Synthesis of oligoribonucleotides containing 2'-o-methoxymethyl group by the phosphotriester method

Article abstract of DOI:10.1080/15257770.2011.586255

An effective procedure for the synthesis of ribonucleotide monomers containing a 2'-methoxymethyl-modifying group was developed. These monomers were used for the synthesis of RNA fragments by the solid-phase phosphotriester method under O-nucleophilic intramolecular catalysis. The properties of 2'-methoxymethyl-containing oligoribonucleotides were examined. Copyright Taylor and Francis Group, LLC.

Full text of DOI:10.1080/15257770.2011.586255

This article was downloaded by: [Duke University Libraries]
On: 24 September 2012, At: 10:34
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Nucleosides, Nucleotides and Nucleic
Acids
Publication details, including instructions for authors and
subscription information:
http://www.tandfonline.com/loi/lncn20
Synthesis of Oligoribonucleotides
Containing 2′-O-Methoxymethyl Group
by the Phosphotriester Method
Dr Vladimir A. Efimov a , Mr Andrey V. Aralov a & Dr Oksana G.
Chakhmakhcheva a
a Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian
Academy of Sciences, Moscow, Russia
Version of record first published: 02 Sep 2011.
To cite this article: Dr Vladimir A. Efimov, Mr Andrey V. Aralov & Dr Oksana G. Chakhmakhcheva
(2011): Synthesis of Oligoribonucleotides Containing 2′-O-Methoxymethyl Group by the
Phosphotriester Method, Nucleosides, Nucleotides and Nucleic Acids, 30:7-8, 565-576
To link to this article: http://dx.doi.org/10.1080/15257770.2011.586255
PLEASE SCROLL DOWN FOR ARTICLE
Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions
This article may be used for research, teaching, and private study purposes. Any
substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,
systematic supply, or distribution in any form to anyone is expressly forbidden.
The publisher does not give any warranty express or implied or make any representation
that the contents will be complete or accurate or up to date. The accuracy of any
instructions, formulae, and drug doses should be independently verified with primary
sources. The publisher shall not be liable for any loss, actions, claims, proceedings,
demand, or costs or damages whatsoever or howsoever caused arising directly or
indirectly in connection with or arising out of the use of this material.

Nucleosides, Nucleotides and Nucleic Acids, 30:565–576, 2011
Copyright ꢀC Taylor and Francis Group, LLC
ISSN: 1525-7770 print / 1532-2335 online
DOI: 10.1080/15257770.2011.586255
SYNTHESIS OF OLIGORIBONUCLEOTIDES
CONTAINING 2ꢀ-O-METHOXYMETHYL GROUP
BY THE PHOSPHOTRIESTER METHOD
Vladimir A. Efimov, Andrey V. Aralov, and Oksana G. Chakhmakhcheva
Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences,
Moscow, Russia
An effective procedure for the synthesis of ribonucleotide monomers containing a 2 ꢁ-О-
2
methoxymethyl-modifying group was developed. These monomers were used for the synthesis of RNA
fragments by the solid-phase phosphotriester method under O-nucleophilic intramolecular catalysis.
The properties of 2 ꢁ-О-methoxymethyl-containing oligoribonucleotides were examined.
Keywords Oligoribonucleotides; synthesis; phosphotriester method; methoxymethyl
group
INTRODUCTION
Chemical modification of natural oligonucleotides (ONs) is widely used
to improve their physicochemical and biochemical properties. Because natu-
ral ONs are rapidly degraded by cellular nucleases, numerous attempts have
been made to develop modified ONs having both increased affinity to the
complementary DNA and RNA fragments and enhanced nuclease resistance.
The modifications at the ribose 2 ꢁ-position appear to be the most promising
because they do not generally cause essential distortions in the ON structure.
One example is 2 ꢁ-F modification, which increases the hybridization affinity
but, unfortunately, does not enhance the nuclease resistance in comparison
with unmodified ONs.[1] Other types of 2 ꢁ-modified ONs containing O-alkyl
substitutions, such as methyl, methoxyethyl, and cyanoethyl groups, the in-
troduction of which leads to enhanced hybridization affinity and nuclease
resistance of ONs compared with natural ones, were also described.[2–5]
Earlier, it was shown that the rapid phosphotriester method of ON syn-
thesis with the use of О-nucleophilic catalysis for the internucleotide bond
formation is an alternative to the phosphoroamidite approach, and it was
Received 25 April 2011; accepted 3 May 2011.
Address correspondence to Andrey Aralov, Shemyakin-Ovchinnikov Institute of Bioorganic
Chemistry, Russian Academy of Sciences, ul. Miklukho-Maklaya, 117997 Moscow, Russia. E-mail:
Baruh238@mail.ru
565

