Benzylidene acetal type bridged nucleic acids: Changes in properties upon cleavage of the bridge triggered by external stimuli

Article abstract of DOI:10.1002/chem.201100541

Four classes of benzylidene acetal type bridged nucleic acids (BA-BNAs) were designed with 2′,4′-bridged structures that cleaved upon exposure to appropriate external stimuli. Cleavage of 6-nitroveratrylidene and 2-nitrobenzylidene acetal type BNA bridges

Full text of DOI:10.1002/chem.201100541

DOI: 10.1002/chem.201100541
Benzylidene Acetal Type Bridged Nucleic Acids: Changes in Properties
Upon Cleavage of the Bridge Triggered by External Stimuli
Kunihiko Morihiro, Tetsuya Kodama, and Satoshi Obika*[a]
Abstract: Four classes of benzylidene
acetal type bridged nucleic acids (BA-
BNAs) were designed with 2’,4’-
bridged structures that cleaved upon
exposure to appropriate external stimu-
li. Cleavage of 6-nitroveratrylidene and
2-nitrobenzylidene acetal type BNA
bridges occurred upon photoirradiation
and subsequent treatment with thiol
caused changes in secondary structure
to afford 4’-C-hydroxymethyl RNA.
Benzylidene and 4-nitrobenzylidene
acetal type BNA responded to acids
and reducing agents, respectively, re-
sulting in hydrolysis of the acetal-
bridged structure. Cleavage of the
bridge removed sugar conformational
restrictions and changed the duplex-
and triplex-forming properties of the
BNA-modified oligonucleotides. More-
over, oligonucleotides incorporating a
single BA-BNA modification had con-
siderably improved stability toward 3’-
exonuclease, which was lost upon
cleavage of the bridge. Thus, these new
BNAs may be useful as therapeutic
and detection tools by sensing various
environments.
Keywords: DNA · nuclease resist-
ance · nucleic acids · oligonucleo-
tides · RNA
Introduction
The ability to respond to an external stimulus is an impor-
tant requirement for molecular tools aimed at regulating
biological phenomena or acting as sensing systems for nano-
devices. The regulation of nucleic acid properties is a partic-
ularly attractive research area due to its diverse applications,
such as gene regulation,[1] molecular diagnostics,[2] catalysts[3]
or functional nanoscale materials.[4] Various external stimuli,
such as light,[5] pH,[6] temperature,[7] change in redox poten-
tial,[8] or small molecules,[9] have been used for this purpose.
Previously, we[10a] and Wengelꢀs[10b] group independently
synthesized 2’-O,4’-C-methylene-bridged nucleic acid (2’,4’-
BNA/LNA)[10] with an N-type locked sugar conformation
imposed by the bridged structure, and demonstrated that
oligonucleotides (ONs) containing 2’,4’-BNA/LNA have
high affinity for complementary single-stranded RNA
(ssRNA)[11] and double-stranded DNA (dsDNA).[12] Since
these characteristics of 2’,4’-BNA/LNA are due to the fixed
N-type sugar conformation, we were inspired to design ben-
zylidene acetal type BNAs (BA-BNAs) that have a labile
2’,4’-bridged structure (Scheme 1). The sugar conformation
of BA-BNAs is locked in the N-type conformation, but
upon exposure to an appropriate external stimulus, the
bridge is cleaved and the sugar conformational restriction is
Scheme 1. Cleavage of the bridged structure and loss of sugar conforma-
tional restriction triggered by external stimulus.
lost. This causes changes in the properties of the nucleic
acid, including its ability to form duplexes or triplexes, and
allows control of various molecular systems. We recently
communicated the synthesis and properties of a light-re-
sponsive BNA that contained a photolabile 6-nitroveratryl
group in the acetal-bridged structure (Scheme 2, 6-NVB).[13]
The bridged structure of 6-NVB can be cleaved upon photo-
irradiation (form II) and subsequent treatment with gluta-
thione (GSH) causes secondary structure changes to afford
4’-C-hydroxymethyl RNA (form III).[14] With these two
steps required to change the structure of 6-NVB, the binding
affinity of ONs containing 6-NVB for complementary
ssRNA can be changed in two stages. Nucleic acids that re-
spond to both light and GSH may have potential in thera-
peutics, diagnostics, or as detection agents by sensing GSH
concentration.
