Ethionamide boosters: Synthesis, biological activity, and structure-activity relationships of a series of 1,2,4-oxadiazole EthR inhibitors

ARTICLE

pubs.acs.org/jmc

Ethionamide Boosters: Synthesis, Biological Activity, and

StructureꢀActivity Relationships of a Series of 1,2,4-Oxadiazole

EthR Inhibitors

||

||,^

Marion Flipo,^{†,‡,§, ,^,b}Matthieu Desroses,^{b,†,‡,§, ,^}Nathalie Lecat-Guillet,^{†, ,^,#,3,O}Bertrand Diriꢀe,^†,‡,§,

||

||,^

Xavier Carette,^{†, ,^,#,3,O}Florence Leroux,^{†,‡,§, ,^}Catherine Piveteau,^{†,‡,§, ,^}Fatma Demirkaya,^†,‡,§,

Zoꢀe Lens,^†,[,zPrakash Rucktooa,^†,[Vincent Villeret,^†,[Thierry Christophe,^þHee Kyoung Jeon,^þ

||

||,^,#,3,O,b

Camille Locht,^{†, ,#,3,O}Priscille Brodin,^{†, ,#,3,O,þ}Benoit Dꢀeprez,*^{,†,‡,§, ,^}Alain R. Baulard,^†,

and Nicolas Willand^†,‡,§,

||,^,b

^†Univ Lille Nord de France, F-59000 Lille, France

^‡Biostructures and Drug Discovery, INSERM U761, F-59000 Lille, France

^§UDSL, F-59000 Lille, France

IPL, F-59019 Lille, France

^{^}PRIM, F-59000 Lille, France

^#INSERM U1019, F-59000 Lille, France

³CNRS UMR8204, F-59021 Lille, France

^OCenter for Infection and Immunity of Lille, F-59019 Lille, France

^[IRI, USR 3078 CNRS, F-59658 Villeneuve d'Ascq, France

^zLaboratory of Molecular Virology, IBBM, ULB, 6041 Gosselies, Belgium

^þBiology of Intracellular Pathogens Inserm Avenir, IPK, 463-400 Gyeonggi-do, South Korea

ABSTRACT: We report in this article an extensive structureꢀ

activity relationships (SAR) study with 58 thiophen-2-

yl-1,2,4-oxadiazoles as inhibitors of EthR, a transcriptional

regulator controling ethionamide bioactivation in Mycobacter-

ium tuberculosis. We explored the replacement of two key fragments of the starting lead BDM31343. We investigated the potency of

all analogues to boost subactive doses of ethionamide on a phenotypic assay involving M. tuberculosis infected macrophages and then

ascertained the mode of action of the most active compounds using a functional target-based surface plasmon resonance assay. This

process revealed that introduction of 4,4,4-triﬂuorobutyryl chain instead of cyanoacetyl group was crucial for intracellular activity.

Replacement of 1,4-piperidyl by (R)-1,3-pyrrolidyl scaﬀold did not enhance activity but led to improved pharmacokinetic

properties. Furthermore, the crystal structures of ligandꢀEthR complexes were consistent with the observed SAR. In conclusion, we

identiﬁed EthR inhibitors that boost antibacterial activity of ethionamide with nanomolar potency while improving solubility and

metabolic stability.

’ INTRODUCTION

regions remain below the 85% target.⁶In addition, the global

human immunodeficiency virus (HIV) epidemic has caused an

explosive escalation in TB incidence and may be contributing to

the increasing emergence of multidrug resistant TB (MDR-TB).

The treatment of MDR-TB is long, usually two to four years, and

requires the use of second line drugs that are less effective

and often badly tolerated, especially by individuals with a de-

pressed immune system, leading to high rates of recurrence and

mortality.⁷In parallel to the development of new highly active

antibiotics designed to shorten treatment time, any strategy able

to improve the efficacy of existing drugs should increase the

Tuberculosis at a Glance. Tuberculosis (TB) is the second

leading cause of death among all infectious diseases, killing an

estimated 1.7 million people every year. Rates of TB continue to

rise even in the 21st century, with approximately 9.4 million of

new cases and 13.7 million of chronic active cases in 2009.¹The

directly observed treatment short course (DOTS), a multidrug

therapy program developed by the World Health Organization, is

today considered as the major weapon against the global

tuberculosis epidemic. DOTS covers approximately 77% of the

world’s population,^2,3and the treatment success in the 2007

DOTS campaign was 86% overall.⁴However, the regional

average cure rates in some African,⁵American, and European

Received: January 24, 2011

Published: March 21, 2011

r

2011 American Chemical Society

2994

dx.doi.org/10.1021/jm200076a J. Med. Chem. 2011, 54, 2994–3010

|

Journal of Medicinal Chemistry

ARTICLE

Figure 1. Structure of ETHꢀNADH adduct, formed after the mycobacterial activation of ETH by the monooxygenase EthA and responsible for InhA

inhibition. This process is under the control of the transcriptional regulator EthR.

observance of the therapy by patients and thus would benefit the

global effectiveness of DOTS.

pharmacokinetic profile. Both compounds were evaluated in

M. tuberculosis infected mice. The coadministration of 2 at

100 mg/kg with ethionamide resulted in a minor effect on the

bacterial load in the lung of treated animals when compared to

the treatment with ethionamide alone. In contrast, daily treat-

ment with 1 at 100 mg/kg was able to triple the activity of

ethionamide in the same animal model. Having demonstrated

the concept that boosting ethionamide with EthR inhibitors was

successful to reduce the dose of antitubercular agent while

keeping the same efficacy, we report now the SAR studies of

thiophen-2-yl-1,2,4-oxadiazole analogues based on ex vivo phe-

notypic and in vitro functional assays. In parallel, we performed

cocrystallization to understand the binding mode of our com-

pounds to the repressor EthR. Finally, physicochemical and

pharmacokinetic properties of two promising compounds were

measured (Figure 2).

Boosting Ethionamide Bioactivation As an Alternative

Therapeutic Approach. Ethionamide is one of the drugs

recommended by WHO for the treatment of MDR-TB.⁸It is a

very efficient drug active against more than 80% of MDR-TB

clinical strains.⁹However, it has a low therapeutic index. Indeed,

the minimal dose necessary to inhibit M. tuberculosis growth is

generally sufficient to produce serious adverse effects such as

gastrointestinal disturbances, hepatitis, and mental disturbances,

including depression, anxiety, and psychosis.¹⁰Like several other

antituberculous drugs, body circulating ethionamide is inactive

and needs to be enzymatically activated inside the mycobacteria

to reveal its antibacterial potency. Because most of the side effects

of ethionamide are dose-related,¹¹we postulated that increasing

bacterial bioactivation would make lower circulating doses as

active against the mycobacteria but with limited dose-related

toxicity of the parent compound. It has been shown that the

mycobacterial flavin adenine dinucleotide-containing monoox-

ygenase EthA is central in the bioactivation process of

ethionamide.^12,13The corresponding NAD-adduct produced

eventually inhibits the M. tuberculosis enoyl-ACP reductase InhA

involved in cell wall synthesis (Figure 1).¹⁴The transcription of

ethA is under the control of the transcriptional regulator encoded

by the neighboring gene ethR.^15,16As EthR represses ethA

transcription, chromosomal inactivation of ethR was shown to

sensitize the bacteria to ethionamide.¹⁷On the basis of these

observations, we postulated that a drug-like inhibitor of EthR

would increase the production of EthA and, consequently, the

sensitivity of M. tuberculosis to ethionamide.^17,18The analysis of

the two known crystals of liganded EthR (PDB codes: 1U9N,

1T56)^18ꢀ20suggested that holoprotein conformations are un-

able to bind DNA and thus to repress transcription of ethA. The

chemical structure of the ligands identified in these holostruc-

tures, associated to the physicochemical properties of the EthR

ligand binding domain inspired the design and the synthesis of a

focused library of 131 compounds. The ability of these ligands to

inhibit the DNA-binding function of EthR was measured and this

led to the identification of a thiophen-2-yl-1,2,4-oxadiazole

family of potent inhibitors. Preliminary hit optimization led to

the identification of two analogues 1 (BDM31343) and 2

(BDM31381).²¹Compound 2 was the most potent booster of

ethionamide bioactivation in vitro but was rapidly cleared in mice

resulting in low systemic exposure. Inversely, compound 1 was a

less active compound in vitro, but showed a more favorable

’ CHEMISTRY

We focused chemistry at the R position by the introduction of

ﬁve-membered heteroaromatic or substituted phenyl acetyl

groups and alicyclic or aliphatic chains according to chemistry

described in Scheme 1 (compounds 1ꢀ52). In a second round of

optimization, we studied the replacement of the 1,4-piperidine

scaﬀold with smaller saturated nitrogen heterocycles (com-

pounds 53ꢀ57) or aminopropyl linker (compound 58) sub-

stituted on nitrogen by 4,4,4-triﬂuorobutyryl chain.

Thiophene-2-amidoxime was obtained from commercially

available thiophene-2-carbonitrile using hydroxylamine hydro-

chloride. Compounds 1ꢀ52 were obtained by reaction of

thiophene-2-amidoxime with Boc-isonipecotic acid using HBTU

as activating agent. The acylated product was isolated by

precipitation in water prior to cyclization in DMF at 120 ꢀC to

yield the desired 1,2,4-oxadiazole ring.²²The Boc-protecting

group was then cleaved in acidic conditions, and the free

piperidine was acylated with carboxylic acids, acyl chlorides, or

anhydrides to yield compounds 1ꢀ50. Compounds 51 and 52

were respectively obtained by sulfonylation of the deprotected

piperidinyl scaﬀold using 3,3,3-triﬂuoropropane-1-sulfonyl

chloride and acylation using CDI and 2,2,2-triﬂuoroethylamine

hydrochloride under basic conditions. The synthesis of com-

pounds 53 and 54 proceeded in three steps: thiophene-

2-amidoxime was acylated with N-Boc-nipecotic acids in R or S

conﬁguration and cyclized to yield the desired 1,2,4-oxadiazoles

as described above. Deprotection of Boc-protecting group in

2995

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

Figure 2. Screening cascade developed for SAR studies and validation of EthR inhibitors as ethionamide boosters starting from our lead compound

BDM31343.

Scheme 1. Synthesis of Thiophen-2-yl-1,2,4-oxadiazole Derivatives for SAR Studies^a

^aReagents and reaction conditions: (a) 1.5 equiv H₂NOH HCl, 1.6 equiv DIEA, EtOH, reﬂux, 4 h; (b) 1 equiv Boc-isonipecotic acid, 1.1 equiv HBTU,

3

0.2 equiv HOBt, 3 equiv DIEA, DMF, RT, 2 h; (c) DMF, 120 ꢀC, 3 h to overnight; (d) 5 equiv HCl 4N dioxane, RT; (e) 1.5 equiv carboxylic acid, 1.5

equiv EDCI, 4.5 equiv Et₃N, CH₂Cl₂, RT, or 1.1 equiv acid chloride, 3 equiv Et₃N, CH₂Cl₂, RT, or 1.2 equiv anhydride, 3 equiv DIEA, CH₂Cl₂, RT;

(f) 1.3 equiv 3,3,3-triﬂuoropropane-1-sulfonyl chloride, 3 equiv Et₃N, CH₂Cl₂, RT, overnight; (g) 1 equiv CDI, 1 equiv 2,2,2-triﬂuoroethylamine

hydrochloride, 1 equiv Et₃N, THF, RT, overnight; (h) 1 equiv carboxylic acid, 1.1 equiv HBTU, 3 equiv DIEA, DMF, RT, overnight; (i) 1.3 equiv 4,4,4-

triﬂuorobutyric acid, 1.3 equiv, EDCI, 0.3 equiv HOBt, 4 equiv DIEA, DMF, RT, overnight.

acidic conditions was followed by acylation with 4,4,4-triﬂuor-

obutyric acid using EDCI and HOBt as coupling agents. The

same procedure was applied with both enantiomers of N-Boc-

β-proline to give compounds 55 and 56, with N-Boc-azetidine-

3-carboxylic acid to give compound 57 and ﬁnally with N-Boc-

γ-aminobutyric acid to yield compound 58. Compounds with

stereogenic centers were synthesized and screened as pure

enantiomers.

’ RESULTS AND DISCUSSION

The 58 thiophen-2-yl-1,2,4-oxadiazole derivatives were

screened in combination with subactive doses of ethionamide

on a phenotypic assay using M. tuberculosis infected macro-

phages. Molecular composition and structural features of the

mycobacterial cell envelope are thought to confer low perme-

ability and thereby a basal resistance to most hydrophilic drugs.²³

Moreover, during the pathological course of tuberculosis, most of

2996

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

Figure 3. (A) Dose response analysis of ethionamide alone or in the presence of compound 1 (BDM31343) and compound 2 (BDM31381) at 10 μM

against M. tuberculosis growth in Raw264.7 cells monitored by the percentage of infected cells. MIC₉₉of ethionamide alone is equal to 1 μg/mL.

Compounds 1 and 2 at 10 μM reduce the MIC₉₉of ethionamide to 0.1 μg/mL. (B, C) Dose response curves showing the potency of compound 1 and

compound 2 to boost ethionamide at subactive dose (0.1 μg/mL) against M. tuberculosis intracellular growth.

the bacilli are hidden from the immune system within macro-

phages, which further increases the diﬃculty for antibiotics to

reach their target. Thus, the identiﬁcation of analogues that are

able to reach their mycobacterial target EthR and overcome

peculiarities of intracellular M. tuberculosis required the use of a

phenotypic ex vivo assay. This assay uses automated confocal

microscopy and dedicated image analysis to allow quantiﬁcation

of ﬂuorescent M. tuberculosis H37Rv-GFP replication inside

macrophages incubated with a combination of ethionamide

and thiophen-2-yl-1,2,4-oxadiazole analogues.^24,25There are

two ways to quantify the eﬀect of an ethionamide booster. The

ﬁrst consists in measuring the increase of ethionamide eﬃcacy at

a saturating concentration of booster. For example, compounds 1

and 2 were tested at 10 μM in this assay and both were able to

reduce the MIC of ethionamide to 0.1 μg/mL (Figure 3A). The

second way consists in measuring the ability of the booster to

reduce signiﬁcantly the MIC₉₉of ethionamide. In our assay,

several doses of boosters were given in combination with a 10

times subactive dose of ethionamide (MIC₉₉/10 = 0.1 μg/mL).

From the doseꢀresponse curves obtained (Figure 3B,C), an

EC₅₀was calculated and compounds ranked accordingly. EC₅₀

for compounds 1 and 2 were respectively 1.5 and 0.1 μM

(Figure 3B,C). This data are in agreement with the growth

inhibition measured by the mycobacteria growth indicator tube

standard technique (MGIT960).²¹

To conﬁrm that our compounds are eﬀective EthR inhibitors,

a functional surface plasmon resonance (SPR) assay was used.

SPR assay allows monitoring the potency of ligands to inhibit

EthR/DNA operator interactions.¹⁵Doseꢀresponse curves

were established, and activities were expressed as IC₅₀.

In the ﬁrst round of analoguing, we investigated the introduc-

tion in R position of ﬁve- or six-membered aromatic rings.

Table 1 summarizes potency of analogues of compound 2

(compounds 4ꢀ25) to boost 10-fold ethionamide antibacterial

activity on M. tuberculosis infected macrophages.

Elongation of the spacer between carbonyl group and 2-thio-

phene ring led to a less active booster (compound 4), suggesting

that distance between the amide function and the aryl moiety is

2997

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

Table 1. Ex Vivo Activities of Compounds 2 and 4ꢀ25

(Table 2). According to X-ray structures of EthR complexes,

both compounds were hydrogen-bonded to Asn179. The bot-

tom of the ligand binding domain is rich in aromatic residues,

showing Phe114, Trp138, Trp145, and Phe184 aromatic residues

localized in a 3ꢀ5 Å sphere around the thienyl or phenyl

substituents of the two boosters. On the basis of these structures,

there are no obvious diﬀerences in van der Waals interactions,

however, the thienyl ring is coplanar with carbonyl bond. We

therefore propose that the sulfur atom could be the key feature

responsible for the diﬀerences in activities. Several works demon-

strated indeed that the conformation of organosulfur compounds

can be inﬂuenced by intramolecular sulfurꢀnitrogen (or oxygen)

interactions.²⁶In the X-ray structure of compound 2 cocrystal-

lized with EthR (Table 2), the distance between the sulfur atom

(of the thiophene ring) and the oxygen atom (of the amide

function) was equal to 3.10 Å, a distance shorter than the sum of

the corresponding van der Waals radii equal to 3.35 Å. Bound to

EthR, compound 2 was probably stabilized by a noncovalent 1,

5-intramolecular sulfurꢀoxygen interaction in a conformation

more compatible with the architecture of the binding pocket

while maintaining hydrogen-bond with Asn179.

