
induction was performed at 20 ꢀC overnight to increase soluble portion
of the protein. The cell was collected and lysed by sonication and purified
1285
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
by His-Bind (Novagen). The purity and concentration of LeuRS was
determined by SDS-PAGE with BSA as concentration standard.
Aminoacylation Assay. All compounds were dissolved in DMSO.
Experiments were performed in 70 μL reaction mixtures containing 50 mM
HEPES-KOH (pH 7.8), 5 mM MgCl2, 45 mM KCl, 1 mM DTT, 0.02%
BSA (W/V), 0.4 mg/mL brewer’s yeast tRNA (Roche), 4 mM ATP, 10 μM
[14C]Leu, 2 nM tbLeuRS, and compounds at varied concentrations. The
reaction mixture without ATP was first preincubated at 37 ꢀC for 20 min.
Then the reaction was initiated by adding ATP. After 15 min, three aliquots
of 20 μL of reaction solution were quenched on Whatman filter with 5%
trichloroacetic acid (TCA) and washed three times with 95% ethanol. The
filter was then dried under an infrared heat lamp, and the radioactivity of the
precipitate was quantified using a scintillation counter. For each IC50 curve,
nine data points at different concentrations were collected and the sigmoidal
dose response curve fitting was done with GraphPad Prism. Compound 1c
was used as internal reference for each testing batch. Duplicates of IC50
curves at different time period over 3 years showed an average error range of
2-fold (for example, IC50 value of 1c ranges from 15 to 30 μM), which is
reasonable for aaRS assays.
added to each well, and plates were incubated for an additional 3-4 h.
Assay plates were read using an EnVision plate reader at an excitation
wavelength of 544 nm and emission of 590 nm. Single data points were
used to generate sigmoidal dose response curves and determine IC50
values using XLfit curve fitting software from IDBS (Guildford, U.K.).
’ AUTHOR INFORMATION
Corresponding Author
*Phone: þ86(21)34206721. Fax: þ86(21)34204457. E-mail:
hczhou@sjtu.edu.cn.
Author Contributions
^These authors contributed equally to this work.
’ ACKNOWLEDGMENT
We thank National Science Foundation of China (Grant
20702031) and Ministry of Science and Technology of China
(Grant 2009CB918404) for financial support of this work.
In Vitro Trypanosoma brucei Assay. All in vitro antiparasite
assays were conducted with the bloodstream-form Trypanosoma brucei
brucei 427 strain. Parasites were cultured in T-25 vented cap flasks and
kept in humidified incubators at 37 ꢀC and 5% CO2. The parasite culture
medium was complete HMI-9 medium (Hirumi, H.; Hirumi, K. Con-
tinuous cultivation of Trypanosoma brucei bloodstream forms in a
medium containing a low concentration of serum protein without feeder
cell layers. J. Parasitol. 1989, 75, 985-989) containing 10% FBS, 10%
Serum Plus medium, and penicillin/streptomycin. To ensure log growth
phase, trypanosomes were subcultured at appropriate dilutions every 2-
3 days. The log phase cultures were diluted 1:10 in HMI-9, and 10 μL
was counted using hemocytometer to determine parasite concentration.
Parasites were diluted to 2 ꢀ 105/mL in HMI-9 to generate a 2-fold
working concentration for assay. Compounds to be tested were serially
diluted in DMSO, and 0.5 μL was added to 49.5 μL HMI-9 in triplicate
96-well plates using a Biomek NX liquid handler. Parasites from the
diluted stock were added to each well (50 μL) using a Multidrop 384
dispenser to give a final concentration of 1.0 ꢀ 105/mL parasites in 0.4%
for DMSO. Trypanosomes were incubated with compounds for 72 h at
37 ꢀC with 5% CO2. Resazurin (20 μL of 12.5 mg/mL stock) from
Sigma-Aldrich was added to each well, and plates were incubated for an
additional 2-4 h. Assay plates were read using an EnVision plate reader
at an excitation wavelength of 544 nm and emission of 590 nm.