The introduction of other aryl groups into the bridged
structure could provide BNAs that lose their locked sugar
conformation in response to other external stimuli. There-
fore, we designed three BA-BNAs containing either a 2-ni-
trobenzyl (2-NBB), a benzyl (BB), or a 4-nitrobenzyl (4-
NBB) group in the bridged structure (Scheme 2). 2-NBB re-
sponds to light in the same manner as 6-NVB, but the secon-
[a] K. Morihiro, Prof. T. Kodama, Prof. S. Obika
Graduate School of Pharmaceutical Sciences
Osaka University, 1-6 Yamadaoka, Suita
Osaka 565-0871 (Japan)
Fax : (+81)6-6879-8204
E-mail: obika@phs.osaka-u.ac.jp
Supporting information for this article is available on the WWW
under http://dx.doi.org/10.1002/chem.201100541.
7918
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 7918 – 7926

FULL PAPER
Scheme 3. Synthesis of BA-BNA phosphoramidites. Reagents and condi-
tions: a) 2-nitrobenzaldehyde, ZnCl2, toluene, RT, 37 h (2); benzalde-
hyde, ZnCl2, RT, 14 h (3); 4-nitrobenzaldehyde, ZnCl2, HFIP, RT, 18 h
(4); b) TBAF, THF, 08C; c) DMTrCl, pyridine, RT, 15 h (8); 11 h (9);
Scheme 2. Change in structure of BA-BNAs responding to various exter-
nal stimuli.
21 h (10); d) (iPr2N)2PO
17 h (11); 40 h (12); 17 h (13). CE=cyanoethyl, DMTr=4,4’-dimethoxy-
trityl, HFIP=1,1,1,3,3,3-hexafluoroisopropanol, Thy=thymin-1-yl,
TBAF=tetra-n-butylammonium fluoride.
ACHTNUGRTNE(NUGN CH2)2CN, 4,5-dicyanoimidazole, CH3CN, RT,
dary reaction with GSH is predicted to proceed faster than
that of 6-NVB because of the increased electrophilicity of
the 1’’-O-carbonyl group. BB has an electron-donating
phenyl group at the bridged moiety, and the acetal structure
is easily degraded under acidic conditions to form 4’-C-hy-
droxymethyl RNA. In contrast, 4-NBB has a 4-nitrophenyl
group at the bridged structure. The electron-withdrawing
nitro group of 4-NBB can be reduced to an electron-donat-
ing amino group by treatment with a reducing agent, upon
which the acetal-bridged structure becomes very unstable
and can be hydrolyzed even under neutral conditions. Thus,
BB has the potential to be a sensor of acidic conditions and
4-NBB has the potential to be a sensor of reducing condi-
tions. Herein, we report the synthesis of these new BA-
BNAs and describe the changes in structure and properties
of these BA-BNAs, including 6-NVB.
for the other diastereomer. A plausible transition state
model for this reaction is described in Supporting Informa-
tion (Figure S21). Desilylation was carried out by using
TBAF to afford the corresponding nucleoside analogues 5–
7. Tritylation at the primary hydroxyl group with DMTrCl
and phosphitylation at the secondary hydroxyl group yielded
phosphoramidites 11–13. Phosphoramidites 11–13 and the 6-
NVB amidite building block were introduced into ONs 14–
18 on an automated DNA synthesizer (Figure 1, details are
given in the Supporting Information).
Results
Figure 1. Sequences of ONs used in this study. Xs indicate the modified
residues. Series a, b, c, and d represent 6-NVB-, 2-NBB-, BB- and 4-NBB-
modified ONs, respectively.
Synthesis of BA-BNAs phosphoramidites: BA-BNAs were
synthesized from nucleoside derivative 1,[13] as shown in
Scheme 3.[15] When the 3’- and 5’-hydroxyl groups of the nu-
cleoside are modified with the 1,1,3,3-tetraisopropyldisilox-
ane-1,3-diyl (TIPDS) moiety, the sugar conformation is pre-
locked in the N-type conformation,[16] similar to that of 2’,4’-
BNAs. Compound 1, therefore, has advantages for the con-
struction of the 2’,4’-bridged moiety. The 2’,4’-bridged struc-
tures were constructed by treating diol 1 with three types of
aldehydes and ring-closed compounds 2–4 were obtained as
single diastereomers. The configuration at the acetal carbon
atom was determined from NOESY spectra (Figures S18
and S19 in Supporting Information and references [13] and
[15]). The NOESY spectrum showed no correlation between
acetal-H/1’-H or a correlation between acetal-H/TIPDS-H.