To further investigate the impact of piperidine substitution,

N-acylated analogues with aliphatic chains bearing hydrophobic

or hydrophilic substituents were assessed (Table 3). The azido

analogue 3 (BDM14801)²⁷was as active as compound 1.

Introduction of a methyl or ethyl chain (compounds 26 and

27) almost abolished activity. Interestingly, propyl, butyl, and

isobutyl analogues (28ꢀ30) were more active than compounds

26 and 27, suggesting that the occupancy of the bottom of EthR

ligand binding domain is essential to enhance activity. Introduc-

tion of an isopentyl carbon chain (compound 32) increased

drastically the activity, leading to a submicromolar compound

(EC₅₀= 0.1 μM). It is noteworthy that further methylation of

compounds 30 and 32 led to less active boosters (compounds 31

and 33). Hydrophilic groups such as hydroxyl or amino were also

introduced on isobutyl and isopentyl chains (compounds

34ꢀ36), but this substitution strongly reduced activity. In the

same manner, replacement of a methylene spacer by an oxygen

atom (compounds 37 vs 28 and 38 vs 29) or introduction of

carboxylic acid function instead of isopentyl chain (compounds

39 vs 32) reduced potency. As it appeared clearly that hydro-

philic substituents of the piperidine did not lead to potent

ethionamide boosters, we introduced aliphatic rings

(compounds 40ꢀ42). Three-, ﬁve-, and six-membered alicyclic

rings were equally eﬃcient. Interestingly the bioisosteric re-

placement of the phenyl ring (compound 7, Table 1) by a

cyclopropyl (compound 40) led to a compound 10 times more

active with a submicromolar activity (EC₅₀= 0.2 μM). Also

noticeable was the methyl substitution of the cyclohexyl, which

strongly reduced activity (compound 43). In the same manner,

introduction of two methylene spacers between carbonyl and

cyclohexyl groups (compound 44) led to a decrease of activity

suggesting that the maximum steric hindrance in the bottom of

the binding pocket was reached with compound 42. These

results suggested that, in addition to the hydrophobic character

of the ring, its shape and ﬂexibility are key parameters to ensure

optimal occupancy. The crystal structure of EthR in complex

with compound 32 showed the molecule H-bonded to Asn179,

while the isopentyl chain was engaged in hydrophobic contacts

with Phe110, Phe114, and Trp145 (Figure 4). This 3D structure

revealed the tightness of the bottom of the ligand-binding

domain, only accessible through a narrow tunnel, which explains

compd

R

EC₅₀(μM)^a

2

ꢀCOCH₂(2-thiophene)

ꢀCOCH₂CH₂(2-thiophene)

ꢀCOCH₂(2-imidazole)

ꢀCO-phenyl

0.1

>5.0

2.1

4

5

6

7

ꢀCOCH₂-phenyl

8

ꢀCOCH₂(2-F-phenyl)

ꢀCOCH₂(3-F-phenyl)

ꢀCOCH₂(4-F-phenyl)

ꢀCOCH₂(2-Cl-phenyl)

ꢀCOCH₂(3-Cl-phenyl)

ꢀCOCH₂(4-Cl-phenyl)

ꢀCOCH₂(2-CF₃-phenyl)

ꢀCOCH₂(3-CF₃-phenyl)

ꢀCOCH₂(4-CF₃-phenyl)

ꢀCOCH₂(2-CH₃-phenyl)

ꢀCOCH₂(3-CH₃-phenyl)

ꢀCOCH₂(4-CH₃-phenyl)

ꢀCOCH₂(2-OCH₃-phenyl)

ꢀCOCH₂(3-OCH₃-phenyl)

ꢀCOCH₂(4-OCH₃-phenyl)

ꢀCOCH₂(2-pyridinyl)

ꢀCOCH₂(3-pyridinyl)

ꢀCOCH₂(4-pyridinyl)

>5.0

0.8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

>5.0

2.2

>5.0

^aEC₅₀represents the concentration of ligand that allows ethionamide at

0.1 μg/mL (normal MIC/10) to inhibit 50% of M. tuberculosis growth in

macrophages. EC₅₀are mean of two experiments. SD was <10% in

most cases.

an important criterion for the activity. Exchanging the 2-thienyl

group for a ﬁve-membered aromatic heterocycle like imidazole

was detrimental for activity (compound 5). This suggested that a

basic group or a hydrogen-bond donor atom is less tolerated in

the hydrophobic ligand-binding cavity. The bioisosteric re-

placement of the thienyl core by a phenyl ring (compound 7)

reduced activity and the removal of the methylene spacer

(compound 6) strongly aﬀected activity. Substitutions of phenyl

ring in ortho, meta, or para position with electron-donating

groups such as methyl and methoxy (compounds 17ꢀ22) or

cumbersome electron-withdrawing groups such as triﬂuoro-

methyl (compounds 14ꢀ16) did not enhance the activity.

Exchanging the 2-thienyl group for a pyridine led to less active

compounds (23ꢀ25). Interestingly, introduction of ﬂuorine or

chlorine on the phenyl ring (compounds 8ꢀ13) was tolerated

only in para position. The 4-ﬂuoro substitution (compound 10)

led to a compound with submicromolar activity (EC₅₀= 0.8

μM). In this series, the 2-thienoacetyl group (compound 2, EC₅₀=

0.1 μM) appeared to be critical for activity compared to

phenylacetyl (compound 7, EC₅₀= 2.1 μM). Both compounds

were evaluated in our functional SPR assay. With an IC₅₀equal to

0.5 μM, compound 2 revealed to be 10-fold more active than its

phenyl analogue 7, which displayed an IC₅₀equal to 5.6 μM

2998

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

Table 2. X-ray Structures of Compounds 2 (PDB ID: 3G1M) and 7 (PDB ID: 3Q0U) Co-crystallized with EthR

^aFor compound 2 in the left column, 1,5-intramolecular sulfurꢀoxygen interaction between thiophene and amide functions is symbolized with red

dotted line. ^bEC₅₀represents the concentration of ligand that allows ethionamide at 0.1 μg/mL (normal MIC/10) to inhibit 50% of M. tuberculosis

growth in macrophages, EC₅₀are mean of two experiments; ^cIC₅₀represents the concentration of ligand that inhibits 50% of the interaction of EthR with

its promoter.

why linear and less hindered aliphatic substituents better accom-

modate this region.

amide bound (compound 46) by sulfonamide (compound 51)

or urea (compound 52) motives. These two modiﬁcations led to

less active compounds and suggested that the amide function is a

key parameter to ensure optimal interaction via hydrogen bond

with Asn179.

Finally, we focused on the modiﬁcation of the piperidine ring

by smaller cyclic or linear aliphatic amines keeping the 4,4,4-

triﬂuorobutyryl chain. Biological data are summarized in Table 4.

Replacement of 1,4-substituted piperidine (compound 46) by

On the basis of this conclusion, we assessed the replacement of

methyl groups with smaller substituents such as ﬂuorine atoms

(compounds 45ꢀ50). These modiﬁcations led to an increase of

the activity compared to the parent hydrogenated molecules:

compound 45 (EC₅₀= 1.3 μM) was more potent than com-

pound 27 (EC₅₀> 5.0 μM), and introduction of a 4,4,

4-triﬂuorobutyryl substituent strongly increased activity (com-

pound 46, EC₅₀= 0.1 μM, compared to compound 28, EC₅₀

=

1,3-substituted piperidine with R or S conﬁgurations

2.1 μM). Compound 46 was as potent as compound 2 in ex vivo

assay, but less active in SPR assay (IC₅₀= 1.6 μM). This suggest

that introduction of ﬂuorine substituents does not improve

proteinꢀligand interactions but possibly facilitate cell penetra-

tion, as already shown for ﬂuoroquinolones^28,29and enhance

physicochemical properties.³⁰The maximum beneﬁt of the

replacement of hydrogen by ﬂuorine seems to have been over-

steped with compound 50, which is far less active than its

analogue 32. On the basis of van der Waals radius of 1.47 Å for

ﬂuorine atom, the volume of a triﬂuoromethyl group is similar to

that of the ethyl group³⁰and this corroborates that only limited

space is available in the bottom of the ligand binding domain.

Introduction of a methyl substituent (compounds 48 and 49) led

to a decrease in activity. Finally, we explored the replacement of

(compounds 53 and 54) strongly reduced intracellular activity.

Interestingly replacement by pyrrolidine was well tolerated

(compounds 55 and 56). Compound 55 with the stereogenic

center in R conﬁguration was more active than the S stereoiso-

mer (compound 56). On the contrary, introduction of a smaller

azetidine ring or linear chain reduced drastically activity

(compounds 57 and 58). This suggested that both rigidity of

cyclic counterpart and positioning of the carbonyl group were

important criteria for activity.

In conclusion it proved possible to introduce, at R position,

aliphatic or ﬂuorinated aliphatic chains, such as isopentyl and

4,4,4-triﬂuorobutyryl (compounds 32 and 46), or saturated

cyclic groups such as cyclopropyl, cyclopentyl, or cyclohexyl

groups (compounds 40, 41, and 42). Substitution of the carbon

2999

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

Table 3. Biological Activities of Compounds 1, 3, and 26ꢀ52

^aEC₅₀represents the concentration of ligand that allows ethionamide at 0.1 μg/mL (normal MIC/10) to inhibit 50% of M. tuberculosis growth in

macrophages, EC₅₀are mean of two experiments. SD was <10% in most cases; ^bIC₅₀represents the concentration of ligand that inhibits 50% of the

interaction of EthR with its promoter.

adjacent to the carbonyl group with methyl or polar groups

reduced activity. Both 1,4-piperidyl and (R)-1,3-pyrrolidyl lin-

kers were allowed without reducing signiﬁcantly activities. Fi-

nally, the hydrogen bond with Asn179 was optimal with amide

linker rather than with sulfonamide or urea (Figure 5).

Compounds displaying nanomolar intracellular activities dif-

fered by their physicochemical and biological properties. Indeed,

aliphatic derivatives (compounds 32, 41, and 42) are toxic for

macrophages at concentrations greater than 30 μM (data not

shown). In contrast, compounds 40, 46, and 55 are well tolerated

3000

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

Figure 4. (A) X-ray structure representation of the ligand-binding pocket of mycobacterial transcriptional repressor EthR ﬁlled with compound 32

(PDB ID: 3Q0V) surrounded by its initial F_oꢀ F_cmap at 3.0 σ contour level. F_oꢀ F_cmap was calculated prior to adding the ligand to the model. Colors

legend: green (compound 32) or light-gray (EthR) = carbon, blue = nitrogen, red = oxygen, yellow = sulfur. (B) X-ray structure representation of the

homodimeric conformation of EthR ﬁlled in both monomer with compound 32. Surface of ligand binding domain is highlighted and hydrogen-bond

with Asn179 is represented with dotted line.

Table 4. Biological Activities of Compounds 46 and 53ꢀ58

Figure 5. Summary of SAR study with thiophen-2-yl-1,2,4-oxadiazole

derivatives.

46 and 55 displayed higher solubilities in PBS (150 and 80 μg/

mL, respectively) than 40 (64 μg/mL). Compounds 46 and 55

were selected for further mouse liver microsome stability studies

(Table 5), and compound 55 showed a better stability than its

three analogues with an intrinsic clearance and a half-life equal to

4 μL/min/mg and 298 min, respectively.

’ CONCLUSION

In this study, we explored the structureꢀactivity relationships

of thiophen-2-yl-1,2,4-oxadiazoles as 10-fold ethionamide activ-

ity boosters. We conﬁrmed with in vitro functional activities and

X-ray crystallography that the compounds were genuine inhibi-

tors of the mycobacterial regulator EthR. Replacement of the

cyanoacetyl chain in the R position by a thienoacetyl greatly

^aEC₅₀represents the concentration of ligand that allows ethionamide at

improves potency but dramatically reduces solubility and meta-

bolic stability, jeopardizing in vivo activity.²¹Replacement of the

thienoacetyl (R position) with substituted phenylacetyl or het-

0.1 μg/mL (normal MIC/10) to inhibit 50% of M. tuberculosis growth in

macrophages, EC₅₀are mean of two experiments. SD was <10% in most

cases.; ^bIC₅₀represents the concentration of ligand that inhibits 50% of

eroarylacetyl groups did not improve potency in intracellular

the interaction of EthR with its promoter.

assay. However, introduction of aliphatic chains or rings that ﬁt

the pocket of the ligand binding domain was signiﬁcantly more

eﬃcacious. At this position, a ﬂuorinated chain (compound 46)

is equivalent to the thienoacetyl in terms of potency but not

by the macrophages. Compounds 40, 46, and 55 comply with

Lipinski and Veber’s rules (data not shown),^31,32but derivatives

3001

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

Table 5. Physicochemical and Stability Properties of Compounds 1, 2, 46, and 55

physicochemical properties

intracellular antiM. Tb growth assay

mouse microsomal stability^c

compd

MW (g mol^ꢀ1

)

solubility^a(μg/mL)

clogP^b

EC₅₀(μM)

t_1/2(min)

CL_int(μL/min/mg)

3

1

302.3

359.5

359.4

345.3

194

22

1.38

2.97

2.70

2.38

4.7

0.1

0.4

91

3

11

412

213

4

2

46

55

150

80

5

298

^aSolubilities were determined at pH 7.4. ^bclogP were calculated using pipeline pilot software from accelrys. Propranolol known as a high hepatic

clearance drug in rodents was used as reference for microsomal incubations (t_1/2= 13 min, CL_int= 121 μL/min/mg). See Experimental Section for

further details on all assays.

c

better in terms of stability, although it improves solubility.

Keeping the same ﬂuorinated chain, we managed to obtain a

much more stable compound by replacing the piperidine by a

pyrrolidine at a minimal cost in solubility and potency

(compound 55). Eﬀorts to further optimize this series by the

replacement of oxadiazole ring and the remaining thiophene are

ongoing and will be reported in due course.

architecture that allows imaging of cells cultivated in 96- or 384-well

microplates (Evotec). Images were acquired with a 20ꢁ water immer-

sion objective (NA 0.70). Double laser excitation (488 and 635 nm) and

dedicated dichroic mirrors were used to record green fluorescence of

mycobacteria and red fluorescence of the macrophages on two different

cameras, respectively. A series of four pictures at the center of each well

were taken, and each image was then processed using dedicated image

analysis.^24,25The percent of infected cells and the number of cells are the

two parameters extracted from images analysis as previously reported.²⁴

Data of two replicates are average.

’ EXPERIMENTAL SECTION

Potency Assay of Test Compounds on M. tuberculosis (Ethionamide

Concentration Fixed at 0.1 μg/mL, Serial Dilution of Test Compounds).

Ethionamide (Sigma E6005-5G) was diluted into DMSO to 10 mg/mL,

and aliquots were stored frozen at ꢀ20 ꢀC. Test compounds were

suspended in pure DMSO at a concentration of 40 mg/mL in Matrix

tubes and then diluted by a 10-fold dilution to 4 mg/mL in Eppendorf

tubes. Ten 2-fold serial dilutions of compounds were performed in

DMSO in Greiner 384 well V-shape polypropylene plates (Greiner, no.

781280). Equal volumes (5 μL) of diluted compounds and of ethiona-

mide were transferred to a 384-well low volume polypropylene plate

(Corning, no. 3672). Two independent replicates were done for each

setting. On the day of the experiment, 0.5 μL of compound-plate was

first transferred by EVOBird platform (Evotec) to cell assay plates

preplated with 10 μL of assay medium.

Biology. EthRꢀDNA Binding Assay. SPR analysis of the molecular

interactions between EthR and the ethA promoter region was performed

using “research grades CM5 sensor chips” on a BIAcore 2000 instrument

(AB, Uppsala, Sweden). Streptavidin was injected onto the CM5 sensor

chips at 500 ng/mL in 10 mM sodium acetate (pH 3.5) for 12 min at a

10 μL/min flow rate. The 106 bp biotinylated DNA fragment over-

lapping the ethAethR intergenic region was obtained by polymerase

chain reaction (PCR), purified by agarose gel electrophoresis, and

immobilized onto the CM5 sensor chip. The biotinylated DNA frag-

ment (200 ng/mL) was injected in one channel of the chip at to obtain a

50 resonance unit (RU) stable fixation to immobilized streptavidin.