566
V. A. Efimov et al.
FIGURE 1 Monomers containing 2ꢁ-O-protecting and -modifying groups for rapid phosphotriester
method of ON synthesis.
successfully applied to the synthesis of both natural and modified
oligodeoxyribonucleotides.[6,7] Moreover, it was shown that this methodol-
ogy can be used for the preparation of stereospecific phosphorothioate ON
analogues.[8,9] To develop the efficient solid-phase phosphotriester method
for the synthesis of natural and modified RNA fragments, we examined
a number of protecting and modifying groups for 2 ꢁ-hydroxyls, including
(1-oxidopyridin-2-yl) 1, (1-oxidopyridin-4-yl) 2,[9] (2-azidomethyl)benzoyl 3,
azidomethyl 4,[10–12] p-nitrobenzyloxymethyl 5,[13] (2-azidoethoxy)methyl 6,
propargyloxymethyl 7, and (3,4-cyclocarbonatebutoxy)methyl 8[14] groups
(Figure 1). In this paper, we describe the continuation of these studies and
elaboration of schemes for the synthesis of RNA monomers containing the
modifying 2 ꢁ-О-methoxymethyl (MOM) group.
The methoxymethyl (MOM) protecting group found a wide application
in organic synthesis for the protection of hydroxyl functions due to the
simplicity of its introduction and stability in both strong alkaline and mod-
erate acidic conditions, as well as under conditions used for the removal of
silyl, alkoxyacetyl, and benzyl groups.[15–17] Earlier, the introduction of the
MOM-group in various positions of deoxyribo- and ribonucleosides was de-
scribed.[18] Also, the 2 ꢁ-О-MOM-U-containing oligonucleotides synthesized
by the H-phosphonate method were reported.[19] In this case, the 2 ꢁ-О-MOM
derivative was obtained from the 2 ꢁ-О-methylthiomethyl nucleoside. More-
over, it was reported that the 2 ꢁ-O-MOM-modified antisense oligonucleotide
targeting survivin mRNA, LY2181308 (Eli Lilly and Co.), has completed a
phase I trial in patients with advanced cancers,[20] and a phase II study in
combination with docetaxel in hormone-refractory prostate cancer patients
has started.[21]
RESULTS AND DISCUSSION
Our approach to the synthesis of 2ꢁ-О-MOM nucleotide derivatives
14a–d is depicted in Scheme 1. Nucleoside derivatives 9a–c containing

Synthesis of Oligoribonucleotides
567
SCHEME 1 Preparation of 2ꢁ-O-MOM-modified monomers.
protected 3ꢁ- and 5ꢁ-OH groups and amino functions of heterocyclic bases
(in the case of A and C) were treated with the excess of dimethoxymethane
in the presence of boron trifluoride etherate (BF3·Et2O) for 2 hours.
In the case of guanosine, the treatment of the corresponding 3ꢁ,5ꢁ-O-
protected derivative of type 9 with dimethoxymethane in the presence
of BF3·Et2O led to the formation of a large amount of a fluorescent side
product. Therefore, the synthesis of the 2ꢁ-О-МОМ derivative 10d was
carried out starting from methylthiomethyl nucleoside 11 by the treatment
with trifluoromethane sulfonic acid and N -iodosuccinimide (NIS) in
a mixture of THF–methanol (25:1, v/v) for 20 minutes at –45◦С, as it
was described.[19,22] After the isolation of the fully protected nucleoside
10a–d,3ꢁ,5ꢁ-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl) group (TIPDS) was
removed by the action of 1 M tetrabutylammonium fluoride (TBAF) in
THF for 1 hour. The resultant derivatives 12 were 5ꢁ-O-dimethoxytritylated.
Then, the compounds 13 were 3ꢁ-phosphorylated by the action of (2-
chlorophenyl)-(1-oxido-4-methoxy-2-picolyl) phosphate in the presence of
2,4,6-triisopropylbenzenesulfonyl chloride (TPSCl) following the removal
of 2-chlorophenyl group by the action of 1,8-diazabicyclo[5.4.0]undec-
7-ene (DBU) in aqueous acetonitrile, as described.[11,12] The structures
of intermediates and the target monomers 14a–d were confirmed by
mass-spectrometry and NMR spectroscopy methods.

568
V. A. Efimov et al.
FIGURE 2 Analysis of 2ꢁ-O-МОМ-modified ONs by a denaturing 15% PAGE before (1, 3) and after
(2, 4) the treatment with 1 М solution of LiI in acetonitrile–water (20:1, v/v) in the presence of 0.01 М HCl
for 5 hours at room temperature. Lines (1, 2)—U15 and (3, 4)— 5ꢁ- r(CGAUCUCAUCACCUCUCCAU).
Visualization was by UV-shadowing at 254 nm.
Monomers 14a–d were applied to the solid phase synthesis of 15–25-mer
oligoribonucleotides. The synthesis was carried out on the standard CPG
support using TPSCl as a condensing agent for the internucleotide bond
formation, as was described earlier.[6,12] The yields at the chain elongation
steps were 98–99%. After the synthesis was completed, ONs bound to the
support were treated with 1M lithium iodide in acetonitrile (5 hours at room
temperature) for deprotection of internucleotide phosphate residues.[11] Re-
moval of oligonucleotides from the support and deprotection of heterocyclic
bases were performed by the action of conc. ammonia. Then, ONs carrying
modifying 2ꢁ-O-MOM groups were isolated by gel filtration, and their homo-
geneity was examined by gel-electrophoresis (Figure 2), or reversed phase
chromatography.
It is known that the MOM-group can be removed by boiling in aqueous
organic solutions in the presence of catalytic amounts of CBr4 or by the
action of ZnBr2 in the presence of a mercaptan.[23] Unfortunately, we have
found that these conditions are not appropriate for removal of MOM-groups
from ONs in view of their degradation. Our attempts to remove the 2ꢁ-О-
МОМ groups from the synthesized ONs with 30% aqueous trifluoroacetic
acid[17,24] led also to a significant degradation of the oligomer chain. We
found that the treatment of MOM-containing nucleosides 12a–d with 1M
LiI in acetonitrile–water (20:1, v/v) in the presence of 0.01M HCl for 2–
3 hours resulted in practically quantitative removal of the 2ꢁ-О-МОМ pro-
tecting group. However, in the case of treatment of MOM-containing ONs,
in addition to the removal of MOM groups, the partial degradation of the
oligomer chain still occurred under these conditions (Figure 2).
We have found that the presence of 2ꢁ-О-МОМ groups had no signifi-
cant influence on the specificity of ONs binding to the complementary RNA
fragments and the stability of formed duplexes (the increase of Tm was on
average about 0.2◦С per one unit). For comparison, Bizdena et al. reported