It should not be possible to show such a NOESY spectrum
Change in structure of light-responsive BNA: We evaluated
the cleavage of the 2-NBB bridge upon photoirradiation. A
UV-LED (365 nm) lamp was used as the light source. ON
14b (form I), which contains one 2-NBB unit, was photoir-
AHCTUNGTREGrNNUN adiated at 365 nm for 5 s and the resulting products were
analyzed by reverse-phase HPLC (RP-HPLC) and MALDI-
TOF mass spectrometry (Figure 2B). The signals corre-
sponding to the bridge-closed form (form I) disappeared
and the bridge-opened form (form II) was generated. Fur-
thermore, when ON 14b was photoirradiated for 5 s and
then treated with GSH for 60 min, 2-NBB was transformed
into 4’-C-hydroxymethyl RNA (form III; Figure 2C).
Chem. Eur. J. 2011, 17, 7918 – 7926
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
7919

S. Obika et al.
Figure 3. Time course of the reaction of ON 14a (form II) with GSH (&;
~
t
1/2 >200 min), ON 14b (form II) with GSH ; t1/2 =6 min) and ON 14b
*
(form II) with Cys ( ; t1/2 <1 min). Error bars indicate standard deviation
(n=3). Conditions: 25 mm sodium phosphate buffer (pH 7.2), 10 mm ON
14a or ON 14b, and 10 mm GSH or Cys; reaction temperature=378C.
ed into 4’-C-hydroxymethyl RNA (form III). Interestingly,
the reaction rate with Cys was faster than that with GSH
(Figure 3; t1/2 =<1 vs. 6 min), indicating that 2-NBB (form
II) could work not only as a good GSH senser, but also as a
remarkable Cys sensor. These results indicate that the thiol
group is important for the reaction of 6-NVB and 2-NBB
(form II) with GSH.
Change in structure of acid-responsive BNA: The change in
the structure of BB under acidic conditions was evaluated in
a similar way. ON 14c (form I), which contains one BB unit,
was placed in a solution of citrate phosphate buffer at
pH 3.0 for 60 min and analyzed by RP-HPLC (Figure 4).
The acetal-bridged structure was hydrolyzed and 4’-C-hy-
droxymethyl RNA (form III) was generated.
We next examined the efficiency of the hydrolysis of the
acetal-bridged structure of BB at pH 3.0–5.0 (Figure 5) and
found that the hydrolysis rate decreased as the pH of the so-
lution increased. This means that cleavage of the bridged
structure of BB is dependent on the pH under acidic condi-
tions, suggesting that BB holds promise for development as a
pH sensor.
Figure 2. RP-HPLC analysis of ON 14a. A) ON 14a (form I) (10 mm)
before photoirradiation. B) ON 14a (10 mm) after irradiation at 365 nm
for 5 s. C) ON 14a (10 mm) after irradiation at 365 nm for 5 s and subse-
quent reaction with GSH (10 mm) for 60 min. The reaction mixture was
analyzed by RP-HPLC by using an XTerra MS C18 column (4.6ꢂ50 mm)
with a linear gradient of CH3CN (6 to 24% over 15 min) in 0.1m triethyl-
ACHTUNGTRENNUNGammonium acetate (pH 7.0).
Change in structure of reductant-responsive BNA: The re-
AHCTUNGTRENNUNG
action of 4-NBB with the reducing agents sodium ascor-
We compared the reaction efficiency of 2-NBB with 6-
bate,[17] potassium ferrocyanide,[18] dithiothreitol,[19] GSH,[20]
sodium thiosulfate,[21] and sodium dithionite[22] was exam-
ined. Of these reducing agents, only sodium dithionite could
reduce the nitro group of 4-NBB (Figure 6). The signal cor-
responding to the 4-NBB-modified ON (form I) disappeared
within 10 min, but 4’-C-hydroxymethyl RNA (form III) ap-
peared somewhat later, indicating that reduction of the nitro
group proceeded rapidly, but hydrolysis of the acetal-
bridged structure proceeded at a slower rate. In contrast,
the initial reduction of ON 14b (form I) containing 2-NBB
occurs much more slowly and there are no traces of subse-
NVB against GSH. Following photoirradiation of ON 14a
and 14b for 5 s (form II), the products were treated with
GSH and the remaining intact ON was quantified by RP-
HPLC (Figure 3). As expected, the reaction of 2-NBB (form
II) with GSH proceeded faster than that of 6-NVB (form II)
(t1/2 =6 vs. >200 min). The efficient reaction of 2-NBB (form
II) with GSH prompted us to evaluate the reactivity with
glutamate (Glu), cysteine (Cys), and glycine (Gly), which
are constituent amino acids of GSH. The results showed
that 2-NBB (form II) reacted only with Cys and was convert-
7920
www.chemeurj.org
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 7918 – 7926

Benzylidene Acetal Type Bridged Nucleic Acids
FULL PAPER
Figure 5. Time course of the reaction of ON 14c in a solution at pH 3.0
~
*
(
; t1/2 =7 min), 4.0 ( ; t1/2 =41 min), and 5.0 (&; t1/2 >300 min). Error
bars indicate standard deviation (n=3). Conditions: 25 mm citrate phos-
phate buffer and 10 mm ON 14c; reaction temperature=378C.