Another channel of the chip was loaded with a biotinylated double

stranded 113 bp long irrelevant DNA fragment (þ14 to þ127 fragment

of the E. coli bla gene PCR amplified using oligonucleotides O-343,

TTTCCGTGTCGCCCTTATTCC, and O-344, CCACTCGTG-

CACCCAACTGAT, and pUC18 as substrate). Binding of EthR to

the immobilized DNA was performed at 25 ꢀC in 10 mM Tris-HCl

(pH 7.5), 200 mM NaCl, 0.1 mM EDTA, 1 mM DTT, and 1% DMSO at

a flow rate of 20 μL/min. Specific interaction (SI) between EthR and the

106 bp DNA fragment was defined as the signal difference between both

channels. For dose response curves establishment, the test compounds

were serially diluted in the binding buffer containing 540 nM EthR,

incubated 5 min at 37 ꢀC, and then injected in the BIAcore at a flow rate

of 20 μL/min for 3 min. SI values were measured at the end of the

injection period and used to calculate the inhibition of proteinꢀDNA

interaction. IC₅₀values were determined by using GraphPad Prism

software.

Pharmacokinetics. Solubility/Metabolic Stability. These experi-

ments were analyzed using a LC-MS-MS triple-quadrupole system

(Varian 1200ws) under MRM detection with the following mass

parameters: mode of ionization, electrospray; declustering potential,

50 V; collision gas pressure, 1.5 mTorr; collision energy, 20 eV.

Solubility. The 10 mM solution (40 μL) in DMSO of the sample was

added to 1.960 mL of MeOH or PBS at pH 7.4. The samples were gently

shaken for 24 h at room temperature, then centrifuged for 5 min, and

filtered over 0.45 μm filters. An amount equal to 20 μL of each solution

was added to 180 μL of MeOH and analyzed by LC-MS-MS. The

solubility was determined by the ratio of mass signal areas PBS/MeOH.

Metabolic Stability. We purchased male mouse (CD-1) liver micro-

somes from BD Gentest. We performed all incubations in duplicate in a

shaking water bath at 37 ꢀC. The incubation mixtures contained 1 μM of

compound with 1% methanol used as a vehicle, mouse liver microsomes

(0.6 mg of microsomal protein per mL), 5 mM MgCl₂, 1 mM NADP,

Intracellular Assay. Raw264.7 macrophages (10⁸cells) were infected

with H37Rv-GFP suspension at a MOI of 1:1 in 300 mL for 2 h at 37 ꢀC

with shaking (100 rpm). After two washes by centrifugation at 1100 rpm

for 5 min, the remaining extracellular bacilli from the infected cells

suspension were killed by a 1 h Amykacin (20 μM, Sigma, A2324ꢀ5G)

treatment. After a final centrifugation step, 40 μL of M. tuberculosis

H37Rv-GFP colonized macrophages were dispensed with the Wellmate

(Matrix) into 384-well Evotec plates preplated with 10 μL of compound

mixture diluted in cell medium and incubated for 5 days at 37 ꢀC, 5%

CO₂. Macrophages were then stained with SYTO 60 (Invitrogen,

S11342) for 1 h followed by plate sealing. Confocal images were

recorded on an automated fluorescent ultrahigh-throughput microscope

Opera (Evotec). This microscope is based on an inverted microscope

5 mM glucose-6-phosphate, 0.4 U mL^ꢀ1glucose-6-phosphate dehy-

3

drogenase, and 50 mM potassium phosphate buffer (pH 7.4) in a final

volume of 1.5 mL. We took samples at 5, 10, 15, 20, 25, and 30 min after

microsome addition, and we terminated the reactions by adding ice-cold

acetonitrile containing 1 mM internal standard (one volume). We

centrifuged the samples for 10 min at 4000g and 4 ꢀC to pellet

precipitated microsomal proteins, and we subjected the supernatant to

liquid chromatographyꢀtandem mass spectrometry (LC-MS/MS)

analysis. We performed control incubations with denaturated micro-

somes with acetonitrile containing 1 mM internal standard, and we took

3002

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

Table 6. Data Collection Statistics

20.1% (23.3%) for compounds 32 and 7, respectively. The two

structures have been deposited with the Protein Data Bank (PDB)

under the accession codes 3Q0V and 3Q0U.

compd 32

compd 7

Chemistry. General Information. NMR spectra were recorded on

a Bruker DRX-300 spectrometer. Chemical shifts are in parts per million

(ppm). The assignments were made using one-dimensional (1D) H

X-ray source

ESRF ID14-2

100

ESRF ID14-2

100

temperature (K)

wavelength (Å)

space group

1

0.93300

and ¹³C spectra and two-dimensional (2D) HSQC and COSY spectra.

Mass spectra were recorded with a LC-MSMS triple-quadrupole system

(Varian 1200ws) or a LCMS (Waters Alliance Micromass ZQ 2000).

LCMS analysis was performed using a C18 TSK-GEL Super ODS 2 μm

particle size column, dimensions 50 mm ꢁ 4.6 mm. A gradient starting

from 100% H₂O/0.1% formic acid and reaching 20% H₂O/80%

CH₃CN/0.08% formic acid within 10 min at a flow rate of 1 mL/min

was used. Preparative HPLC were performed using a Varian PRoStar

system using an OmniSphere 10 Column C₁₈250 mm ꢁ 41.4 mm

Dynamax from Varian, Inc. A gradient starting from 20% CH₃CN/80%

H₂O/0.1% formic acid and reaching 100% CH₃CN/0.1% formic acid at

a flow rate of 80 mL/min or 20% MeOH/80% H₂O/0.1% formic acid

reaching 100% MeOH/0.1% formic acid was used. Purity (%) was

determined by reversed phase HPLC, using UV detection (215 nm), and

all compounds showed purity greater than 95%. Melting points were

determined on a B€uchi B-540 apparatus and are uncorrected. All

commercial reagents and solvents were used without further

purification.

P4₁

P4₁2₁2

cell constants (Å)

resolution (Å)^a

completeness (%)

R_sym(%)

a = b = 121.5 c = 33.7

1.95 (1.95ꢀ2.0)

99.8 (100)

9.5 (49.4)

a = b = 122.2 c = 33.7

1.7 (1.7ꢀ1.8)

99.9 (100)

9.2 (38.5)

multiplicity

7.1 (6.6)

14.0 (14.3)

17.3 (3.6)

I/σ(I)

17.9 (3.2)

total reﬂections

unique reﬂections

261673 (17929)

401652 (62941)

28678 (4406)

36781 (2692)

^aNumber in parentheses is the statistic for the highest resolution shell.

samples at the start of the incubation and 30 min later (to evaluate the

chemical stability of the compounds in the experimental conditions).

For LC-MS/MS, we used a Varian HPLCꢀMS/MS system 1200 L

triple quadrupole mass spectrometer equipped with an electrospray

ionization source. Analytes were separated in incubation mixtures by

HPLC with a TSK gel Super-ODS C18, 2 μm, 50 mm ꢁ 4.6 mm column

(Interchim). The mobile phase solvents used were 0.01% formic acid in

water (A) or 0.01% formic acid in acetonitrile (B). We applied the

following mobile phase gradient: 10ꢀ90% (B) for 2.30 min; hold at 90%

(B) for 1.30 min; 10ꢀ90% (A) for 0.01 min; 90% (A) hold for 1.04 min.

3-Oxo-3-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-

propionitrile (1). Thiophene-2-carbonitrile (1 equiv), hydroxylamine

hydrochloride (1.5 equiv), and diisopropylethylamine (1.6 equiv) were

mixed in absolute ethanol (1M). The reaction mixture was refluxed 4 h,

and then the solvent was evaporated under reduced pressure. The

residue was dissolved in AcOEt and washed twice with water and once

with brine. The organic layer was dried over MgSO₄and then evapo-

rated under reduced pressure to give thiophene-2-amidoxime as a white

powder. Yield 95%. ¹H NMR (DMSO-d₆) δ 9.61 (s, 1H), 7.47 (dd, J =

3.6 Hz, J = 0.9 Hz, 1H), 7.41 (dd, J = 5.1 Hz, J = 0.9 Hz, 1H), 7.03 (dd, J =

5.1 Hz, J = 3.6 Hz, 1H), 5.92 (brs, 2H). ¹³C NMR (DMSO-d₆) δ 147.94,

136.97, 127.35, 126.68, 125.42. MS [M þ H]^þm/z 143. Boc-isonipe-

cotic acid (10 mmol, 1 equiv), HOBt (0.2 equiv), HBTU (1.1 equiv),

and diisopropylethylamine (3 equiv) were dissolved in dimethylforma-

mide (15 mL). The solution was stirred for 5 min, and then thiophene-2-

amidoxime (1 equiv) was added. The reaction mixture was stirred 2 h at

room temperature and then poured in 50 mL of water. The reaction

mixture produced a thick crystalline slurry. The product was recovered

by filtration and washed with water. The obtained solid was dissolved in

dimethylformamide (15 mL), and then the reaction mixture was heated

at 120 ꢀC overnight. The solvent was removed under vacuum, and the

residue was dissolved in AcOEt. The organic layer was washed twice with

HCl 1N, twice with saturated aqueous NaHCO₃, and once with brine

and then dried over MgSO₄and evaporated under reduced pressure to

give 4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidine-1-carboxylic

The injection volume was 10 μL, and the flow rate was 1 mL min^ꢀ1. We

3

introduced approximately 30% of the eluent into the triple quadrupole

mass spectrometer source. We maintained the source temperature of the

mass spectrometer at 300 ꢀC, the declustering potential was 50 V, and

the collision gas pressure was 1.5 mTorr. We optimized the collision

energy and observed transitions for each compound. We quantified each

compound by converting the corresponding analyte/internal standard

peak area ratios to percentage drug remaining, using the initial ratio

values in control incubations as 100%. We used propranolol, known as a

high hepatic clearance drug in rodents, as a quality control compound for

the microsomal incubations.

Crystal Structure Determination of EthRꢀLigand Complexes. We

produced N-terminally hexahistidine-tagged EthR in Escherichia coli C41

(pET-15b-ethR) and purified it as previously described.¹⁵The protein

was buffer exchanged before crystallization against 10 mM Tris-HCl

(pH 7.5), 200 mM NaCl, and concentrated to 11 mg/mL. Crystals were

obtained by the vapor diffusion method using 0.17 M ammonium

sulfate, 0.085 M sodium cacodylate (pH 6.5), 15% glycerol, and

25ꢀ35% polyethylene glycol 8000 as the crystallization solution. The

ligands were dissolved in 100% DMSO. Before crystallization, the

protein was incubated with the ligand, either compound 32 or com-

pound 7 added at equimolar concentration. Crystals of EthR complexed

with compound 7 belongs to space group P4₁2₁2, with one monomer in

the asymmetric unit, while crystals of EthR complexed with compound

32 belong to space group P4₁, with a dimer in the asymmetric unit. In all

cases, the ligands can be fitted without any ambiguity in the electron

density. Data collection statistics are summarized in Table 6. The

diffraction data were processed with XDS (X-ray detector software:

http://xds.mpimf-heidelberg.mpg.de).³³We refined the structures with

the macromolecular refinement program REFMAC5³⁴from the CCP4

suite³⁵to resolutions of 1.95 and 1.7 Å for compound 32 and compound 7,

respectively. The ligand topology and parameter files were obtained from

the PRODRG2 server (http://davapc1.bioch.dundee.ac.uk/prodrg/).³⁶

The ligands were positioned in the electron density of the crystals using

the program COOT.³⁷The final R (R_free) factors are 16.9% (22.7%) and

1

acid tert-butyl ester as a beige powder. Yield 84%. H NMR (CDCl₃)

δ 7.70 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.42 (dd, J = 5.0 Hz, J = 1.2 Hz,

1H), 7.06 (dd, J = 3.6 Hz, J = 5.0 Hz, 1H), 4.05 (m, 2H), 3.07 (m, 1H),

2.90 (m, 2H), 2.03 (m, 2H), 1.81 (m, 2H), 1.40 (s, 9H). ¹³C NMR

(CDCl₃) δ 181.23, 164.23, 154.51, 129.46, 129.2, 128.32, 127.9, 79.72,

42.84, 34.38, 29.05, 28.38. t_{R LCMS}6.9 min. MS [M þ Na]^þm/z 358.

Boc intermediate was dissolved in dioxane (1 M) and HCl 4N solution

in dioxane (5 equiv) was added. The reaction mixture was stirred 5 h

at room temperature. The product was recovered by filtration and

then washed with petroleum ether to give 4-(3-thiophen-2-yl

-[1,2,4]oxadiazol-5-yl)-piperidine hydrochloride as a white powder.

Yield 91%. ¹H NMR (DMSO-d₆) δ 9.42 (brs, 2H), 7.88 (dd, J = 5.0 Hz,

J = 1.2 Hz, 1H), 7.79 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.25 (dd, J = 5.0 Hz,

J = 3.6 Hz, 1H), 3.5 (m, 1H), 3.31 (m, 2H), 3.05 (m, 2H), 2.24 (m, 2H),

2.05 (m, 2H). ¹³C NMR (DMSO-d₆) δ 181.36, 164.09, 131.26, 130.39,

3003

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

129.03, 127.81, 42.31, 31.68, 25.91. t_{R LCMS}2.8 min. MS [M þ H]^þm/z

236. Cyanoacetic acid (2 equiv), EDCI (2 equiv), and triethylamine (4

equiv) were mixed in DCM (20 mL) for 10 min. 4-(3-Thiophen-

2-yl-[1,2,4]oxadiazol-5-yl)-piperidine hydrochloride (5 mmol, 1 equiv)

was added, and the reaction mixture was stirred overnight at room

temperature and then evaporated under reduced pressure. The residue

was dissolved in AcOEt, and the organic layer was washed twice with

aqueous NaOH 1M, twice with aqueous HCl 1 M, and once with brine,

dried over MgSO₄, and concentrated under vacuum. The residue was

purified by flash chromatography on silica gel (DCM/MeOH 99/1) to

20 mL), dried over MgSO₄, and concentrated under vacuum to give the

desired compound.

2-Thiophen-2-yl-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-pi-

1

peridin-1-yl]-ethanone (2). Yellow oil; yield 39%. H NMR (CDCl₃)

δ 7.76 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.48 (dd, J = 5.1 Hz, J = 1.2 Hz,

1H), 7.19 (dd, J = 5.1 Hz, J = 1.2 Hz, 1H), 7.13 (dd, J = 5.1 Hz, J = 3.7 Hz,

1H), 6.94 (dd, J = 5.1 Hz, J = 3.5 Hz, 1H), 6.89 (dd, J = 3.5 Hz, J = 1.2 Hz,

1H), 4.48 (m, 1H), 3.93 (m, 1H), 3.92 (s, 2H), 3.18 (m, 2H), 3.00 (m,

1H), 2.11 (m, 2H), 1.84 (m, 2H). ¹³C NMR (CDCl₃) δ 180.71, 168.35,

164.36, 136.38, 129.62, 129.36, 128.21, 128.00, 126.92, 126.07, 124.85,

45.35, 41.05, 35.26, 34.17, 29.33, 28.72. t_{R LCMS}5.8 min. Purity >99%.

MS [M þ H]^þm/z 360.

1

give compound 1 as a white powder. Yield 68%. H NMR (CD₂Cl₂):

δ 7.79 (dd, J = 3.5 Hz, J = 1.1 Hz, 1H), 7.55 (dd, J = 4.9 Hz, J = 1.1 Hz,

1H), 7.18 (dd, J = 4.8 Hz, J = 3.3 Hz, 1H), 4.41 (m, 1H), 3.73 (m, 1H),

3.58 (s, 2H), 3.28 (m, 2H), 3.03 (m, 1H), 2.20 (m, 2H), 1.86 (m, 2H).

¹³C NMR (CD₂Cl₂): δ 180.61, 164.34, 160.12, 129.54, 129.35, 128.27,

128.05, 114.18, 45.34, 41.42, 33.84, 29.14, 28.57, 25.09. t_{R LCMS}4.7 min.

Purity >99%. MS [M þ H]^þm/z 303.

2-Azido-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-

yl]-ethanone (3). 4-(3-Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidine

hydrochloride (2 mmol, 1 equiv) and triethylamine (2.1 equiv) were

mixed in dried DCM (4 mL). The reaction mixture was cooled to

ꢀ15 ꢀC, and then chloroacetylchloride (1 equiv) was added dropwise

over 10 min. The reaction mixture was stirred 2 h at room temperature,

and then DCM (20 mL) was added. The organic layer was washed twice

with aqueous HCl 1 M and once with brine and then dried over MgSO₄

and evaporated under reduced pressure to afford 2-chloro-1-[4-(3-

thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-ethanone. The pre-

vious compound was dissolved in DMF (3 mL), and then sodium azide

(1.4 equiv) was added and the reaction mixture was stirred overnight at

room temperature. The solvent was removed under vacuum, and the

residue was dissolved in AcOEt. The organic layer was washed three

times with water and once with brine and then dried over MgSO₄and

evaporated under reduced pressure. The residue was purified by flash

chromatography on silica gel (cyclohexane/AcOEt 7/3) to give com-

pound 3 as a white powder. Yield 76%. ¹H NMR (CDCl₃): δ 7.76 (dd,

J = 3.6 Hz, J = 1.2 Hz, 1H), 7.48 (dd, J = 5.0 Hz, J = 1.2 Hz, 1H), 7.13 (dd,

J = 5.0 Hz, J = 3.6 Hz, 1H), 4.43 (m, 1H), 3.95 (s, 2H), 3.72 (m, 1H),

3.25 (m, 2H), 3.04 (m, 1H), 2.18 (m, 2H), 1.94 (m, 2H). ¹³C NMR

(CDCl₃): δ 180.48, 165.58, 164.39, 129.68, 129.42, 128.12, 128.03,

50.77, 44.16, 41.17, 33.99, 29.68, 28.74. t_{R LCMS}5.2 min. Purity >99%.