Synthesis of Oligoribonucleotides
569
FIGURE 3 Normalized melting curves of duplexes formed by 2ꢁ-O-МОМ-modified ONs U15 (1, 2) and
5ꢁ- r(CGAUCUCAUCACCUCUCCAU) (3, 4) with the complementary oligodeoxyribonucleotides (1, 3)
and oligoribonucleotides (2, 4).
that the 2ꢁ-О-МОМ modification even caused a slight destabilization of du-
plexes with RNA.[19] At the same time, we have found that complexes of
2ꢁ-О-МОМ-containing ONs with DNA had the lower Tm values than those of
complexes formed by natural oligoribonucleotides with the same sequences
(destabilization was ∼0.3◦С per unit) (Figure 3). The introduction of a sin-
gle nucleotide mutation in DNA and RNA targets led to the decrease of
melting temperatures of corresponding duplexes by 10–15◦С, depending
on the position of the mutation (data not shown).
The results obtained in the analysis of 2ꢁ-О-MOM-modified ONs’ stability
revealed that these oligomers are resistant to the action of RNA-specific nu-
cleases (RNase A and RNase T1) as well as to the action of S1 nuclease, mung
bean nuclease, and exonuclease III (data not shown). At the same time,
snake venom and bovine spleen phosphodiesterases were able to cleave 2ꢁ-O-
MOM-modified oligoribonucleotides, but their resistance to these enzymes
was higher in comparison with the resistance of natural ONs (Figure 4).
EXPERIMENTAL
Solvents and reagents were obtained from commercial suppliers and
1
were used without further purification. H- and 31P-NMR spectra were ob-
tained with a DPX-300 spectrometer (Bruker, Germany). Chemical shifts are
given in p.p.m. relative to tetramethylsilane (1H) or H3PO4 (31P). Mass spec-
tra were recorded using an Ultraflex II MALDI-TOF (Bruker Daltonics, Ger-
many) mass spectrometer. TLC was carried out on Merck Silica Gel 60 F254
plates in CHCl3–CH3OH–H2O (65:25:4, v/v/v; solvent A), CHCl3–CH3OH

570
V. A. Efimov et al.
FIGURE 4 Time course of degradation of 2ꢁ-O-MOM-U15 and natural U15 by venom (VPDE) and spleen
(SPDE) phosphodiesterases. The digestions of ONs (0.02 µmol) with VPDE were performed in 200 µL
of 20 mM Tris-HCl (pH 8.0)/50 mM NaCl/10 mM MgCl2, and assays for SPDE stability were performed
in 200 µL of 30 mM NaOAc (pH 6.0)/10mM MgCl2 at 37◦C. At appropriate periods, aliquots of the
reaction mixture were taken, and an enzyme was deactivated by heating at 100◦C for 2 minutes. The
mixtures were then analyzed by 20% denaturing PAGE and the relative density of ON bands on the gel
was estimated using the UVP imaging system.
(9:1, v/v; solvent B), and CHCl3–CH3OH (39:1, v/v; solvent С). Silica gel col-
umn chromatography was performed using Merck silica gel 60. Synthesis of
ONs was performed on a 1 µmol scale using Applied Biosystems Synthesizer
381A and universal CPG support (Glen Research), as described.[11] Depro-
tection and purification of 2ꢁ-О-МОМ-containing ONs were performed, as
described earlier.[13] PAGE of ONs was performed in the presence of 7 M
urea in 0.1 M Tris–borate/EDTA buffer (pH 8.3). Nuclease stability of 2ꢁ-O-
MOM-ON was examined essentially, as described.[11] Absorbance (260 nm)
versus temperature curves of duplexes formed by ONs (3 µM solutions of
each ON) were measured using a Pharmacia Ultrospec 2000 UV-VIS spec-
trophotometer equipped with a heated sample holder and a Peltier temper-
ature control accessory in a buffer containing 0.1 М NaCl, 0.02 М tris-HCl
(рН 7.5), and 0.01 М MgCl2.
3ꢀ,5ꢀ-O-(1,1,3,3-Tetraisopropyldisiloxane-1,3-diyl)-2ꢀ-O-
(methoxymethyl)nucleosides (10)
The 3ꢁ,5ꢁ-O-protected nucleoside of type 9a–c (1.0 mmol) was dissolved
in 1,2-dichloroethane (5 mL), then dimethoxymethane (20 mmol), molec-
˚
ular sieves 4 A (0.4 g), and BF3·Et2O (4.0 mmol) were added. The reac-
tion mixture was stirred at room temperature for 2 hours and filtered. The