es formed between ONs containing three BA-BNA units
and ssDNA or ssRNA were dramatically changed by exter-
nal stimuli because the synergistic effects of bulky aryl moi-
eties on the duplex stability[23] were canceled upon bridge
cleavage. Figure 7 showed the DTm values of each ON (form
II and III) relative to that of form I. ONs 15a–d (form III)
showed remarkably higher binding affinity to their DNA
complement than form I (Figure 7A; Tm values are at most
128C higher). With ssRNA, the binding affinity of form III
was much higher than form I in the case of 15a, whereas
they were almost identical in case of 15b–d. ON 15b (form
II) showed much lower Tm values than form III (Figure 7B).
We also evaluated the triplex-forming ability of ONs con-
taining BA-BNA with target dsDNA (Table 2). BA-BNAs
(form I) showed low binding affinity, especially if they had
three modifications (Tm value <208C). In addition, no tri-
plex formation was observed with 6-NVB and 2-NBB after
photoirradiation (form II), whereas a stable triplex was
formed (Tm of 408C) after conversion into 4’-C-hydroxy-
methyl RNA (form III).
Figure 4. RP-HPLC analysis of ON 14b. A) ON 14b (10 mm) before treat-
ment with acid. B) ON 14b (10 mm) after reaction in a solution of citrate
phosphate buffer at pH 3.0 for 60 min at 378C. The reaction mixture was
analyzed by RP-HPLC by using an XTerra MS C18 column (4.6ꢂ50 mm)
with a linear gradient of CH3CN (6 to 24% over 15 min) in 0.1m triethyl-
ACHTUNGTRENNUNGammonium acetate (pH 7.0).
quent hydrolysis even after 10 min (Figure S24 in the Sup-
porting Information).
Duplex- and triplex-forming abilities: Next, the ability of
the synthesized BA-BNAs to form duplexes and triplexes
was evaluated. These BNAs reacted with each stimulus or-
thogonally and lost their sugar conformational restriction.
These structural changes caused changes in the properties of
the ONs, such as their duplex- and triplex-forming abilities.
The duplex-forming abilities of BA-BNA-modified ONs
were evaluated against complementary ssDNA/RNA by
measuring Tm values (Table 1). The duplex-forming abilities
of ONs 14a–d, which contain one BA-BNA unit, changed
only slightly upon bridge cleavage. The Tm values of duplex-
Nuclease resistance of BA-BNA-modified ONs: We exam-
ined the resistance of ONs modified with a single BA-BNA
unit (ON 18a–d) toward 3’-exonuclease (Crotalus adaman-
teus venom phosphodiesterase (CAVP)) degradation and
compared it with natural ONs.
ONs were incubated with
Table 1. Tm Values [8C] of duplexes formed by BA-BNA-modified ONs with complementary ssDNA/RNA.[a]
CAVP and the percentage of
intact ONs was analyzed at sev-
eral time points by RP-HPLC
(Figure 8). The natural oligo-
thymidylates were essentially
digested within 20 min, whereas
BA-BNA-modified ONs (ON
18a–d; form I) were remarka-
bly stable under these condi-
tions, with about 95% of each
Duplexes
X=
Tm [8C]
6-NVB (I) 6-NVB (II) 2-NBB (I) 2-NBB (II) BB (I) 4-NBB (I) 4’-C-hydroxymethyl
RNA (III)
14a–d/ssDNA 41
39
–
43
23
43
38
42
–
45
–
45
34
44
24
45
41
44
32
43
37
[b]
[b]
[b]
[b]
15a–d/ssDNA
–
14a–d/ssRNA 39
37
39
[b]
[b]
[b]
15a–d/ssRNA
–
–
–
[a] Target strand: 5’-AGCAAAAAACGC-3’. Conditions: 10 mm sodium phosphate buffer solution (pH 7.2)
containing 100 mm NaCl; each strand concentration=4 mm; scan rate of 0.58Cminꢀ1 at 260 nm. X=BA-BNA.