MS [M þ H]^þm/z 319.

General Procedure for the Synthesis of Compounds 4, 8ꢀ25, 45.

The appropriate carboxylic acid (1.5 equiv), EDCI (1.5 equiv), and

triethylamine (4.5 equiv) were mixed in DCM (2 mL) for 5 min. 4-(3-

Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidine hydrochloride (100 mg,

1 equiv) was added with 3 mL of DCM. The reaction mixture was stirred

overnight at room temperature, and then DCM was added and the

organic layer was washed with aqueous HCl 1 M (3 times), aqueous

saturated NaHCO₃(twice), and brine (once), dried over MgSO₄, and

concentrated under vacuum. The residue was purified by preparative

HPLC to give the expected compound.

General Procedure for the Synthesis of Compounds 2, 6, 7, 32, 38,

40ꢀ44, 46. The appropriate carboxylic acid (2 equiv), EDCI (2 equiv),

and triethylamine (4 equiv) were mixed in dried DCM (2 mL) for 5 min.

4-(3-Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidine

hydrochloride

(100 mg, 1 equiv) was added, and the reaction mixture was stirred

overnight at room temperature. AcOEt was added (20 mL). The organic

layer was washed with aqueous NaOH 1 M (thrice, 30 mL), aqueous

HCl 1 M (thrice, 30 mL) and brine (30 mL), dried over MgSO₄, and

concentrated under vacuum. The residue was purified by thick layer

chromatography to give the expected compound.

General Procedure for the Synthesis of Compounds 5, 33, 36,

47ꢀ50. The appropriate carboxylic acid (1.5 equiv), EDCI (1.5 equiv),

HOBt (0.3 equiv), and diisopropylethylamine (4.5 equiv) were mixed in

DMF (2 mL) for 5 min. 4-(3-Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-

piperidine hydrochloride (100 mg, 1 equiv) was added with 3 mL of

DMF. The reaction mixture was stirred overnight at room temperature

and then evaporated under reduced pressure. The residue was dissolved

in AcOEt, and the organic layer was washed with aqueous HCl 1 M (3

times), aqueous saturated NaHCO₃(twice), and brine (once), dried

over MgSO₄, and concentrated under vacuum. The residue was purified

by preparative HPLC to give the expected compound.

3-Thiophen-2-yl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperi-

din-1-yl]-propan-1-one (4). Colorless oil; yield 72%. ¹H NMR

(MeOD) δ 7.79 (dd, J = 3.7 Hz, J = 1.3 Hz, 1H), 7.67 (dd, J = 5.1

Hz, J = 1.3 Hz, 1H), 7.17ꢀ7.22 (m, 2H), 6.87ꢀ6.92 (m, 2H), 4.46ꢀ4.51

(m, 1H), 3.97ꢀ4.01 (m, 1H), 3.23ꢀ3.40 (m, 2H), 3.17 (t, J = 7.2 Hz,

2H), 2.94ꢀ3.03 (m, 1H), 2.70ꢀ2.88 (m, 2H), 2.11ꢀ2.18 (m, 2H),

1.65ꢀ1.85 (m, 2H). t_{R LCMS}6.2 min. Purity >99%. MS [M þ H]^þm/z

374.

2-(3H-Imidazol-4-yl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

piperidin-1-yl]-ethanone (5). Colorless oil; yield 20%. ¹H NMR

(CD₂Cl₂) δ 8.15 (brs, NH), 7.74 (d, J = 3.6 Hz, 1H), 7.73 (s, 1H),

7.51 (d, J = 5.1 Hz, 1H), 7.14 (dd, J = 3.6 Hz, J = 5.1 Hz, 1H), 6.94 (s,

1H), 4.41ꢀ4.46 (m, 1H), 3.99ꢀ4.04 (m, 1H), 3.75 (s, 2H), 3.18ꢀ3.30

(m, 2H), 2.88ꢀ2.96 (m, 1H), 2.10ꢀ2.13 (m, 2H), 1.77ꢀ1.84 (m, 2H).

¹³C NMR (CD₂Cl₂) δ 181.74, 168.98, 164.91, 135.15, 130.88, 130.03,

129.84, 129.07, 128.59, 118.30, 45.77, 41.58, 34.72, 32.07, 30.00, 29.37.

t_{R LCMS}3.2 min. Purity >99%. MS [M þ H]^þm/z 344.

General Procedure for the Synthesis of Compounds 27ꢀ31, 37.

4-(3-Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidine

hydrochloride

(100 mg, 1 equiv) and triethylamine (3 equiv) were mixed in dried

DCM (5 mL). The acid chloride derivative (1.1 equiv) was added

dropwise, and the reaction mixture was stirred for 2 h at room

temperature. DCM was added (15 mL). The organic layer was washed

with aqueous NaOH 1 M (thrice, 20 mL), aqueous HCl 1 M (thrice,

20 mL), and brine (once, 20 mL), dried over MgSO₄, and concentrated

under vacuum to give the expected compound.

General Procedure for the Synthesis of Compounds 26, 39. 4-(3-

Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidine hydrochloride (50 mg,

1 equiv) and diisopropylethylamine (3 equiv) were mixed in dried DCM

(1 mL). The appropriate anhydride (1.2 equiv) was added dropwise, and

the reaction mixture was stirred for 2 h at room temperature. AcOEt was

added (15 mL). The organic layer was washed with aqueous NaOH 1 M

(thrice, 20 mL), aqueous HCl 1 M (thrice, 20 mL), and brine (once,

Phenyl-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-

methanone (6). White powder; yield 52%. ¹H NMR (CD₂Cl₂) δ 7.79

(dd, J = 3.8 Hz, J = 1.2 Hz, 1H), 7.56 (dd, J = 5.0 Hz, J = 1.2 Hz, 1H),

7.41ꢀ7.47 (m, 5H), 7.20 (dd, J = 3.8 Hz, J = 5.0 Hz, 1H), 4.50ꢀ4.58 (m,

1H), 3.84ꢀ3.91 (m, 1H), 3.28ꢀ3.35 (m, 1H), 3.15ꢀ3.23 (m, 2H),

2.15ꢀ2.22 (m, 2H), 1.93ꢀ1.99 (m, 2H). t_{R LCMS}5.7 min. Purity 98%.

MS [M þ H]^þm/z 340.

2-Phenyl-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-

yl]-ethanone (7). White powder; yield 98%. ¹H NMR (CDCl₃) δ 7.73

(dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.45 (dd, J = 5.1 Hz, J = 1.2 Hz, 1H),

7.21ꢀ7.32 (m, 5H), 7.10 (dd, J = 5.1 Hz, J = 3.7 Hz, 1H), 4.47 (m, 1H),

3004

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

3.86 (m, 1H), 3.73 (s, 2H), 3.13 (m, 2H), 2.94 (m, 1H), 1.6ꢀ2.12 (m,

4H). ¹³C NMR (CDCl₃) δ 180.79, 169.44, 164.30, 134.95, 129.62,

129.38, 128.82, 128.57, 128.19, 128.03, 126.90, 45.18, 41.08, 40.88, 34.15,

29.23, 28.77. t_{R LCMS}5.9 min. Purity 95%. MS [M þ H]^þm/z 354.

2-(2-Fluoro-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-pi-

peridin-1-yl]-ethanone (8). White powder; yield 69%. ¹H NMR

(CD₂Cl₂) δ 7.75 (d, J = 3.7 Hz, 1H), 7.51 (d, J = 5.1 Hz, 1H),

7.23ꢀ7.27 (m, 2H), 7.02ꢀ7.17 (m, 3H), 4.46ꢀ4.50 (m, 1H),

3.93ꢀ3.98 (m, 1H), 3.71 (s, 2H), 3.17ꢀ3.29 (m, 2H), 2.90ꢀ2.98 (m,

1H), 2.10ꢀ2.16 (m, 2H), 1.78ꢀ1.88 (m, 2H). ¹³C NMR (CD₂Cl₂)

δ 183.64, 170.66, 166.86, 163.33 (d, J = 245.9 Hz), 133.72 (d, J = 4.2

Hz), 132.01, 131.81, 131.24 (d, J = 7.8 Hz), 130.93, 130.58, 126.73 (d,

J= 3.2 Hz), 125.31 (d, J = 16.1 Hz), 117.68 (d, J = 21.0 Hz), 47.56, 43.47,

36.85, 35.92, 31.95, 31.46. t_{R LCMS}6.1 min. Purity 99%. MS [M þ H]^þ

m/z 372.

Hz, 1H), 7.58 (t, J = 7.8 Hz, 1H), 7.56 (dd, J = 4.8 Hz J = 1.2 Hz, 1H),

7.43 (t, J = 7.8 Hz, 1H), 7.38 (d, J = 7.8 Hz, 1H), 7.20 (dd, J = 4.8 Hz

J = 3.9 Hz, 1H), 4.51ꢀ4.56 (m, 1H), 3.84ꢀ3.96 (m, 1H), 3.91 (s, 2H),

3.25ꢀ3.33 (m, 2H), 2.96ꢀ3.05 (m, 1H), 2.16ꢀ2.19 (m, 2H),

1.82ꢀ1.94 (m, 2H). t_{R LCMS}6.8 min. Purity 98%. MS [M þ H]^þm/z

422.

1-[4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-2-(3-tri-

1

fluoromethyl-phenyl)-ethanone (15). White powder; yield 60%. H

NMR (CD₂Cl₂) δ 7.80 (dd, J = 3.9 Hz, J = 1.2 Hz, 1H), 7.49ꢀ7.57 (m,

5H), 7.20 (dd, J = 5.1 Hz, J = 3.9 Hz, 1H), 4.50ꢀ4.54 (m, 1H),

3.94ꢀ3.98 (m, 1H), 3.82 (s, 2H), 3.22ꢀ3.32 (m, 2H), 2.96ꢀ3.08 (m,

1H), 2.11ꢀ2.19 (m, 2H), 1.76ꢀ1.94 (m, 2H). t_{R LCMS}6.8 min. Purity

98%. MS [M þ H]^þm/z 422.

1-[4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-2-(4-tri-

1

fluoromethyl-phenyl)-ethanone (16). White powder; yield 25%. H

2-(3-Fluoro-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-pi-

peridin-1-yl]-ethanone (9). White powder; yield 66%. ¹H NMR

(CD₂Cl₂) δ 7.74 (d, J = 3.7 Hz, 1H), 7.51 (d, J = 5.1 Hz, 1H),

7.26ꢀ7.33 (m, 1H), 7.15 (dd, J = 5.1 Hz, J = 3.7 Hz, 1H), 6.92ꢀ7.03 (m,

3H), 4.45ꢀ4.49 (m, 1H), 3.87ꢀ3.92 (m, 1H), 3.71 (s, 2H), 3.17ꢀ3.24

(m, 2H), 2.90ꢀ2.97 (m, 1H), 2.04ꢀ2.15 (m, 2H), 1.67ꢀ1.87 (m, 2H).

¹³C NMR (CD₂Cl₂) δ 183.57, 171.04, 166.83, 165.43 (d, J = 245.1 Hz),

140.47 (d, J = 7.8 Hz), 132.62 (d, J = 7.8 Hz), 132.01, 131.82, 130.91,

130.58, 127.20 (d, J = 3.2 Hz), 118.31 (d, J = 21.0 Hz), 116.11 (d, J = 21.0

Hz), 47.68, 43.46, 42.86, 36.74, 32.02, 31.37. t_{R LCMS}6.1 min. Purity

99%. MS [M þ H]^þm/z 372.

NMR (CD₂Cl₂) δ 7.75 (d, J = 3.6 Hz, 1H), 7.59 (d, J = 7.8 Hz, 2H), 7.51

(d, J = 5.1 Hz, 1H), 7.37 (d, J = 7.8 Hz, 2H), 7.15 (dd, J = 5.1 Hz, J = 3.6

Hz, 1H), 4.45ꢀ4.49 (m, 1H), 3.88ꢀ3.93 (m, 1H), 3.78 (s, 2H),

3.18ꢀ3.27 (m, 2H), 2.91ꢀ2.99 (m, 1H), 2.07 ꢀ2.15 (m, 2H),

1.71ꢀ1.88 (m, 2H). ¹³C NMR (CD₂Cl₂) δ 181.51, 168.73, 164.84,

140.29, 129.99, 129.98, 129.81, 128.88, 125.90 (q, J = 3.9 Hz), 124.86

(q, J = 272 Hz), 45.61, 41.46, 40.77, 34.74, 29.97, 29.34. t_{R LCMS}6.8 min.

Purity >99%. MS [M þ H]^þm/z 422.

1-[4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-2-o-to-

lyl-ethanone (17). White powder; yield 50%. ¹H NMR (CD₂Cl₂) δ 7.80

(dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.56 (dd, J = 4.8 Hz, J = 1.2 Hz, 1H),

7.11ꢀ7.21 (m, 5H), 4.52ꢀ4.59 (m, 1H), 3.89ꢀ3.97 (m, 1H), 3.71 (s,

2H), 3.22ꢀ3.32 (m, 2H), 2.96ꢀ3.05 (m, 1H), 2.29 (s, 3H), 2.12ꢀ2.17

(m, 2H), 1.82ꢀ1.90 (m, 2H). t_{R LCMS}6.4 min. Purity 98%, MS [M þ

H]^þm/z 368.

2-(4-Fluoro-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-pi-

peridin-1-yl]-ethanone (10). White powder; yield 53%. ¹H NMR

(CD₂Cl₂) δ 7.74 (d, J = 3.7 Hz, 1H), 7.51 (d, J = 5.1 Hz, 1H),

7.13ꢀ7.23 (m, 3H), 6.98ꢀ7.04 (m, 2H), 4.45ꢀ4.49 (m, 1H),

3.88ꢀ3.93 (m, 1H), 3.68 (s, 2H), 3.16ꢀ3.25 (m, 2H), 2.87ꢀ2.96 (m,

1H), 2.03ꢀ2.14 (m, 2H), 1.66ꢀ1.86 (m, 2H). ¹³C NMR (CD₂Cl₂)

δ 183.57, 171.42, 166.80, 164.25 (d, J = 245.9 Hz), 133.79 (d, J = 3.5

Hz), 132.99 (d, J = 7.6 Hz), 131.99, 131.80, 130.91, 130.56, 117.81 (d,

J = 21.0 Hz), 47.57, 43.39, 42.31, 36.83, 32.02, 31.40. t_{R LCMS}6.1 min.

Purity >99%. MS [M þ H]^þm/z 372.

1-[4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-2-m-to-

lyl-ethanone (18). White powder; yield 35%. ¹H NMR (CD₂Cl₂) δ 7.79

(dd, J = 3.3 Hz, J = 0.9 Hz, 1H), 7.55 (dd, J = 5.1 Hz, J = 0.9 Hz, 1H),

7.18ꢀ7.26 (m, 2H), 7.04ꢀ7.10 (m, 3H), 4.51ꢀ4.57 (m, 1H),

3.93ꢀ3.97 (m, 1H), 3.72 (s, 2H), 3.18ꢀ3.28 (m, 2H), 2.92ꢀ3.00 (m,

1H), 2.36 (s, 3H), 2.05ꢀ2.13 (m, 2H), 1.70ꢀ1.86 (m, 2H). t_{R LCMS}6.4

min. Purity 98%. MS [M þ H]^þm/z 368.

2-(2-Chloro-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

piperidin-1-yl]-ethanone (11). White powder; yield 56%. ¹H NMR

(CD₂Cl₂) δ 7.79 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.56 (dd, J = 4.8 Hz,

J = 1.2 Hz, 1H), 7.41ꢀ7.44 (m, 1H), 7.25ꢀ7.31 (m, 3H), 7.18ꢀ7.21 (m,

1H), 4.52ꢀ4.56 (m, 1H), 3.95ꢀ4.00 (m, 1H), 3.85 (s, 2H), 3.23ꢀ3.35

(m, 2H), 2.96ꢀ3.05 (m, 1H), 2.15ꢀ2.18 (m, 2H), 1.86ꢀ1.92 (m, 2H).

t_{R LCMS}6.5 min. Purity 98%. MS [M þ H]^þm/z 388.