Synthesis of Oligoribonucleotides
571
filtrate was diluted with chloroform (15 mL) and washed with 1М TEAB
(10 mL).
To obtain the guanosine derivative 10d, 3ꢁ,5ꢁ-O-(1,1,3,3-tetraiso
propyldisiloxane-1,3-diyl)-2ꢁ-O-(methylthiomethyl)guanosine 11 (1.0 mmol)
prepared, as described,[25] was dissolved in dry THF/CH3OH (25:1, v/v,
˚
5 mL). After the addition of molecular sieves 4 A (0.4 g), CF3SO3H
(1.6 mmol) was added dropwise at −45◦С. Then, NIS (1.6 mmol) in dry
THF (1 mL) was added, and the resulting mixture was stirred for 20
min at −45◦С. The reaction was stopped by the addition of triethylamine
(TEA) (5.0 mmol), and the mixture was filtered, diluted with ethylac-
etate (20 mL), and washed with saturated aqueous solution of Na2S2O3
(20 mL). The organic layer was dried over Na2SO4 and evaporated to
dryness.
The desired products 10a–d were isolated by silica gel column chro-
matography using a gradient of chloroform (50–100%) in n-hexane. The
fractions containing the derivatives 10 were evaporated to a gum and dried
in vacuo.
3ꢁ,5ꢁ-O-(1,1,3,3-Tetraisopropyldisiloxane-1,3-diyl)-2ꢁ-O-
(methoxymethyl)uridine(10а)
The yield was 87%. Rf (solvent С) = 0.55. 1H-NMR (300 MHz, CDCl3):
δ 8.69 (1H, br s, Ura-NH), 7.88 (1H, d, J = 8.2 Hz, Ura-H-6), 5.76 (1H, s,
H-1ꢁ), 5.66 (1H, dd, J = 8.2 Hz, J = 1.8 Hz, Ura-H-5), 4.96 (1H, d, J = 6.6
Hz, OCHαO), 4.86 (1H, d, J = 6.6 Hz, OCHβO), 4.29–4.14 (4H, m, H-2ꢁ,
H-3ꢁ, H-4ꢁ, Hα-5ꢁ), 3.99 (1H, dd, J = 13.6 Hz, J = 2.3 Hz, Hβ-5ꢁ), 3.46 (3H, s,
+
OCH3), 1.12–0.95 (28H, m, iPr-H). MS: 553.28, calc. for C23H42N2NaO8Si2
(M+Na)+ 553.24.
N4-Benzoyl-3ꢁ,5ꢁ-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)-2ꢁ-O-
(methoxymethyl)cytidine (10b)
The yield was 86%. Rf (solvent C) = 0.60. 1H-NMR (300 MHz, CDCl3):
δ 8.36 (1H, d, J = 7.6 Hz, Cyt-H-6), 7.95–7.47 (6H, m, Bz-H-Ar, Cyt-H-5),
5.86 (1H, s, H-1ꢁ), 5.10 (1H, d, J = 6.5 Hz, OCHαO), 4.88 (1H, d, J =
6.5 Hz, OCHβO), 4.31 (1H, d, J =13.6 Hz, Hα-5ꢁ), 4.25–4.19 (3H, m, H-2ꢁ,
H-3ꢁ, H-4ꢁ), 4.01 (1H, dd, J = 13.6 Hz, J = 1.5 Hz, Hβ-5ꢁ), 3.48 (3H, s,
+
OCH3), 1.14–0.94 (28H, m, iPr-H). MS: 634.37, calc. for C30H48N3O8Si2
(M+H)+ 634.30.
N6-Benzoyl-3ꢁ,5ꢁ-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)-2ꢁ-O-
(methoxymethyl)adenosine (10c)
The yield was 84 %. Rf (solvent C) = 0.65. 1H-NMR (300 MHz, CDCl3):
δ 9.09 (1H, s, Ade-NH), 8.79 (1H, s, Ade-H-8), 8.32 (1H, s, Ade-H-2),
8.10–7.49 (5H, m, Bz-H-Ar), 6.14 (1H, br s, H-1ꢁ), 4.98 (1H, d, J = 6.5
Hz, OCHαO), 4.95 (1H, d, J = 6.5 Hz, OCHβO), 4.78–4.69 (1H, m, H-3ꢁ),
4.54–4.51 (1H, m, H-2ꢁ), 4.29–4.16 (2H, m, H-4ꢁ, Hα-5ꢁ), 4.07–4.04 (1H, m,
Hβ-5ꢁ), 3.32 (3H, s, OCH3), 1.14–0.90 (28H, m, iPr-H). MS: 658.28, calc. for
C31H48N5O7Si2+ (M+H)+ 658.31.