The number is average of three independent measurements. [b] Tm <208C or not detectable.
Chem. Eur. J. 2011, 17, 7918 – 7926
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
7921

S. Obika et al.
4-NBB could not be cleaved by
light (Figure S22 in Supporting
Information). Moreover, a nitro
group on the aryl moiety also
affects the stability of the acetal
bridge against acid. Benzyl-
AHCTUNGTRENGNiUN dene acetal is more sensitive to
acid than methylene acetal be-
cause of the presence of the
electron-donating
phenyl
group;[27] therefore, BB loses its
bridge under mild acidic condi-
tions. In addition, it was impos-
sible, in our hands, to synthesize
ONs with a BA-BNA that had
a
2,5-dimethoxybenzyl group
because the acetal bridge was
degraded by the acid treatment
required for detritylation by the
automated DNA synthesizer
(data not shown). In contrast,
all of the other BNAs were
stable under these acidic condi-
tions because the introduction
of a nitro group into the aryl
moiety reduced the electron
density of the acetal bridge
(Figure S23 in the Supporting
Information). Furthermore, the
position of the nitro group on
the aryl moiety affected the re-
activity with the reducing agent.
4-NBB could effectively react
with sodium dithionite and the
Figure 6. RP-HPLC analysis of ON 14c. ON 14c (10 mm) was treated with sodium dithionite (25 mm) for a
given time at 378C. The reaction mixture was analyzed by RP-HPLC using an XTerra MS C18 column (4.6ꢂ
50 mm) with a linear gradient of CH3CN (6% to 24% over 15 min) in 0.1m triethylammonium acetate
(pH 7.0).
Table 2. Tm Values [8C] of triplexes formed by BA-BNA-modified ONs with target dsDNA.[a]
Oligonucleotides
X=
Tm [8C]
6-NVB (I) 6-NVB (II) 2-NBB (I) 2-NBB (II) BB (I) 4-NBB (I) 4’-C-hydroxymethyl
RNA (III)
16a–d
17a–d
24
–
26
–
32
–
27
–
25
–
35
–
41
40
[b]
[b]
[b]
[b]
[b]
[b]
[a] Target strand: 5’-d(GCTAAAAAGAAAGAGAGATCG)-3’/3’-d(CGATTTTTCTTTCTCTCTATC)-5’; the
italic portion indicates the target site for triplex formation. Conditions: 7 mm sodium phosphate buffer solution
(pH 7.0) containing 140 mm KCl and 10 mm MgCl2; each strand concentration=1.5 mm; scan rate of
0.58Cminꢀ1 at 260 nm. X=BA-BNA; mC=2’-deoxy-5-methylcytidine. The number is average of three inde-
pendent measurements. [b] Tm <208C or not detectable.
resulting
4-aminobenzylidene
acetal-bridged structure was
easily hydrolyzed under neutral
conditions. However, reduction
ON remaining intact after 20 min of exposure (form I: t1/2
>
of the nitro group in 2-NBB under the same conditions was
less effective (Figure S24 in the Supporting Information). It
has been reported that the less-hindered para-nitro group in
2,4-dinitroaryl derivatives was preferentially reduced by
some reducing agents;[28] therefore, reduction of the para-
nitro group by sodium dithionite proceeded faster than that
of the ortho-nitro group.
30 h). The nuclease resistance of ON 18a and 18b decreased
drastically upon photoirradiation (form II; t1/2 =24 min).