1-[4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-2-p-to-

lyl-ethanone (19). White powder; yield 54%. ¹H NMR (CD₂Cl₂) δ 7.74

(d, J = 3.6 Hz, 1H), 7.51 (d, J = 5.1 Hz, 1H), 7.1 5 (dd, J = 5.1 Hz, J = 3.6

Hz, 1H), 7.08ꢀ7.13 (m, 4H), 4.49ꢀ4.54 (m, 1H), 3.87ꢀ3.93 (m, 1H),

3.67 (s, 2H), 3.14ꢀ3.21 (m, 2H), 2.87ꢀ2.95 (m, 1H), 2.30 (s, 3H),

1.99ꢀ2.13 (m, 2H), 1.66ꢀ1.82 (m, 2H). ¹³C NMR (CD₂Cl₂) δ 181.60,

169.82, 164.82, 136.98, 132.76, 129.96, 129.78, 129.76, 129.08, 128.91,

128.55, 45.70, 41.30, 40.92, 34.92, 29.84, 29.31, 21.26. t_{R LCMS}6.4 min.

Purity >99%. MS [M þ H]^þm/z 368.

2-(3-Chloro-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

piperidin-1-yl]-ethanone (12). White powder; yield 81%. ¹H NMR

(CD₂Cl₂) δ 7.80 (d, J = 3.6 Hz, 1H), 7.57 (d, J = 5.0 Hz, 1H), 7.27ꢀ7.35

(m, 3H), 7.17ꢀ7.22 (m, 2H), 4.50ꢀ4.55 (m, 1H), 3.92ꢀ3.97 (m, 1H),

3.75 (s, 2H), 3.23ꢀ3.31 (m, 2H), 2.95ꢀ3.04 (m, 1H), 2.11ꢀ2.20 (m,

2H), 1.78ꢀ1.94 (m, 2H). ¹³C NMR (CD₂Cl₂) δ 183.58, 170.98, 166.83,

140.07, 136.72, 132.40, 132.01, 131.82, 131.55, 130.96, 130.58, 129.78,

129.42, 47.79, 43.52, 42.69, 36.84, 32.04, 31.44. t_{R LCMS}6.5 min. Purity

98%. MS [M þ H]^þm/z 388.

2-(2-Methoxy-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

1

piperidin-1-yl]-ethanone (20). White powder; yield 70%. H NMR

(CD₂Cl₂) δ 7.80 (d, J = 3.6 Hz, 1H), 7.57 (d, J = 5.1 Hz, 1H), 7.19ꢀ7.31

(m, 3H), 6.92ꢀ6.98 (m, 2H), 4.52ꢀ4.63 (m, 1H), 4.00ꢀ4.08 (m, 1H),

3.87 (s, 3H), 3.72 (s, 2H), 3.21ꢀ3.30 (m, 2H), 2.89ꢀ3.02 (m, 1H),

2.11ꢀ2.20 (m, 2H), 1.71ꢀ1.85 (m, 2H). ¹³C NMR (CD₂Cl₂) δ 183.79,

172.09, 166.92, 159.53, 132.68, 131.97, 131.78, 131.00, 130.60, 130.57,

126.72, 123.06, 112.95, 57.92, 47.64, 43.49, 36.97, 36.85, 32.08, 31.53.

t_{R LCMS}6.1 min. Purity 98%. MS [M þ H]^þm/z 384.

2-(4-Chloro-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

piperidin-1-yl]-ethanone (13). White powder; yield 30%. ¹H NMR

(CD₂Cl₂) δ 7.74 (d, J = 3.6 Hz, 1H), 7.51 (d, J = 5.0 Hz, 1H), 7.28ꢀ7.31

(m, 2H), 7.13ꢀ7.19 (m, 3H), 4.44ꢀ4.49 (m, 1H), 3.87ꢀ3.91 (m, 1H),

3.68 (s, 2H), 3.16ꢀ3.24 (m, 2H), 2.89ꢀ2.96 (m, 1H), 2.04ꢀ2.14 (m,

2H), 1.68ꢀ1.88 (m, 2H). ¹³C NMR (CD₂Cl₂) δ 183.57, 171.17, 166.88,

136.64, 134.97, 132.92, 132.02, 131.83, 131.17, 130.92, 130.59, 47.63,

43.43, 42.46, 36.79, 32.02, 31.42. t_{R LCMS}6.5 min. Purity >99%. MS [M þ

H]^þm/z 388.

2-(3-Methoxy-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

1

piperidin-1-yl]-ethanone (21). White powder; yield 70%. H NMR

(CD₂Cl₂) δ 7.74 (d, J = 3.6 Hz, 1H), 7.51 (d, J = 5.1 Hz, 1H), 7.13ꢀ7.25

(m, 2H), 6.76ꢀ6.81 (m, 3H), 4.46ꢀ4.50 (m, 1H), 3.88ꢀ3.93 (m, 1H),

3.77 (s, 3H), 3.69 (s, 2H), 3.15ꢀ3.22 (m, 2H), 2.88ꢀ2.96 (m, 1H),

2.00ꢀ2.13 (m, 2H), 1.63ꢀ1.86 (m, 2H). ¹³C NMR (CD₂Cl₂) δ 183.75,

171.56, 166.90, 162.59, 139.54, 132.12, 131.99, 131.80, 131.01, 130.57,

123.51, 116.90, 114.65, 57.73, 47.73, 43.42, 43.39, 36.87, 31.93, 31.38.

t_{R LCMS}6.1 min. Purity 98%. MS [M þ H]^þm/z 384.

1-[4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-2-(2-tri-

1

fluoromethyl-phenyl)-ethanone (14). White powder; yield 84%. H

NMR (CD₂Cl₂) δ 7.80 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.70 (d, J = 7.8

3005

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

2-(4-Methoxy-phenyl)-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

piperidin-1-yl]-ethanone (22). White powder; yield 53%. ¹H NMR

(CD₂Cl₂) δ 7.74 (d, J = 3.6 Hz, 1H), 7.51 (d, J = 5.1 Hz, 1H), 7.12ꢀ7.15

(m, 3H), 6.84 (d, J = 8.7 Hz, 2H), 4.45ꢀ4.50 (m, 1H), 3.89ꢀ3.94 (m,

1H), 3.76 (s, 3H), 3.64 (s, 2H), 3.15ꢀ3.22 (m, 2H), 2.87ꢀ2.95 (m, 1H),

2.00ꢀ2.13 (m, 2H), 1.62ꢀ1.82 (m, 2H). ¹³C NMR (CD₂Cl₂) δ 183.65,

172.03, 166.93, 161.04, 132.31, 132.01, 131.82, 130.60, 129.90, 116.53,

57.76, 47.76, 43.40, 42.44, 36.86, 31.95, 31.49. t_{R LCMS}6.1 min. Purity

98%. MS [M þ H]^þm/z 384.

3-Methyl-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-

yl]-butan-1-one (30). Colorless oil; yield 68%. ¹H NMR (CDCl₃)

δ 7.76 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.48 (dd, J = 5.0 Hz, J = 1.2 Hz,

1H), 7.12 (dd, J = 5.0 Hz J = 3.7 Hz, 1H), 4.52 (m, 1H), 3.93 (m, 1H),

3.21 (m, 2H), 2.91 (m, 1H), 2.22 (d, J = 6.4 Hz,1H), 2.12 (m, 4H), 1.87

(m, 2H), 0.96 (d, J = 6.4 Hz, 6H). ¹³C NMR (CDCl₃) δ 180.86, 171.22,

164.31, 129.60, 129.33, 128.16, 127.97, 44.96, 42.06, 40.72, 34.34, 29.68,

29.01, 25.82, 22.70. t_{R LCMS}5.8 min. Purity >99%. MS [M þ H]^þ320 m/z.

3,3-Dimethyl-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-

1

2-Pyridin-2-yl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperi-

din-1-yl]-ethanone (23). Beige powder; yield 36%. ¹H NMR (CDCl₃)

δ 8.53ꢀ8.58 (m, 1H), 7.78 (d, J = 3.5 Hz, 1H), 7.72ꢀ7.76 (m, 1H), 7.51

(d, J = 5.0 Hz, 1H), 7.42ꢀ7.45 (m, 1H), 7.23ꢀ7.26 (m, 1H), 7.15 (dd, J

= 5.0 Hz, J = 3.5 Hz, 1H), 4.48ꢀ4.53 (m, 1H), 4.16ꢀ4.20 (m, 1H), 4.03

(s, 2H), 3.23ꢀ3.35 (m, 2H), 2.98ꢀ3.05 (m, 1H), 2.09ꢀ2.17 (m, 2H),

1.76ꢀ1.93 (m, 2H). t_{R LCMS}3.8 min. Purity 99%. MS [M þ H]^þm/z

355.

1-yl]-butan-1-one (31). Colorless oil; yield 62%. H NMR (CDCl₃)

δ 7.74 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.46 (dd, J = 5.0 Hz, J = 1.2 Hz,

1H), 7.11 (dd, J = 5.0 Hz, J = 3.8 Hz, 1H), 4.51 (m, 1H), 3.98 (m, 1H),

3.19 (m, 1H), 3.00 (m, 2H), 2.27 (s, 2H), 2.13 (m, 2H), 1.88 (m, 2H),

1.03 (s, 9H). ¹³C NMR (CDCl₃) δ 180.90, 170.47, 164.33, 129.59,

129.31, 128.21, 127.98, 44.69, 34.35, 31.49, 30.06, 29.64, 29.37. t_{R LCMS}

6.1 min. Purity 99%. MS [M þ H]^þm/z 334.

4-Methyl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-

1

2-Pyridin-3-yl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperi-

din-1-yl]-ethanone (24). Beige powder; yield 60%. ¹H NMR (CDCl₃)

δ 8.97 (s, 1H), 8.64 (d, J = 5.6 Hz, 1H), 8.40 (d, J = 7.9 Hz, 1H), 7.87 (dd,

J = 5.6 Hz, J = 7.9 Hz, 1H), 7.77 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.50 (dd,

J =5.1 Hz, J= 1.2Hz, 1H), 7.15 (dd, J =5.1 Hz, J = 3.6Hz, 1H), 4.40ꢀ4.45

(m, 1H), 4.06ꢀ4.11 (m, 3H), 3.26ꢀ3.46 (m, 2H), 3.02ꢀ3.10 (m, 1H),

2.16ꢀ2.28 (m, 2H), 1.90ꢀ2.07 (m, 2H). t_{R LCMS}3.8min. Purity 99%. MS

[M þ H]^þm/z 355.

yl]-pentan-1-one (32). Colorless oil; yield 83%. H NMR (CDCl₃)

δ 7.72 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.45 (dd, J = 5.1 Hz, J = 1.2 Hz,

1H), 7.09 (dd, J = 5.1 Hz, J = 3.7 Hz, 1H), 4.46 (m, 1H), 3.89 (m, 1H),

3.19 (m, 2H), 2.90 (m, 1H), 2.30 (t, J = 8.0 Hz, 2H), 2.10 (m, 2H), 1.84

(m, 2H), 1.49 (m, 3H), 0.86 (d, J = 6.4 Hz, 6H). ¹³C NMR (CDCl₃)

δ 180.87, 171.86, 164.30, 129.58, 129.32, 128.19, 127.98, 44.55, 40.73,

34.35, 34.21, 31.37, 29.27, 27.91, 22.39. t_{R LCMS}6.3 min. Purity 98%. MS

[M þ H]^þm/z 334.

2-Pyridin-4-yl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperi-

din-1-yl]-ethanone (25). Beige powder; yield 65%. ¹H NMR (MeOD)

δ 8.49 (d, J = 5.8 Hz, 2H), 7.78 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.68 (dd, J =

5.1 Hz, J = 1.2 Hz, 1H), 7.37 (d, J = 5.8 Hz, 2H), 7.20 (dd, J = 5.1 Hz, J = 3.6

Hz, 1H), 4.47ꢀ4.51 (m, 1H), 4.04ꢀ4.09 (m, 1H), 3.92 (s, 2H),

3.35ꢀ3.42 (m, 2H), 3.02ꢀ3.10 (m, 1H), 2.15ꢀ2.22 (m, 2H),

1.75ꢀ1.85 (m, 2H). t_{R LCMS}3.8 min. Purity 98%. MS [M þ H]^þm/z

355.

4,4-Dimethyl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-

1

yl]-pentan-1-one (33). White powder; yield 80%. H NMR (CDCl₃)

δ 7.79 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.51 (dd, J = 5.1 Hz, J = 1.2 Hz,

1H), 7.16 (dd, J = 5.1 Hz, J = 3.6 Hz, 1H), 4.52ꢀ4.57 (m, 1H),

3.91ꢀ3.96 (m, 1H), 3.22ꢀ3.29 (m, 2H), 2.90ꢀ2.98 (m, 1H),

2.30ꢀ2.36 (m, 2H), 2.15ꢀ2.22 (m, 2H), 1.86ꢀ2.01 (m, 2H),

1.53ꢀ1.58 (m, 2H), 0.93 (s, 9H). t_{R LCMS}6.2 min. Purity >99%. MS

[M þ H]^þm/z 348.

1-[4-(3-Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-etha-

none (26). Beige powder; yield 98%. ¹H NMR (CDCl₃) δ 7.76 (dd, J =

3.7 Hz J = 1.1 Hz, 1H), 7.48 (dd, J = 5.0 Hz, J = 1.1 Hz, 1H), 7.13 (dd, J =

5.0 Hz, J = 3.7 Hz, 1H), 4.48 (m, 1H), 3.93 (m, 1H), 3.23 (m, 2H), 2.94

(m, 1H), 2.12 (m, 5H), 1.90 (m, 2H). ¹³C NMR (CDCl₃) δ 180.79,

169.09, 164.37, 129.61, 129.35, 128.21, 128.00, 34.25, 29.70, 29.33,

21.37. t_{R LCMS}4.5 min. Purity >99%. MS [M þ H]^þm/z 278.

1-[4-(3-Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-pro-

pan-1-one (27). White powder; yield 56%. ¹H NMR (CDCl₃) δ 7.75

(dd, J = 3.8 Hz, J = 1.2 Hz, 1H), 7.47 (dd, J = 5.0 Hz, J = 1.2 Hz, 1H), 7.11

(dd, J = 5.0 Hz, J = 3.8 Hz, 1H), 4.1 (m, 2H), 3.21 (m, 1H), 3.07 (m, 2H),

2.35 (q, J = 7.5 Hz, 2H), 2.13 (m, 2H), 1.88 (m, 2H), 1.13 (t, J = 7.5 Hz,

3H). ¹³C NMR (CDCl₃) δ 180.88, 172.29, 164.33, 129.59, 129.33,

128.21, 127.98, 34.37, 29.33, 29.27, 26.49, 9.52. t_{R LCMS}4.9 min. Purity

98%. MS [M þ H]^þm/z 292.

(S)-2-Amino-3-methyl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

piperidin-1-yl]-butan-1-one Hydrochloride (34). N-Boc-^L-valine (1.2

equiv), EDCI (1.2 equiv), HOBt (0.5 equiv), and triethylamine (4

equiv) were mixed in DCM (2 mL) for 5 min, and then 4-(3-thiophen-2-

yl-[1,2,4]oxadiazol-5-yl)-piperidine hydrochloride (150 mg, 1 equiv)

was added with 3 mL of DCM. The reaction mixture was stirred

overnight at room temperature and then evaporated under reduced

pressure. The residue was purified by thick layer chromatography

(DCM/MeOH 98/2) to give 147 mg of the expected product (yield =

61%). Boc intermediate was dissolved in dioxane (2 mL), and HCl 4N

solution in dioxane (5 equiv) was added. The reaction mixture was

stirred overnight at room temperature and then evaporated under

reduced pressure. The residue was purified by thick layer chromatogra-

phy (DCM/MeOH 9/1) to give (34) as a white powder. Yield 66%. ¹H

NMR (MeOD) δ 7.78 (dd, J = 3.6 Hz J = 1.2 Hz, 1H), 7.68 (dd, J = 5.1

Hz, J = 1.2 Hz, 1H), 7.20 (dd, J = 5.1 Hz, J = 3.6 Hz, 1H), 4.40ꢀ4.59 (m,

1H), 4.23ꢀ4.30 (m, 1H), 3.99ꢀ4.09 (m, 1H), 3.41ꢀ3.46 (m, 2H),

3.00ꢀ3.18 (m, 1H), 2.13ꢀ2.29 (m, 3H), 1.81ꢀ2.01 (m, 2H), 1.10 (d,

J = 7.2 Hz, 3H), 1.02 (d, J = 6.9 Hz, 3H). t_{R LCMS}3.9 min. Purity 99%. MS

[M þ H]^þm/z 335.