572
V. A. Efimov et al.
N2-Isobutyryl-3ꢁ,5ꢁ-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)-2ꢁ-O-
(methoxymethyl)guanosine (10d)
The yield was 81%. Rf (solvent С) = 0.30. 1H-NMR (300 MHz, CDCl3):
δ 12.08 (1H, br s, Gua-NH), 8.95 (1H, br s, Gua-NH), 7.99 (1H, s, Gua-H-8),
5.87 (1H, s, H-1ꢁ), 4.92 (1H, d, J = 6.5 Hz, OCHαO), 4.82 (1H, d, J =
6.5 Hz, OCHβO), 4.49 (1H, dd, J = 9.4 Hz, J = 4.6 Hz, H-3ꢁ), 4.26–4.19
(2H, m, H-2ꢁ, Hα-5ꢁ), 4.15–4.10 (1H, m, H-4ꢁ), 4.00 (1H, dd, J = 13.4 Hz,
J = 2.5 Hz, Hβ-5ꢁ), 3.39 (3H, s, OCH3), 2.68 (1H, sept, J = 6.9 Hz, iBu-CH),
1.28–1.21 (6H, m, iBu-CH3), 1.10–0.96 (28H, m, iPr-H). MS: 640.32, calc.
for C28H50N5O8Si2+ (M+H)+ 640.32.
General Procedure for the Synthesis of
5ꢀ-O-(4,4ꢀ-Dimethoxytrityl)-2ꢀ-O-(methoxymethyl)nucleosides (13)
The derivative 10 (1.0 mmol) was dissolved in dry THF (5 mL) and
treated with 1 М solution of TBAF (2.2 mL) in dry THF for 1 hour. After
the evaporation, crude 2ꢁ-O-(2-methoxymethyl) nucleoside 12 was dissolved
in chloroform and purified by silica gel column chromatography in a gra-
dient of methanol (0–6%) in chloroform. The following 5ꢁ-O-protection of
2ꢁ-O-methoxymethyl nucleosides 12a–d was performed by the action 4,4ꢁ-
dimethoxytritylchloride (1.2 equiv.) in dry pyridine during 1.5 hours. The
reaction was stopped by the addition of 0.5 M TEAB (20 mL), and the crude
product was extracted with chloroform (2 × 20 mL). The combined organic
fractions were evaporated to a gum. The residue was dissolved in chloroform,
and a 5ꢁ-O-dimethoxytrityl-2ꢁ-O-methoxymethyl nucleoside 13 was isolated by
silica gel column chromatography using a gradient of methanol (0–3%) in
chloroform containing 0.1% of TEA. The fractions containing the desired
derivative 13 were evaporated to a gum and dried in vacuo.
5ꢁ-O-(4, 4ꢁ-Dimethoxytrityl)-2ꢁ-O-(methoxymethyl)uridine (13а)
Yield 82%. Rf (solvent B) = 0.55. 1H-NMR (300 MHz, DMSO-d6): δ 11.33
(1H, br s, Ura-NH), 7.71 (1H, d, J = 8.1 Hz, Ura-H-6), 7.41–7.22 (9H, m,
DMTr-H-Ar), 6.93–6.87 (4H, m, DMTr-H-Ar), 5.88 (1H, d, J = 3.8 Hz, H-1ꢁ),
5.31 (1H, d, J = 8.1 Hz, Ura-H-5), 5.26 (1H, d, J = 5.6 Hz, OH-3ꢁ), 4.73
(1H, d, J = 6.6 Hz, OCHαO), 4.69 (1H, d, J = 6.6 Hz, OCHβO), 4.28–4.21
(2H, m, H-2ꢁ, H-3ꢁ), 4.03–3.97 (1H, m, H-4ꢁ), 3.75 (6H, s, DMTr-OCH3),
3.32 (1H, dd, J = 11.0 Hz, J = 4.5 Hz, Hα-5ꢁ), 3.27 (3H, s, OCH3), 3.24 (1H,
+
dd, J = 11.0 Hz, J = 2.8 Hz, Hβ-5ꢁ). MS: 613.23, calc. for C32H34N2NaO9
(M+Na)+ 613.22.
N4-Benzoyl-5ꢁ-O-(4,4ꢁ-dimethoxytrityl)-2ꢁ-O-(methoxymethyl)cytidine (13b)
1
Yield 79%. Rf (solvent С) = 0.45. H-NMR (300 MHz, DMSO-d6):
11.24 (1H, br s, Cyt-NH), 8.35 (1H, d, J = 7.3 Hz, Cyt-H-6), 8.03–7.48
(5H, m, Bz-H-Ar), 7.32–6.79 (9H, m, DMTr-H-Ar), 7.15 (1H, d, J =
7.3 Hz, Cyt-H-5), 6.96–6.89 (4H, m, DMTr-H-Ar), 5.89 (1H, d, J = 1.9
Hz, H-1ꢁ), 5.29 (1H, d, J = 7.3 Hz, OH-3ꢁ), 4.91 (1H, d, J = 6.4 Hz,

Synthesis of Oligoribonucleotides
573
OCHαO), 4.77 (1H, d, J = 6.4 Hz, OCHαO), 4.39–4.31 (1H, m, H-3ꢁ),
4.18–4.15 (1H, m, H-2ꢁ), 4.12–4.06 (1H, m, H-4ꢁ), 3.76 (6H, br s, DMTr-
OCH3), 3.43–3.35 (2H, m, H-5ꢁ), 3.32 (3H, s, OCH3). MS: 732.20, calc. for
C40H43N3NaO9+ (M+Na)+ 732.29.
N6-Benzoyl-5ꢁ-O-(4,4ꢁ-dimethoxytrityl)-2ꢁ-O-(methoxymethyl)adenosine (13c)
1
Yield 68%. Rf (solvent С) = 0.50. H-NMR (300 MHz, DMSO-d6):
δ 11.21 (1H, br s, Ade-NH), 8.67 (1H, s, Ade-H-8), 8.60 (1H, s, Ade-H-
2), 8.07–7.51 (5H, m, Bz-H-Ar), 7.39–7.16 (9H, m, DMTr-H-Ar), 6.87–6.80
(4H, m, DMTr-H-Ar), 6.23 (1H, d, J = 5.1 Hz, H-1ꢁ), 5.42 (1H, d, J = 5.8 Hz,
OH-3ꢁ), 4.96–4.91 (1H, m, H-2ꢁ), 4.72 (1H, d, J = 6.7 Hz, OCHαO), 4.64
(1H, d, J = 6.7 Hz, OCHβO), 4.53–4.46 (2H, m, H-3ꢁ), 4.17–4.11 (1H, m,
H-4ꢁ), 3.72 (6H, d, J = 0.5 Hz, DMTr-OCH3), 3.29–3.24 (2H, m, H-5ꢁ), 3.11
(3H, s, OCH3). MS: 718.26, calc. for C40H40N5O8+ (M+H)+ 718.29.
N2-Isobutyryl-5ꢁ-O-(4,4ꢁ-dimethoxytrityl)-2ꢁ-O-(methoxymethyl)guanosine
(13d)
1
Yield 68%. Rf (solvent B) = 0.50. H-NMR (300 MHz, DMSO-d6): δ
12.10 (1H, br s, Gua-NH), 11.60 (1H, br s, Gua-NH), 8.11 (1H, s, Gua-H-
8), 7.37–7.18 (9H, m, DMTr-H-Ar), 6.85–6.79 (4H, m, DMTr-H-Ar), 6.01
(1H, d, J = 5.6 Hz, H-1ꢁ), 5.32 (1H, d, J = 5.6 Hz, OH-3ꢁ), 4.72 (1H, d,
J = 6.7 Hz, OCHαO), 4.72–4.68 (1H, m, H-2ꢁ), 4.63 (1H, d, J = 6.7 Hz,
OCHβO), 4.39–4.33 (1H, m, H-3ꢁ), 4.10–4.04 (1H, m, H-4ꢁ), 3.72 (6H, d,
J = 0.7 Hz, DMTr-OCH3), 3.33–3.26 (1H, m, Hα-5ꢁ), 3.20–3.14 (1H, m,
Hβ-5ꢁ), 3.14 (3H, s, OCH3), 2.76 (1H, sept, J = 6.9 Hz, iBu-CH), 1.12,1.11
(6H, d, J = 6.9 Hz, iBu-CH3). MS: 700.35, calc. for C37H42N5O9+ (M+H)+
700.29.
General Method for the Synthesis of Ribonucleotide Monomers
(14) Containing 2ꢀ-O-MOM Modifying Groups
To introduce the phosphate residue bearing the O-catalytic protec-
tive group, the compound 13 (1.0 mmol) was allowed to react with (2-
chlorophenyl)-(1-oxido-4-methoxy-2-picolyl) phosphate (2.0 mmol)[11] in
dry pyridine/CH3CN (1:4, v/v, 10 mL) in the presence of TPSCl (3.0 mmol)
for 15 minutes. The reaction was terminated by the addition of 1 M TEAB
(20 mL). The solution obtained was extracted with chloroform (2 × 20 mL),
and the combined organic fractions were evaporated to dryness. To remove
the traces of pyridine, the residue was co-evaporated with toluene. The gum
obtained was treated with 10 mL of 0.25 M solution of DBU in CH3CN-H2O
(9:1, v/v) for 16 hours at room temperature. After the following treatment
with 0.5 M TEAB (10 mL), the reaction mixture was extracted with chloro-
form (2 × 15 mL). The combined organic fractions were washed with 0.5
M TEAB (3 × 20 mL) and evaporated to dryness. The product was isolated
by silica gel column chromatography using 0–15% gradient of methanol in
chloroform with 1% of TEA. The fractions containing the desired compound
14 were concentrated by evaporation to foam and dried in vacuo.