Triplicate data points were averaged to generate sigmoidal dose
response curve and to determine IC50 values using XLfit curve fitting
software from IDBS (Guildford, U.K.). IC50 values were measured in
triplicate with an error range of (0.2 μM. Suramin and pentamidine are
used as positive control, and typical average IC50 values are 0.007 μg/mL
(0.005 μM) and 0.009 μg/mL (0.026 μM), respectively.
In Vitro Mammalian Cell Cytotoxicity Assay. For evaluation
of compound effects on mammalian cells, L929 mouse fibroblast cells
were used. Cells were maintained as adherent cultures in T-25 vented cap
flasks in a humidified incubator at 37 ꢀC in the presence of 5% CO2.
Culture medium was D-MEM supplemented with 10% fetal bovine serum
and 1% penicillin/streptomycin. L929 cells were maintained below
confluent levels by subculturing at 1:10 dilution twice weekly using
0.05% trypsin for detachment. Subconfluent L929 cells were trypsinized,
resuspended in fresh medium, and 10 μL was counted using hemocyt-
ometer to determine cell concentration. Cells were diluted to 1 ꢀ 104/mL
in DMEM, dispensed (100 μL) into 96-well plates using a Multidrop 384
dispenser, and allowed to attach overnight. Spent medium was replaced
with 99.5 μL of fresh D-MEM. Compounds to be tested were serially
diluted in DMSO, and 0.5 μL was added using a Biomek NX liquid
handler. Plates were incubated with compounds for 72 h at 37 ꢀC with 5%
CO2. Resazurin (20 μL of 12.5 mg/mL stock) from Sigma-Aldrich was
’ ABBREVIATIONS USED
T. brucei, Trypanosoma brucei; TbLeuRS, T. brucei leucyl-tRNA
synthetase; LeuRS, leucyl-tRNA synthetase; aaRS, aminoacyl-
tRNA synthetase; IleRS, isoleucyl-tRNA synthetase; MetRS,
methionyl-tRNA synthetase; AsnRS, asparaginyl-tRNA synthe-
tase; CaLeuRS, Candida albicans LeuRS
’ REFERENCES
(1) Hotez, P. J.; Molyneux, D. H.; Fenwick, A.; Kumaresan, J.; Sachs,
S. E.; Sachs, J. D.; Savioli, L. Control of neglected tropical diseases. N.
Engl. J. Med. 2007, 357, 1018–1027.
(2) Croft, S. L.; Barrett, M. P.; Urbina, J. A. Chemotherapy of
trypanosomiases and leishmaniasis. Trends Parasitol. 2005, 21, 508–512.
(3) Renslo, A. R.; McKerrow, J. H. Drug discovery and development
for neglected parasitic diseases. Nat. Chem. Biol. 2006, 2, 701–710.
(4) Pink, R.; Hudson, A.; Mouries, M. A.; Bendig, M. Challenges in
antiparasitic drug discovery. Nat. Rev. Drug Discovery 2005, 4, 727–740.
(5) Hurdle, J. G.; O’Neill, A. J.; Chopra, I. Prospects for aminoacyl-
tRNA synthetase inhibitors as new antimicrobial agents. Antimicrob.
Agents Chemother. 2005, 49, 4821–4833.
(6) Kim, S.; Lee, S. W.; Choi, E. C.; Choi, S. Y. Aminoacyl-tRNA
synthetases and their inhibitors as a novel family of antibiotics. Appl.
Microbiol. Biotechnol. 2003, 61, 278–288.
(7) Hendrickson, T. L.; Schimmel, P. Transfer RNA-Dependent
Amino Acid Discrimination by Aminoacyl-tRNA Synthetases. In Trans-
lation Mechanisms; Lapointe, J., Brakier-Gingras, L., Eds.; Kluwer Aca-
demic and Plenum Publishers: New York, 2003.