1-[4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-butan-

1-one (28). White powder; yield 76%. ¹H NMR(CD₂Cl₂) δ 7.79 (dd, J =

3.8 Hz J = 1.2 Hz, 1H), 7.56 (dd, J = 5.0 Hz J = 1.2 Hz, 1H), 7.19 (dd, J =

5.0 Hz, J = 3.8 Hz, 1H), 4.51ꢀ4.55 (m, 1H), 3.93ꢀ3.97 (m, 1H),

3.23ꢀ3.29 (m, 2H), 2.85ꢀ2.94 (m, 1H), 2.33 (t, J = 7.5 Hz, 2H),

2.14ꢀ2.22 (m, 2H), 1.78ꢀ1.97 (m, 2H), 1.65 (sextuplet, J = 7.5 Hz, 2H),

0.98 (t, J = 7.5 Hz, 3H). t_{R LCMS}5.4 min. Purity >99%. MS [M þ H]^þ

m/z 306.

(S)-2-Amino-4-methyl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

piperidin-1-yl]-pentan-1-one Hydrochloride (35). N-Boc-^L-leucine (1.2

equiv), EDCI (1.2 equiv), HOBt (0.5 equiv), and triethylamine (4

equiv) were mixed in DCM (2 mL) for 5 min, and then 4-(3-thiophen-2-

yl-[1,2,4]oxadiazol-5-yl)-piperidine hydrochloride (150 mg, 1 equiv)

was added with 3 mL of DCM. The reaction mixture was stirred

overnight at room temperature and then evaporated under reduced

pressure. The residue was purified by thick layer chromatography

(DCM/MeOH 98/2) to give 162 mg of the expected product (yield =

65%). Boc intermediate was dissolved in dioxane (2 mL), and HCl 4N

solution in dioxane (5 equiv) was added. The reaction mixture was

1-[4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidin-1-yl]-pentan-1-

one (29). Colorless oil; yield 76%. ¹H NMR (CD₂Cl₂) δ 7.79 (dd, J =

3.8 Hz, J = 1.2 Hz, 1H), 7.56 (dd, J = 5.0 Hz, J = 1.2 Hz, 1H), 7.19 (dd, J =

5.0 Hz, J = 3.8 Hz, 1H), 4.50ꢀ4.55 (m, 1H), 3.93ꢀ3.97 (m, 1H),

3.23ꢀ3.30 (m, 2H), 2.85ꢀ2.94 (m, 1H), 2.36 (t, J = 7.5 Hz, 2H),

2.11ꢀ2.22 (m, 2H), 1.80ꢀ1.97 (m, 2H), 1.55ꢀ1.65 (m, 2H), 1.39

(sextuplet, J = 7.5 Hz, 2H), 0.96 (t, J = 7.5 Hz, 3H). t_{R LCMS}5.9 min.

Purity >99%. MS [M þ H]^þm/z 320.

3006

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

stirred overnight at room temperature and then evaporated under

reduced pressure. The residue was purified by thick layer chromatogra-

phy (DCM/MeOH 9/1) to give (35) as a white powder. Yield 73%. ¹H

NMR (MeOD) δ 7.79 (dd, J = 3.6 Hz, J = 1.1 Hz, 1H), 7.69 (dd, J = 5.0

Hz, J = 1.1 Hz, 1H), 7.21 (dd, J = 5.0 Hz, J = 3.6 Hz, 1H), 4.38ꢀ4.57 (m,

2H), 3.87ꢀ3.96 (m, 1H), 3.39ꢀ3.49 (m, 2H), 3.00ꢀ3.20 (m, 1H),

2.22ꢀ2.33 (m, 2H), 1.61ꢀ1.99 (m, 5H), 1.06 (d, J = 6.4 Hz, 3H), 1.02

(d, J = 6.4 Hz, 3H). t_{R LCMS}4.0 min. Purity 99%. MS [M þ H]^þm/z 349.

2-Hydroxy-4-methyl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

129.60, 129.34, 128.07, 127.95, 45.06, 41.97, 40.67, 35.17, 34.25, 33.30,

32.95, 29.64, 28.96, 26.03. t_{R LCMS}6.7 min. Purity 98%. MS [M þ H]^þ

m/z 360.

2-(4-Methyl-cyclohexyl)-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-

1

yl)-piperidin-1-yl]-ethanone (43). Colorless oil; yield 98%. H NMR

(CDCl₃) δ 7.70 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.42 (dd, J = 5.1 Hz, J =

1.2 Hz, 1H), 7.07 (dd, J = 5.1 Hz, J = 3.7 Hz, 1H), 4.45 (m, 1H), 3.88 (m,

1H), 3.17 (m, 2H), 2.86 (m, 1H), 2.26 (d, J = 7.2 Hz, 2H), 2.17ꢀ1.18

(m, 17H). ¹³C NMR (CDCl₃) δ 180.88, 171.14, 164.33, 129.59, 129.32,

128.21, 127.98, 44.98, 40.67, 37.97, 34.97, 34.40, 33.34, 32.67, 30.77,

28.74, 22.60, 20.06. t_{R LCMS}7.3 min. Purity 98%. MS [M þ H]^þm/z 374.

3-Cyclohexyl-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperi-

din-1-yl]-propan-1-one (44). Colorless oil; yield 98%. ¹H NMR

(CDCl₃) δ 7.71 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.44 (dd, J = 5.0

Hz, J = 1.2 Hz, 1H), 7.08 (dd, J = 5.0 Hz, J = 3.7 Hz, 1H), 4.46 (m, 1H),

1

piperidin-1-yl]-pentan-1-one (36). Colorless oil; yield 40%. H NMR

(CD₂Cl₂) δ 7.80 (d, J = 3.7 Hz, 1H), 7.56 (dd, J = 5.0 Hz J = 1.2 Hz, 1H),

7.20 (dd, J = 5.0 Hz, J = 3.7 Hz, 1H), 4.40ꢀ4.56 (m, 2H), 3.74ꢀ3.80 (m,

1H), 3.62 (brs, OH), 3.19ꢀ3.36 (m, 2H), 2.97ꢀ3.15 (m, 1H),

2.17ꢀ2.27 (m, 2H), 1.87ꢀ2.03 (m, 2H), 1.27ꢀ1.50 (m, 2H), 1.02 (d,

J = 6.8 Hz, 3H), 0.98 (d, J = 6.8 Hz, 3H). t_{R LCMS}5.7 min. Purity >99%.

MS [M þ H]^þm/z 350.

3.87 (m, 1H), 3.18 (m, 2H), 2.86 (m, 1H), 2.35ꢀ1.45 (m, 19H). ¹³

C

NMR (CDCl₃) δ 180.87, 172.12, 164.28, 129.58, 129.32, 128.17,

121.97, 44.75, 40.71, 37.44, 34.33, 33.10, 32.80, 30.90, 29.63, 28.94,

26.52, 26.22. t_{R LCMS}7.4 min. Purity 98%. MS [M þ H]^þm/z 374.

3,3,3-Trifluoro-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piper-

idin-1-yl]-propan-1-one (45). White powder; yield 47%. ¹H NMR

(MeOD) δ 7.79 (dd, J = 3.6 Hz J = 1.2 Hz, 1H), 7.67 (dd, J = 5.0 Hz,

J = 1.2 Hz, 1H), 7.20 (dd, J = 5.0 Hz, J = 3.6 Hz, 1H), 4.45ꢀ4.51 (m,

1H), 3.96ꢀ4.04 (m, 1H), 3.55 (q, J = 10.5 Hz, 2H), 3.35ꢀ3.42 (m, 2H),

3.01ꢀ3.10 (m, 1H), 2.15ꢀ2.25 (m, 2H), 1.78ꢀ2.00(m, 2H). t_{R LCMS}

5.6 min. Purity 99%. MS [M þ H]^þm/z 346.

2-Methoxy-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-

ethanone (37). Colorless oil; yield 72%. ¹H NMR (CDCl₃) δ 7.72 (dd,

J = 3.7 Hz, J = 1.2 Hz, 1H), 7.45 (dd, J = 5.0 Hz, J = 1.2 Hz, 1H), 7.09 (dd,

J = 5.0 Hz, J = 3.7 Hz, 1H), 4.41 (m, 1H), 4.07 (s, 2H), 3.90 (m, 1H),

3.38 (s, 3H), 3.20 (m, 2H), 2.94 (m, 1H), 2.12 (m, 2H), 1.87 (m, 2H).

¹³C NMR (CDCl₃) δ 180.76, 167.54, 164.32, 129.60, 129.35, 128.17,

127.98, 71.87, 59.07, 44.08, 40.94, 34.22, 29.56, 28.89. t_{R LCMS}4.5 min.

Purity 98%. MS [M þ H]^þm/z 308.

3-Methoxy-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-

1

1-yl]-propan-1-one (38). Colorless oil; yield 86%. H NMR (CDCl₃)

3,3,3-Trifluoro-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piper-

idin-1-yl]-butan-1-one (46). White powder; yield 76%. ¹H NMR

(CDCl₃) δ 7.74 (dd, J = 3.7 Hz, J = 1.1 Hz, 1H), 7.47 (dd, J = 5.0

Hz, J = 1.1 Hz, 1H), 7.11 (dd, J = 5.0 Hz, J = 3.7 Hz, 1H), 4.45 (m, 1H),

3.86 (m, 1H), 3.23 (m, 2H), 2.96 (m, 1H), 2.52 (m, 4H), 2.13 (m, 2H),

1.88 (m, 2H). ¹³C NMR (CDCl₃) δ 180.66, 168.07, 164.34, 129.63,

129.36, 128.15, 128.00, 127.06 (q, J = 275 Hz), 44.38, 40.98, 34.15, 29.56

(q, J = 29 Hz), 29.38, 28.81, 25.87. t_{R LCMS}5.9 min. Purity 99%. MS [M þ

H]^þm/z 360.

4,4,4-Trifluoro-3-hydroxy-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-

yl)-piperidin-1-yl]-butan-1-one (47). White powder; yield 27%. ¹H

NMR (CD₂Cl₂) δ 7.80 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.56 (dd, J =

5.1 Hz, J = 1.2 Hz, 1H), 7.20 (dd, J = 5.1 Hz, J = 3.6 Hz, 1H), 4.86 (brs,

OH), 4.45ꢀ4.56 (m, 2H), 3.86ꢀ3.94 (m, 1H), 3.26ꢀ3.35 (m, 2H),

2.97ꢀ3.09 (m, 1H), 2.64ꢀ2.79 (m, 2H), 2.18ꢀ2.26 (m, 2H),

1.83ꢀ2.04 (m, 2H). t_{R LCMS}5.3 min. Purity >99%. MS [M þ H]^þ

m/z 376.

δ 7.70 (dd, J = 3.7 Hz, J = 1.1 Hz, 1H), 7.43 (dd, J = 5.0 Hz, J = 1.1 Hz,

1H), 7.07 (dd, J = 5.0 Hz, J = 3.7 Hz, 1H), 4.44 (m, 1H), 3.89 (m, 1H),

3.63 (t, J = 6.4 Hz, 2H), 3.29 (s, 3H), 3.17 (m, 2H), 2.89 (m, 1H), 2.57 (t,

J = 6.4 Hz, 2H), 2.08 (m, 2H), 1.85 (m, 2H). ¹³C NMR (CDCl₃)

δ 180.85, 169.44, 164.28, 129.57, 129.32, 128.19, 127.96, 68.75, 58.86,

44.81, 40.72, 34.25, 33.46, 29.52, 28.87. t_{R LCMS}4.7 min. Purity 98%. MS

[M þ H]^þm/z 322.

4-Oxo-4-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperidin-1-yl]-

butyric Acid (39). Beige powder; yield 86%. ¹H NMR (CDCl3) δ 7.77

(d, J = 3.6 Hz, 1H), 7.50 (d, J = 4.9 Hz, 1H), 7.15 (dd, J = 4.9 Hz, J = 3.6

Hz, 1H), 4.48 (m, 1H), 3.95 (m, 1H), 3.27 (m, 2H), 3.02 (m, 1H), 2.72

(m, 4H), 2.17 (m, 2H), 1.96 (m, 2H). ¹³C NMR (CDCl₃) δ 180.77,

176.86, 170.22, 164.40, 129.68, 129.39, 128.15, 128.02, 34.19, 29.48,

28.86, 27.98, 27.96. t_RLCMS 4.3 min. Purity 98%. MS [M þ H]þ m/z 336.

2-Cyclopropyl-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piper-

idin-1-yl]-ethanone (40). Colorless oil; yield 78%. ¹H NMR (CDCl₃)

δ 7.80 (dd, J = 3.9 Hz J = 1.2 Hz, 1H), 7.56 (dd, J = 5.1 Hz, J = 1.2 Hz,

1H), 7.20 (dd, J = 5.1 Hz, J = 3.9 Hz, 1H), 4.55 (m, 1H), 3.93 (m, 1H),

3.27 (m, 2H), 2.94 (m, 1H), 2.27 (d, J = 7.2 Hz, 2H), 2.21 (m, 2H), 1.91

(m, 2H), 1.06 (m, 1H), 0.58 (m, 2H), 0.20 (m, 2H). ¹³C NMR (CDCl₃)

δ 180.86, 171.07, 164.32, 129.58, 129.32, 128.21, 127.98, 44.79, 40.66,

38.54, 34.35, 29.64, 29.00, 7.31, 4.57. t_{R LCMS}5.3 min. Purity >99%. MS

[M þ H]^þm/z 318.

4,4,4-Trifluoro-2-methyl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

1

piperidin-1-yl]-butan-1-one (48). Colorless oil; yield 70%. H NMR

(CD₂Cl₂) δ 7.80 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.56 (dd, J = 5.1 Hz, J =

1.2 Hz, 1H), 7.19 (dd, J = 5.1 Hz, J = 3.7 Hz, 1H), 4.45ꢀ4.58 (m, 1H),

3.97ꢀ4.05 (m, 1H), 3.25ꢀ3.39 (m, 2H), 3.06ꢀ3.18 (m, 1H),

2.89ꢀ3.05 (m, 1H), 2.73ꢀ2.86 (m, 1H), 2.13ꢀ2.27 (m, 3H),

1.81ꢀ1.97 (m, 2H), 1.22ꢀ1.25 (m, 3H). t_R

>99%. MS [M þ H]^þm/z 374.

6.1 min. Purity

2-Cyclopentyl-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piper-

idin-1-yl]-ethanone (41). White powder; yield 94%. ¹H NMR (CDCl₃)

δ 7.70 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.43 (dd, J = 5.0 Hz, J = 1.2 Hz,

1H), 7.08 (dd, J = 5.0 Hz, J = 3.6 Hz, 1H), 4.47 (m, 1H), 3.89 (m, 1H),

3.17 (m, 2H), 2.86 (m, 1H), 2.32 (d, J = 7.5 Hz, 2H), 2.17 (m, 1H), 2.09

(m, 2H), 1.80 (m, 4H), 1.54 (m, 4H), 1.11 (m, 2H). ¹³C NMR (CDCl₃)

δ 180.96, 171.36, 164.34, 129.63, 129.37, 128.26, 128.02, 44.88, 40.70,

39.25, 36.79, 34.41, 32.75, 29.71, 29.06, 25.00. t_{R LCMS}6.4 min. Purity

>99%. MS [M þ H]^þm/z 346.

LCMS

4,4,4-Trifluoro-3-methyl-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

1

piperidin-1-yl]-butan-1-one (49). Colorless oil; yield 70%. H NMR

(CDCl₃) δ 7.80 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.53 (dd, J = 5.1 Hz, J =

1.2 Hz, 1H), 7.17 (dd, J = 5.1 Hz, J = 3.7 Hz, 1H), 4.47ꢀ4.59 (m, 1H),

3.91ꢀ3.97 (m, 1H), 3.25ꢀ3.35 (m, 2H), 2.90ꢀ3.09 (m, 2H),

2.67ꢀ2.74 (m, 1H), 2.30ꢀ2.39 (m, 1H), 2.16ꢀ2.23 (m, 2H),

1.85ꢀ2.03 (m, 2H), 1.20 (d, J = 7.0 Hz, 3H). t_{R LCMS}6.4 min. Purity

>99%; MS [M þ H]^þm/z 374.