574
V. A. Efimov et al.
5ꢁ-O-(4,4ꢁ-Dimethoxytrityl)-2ꢁ-O-(methoxymethyl)uridine 3ꢁ-O-(1-Oxido-4-
methoxy-2-picolyl)phosphate (14а)
1
Yield 72%. Rf (solvent A) = 0.30. H-NMR (300 MHz, CDCl3): δ 11.95
(1H, br s, Ura-NH), 8.06 (1H, d, J = 7.2 Hz, picolyl-H-6), 7.71 (1H, d, J =
8.2 Hz, Ura-H-6), 7.38–7.16 (10H, m, DMTr-H-Ar, picolyl-H-3), 6.85–6.77
(4H, m, DMTr-H-Ar), 6.70 (1H, dd, J = 7.2 Hz, J = 3.4 Hz, picolyl-H-5), 6.14
(1H, d, J = 6.6 Hz, H-1ꢁ), 5.16 (1H, d, J = 8.2 Hz, Ura-H-5), 5.16–5.10 (2H,
m, P-OCH2), 5.04–4.98 (1H, m, H-3ꢁ), 4.91 (1H, d, J = 6.7 Hz, OCHαO),
4.63 (1H, d, J = 6.7 Hz, OCHβO), 4.62–4.57 (1H, m, H-2ꢁ), 4.47–4.42 (1H,
m, H-4ꢁ), 3.80 (3H, s, picolyl-OCH3), 3.78 (6H, d, J =0.9 Hz, DMTr-OCH3),
3.60–3.41 (1H, dd, J = 10.7 Hz, J = 2.3 Hz, Hα-5ꢁ), 3.35–3.48 (1H, m,
Hβ-5ꢁ), 3.29 (3H, s, OCH3). 31P-NMR (121.5 MHz, CDCl3) δ = 0.10. MS:
806.28, calc. for C39H41N3O14P− (M)− 806.23.
N4-Benzoyl-5ꢁ-O-(4,4ꢁ-dimethoxytrityl)-2ꢁ-O-(methoxymethyl)cytidine
3ꢁ-O-(1-Oxido-4-methoxy-2-picolyl)phosphate (14b)
Yield 83%. Rf (solvent A) = 0.40. 1H-NMR (300 MHz, CDCl3): 8.20 (1H,
d, J = 7.4 Hz, Cyt-H-6), 8.04 (1H, d, J = 7.2 Hz, picolyl-H-6), 7.92–7.45
(5H, m, Bz-H-Ar), 7.43–7.19 (11H, m, DMTr-H-Ar, Cyt-H-5, picolyl-H-3),
6.86–6.79 (4H, m, DMTr-H-Ar), 6.69 (1H, dd, J = 7.2 Hz, J = 3.4 Hz,
picolyl-H-5), 6.23 (1H, d, J = 4.3 Hz, H-1ꢁ), 5.10 (2H, ddd, J = 31.2 Hz, J =
17.0 Hz, J = 7.7 Hz, P-OCH2), 5.01–4.93 (1H, m, H-3ꢁ), 4.96 (1H, d, J = 6.5
Hz, OCHαO), 4.75 (1H, d, J = 6.5 Hz, OCHαO), 4.59–4.54 (1H, m, H-2ꢁ),
4.50–4.45 (1H, m, H-4ꢁ), 3.79 (6H, d, J = 0.6 Hz, DMTr-OCH3), 3.78 (3H,
s, picolyl-OCH3), 3.63–3.53 (2H, m, H-5ꢁ), 3.33 (3H, s, OCH3). 31P-NMR
(121.5 MHz, CDCl3) δ = −0.03. MS: 909.26, calc. for C46H46N4O14P− (M)−
909.28.
N6-Benzoyl-5ꢁ-O-(4,4ꢁ-dimethoxytrityl)-2ꢁ-O-(methoxymethyl)adenosine
3ꢁ-O-(1-Oxido-4-methoxy-2-picolyl)phosphate (14c)
1
Yield 84%. Rf (solvent A) = 0.40. H-NMR (300 MHz, CDCl3): δ 9.12
(1H, br s, Ade-NH), 8.71 (1H, s, Ade-H-8), 8.14 (1H, s, Ade-H-2), 8.05 (1H,
d, J = 7.3 Hz, picolyl-H-6), 8.04–7.47 (5H, m, Bz-H-Ar), 7.41–7.15 (10H, m,
DMTr-H-Ar, picolyl-H-3), 6.79–6.73 (4H, m, DMTr-H-Ar), 6.70 (1H, dd, J =
7.3 Hz, J = 3.6 Hz, picolyl-H-5), 6.35 (1H, d, J = 7.4 Hz, H-1ꢁ), 5.24–5.06
(4H, m, H-2ꢁ, H-3ꢁ, P-OCH2), 4.88 (1H, d, J = 6.8 Hz, OCHαO), 4.63–4.59
(1H, m, H-4ꢁ), 4.53 (1H, d, J = 6.8 Hz, OCHβO), 3.78 (3H, s, picolyl-OCH3),
3.75 (6H, s, DMTr-OCH3), 3.51–3.45 (2H, m, H-5ꢁ), 3.03 (3H, s, OCH3).
31P-NMR (121.5 MHz, CDCl3) δ = 0.06. MS: 933.32, calc. for C47H46N6O13P−
(M)− 933.29.
N2-Isobutyryl-5ꢁ-O-(4,4ꢁ-dimethoxytrityl)-2ꢁ-O-(methoxymethyl)guanosine
3ꢁ-O-(1-Oxido-4-methoxy-2-picolyl)phosphate (14d)
1
Yield 72%. Rf (solvent A) = 0.25. H-NMR (300 MHz, CDCl3): δ 12.05
(1H, br s, Gua-NH), 10.78 (1H, br s, Gua-NH), 8.02 (1H, d, J = 7.2 Hz,
picolyl-H-6), 7.74 (1H, s, Gua-H-8), 7.40–7.14 (10H, m, DMTr-H-Ar, picolyl-
H-3), 6.76–6.70 (5H, m, DMTr-H-Ar, picolyl-H-5), 6.02 (1H, d, J = 6.3 Hz,