(8) Green, L. S.; Bullard, J. M.; Ribble, W.; Dean, F.; Ayers, D. F.;
Ochsner, U. A.; Janjic, N.; Jarvis, T. C. Inhibition of methionyl-tRNA
synthetase by REP8839 and effects of resistance mutations on enzyme
activity. Antimicrob. Agents Chemother. 2009, 53, 86–94.
(9) Rock, F. L.; Mao, W.; Yaremchuk, A.; Tukalo, M.; Crepin, T.;
Zhou, H.; Zhang, Y. K.; Hernandez, V.; Akama, T.; Baker, S. J.; Plattner,
J. J.; Shapiro, L.; Martinis, S. A.; Benkovic, S. J.; Cusack, S.; Alley, M. R. K.
An antifungal agent inhibits an aminoacyl-tRNA synthetase by trapping
tRNA in the editing site. Science 2007, 316, 1759–1761.
(10) Lincecum, T. L.; Tukalo, M.; Yaremchuk, A.; Mursinna, R. S.;
Williams, A. M.; Sproat, B. S.; Eynde, W. V. D.; Link, A.; Calenbergh,
S. V.; Grotli, M.; Martinis, S. A.; Cusack, S. Structural and mechanistic
basis of pre- and posttransfer editing by leucyl-tRNA synthetase. Mol.
Cell 2003, 11, 951–963.
(11) Zhou, X. L.; Zhu, B.; Wang, E. D. The CP2 domain of leucyl-
tRNA synthetase is crucial for amino acid activation and post-transfer
editing. J. Biol. Chem. 2008, 283, 36608–36616.
1286
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287

Journal of Medicinal Chemistry
ARTICLE
(12) Sukuru, S. C. K.; Crepin, T.; Milev, Y.; Marsh, L. C.; Hill, J. B.;
Anderson, R. J.; Morris, J. C.; Rohatgi, A.; O’Mahony, G. O.; Grotli, M.;
Danel, F.; Page, M. G. P.; Hartlein, M.; Cusack, S.; Kron, M. A.; Kuhn,
L. A. Discovering new classes of Brugia malayi asparaginyl-tRNA
synthetase inhibitors and relating specificity to conformational change.
J. Comput.-Aided Mol. Des. 2006, 20, 159–178.
(13) Ye, L.; Ding, D.; Feng, Y.; Xie, D.; Wu, P.; Guo, H.; Meng, Q.;
Zhou, H. Convenient and versatile synthesis of formyl-substituted
benzoxaboroles. Tetrahedron 2009, 65, 8738–8744.
(14) Ding, D.; Zhao, Y.; Meng, Q.; Xie, D.; Nare, B.; Chen, D.;
Bacchi, C. J.; Yarlett, N.; Zhang, Y. K.; Hernandez, V.; Xia, Y.; Freund, Y.;
Abdulla, M.; Ang, K. H.; Ratnam, J.; McKerrow, J. H.; Jacobs, R. T.;
Zhou, H.; Plattner, J. J. Discovery of novel benzoxaborole-based potent
antitrypanosomal agents. ACS Med. Chem. Lett. 2010, 1, 165–169.
(15) Seiradake, E.; Mao, W.; Hernandea, V.; Baker, S. J.; Plattner,
J. J.; Alley, M. R. K.; Cusack, S. Crystal structures of the human and
fungal cytosolic leucyl-tRNA synthetase editing domains: a structural
basis for the rational design of antifungal benzoxaboroles. J. Mol. Biol.
2009, 390, 196–207.
(16) Laskowski, R. A.; MacArthur, M. W.; Moss, D. S.; Thornton,
J. M. PROCHECK: a program to check the stereochemical quality of
protein structures. J. Appl. Crystallogr. 1993, 26, 283–291.
1287
dx.doi.org/10.1021/jm101225g |J. Med. Chem. 2011, 54, 1276–1287