2-Cyclohexyl-1-[4-(3-thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-piperi-

1

4,5,5,5-Tetrafluoro-1-[4-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-

piperidin-1-yl]-4-trifluoromethyl-pentan-1-one (50). White powder;

yield 84%. ¹H NMR (CD₂Cl₂) δ 7.80 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H),

7.56 (dd, J = 5.0 Hz, J = 1.2 Hz, 1H), 7.19 (dd, J = 5.0 Hz, J = 3.7 Hz, 1H),

4.49ꢀ4.54 (m, 1H), 3.89ꢀ3.93 (m, 1H), 3.24ꢀ3.34 (m, 2H),

din-1-yl]-ethanone (42). Colorless oil; yield 98%. H NMR (CDCl₃)

δ 7.69 (dd, J = 3.7 Hz, J = 1.2 Hz, 1H), 7.42 (dd, J = 5.0 Hz, J = 1.2 Hz,

1H), 7.06 (dd, J = 5.0 Hz, J = 3.7 Hz, 1H), 4.44 (m, 1H), 3.87 (m, 1H),

3.17 (m, 2H), 2.88 (m, 1H), 2.17 (d, J = 6.7 Hz, 2H), 2.09 (m, 3H),

1.59ꢀ1.83 (m, 12H). ¹³C NMR (CDCl₃) δ 180.84, 171.29, 164.24,

3007

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

2.94ꢀ3.02 (m, 1H), 2.50ꢀ2.66 (m, 4H), 2.17ꢀ2.24 (m, 2H),

1.81ꢀ2.00 (m, 2H). t_{R LCMS}7.2 min. Purity >99%. MS [M þ H]^þ

m/z 460.

45.63, 44.42, 34.51, 29.61 (q, J = 29 Hz), 28.52, 25.97, 24.72. t_{R LCMS}

5.7 min. Purity >99%. MS [M þ H]^þm/z 360.

4,4,4-Trifluoro-1-[(S)-3-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-pi-

peridin-1-yl]-butan-1-one (54). Using the above procedure for 53 with

4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-1-(3,3,3-trifluoro-propane-

1-sulfonyl)-piperidine (51). 4-(3-Thiophen-2-yl-[1,2,4]oxadiazol-5-yl)-

piperidine hydrochloride (0.5 mmol, 1 equiv) and triethylamine (3

equiv) were mixed in dried DCM (5 mL). 3,3,3-Trifluoropropane-1-

sulfonyl chloride (1.3 equiv) was added dropwise, and the reaction

mixture was stirred overnight at room temperature and then evaporated

under reduced pressure and purified by preparative HPLC. White

1

(S)-Boc-nipecotic acid provided 54 as a colorless oil; yield 62%. H

NMR (CDCl₃) cis/trans isomer mixture (53% isomer A/47% isomer

B); isomer A δ 7.78 (d, J = 3.6 Hz, 1H), 7.50ꢀ7.53 (m, 1H), 7.14ꢀ7.18

(m, 1H), 3.79ꢀ3.90 (m, 3H), 3.44ꢀ3.53 (m, 1H), 3.15ꢀ3.25 (m, 1H),

2.84ꢀ2.95 (m, 1H), 2.49ꢀ2.70 (m, 3H), 2.13ꢀ2.23 (m, 2H),

1.61ꢀ1.77 (m, 2H); isomer B δ 7.78 (d, J = 3.6 Hz, 1H), 7.50ꢀ7.53

(m, 1H), 7.14ꢀ7.18 (m, 1H), 4.75ꢀ4.85 (m, 1H), 3.79ꢀ3.85 (m, 1H),

3.15ꢀ3.25 (m, 3H), 2.49ꢀ2.70 (m, 4H), 2.28ꢀ2.36 (m, 1H),

1.91ꢀ2.00 (m, 2H), 1.61ꢀ1.77 (m, 1H). ¹³C NMR (CDCl₃) cis/trans

isomer mixture (53% isomer A/47% isomer B); isomer A δ 179.06,

168.49, 164.41, 129.70, 129.56, 128.07, 127.95, 127.12 (q, J = 275 Hz),

47.41, 42.11, 34.87, 29.61 (q, J = 29 Hz), 27.96, 25.97, 23.15; isomer B

δ 179.34, 168.31, 164.34, 129.64, 129.34, 128.22, 127.99, 127.05 (q,

J = 275 Hz), 45.63, 44.42, 34.51, 29.61 (q, J = 29 Hz), 28.53, 25.97, 24.72.

t_{R LCMS}5.7 min. Purity >99%. MS [M þ H]^þm/z 360.

1

powder; yield 70%. H NMR (CD₂Cl₂) δ 7.81 (dd, J = 3.7 Hz, J =

1.2 Hz, 1H), 7.57 (dd, J = 5.0 Hz, J = 1.2 Hz, 1H), 7.20 (dd, J = 5.0 Hz, J =

3.7 Hz, 1H), 3.78ꢀ3.86 (m, 2H), 3.08ꢀ3.26 (m, 5H), 2.60ꢀ2.76 (m,

2H), 2.25ꢀ2.31 (m, 2H), 2.00ꢀ2.13 (m, 2H). t_{R LCMS}6.5 min. Purity

>99%. MS [M þ H]^þm/z 396.

4-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidine-1-carboxylic Acid

(2,2,2-Trifluoro-ethyl)-amide (52). Carbonyldiimidazole (1 equiv) was

added to a solution of 2,2,2-trifluoroethylamine hydrochloride (1 equiv)

in THF (4 mL) and triethylamine (1 equiv). The reaction mixture was

stirred

5 h at room temperature, and then 4-(3-thiophen-2-

4,4,4-Trifluoro-1-[(R)-3-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-pyr-

rolidin-1-yl]-butan-1-one (55). (R)-N-Boc-pyrrolidine-3-carboxylic

acid (4.65 mmol, 1 equiv), HBTU (1.1 equiv), and diisopropylethyla-

mine (2.5 equiv) were dissolved in dimethylformamide (10 mL). The

solution was stirred 5 min, and then thiophene-2-amidoxime (1 equiv)

was added. The reaction mixture was stirred overnight at room

temperature and then evaporated under reduced pressure. The residue

was dissolved in AcOEt and washed twice with saturated aqueous

NaHCO₃and once with brine and then dried over MgSO₄and

evaporated under reduced pressure. The residue was dissolved in

10 mL of DMF and then heated at 120 ꢀC for 9 h. The solvent was

removed under vacuum, and the residue was dissolved in AcOEt. The

organic layer was washed once with HCl 1N, once with saturated

aqueous NaHCO₃, and once with brine, then dried over MgSO₄and

evaporated under reduced pressure. The obtained product was used

in the next step without further purification. Boc intermediate was

dissolved in dioxane (5 mL), and HCl 4N solution in dioxane (5 equiv)

was added. The reaction mixture was stirred overnight at room

temperature and then evaporated under reduced pressure. The residue

was dissolved in water and then washed once with diethyl ether. The pH

of the aqueous phase was adjusted to 8 with saturated aqueous K₂CO₃,

and then the product was extracted 3 times with AcOEt. The organic

phases were joined, washed once with brine, then dried over MgSO₄and

evaporated under reduced pressure to give 5-(R)-pyrrolidin-3-yl-3-

thiophen-2-yl-1,2,4-oxadiazole (yield 74% over two steps). 4,4,4-Ti-

fluorobutyric acid (1.3 equiv), EDCI (1.3 equiv), HOBt (0.4 equiv), and

diisopropylethylamine (4 equiv) were mixed in DMF (2 mL) for 5 min.

5-(R)-Pyrrolidin-3-yl-3-thiophen-2-yl-1,2,4-oxadiazole (0.9 mmol, 1

equiv) was added with 3 mL of DMF. The reaction mixture was stirred

overnight at room temperature and then evaporated under reduced

pressure. The residue was dissolved in AcOEt, and the organic layer was

washed with aqueous saturated NaHCO₃(3 times), aqueous HCl 1 M

(3 times) and brine (once), dried over MgSO₄, and concentrated under

vacuum. The residue was recrystallized in diisopropyl ether and then in

absolute ethanol to give 55 as white crystals; yield 62%. ¹H NMR

(CDCl₃) δ 7.77ꢀ7.79 (m, 1H), 7.50ꢀ7.53 (m, 1H), 7.14ꢀ7.17 (m,

1H), 3.91ꢀ4.04 (m, 2H), 3.71ꢀ3.85 (m, 2H), 3.59ꢀ3.68 (m, 1H),

2.33ꢀ2.60 (m, 6H). ¹³C NMR (CDCl₃) cis/trans isomer mixture (55%

isomer A/45% isomer B); isomer A δ 179.10, 168.39, 164.55, 129.81,

129.53, 128.04, 127.95, 127.00 (q, J = 275 Hz), 49.31, 45.57, 35.04, 29.17

(q, J = 30 Hz), 28.96, 27.17; isomer B δ 178.63, 168.21, 164.55, 129.85,

129.62, 128.07, 127.82, 127.00 (q, J = 275 Hz), 49.54, 45.22, 36.85,

30.45, 29.17 (q, J = 30 Hz), 27.35. Melting point 111.8ꢀ112.4 ꢀC;

t_{R LCMS}5.6 min. Purity >99%. MS [M þ H]^þm/z 346.

yl-[1,2,4]oxadiazol-5-yl)-piperidine hydrochloride (0.5 mmol, 1 equiv)

was added with 4 mL of THF. The mixture was stirred overnight at room

temperature and then evaporated under reduced pressure and purified

1

by preparative HPLC. White powder; yield 5%. H NMR (CD₂Cl₂)

δ 7.80 (d, J = 3.6 Hz, 1H), 7.57 (d, J = 5.0 Hz, 1H), 7.21 (dd, J = 5.0 Hz

J = 3.6 Hz, 1H), 4.93 (NH), 3.91ꢀ4.04 (m, 4H), 3.21ꢀ3.30 (m, 1H),

3.07ꢀ3.16 (m, 2H), 2.17ꢀ2.22 (m, 2H), 1.87ꢀ2.00 (m, 2H). t_{R LCMS}

5.1 min. Purity 99%. MS [M þ H]^þm/z 361.

4,4,4-Trifluoro-1-[(R)-3-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-pi-

peridin-1-yl]-butan-1-one (53). (R)-Boc-nipecotic acid (4.6 mmol, 1

equiv), HBTU (1.1 equiv), and diisopropylethylamine (3 equiv) were

dissolved in dimethylformamide (15 mL). The solution was stirred for 5

min, and then thiophene-2-amidoxime (1.1 equiv) was added. The

reaction mixture was stirred overnight at room temperature and then

heated at 120 ꢀC for 6 h. The solvent was removed under vacuum, and

the residue was dissolved in AcOEt. The organic layer was washed once

with HCl 1N, once with saturated aqueous NaHCO₃, and once with

brine, then dried over MgSO₄and evaporated under reduced pressure.

The obtained product was used in the next step without further

purification. Boc intermediate was dissolved in dioxane (10 mL), and

HCl 4N solution in dioxane (5 equiv) was added. The reaction mixture

was stirred overnight at room temperature. The product was recovered

by filtration and then washed with petroleum ether to give 990 mg of

(R)-3-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidine hydrochloride

as a beige powder (yield 79% over two steps). 4,4,4-Trifluorobutyric

acid (1.3 equiv), EDCI (1.3 equiv), HOBt (0.4 equiv), and diisopropy-

lethylamine (4 equiv) were mixed in DMF (2 mL) for 5 min. (R)-3-(3-

Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-piperidine hydrochloride (217 mg,

0.8 mmol, 1 equiv) was added with 3 mL of DMF. The reaction mixture

was stirred overnight at room temperature and then evaporated under

reduced pressure and purified by preparative HPLC to give 53 as a

1

colorless oil; yield 56%. H NMR (CDCl₃) cis/trans isomer mixture

(53% isomer A/47% isomer B); isomer A δ 7.78 (d, J = 3.6 Hz, 1H),

7.50ꢀ7.53 (m, 1H), 7.14ꢀ7.18 (m, 1H), 3.79ꢀ3.90 (m, 3H),

3.44ꢀ3.53 (m, 1H), 3.15ꢀ3.25 (m, 1H), 2.84ꢀ2.95 (m, 1H),

2.49ꢀ2.70 (m, 3H), 2.13ꢀ2.23 (m, 2H), 1.61ꢀ1.77 (m, 2H); isomer

B δ 7.78 (d, J = 3.6 Hz, 1H), 7.50ꢀ7.53 (m, 1H), 7.14ꢀ7.18 (m, 1H),

4.75ꢀ4.85 (m, 1H), 3.79ꢀ3.85 (m, 1H), 3.15ꢀ3.25 (m, 3H),

2.49ꢀ2.70 (m, 4H), 2.28ꢀ2.36 (m, 1H), 1.91ꢀ2.00 (m, 2H),

1.61ꢀ1.77 (m, 1H). ¹³C NMR (CDCl₃) cis/trans isomer mixture

(53% isomer A/47% isomer B); isomer A δ 179.07, 168.49, 164.40,

129.69, 129.55, 128.06, 127.95, 127.11 (q, J = 275 Hz), 47.41, 42.11,

34.87, 29.61 (q, J = 29 Hz), 27.96, 25.97, 23.15; isomer B δ 179.34,

168.32, 164.34, 129.64, 129.34, 128.22, 127.99, 127.05 (q, J = 275 Hz),

3008

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

4,4,4-Trifluoro-1-[(S)-3-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-pyr-

rolidin-1-yl]-butan-1-one (56). Using the above procedure for 55 with

(S)-N-Boc-pyrrolidine-3-carboxylic acid provided 56 as a white powder

after purification by preparative HPLC; yield 51%. ¹H NMR (CD₂Cl₂)

δ 7.80ꢀ7.81 (m, 1H), 7.56ꢀ7.59 (m, 1H), 7.18ꢀ7.22 (m, 1H),

3.66ꢀ3.99 (m, 4H), 3.53ꢀ3.63 (m, 1H), 2.32ꢀ2.64 (m, 6H). ¹³C

NMR (CD₂Cl₂) cis/trans isomer mixture (55% isomer A/45% isomer

B); isomer A δ 180.03, 168.63, 164.99, 130.19, 129.96, 128.70, 128.58,

127.81 (q, J = 275 Hz), 49.73, 46.09, 35.62, 29.57 (q, J = 30 Hz), 29.41,

27.53; isomer B δ 179.58, 168.40, 164.99, 130.22, 130.03, 128.70,

128.60, 127.81 (q, J = 275 Hz), 50.02, 45.62, 37.40, 30.97, 29.57 (q,

J = 30 Hz), 27.70. t_{R LCMS}5.6 min. Purity >99%. MS [M þ H]^þm/z 346.

4,4,4-Trifluoro-1-[3-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-azetidin-1-

yl]-butan-1-one (57). 1-Boc-azetidine-3-carboxylic acid (8.5 mmol, 1

equiv), HBTU (1.1 equiv), and diisopropylethylamine (2.5 equiv) were

dissolved in dimethylformamide (15 mL). The solution was stirred for 5

min, and then thiophene-2-amidoxime (1 equiv) was added. The

reaction mixture was stirred overnight at room temperature and then

evaporated under reduced pressure. The residue was dissolved in AcOEt

and washed twice with saturated aqueous NaHCO₃and once with brine

and then dried over MgSO₄and evaporated under reduced pressure.

The residue was dissolved in 15 mL of DMF and then heated at 120 ꢀC

for 3 h. The solvent was removed under vacuum, and the residue was

dissolved in AcOEt. The organic layer was washed once with HCl 1N,

twice with saturated aqueous NaHCO₃, and once with brine, then dried

over MgSO₄and evaporated under reduced pressure (yield 67%). The

obtained product (5.5 mmol) was dissolved in dioxane (5 mL), and HCl

4N solution in dioxane (5 equiv) was added. The reaction mixture was

stirred overnight at room temperature. The product was recovered by

filtration and then washed with petroleum ether to give 1.23 g of

equiv), and diisopropylethylamine (4 equiv) were mixed in DMF

(2 mL) for 5 min. 3-(3-Thiophen-2-yl-1,2,4-oxadiazol-5-yl)-propyla-

mine hydrochloride (0.5 mmol, 1 equiv) was added with 3 mL of DMF.

The reaction mixture was stirred overnight at room temperature and

then evaporated under reduced pressure and purified by preparative

1

HPLC to give 58 as a white powder; yield 54%. H NMR (CD₂Cl₂)

δ 7.74 (d, J = 3.6 Hz, 1H), 7.51 (d, J = 5.0 Hz, 1H), 7.15 (dd, J = 5.0 Hz,

J = 3.6 Hz, 1H), 5.92 (brs, NH), 3.37 (q, J = 6.4 Hz, 2H), 2.95 (t, J = 7.2

Hz, 2H), 2.35ꢀ2.52 (m, 4H), 2.05 (quintuplet, J = 7.2 Hz, 2H). ¹³C

NMR (CD₂Cl₂) δ 180.48, 170.77, 165.38, 130.41, 130.29, 129.41,

129.09, 128.11 (q, J = 275 Hz), 39.80, 30.45 (q, J = 29 Hz), 29.60,

27.32, 25.13. t_{R LCMS}5.2 min. Purity >99%. MS [M þ H]^þm/z 334.

Accession Codes

PDB ID codes: 3G1M, 3Q0U, 3Q0V.