Synthesis of Oligoribonucleotides
575
H-1ꢁ), 5.42–5.34 (1H, m, H-3ꢁ), 5.21 (2H, d, J = 7.0 Hz, P-OCH2), 5.10–5.05
(1H, m, H-2ꢁ), 4.84 (1H, d, J = 6.7 Hz, OCHαO), 4.58–4.52 (2H, m, H-4ꢁ,
OCHβO), 3.76 (3H, s, picolyl-OCH3), 3.75 (6H, d, J = 1.7 Hz, DMTr-OCH3),
3.47–3.38 (1H, m, Hα-5ꢁ), 3.28 (1H, dd, J = 10.8 Hz, J = 4.1 Hz, Hβ-5ꢁ), 3.12
(3H, s, OCH3), 2.55 (1H, sept, J = 6.9 Hz, iBu-CH), 1.14, 1.07 (6H, d, J =
6.9 Hz, iBu-CH3). 31P-NMR (121.5 MHz, CDCl3) δ = 0.54. MS: 915.43, calc.
for C44H48N6O14P− (M)− 915.30.
REFERENCES
1. Kawasaki, A.M.; Casper, M.D.; Freier, S.M.; Lesnik, E.A.; Zounes, M.C.; Cummins, L.L.; Gonzalez, C.;
Cook, P.D. Uniformly modified 2ꢁ-deoxy-2ꢁ-fluoro phosphorothioate oligonucleotides as nuclease-
resistant antisense compounds with high affinity and specificity for RNA targets. J. Med. Chem. 1993,
36, 831–841.
2. Sproat, B.S.; Lamond, A.I.; Beijer, B.; Neuner, P.; Ryder, U. Highly efficient chemical synthesis of
2ꢁ-O-methyloligoribonucleotides and tetrabiotinylated derivatives; novel probes that are resistant to
degradation by RNA or DNA specific nucleases. Nucleic Acids Res. 1989, 17, 3373–3386.
3. Lamond, A.I.; Sproat, B.S. Antisense oligonucleotides made of 2ꢁ-O-alkylRNA: Their properties and
applications in RNA biochemistry. FEBS Lett. 1993, 325, 123–127.
4. Altmann, K.-H.; Martin, P.; Dean, N.M.; Monia, B.P. Second generation antisense
oligonucleotides—inhibition of PKC-α and c-raf kinase expression by chimeric oligonucleotides
incorporating 6ꢁ-substituted carbocyclic nucleosides and 2ꢁ-O-ethylene glycol substituted ribonucle-
osides. Nucleosides & Nucleotides 1997, 16, 917–926.
5. Saneyoshi, H.; Seio, K.; Sekine, M. A general method for the synthesis of 2ꢁ-O-cyanoethylated olig-
oribonucleotides having promising hybridization affinity for DNA and RNA and enhanced nuclease
resistance. J. Org. Chem. 2005, 70, 10453–10460.
6. Efimov, V.; Buryakova, A.; Dubey, I.; Polushin, N.; Chakhmakhcheva, O.; Ovchinnikov, Yu. Applica-
tion of new catalytic phosphate protecting groups for the highly efficient phosphotriester oligonu-
cleotide synthesis. Nucleic Acids Res. 1986, 14, 6526–6540.
7. Polushin, N.; Smirnov, I.; Verentchikov, A.; Coull, J. Synthesis of oligonucleotides containing 2ꢁ-azido-
and 2ꢁ-amino-2ꢁ-deoxyuridine using phosphotriester chemistry. Tetrahedrom Lett. 1996, 37, 3227–3230.
8. Almer, H.; Szabo, T.; Stawinski, J. A new approach to stereospecific synthesis of P-chiral phos-
phorothioates. Preparation of diastereomeric dithymidyl-(3ꢁ-5ꢁ) phosphorothioates. Chem. Commun.
2004, 290–291.
9. Efimov, V.A.; Molchanova, N.S.; Chakhmakhcheva, O.G. Approach to the synthesis of natural and
modified oligonucleotides by the phosphotriester method using o-nucleophilic intramolecular catal-
ysis. Nucleosides Nucleotides Nucleic Acids 2007, 26, 1087–1093.
10. Efimov, V.A.; Aralov, A.V.; Fedunin, S.V.; Klykov, V.N.; Chakhmakhcheva, O.G. An azidomethyl
protective group in the synthesis of oligoribonucleotides by the phosphotriester method. Russ. J.
Bioorg. Chem. 2009, 35, 250–253.
11. Efimov, V.A.; Aralov, A.V.; Klykov, V.N.; Chakhmakhcheva, O.G. Synthesis of RNA by the rapid
phosphotriester method using azido-based 2ꢁ-O-protecting groups. Nucleosides Nucleotides Nucleic Acids
2009, 28, 846–865.
12. Efimov, V.A.; Aralov, A.V.; Grachev, S.A.; Chakhmakhcheva, O.G. N -azidomethylbenzoyl block-
ing group in the phosphotriester synthesis of oligoribonucleotides. Russ. J. Bioorg. Chem. 2010, 36,
628–633.
13. Efimov, V.A.; Aralov, A.V.; Chakhmakhcheva, O.G. Methoxymethyl and (p-nitrobenzyloxy)methyl
groups in synthesis of oligoribunucleotides by the phosphotriester method. Russ. J. Bioorg. Chem.
2011, 37, 254–258.
14. Aralov, A.V.; Klykov, V.N.; Chakhmakhcheva, O.G.; Efimov, V.A. Monomers containing 2ꢁ-O-
alkoxymethyl groups as synthons for the oligonucleotide synthesis by the phosphotriester method.
Russ. J. Bioorg. Chem. 2011, 37, 586–592.