’ AUTHOR INFORMATION

Corresponding Author

*Phone: þ33 (0)320 964 947. Fax: þ33 (0) 320 964 709. E-mail:

benoit.deprez@univ-lille2.fr. Home pages: U761, http://www.

deprezlab.fr; PRIM, http://www.drugdiscoverylille.org.

Author Contributions

^bThese authors contributed equally to this work.

’ ACKNOWLEDGMENT

We thank Eve Willery, Julie Dumont, and Bernard Clantin for

technical assistance and Prof. Andrꢀe Tartar for scientiﬁc discus-

sion. We are grateful to the institutions that support our

laboratory (Inserm, INSERM-Avenir fellowship to Priscille

Brodin at Institut Pasteur Korea, Universitꢀe Lille Nord de France,

Institut Pasteur de Lille, CNRS, EU, Rꢀegion Nord-Pas de Calais,

FEDER (nos. 09220019 and 09220020 PRESAGE 31510), ANR

(ANR-06-EMPB-033), and PRIM: P^ole de Recherche Interdis-

ciplinaire du Mꢀedicament). Data management was performed

using Pipeline Pilot from Accelrys. Xavier Carette was funded by

a doctoral fellowship of Institut Pasteur de Lille and the Rꢀegion

Nord-Pas de Calais. Bertrand Diriꢀe was a recipient of a doctoral

fellowship MENR. This project was supported by the Fondation pour

la Recherche Medicale, Nord-Pas-de-Calais (RAD07001EEA). We

are indebted to the ESRF (Group BAG MX-485). We thank

VARIAN Inc. for their technical support. NMR acquisitions were

done by the LARMN, Lille.

5-azetidin-3-yl-3-thiophen-2-yl-1,2,4-oxadiazole hydrochloride as

a

white powder (yield 91%). 4,4,4-Trifluorobutyric acid (1.3 equiv),

EDCI (1.3 equiv), HOBt (0.4 equiv), and diisopropylethylamine (4

equiv) were mixed in DMF (2 mL) for 5 min. 5-Azetidin-3-yl-3-

thiophen-2-yl-1,2,4-oxadiazole hydrochloride (0.5 mmol, 1 equiv) was

added with 3 mL of DMF. The reaction mixture was stirred overnight at

room temperature and then evaporated under reduced pressure and

purified by preparative HPLC to give 57 as a white powder; yield 51%.

¹H NMR (CD₂Cl₂) δ 7.83 (dd, J = 3.6 Hz, J = 1.2 Hz, 1H), 7.59 (dd, J =

5.0 Hz, J = 1.2 Hz, 1H), 7.21 (dd, J = 5.0 Hz, J = 3.6 Hz, 1H), 4.32ꢀ4.64

(m, 4H), 4.12ꢀ4.23 (m, 1H), 2.37ꢀ2.60 (m, 4H). ¹³C NMR (CD₂Cl₂)

δ 178.74, 169.59, 164.69, 129.81, 129.61, 128.12, 127.93, 127.10 (q, J =

275 Hz), 53.20, 52.11, 28.69 (q, J = 29 Hz), 25.66, 23.90. t_{R LCMS}5.6

min. Purity >99%. MS [M þ H]^þm/z 332.

4,4,4-Trifluoro-N-[3-(3-thiophen-2-yl-1,2,4-oxadiazol-5-yl)-propyl]-

butyramide (58). Boc-4-amino-butyric acid (10 mmol, 1 equiv), HBTU

(1 equiv), and diisopropylethylamine (2.5 equiv) were dissolved in

dimethylformamide (20 mL). The solution was stirred for 5 min, and

then thiophene-2-amidoxime (1 equiv) was added. The reaction mixture

was stirred overnight at room temperature and then poured in 50 mL of

water. The reaction mixture produced a thick crystalline slurry. The

product was recovered by filtration and washed with water. The solid

obtained was dissolved in dimethylformamide (20 mL), and then the

reaction mixture was heated at 120 ꢀC for 4 h. The solvent was removed

under vacuum, and the residue was dissolved in AcOEt. The organic

layer was washed once with HCl 1N, once with saturated aqueous

NaHCO₃, and once with brine, then dried over MgSO₄and evaporated

under reduced pressure (yield 90%). The obtained product (9 mmol)

was dissolved in dioxane (20 mL), and HCl 4N solution in dioxane (5

equiv) was added. The reaction mixture was stirred overnight at room

temperature. The product was recovered by filtration and then washed

with petroleum ether to give 1.79 g of 3-(3-thiophen-2-yl-1,2,4-oxadia-

zol-5-yl)-propylamine hydrochloride as a white powder (yield 81%).

4,4,4-Trifluorobutyric acid (1.3 equiv), EDCI (1.3 equiv), HOBt (0.4

’ ABBREVIATIONS USED

ACM, automated confocal microscopy; AcOEt, ethyl acetate; AcOH,

acetic acid; Boc, t-butoxycarbonyl; CDI, N,N-carbonyldiimidazole;

CH₃CN, acetonitrile; DCM, dichloromethane; DIEA, diisopropy-

lethylamine; DMF, dimethylformamide; DMSO, dimethylsulfoxide;

DOTS, directly observed treatment short-course; EDCI, N-ethyl-

3-(3-dimethyaminopropyl)-carbodiimide; ETH, ethionamide; Et₃N,

triethylamine; EtOH, ethanol; GFP, green ﬂuorescent protein;

HBTU, O-benzotriazole-N,N,N⁰,N⁰-tetramethyl-uronium-hexaﬂuoro-

phosphate; HOBt, N-hydroxybenzotriazole; MDR-TB, multi-

drug resistant tuberculosis; MeOH, methanol; MIC, minimal

inhibitory concentration; PBS, phosphate buﬀered saline; PK,

pharmacokinetic; RT, room temperature; SAR, structureꢀactiv-

ity relationships; SPR, surface plasmon resonance; TB, tubercu-

losis; TFA, triﬂuoroacetic acid; THF, tetrahydrofuran

3009

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Journal of Medicinal Chemistry

ARTICLE

’ REFERENCES

(21) Willand, N.; Dirie, B.; Carette, X.; Bifani, P.; Singhal, A.;

Desroses, M.; Leroux, F.; Willery, E.; Mathys, V.; Deprez-Poulain, R.;

Delcroix, G.; Frenois, F.; Aumercier, M.; Locht, C.; Villeret, V.; Deprez,

B.; Baulard, A. R. Synthetic EthR inhibitors boost antituberculous

activity of ethionamide. Nature Med. 2009, 15, 537–544.

(22) Poulain, R. F.; Tartar, A. L.; Deprez, B. P. Parallel synthesis of

1,2,4-oxadiazoles from carboxylic acids using an improved, uronium-

based, activation. Tetrahedron Lett. 2001, 42, 1495–1498.

(23) Nguyen, L.; Thompson, C. J. Foundations of antibiotic resis-

tance in bacterial physiology: the mycobacterial paradigm. Trends

Microbiol. 2006, 14, 304–312.

(24) Christophe, T.; Jackson, M.; Jeon, H. K.; Fenistein, D.; Con-

treras-Dominguez, M.; Kim, J.; Genovesio, A.; Carralot, J.-P.; Ewann, F.;

Kim, E. H.; Lee, S. Y.; Kang, S.; Seo, M. J.; Park, E. J.; Skovierova, H., H.;

Pham, H.; Riccardi, G.; Nam, J. Y.; Marsollier, L.; Kempf, M.; Joly-

Guillou, M.-L.; Oh, T.; Shin, W. K.; No, Z.; Nehrbass, U.; Brosch, R.;

Cole, S. T.; Brodin, P. High Content Screening Identiﬁes Decaprenyl-

Phosphoribose 2⁰Epimerase as a Target for Intracellular Antimycobac-

terial Inhibitors. PLoS Pathog. 2009, 5, e1000645.

(1) World Health Organization. Global Tuberculosis Control; World

Health Organization: Geneva, 2010; ISBN 978 92 4 156406 9.

(2) Elzinga, G.; Raviglione, M. C.; Maher, D. Scale up: meeting

targets in global tuberculosis control. Lancet 2004, 363, 814–819.

(3) Dye, C.; Maher, D.; Weil, D.; Espinal, M.; Raviglione, M. Targets

for global tuberculosis control [Short Communication]. Int. J. Tubercu-

losis Lung Dis. 2006, 10, 460–462.

(4) Cox, H. S.; Ford, N.; Reeder, J. C. Are we really that good at

treating tuberculosis?. Lancet Infect. Dis. 2009, 9, 138–139.

(5) Chaisson, R. E.; Martinson, N. A. Tuberculosis in Africa-Com-

bating an HIV-Driven Crisis. New England Journal of Medicine 2008,

358, 1089–1092.

(6) Global Tuberculosis Control: Epidemiology, Strategy, Financing;

World Health Organization: Geneva, 2009; publication no. WHO/

HTM/TB/2009.411.

(7) Cox, H.; Kebede, Y.; Allamuratova, S.; Ismailov, G.; Davletmur-

atova, Z.; Byrnes, G.; Stone, C.; Niemann, S.; R€usch-Gerdes, S.; Blok, L.;

Doshetov, D. Tuberculosis Recurrence and Mortality after Successful

Treatment: Impact of Drug Resistance. PLoS Med. 2006, 3, 1836–1843.

(8) WHO/HTM/TB. Management of MDR-TB: a Field Guide: A

Companion Document to Guidelines for Programmatic Management of

Drug-Resistant Tuberculosis: Integrated Management of Adolescent and

Adult Illness (IMAI); World Health Organization: Geneva, 2008;

WHO/HTM/TB/2008.402a.

(25) Christophe, T.; Ewann, F.; Jeon, H. K.; Cechetto, J.; Brodin, P.

High-content imaging of Mycobacterium tuberculosis-infected macro-

phages: an in vitro model for tuberculosis drug discovery. Future

Medicinal Chemistry 2010, 2, 1283–1293.

(26) Ohkata, K.; Ohsugi, M.; Yamamoto, K.; Ohsawa, M.; Akiba, K.-

y. Structural Features of Tetraazathiapentalenes Fused with Pyrimidine

and/or Pyridine Rings. Experimental Evaluation of the Nature of

Hypervalent NꢀSꢀN Bond by Restricted Internal Rotation of the

Pyrimidine Ring. J. Am. Chem. Soc. 1996, 118, 6355–6369.

(27) Willand, N.; Desroses, M.; Toto, P.; Dirie, B.; Lens, Z.; Villeret,

V.; Rucktooa, P.; Locht, C.; Baulard, A.; Deprez, B. Exploring Drug

Target Flexibility Using in Situ Click Chemistry: Application to a

Mycobacterial Transcriptional Regulator. ACS Chem. Biol. 2010,

5, 1007–1013.

(28) Rentmeister, A.; Arnold, F. H.; Fasan, R. Chemo-enzymatic

ﬂuorination of unactivated organic compounds. Nature Chem. Biol.

2009, 5, 26–28.

(29) Domagala, J. M.; Hanna, L. D.; Heifetz, C. L.; Hutt, M. P.; Mich,

T. F.; Sanchez, J. P.; Solomon, M. New structureꢀactivity relationships

of the quinolone antibacterials using the target enzyme. The develop-

ment and application of a DNA gyrase assay. J. Med. Chem. 1986,

29, 394–404.

(9) (a) Schwartz, W. S. Comparison of ethionamide with isoniazid in

original treatment cases of pulmonary tuberculosis. XIV. A report of the

Veterans AdministrationꢀArmed Forces cooperative study. Am. Rev. Respir.

Dis. 1966, 93, 685–692.(b) Ethionamide. Tuberculosis 2008, 88, 106ꢀ108

(10) Goodman and Gilman’s The Pharmacological Basis of Therapeu-

tics, 8th ed.; Gilman, A. G., Rall, T. W., Nies, A. S., Taylor, P, Eds.;

Pergamon Press: New York, 1990; pp 1154ꢀ1155.

(11) Martindale, the Extra Pharmacopoeia, 29th ed.; Reynolds,

J. E. F., Ed.; Pharmaceutical Press: London, 1989; pp 562ꢀ563.

(12) Fraaije, M. W.; Kamerbeek, N. M.; Heidekamp, A. J.; Fortin, R.;

Janssen, D. B. The prodrug activator EtaA from Mycobacterium tuberculosis is a

BaeyerꢀVilliger monooxygenase. J. Biol. Chem. 2004, 279, 3354–3360.

(13) Vannelli, T. A.; Dykman, A.; Ortiz De Montellano, P. R. The

antituberculosis drug ethionamide is activated by a ﬂavoprotein mono-

oxygenase. J. Biol. Chem. 2002, 277, 12824–12829.

(14) Wang, F.; Langley, R.; Gulten, G.; Dover, L. G.; Besra, G. S.;

Jacobs, W. R., Jr.; Sacchettini, J. C. Mechanism of thioamide drug action

against tuberculosis and leprosy. J. Exp. Med. 2007, 204, 73–78.

(15) Engohang-Ndong, J.; Baillat, D.; Aumercier, M.; Bellefontaine,

F.; Besra, G. S.; Locht, C.; Baulard, A. R. EthR, a repressor of the TetR/

CamR family implicated in ethionamide resistance in mycobacteria,

octamerizes cooperatively on its operator. Mol. Microbiol. 2004,

51, 175–188.

(16) DeBarber, A. E.; Mdluli, K.; Bosman, M.; Bekker, L. G.; Barry,

C. E., III. Ethionamide activation and sensitivity in multidrug-resistant

Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U.S.A. 2000,

97, 9677–9682.

(30) M€uller, K.; Faeh, C.; Diederich, F. Fluorine in Pharmaceuticals:

Looking Beyond Intuition. Science 2007, 317, 1881–1886.

(31) Lipinski, C. A.; Lombardo, F.; Dominy, B. W.; Feeney, P. J.

Experimental and computational approaches to estimate solubility and

permeability in drug discovery and development settings. Adv. Drug

Delivery Rev. 2001, 46, 3–26.

(32) Veber, D. F.; Johnson, S. R.; Cheng, H. Y.; Smith, B. R.; Ward,

K. W.; Kopple, K. D. Molecular Properties That Inﬂuence the Oral

Bioavailability of Drug Candidates. J. Med. Chem. 2002, 45, 2615–2623.

(33) Kabsch, W. Automatic processing of rotation diﬀraction data

from crystals of initially unknown symmetry and cell constants. J. Appl.

Crystallogr. 1993, 26, 795–800.

(17) Baulard, A. R.; Betts, J. C.; Engohang-Ndong, J.; Quan, S.;

McAdam, R. A.; Brennan, P. J.; Locht, C.; Besra, G. S. Activation of the

Pro-drug Ethionamide Is Regulated in Mycobacteria. J. Biol. Chem. 2000,

275, 28326–28331.

(34) Winn, M. D.; Isupov, M. N.; Murshudov, G. N. Use of TLS

parameters to model anisotropic displacements in macromolecular

reﬁnement. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2001, 57, 122–

133.

(18) Frenois, F.; Baulard, A. R.; Villeret, V. Insights into mechanisms

of induction and ligands recognition in the transcriptional repressor

EthR from Mycobacterium tuberculosis. Tuberculosis 2006, 86, 110–114.

(19) Frenois, F.; Engohang-Ndong, J.; Locht, C.; Baulard, A. R.;

Villeret, V. Structure of EthR in a ligand bound conformation reveals

therapeutic perspectives against tuberculosis. Mol. Cell 2004,

16, 301–307.

(20) Dover, L. G.; Corsino, P. E.; Daniels, I. R.; Cocklin, S. L.;

Tatituri, V.; Besra, G. S.; Futterer, K. Crystal structure of the TetR/

CamR family repressor Mycobacterium tuberculosis EthR implicated in

ethionamide resistance. J. Mol. Biol. 2004, 340, 1095–1105.

(35) Collaborative-Computational-Project-Number-4. The CCP4

suite: programs for protein crystallography. Acta Crystallogr., Sect. D:

Biol. Crystallogr. 1994, 50, 760ꢀ763.

(36) Schuettelkopf, A. W.; van Aalten, D. M. F. PRODRG—a tool

for high-throughput crystallography of proteinꢀligand complexes. Acta

Crystallogr., Sect. D: Biol. Crystallogr. 2004, 60, 1355–1363.

(37) Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K. Features and

development of Coot. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010,

66, 486–501.

3010

dx.doi.org/10.1021/jm200076a |J. Med. Chem. 2011, 54, 2994–3010

Article Doi

Ethionamide boosters: Synthesis, biological activity, and structure-activity relationships of a series of 1,2,4-oxadiazole EthR inhibitors

DOI: 10.1021/jm200076a

Source and publish data:

Authors:

Article abstract of DOI:10.1021/jm200076a

Full text of DOI:10.1021/jm200076a

Products guided by the article

R&D Labs maybe for 1286708-24-4

Relevant to this article

Hot Product