576
V. A. Efimov et al.
15. Greene, T.W.; Wuts, P.G.M. Protective Groups in Organic Synthesis, 4th ed., Wiley, New York, 1999,
pp. 27–33.
16. Groziak, M.P.; Koohang, A. Facile addition of hydroxylic nucleophiles to the formyl group of uridine-
6-carboxaldehydes. J. Org. Chem. 1992, 57, 940–944.
17. Tanaka, H.; Hayakawa, H.; Miyasaka, T. Synthesis of 6-aroyluridine from uridine via regiospecific
lithiatio. Chem. Pharm. Bull. 1981, 29, 3565–3572.
18. Nishino, S.; Ishido, Y. Partial protection of carbohydrate derivatives. Part 22. Further improvement
in introduction of methoxymethyl group to hydroxyl groups of carbohydrate derivatives. J. Carbohydr.
Chem. 1986, 5, 313–327.
19. Bizdena, E.; Rozners, E.; Stromberg, R. Synthesis and properties of 2ꢁ-O-methoxymethyl oligonu-
cleotides. Collect. Czech. Chem. Commun. 1996, s283–s286.
20. Talbot, D.C.; Davies, J.; Callies, S.; Andre, V.; Lahn, M.; Ang, J.; De Bono, J.S.; Ranson, M. First hu-
man dose study evaluating safety and pharmacokinetics of LY2181308, an antisense oligonucleotide
designed to inhibit survivin. J. Clin. Oncol. (Meeting Abstracts) 2008, 26, 3518.
21. Pennati, M.; Folini, M.; Zaffaroni, N. Targeting survivin in cancer therapy: Pre-clinical studies, in
Apoptosome, ed. F. Cecconi, M. D’Amelio, Springer, Dordrecht, 2010, pp. 147–168.
22. Shiba, Y.; Masuda, H.; Watanabe, N.; Ego, T.; Takagaki, K.; Ishiyama, K.; Ohgi, T.; Yano, J. Chemical
synthesis of a very long oligoribonucleotide with 2-cyanoethoxymethyl (CEM) as the 2ꢁ-O-protecting
group: Structural identification and biological activity of a synthetic 110mer precursor-microRNA
candidate. Nucleic Acids Res. 2007, 35, 3287–3296.
23. Han, J.H.; Kwon, Y.E.; Sohn, J.-H.; Ryu, D.H. A facile method for the rapid and selective deprotection
of methoxymethyl (MOM) ethers. Tetrahedron 2010, 66, 1673–1677.
24. Eskandari, R.; Jayakanthan, K.; Kuntz, D.A.; Rose, D.R.; Pinto, B.M. Synthesis of a biologically ac-
tive isomer of kotalanol, a naturally occurring glucosidase inhibitor. Bioorg. Med. Chem. 2010, 18,
2829–2835.
25. Pechenov, A.E.; Zavgorodny, S.G.; Shvets, V.L.; Miroshnikov, A.I. The S, X-acetals in nucleoside
chemistry. I. The synthesis of 2ꢁ- and 5ꢁ-O-methylthiomethylribonucleosides. Russ. J. Bioorg. Chem.
2000, 26, 327–333.