Conversion to 4’-C-hydroxymethyl RNA (form III) also de-
creased nuclease resistance, but form III was still more
stable than natural ON (t1/2 =11 min vs 5 min), in agreement
with the report by Wengel et al.[14]
Change in hybridization properties of each BA-BNA-modi-
fied ONs: The hybridizing abilities of ONs 15a–d, which
have three BA-BNAs, to ssDNA were dramatically in-
creased by converting form I into form III. In general, ONs
containing a BNA with a seven-membered bridged ring had
low hybridization affinities for their DNA complement.[29] In
addition to the seven-membered bridge, BA-BNAs have a
bulky aryl moiety in the minor groove, which may substan-
tially destabilize the duplex structure. Transformation from
form I to form III did not affect the hybridizing abilities of
these ONs with ssRNA, except for 6-NVB. Since the sugar
Discussion
Orthogonal reactivity of BA-BNAs to each stimulus: The
synthesized BA-BNAs respond to each stimulus (light, acid,
or reductant) orthogonally by undergoing cleavage of the
bridge according to the type of aryl moiety introduced into
the acetal-bridged structure. 6-NVB and 2-NBB have a pho-
toreactive 6-nitroveratryl[24] and 2-nitrobenzyl group,[25] re-
spectively. Because an aryl moiety containing an ortho-nitro
group is required for photoreactivity,[26] the bridge in BB and
7922
www.chemeurj.org
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 7918 – 7926

Benzylidene Acetal Type Bridged Nucleic Acids
FULL PAPER
3-position of the aryl moiety that may hinder formation of a
stable duplex due to steric repulsion (based on a modeling
study; Figure S26 in the Supporting Information). Form III
retained the ability to bind to ssRNA despite a flexible
sugar conformation due to a reduction in steric hindrance.
6-NVB and 2-NBB (form II) lack sugar conformational re-
striction, yet have bulky substituents; hence, ONs containing
form II are unable to bind to ssRNA. These results demon-
strate that ONs with 6-NVB and 2-NBB will have different
behavior following photoirradiation and subsequent thiol
treatment in two stages.
The hybridizing abilities of all BA-BNAs to target
dsDNA were changed upon exposure to the appropriate
stimulus. Molecular modeling of triplex ON units helped
clarify this change in affinity (Figure S27 in the Supporting
Information) and showed that the aryl moiety of BA-BNAs
(form I and II) in a triplex is positioned near the phospho-
diester linkage. The resulting steric hindrance would de-
crease their ability to hybridize with dsDNA. Form III has a
high triplex-forming ability due to its reduced steric hin-
drance.
Nuclease resistance of BA-BNA-modified ONs: Previous
studies have shown that the substituent on the bridge struc-
ture, and the bridge size, contribute to the nuclease resist-
ance of 2’,4’-BNA/LNA analogues and sterically hindered
structures increase the nuclease resistance of modified
ONs.[29a,b,d,32] In this study, ONs modified with BA-BNA
(form I) showed high nuclease resistance against CAVP,
probably due to steric hindrance of the aryl-substituted
seven-membered bridged moiety. On the other hand, ONs
with forms II and III, which were generated upon cleavage
of the bridge, showed decreased nuclease resistance.
Figure 7. DTm values of ONs 15a–d (form II and III) relative to that of
form
I
for A) ssDNA and B) ssRNA. ON 15 sequence: 5’-
d(GCGXTXTXTGCT)-3’.
General overview: Several properties of ONs containing
BA-BNAs can be regulated by various external stimuli, sug-
gesting that BA-BNAs may be applicable to a variety of bio-
technological applications. For example, the binding affini-
ties of ONs containing 6-NVB or 2-NBB for ssRNA could be
changed in two stages: first, by light and then with a thiol.
Interestingly, the behavior of an ON could be changed ac-
cording to which BNA is introduced (Figure 9A). These
BA-BNAs could be useful for trapping or releasing func-
tional ssRNA (mRNA, miRNA, or ribozyme) in a low thiol
concentration or high thiol concentration environment at
the desired time.[33] ONs modified with BB or 4-NBB would
be able to bind ssRNA regardless of sugar conformation re-
striction by the bridge, although nuclease resistance is de-
stroyed upon cleavage of the bridge (Figure 9B). These
characteristics have a potential application as a molecular
system in degradable devices, the properties of which could
change in a controlled fashion at a specific location in the
molecule.[34]
Figure 8. Nuclease resistance of 5’-d
G
B
B
Pharmacia Biotech); X=thymidine ( ), 6-NV (form I) ( ), 6-NV
(form I) (&), 2-NBB (form I) ( ), 2-NB (form II) ( ), B
^
&
^
( ), 4’-C-hydroxymethal RNA ( ). Hydrolysis of the oligonucleotides
(7.5 mm) was carried out at 378C in buffer (100 mL) containing 50 mm
Tris-HCl (pH 8.0), 10 mm MgCl2, and CAVP (0.02 mg).
conformation of BA-BNA (form I) is restricted to N-type,
which is the major conformation in the A-form of the RNA
duplex structure,[30] these compounds can bind to RNA de-
spite the presence of a large hydrophobic group in the
minor groove.[31] 6-NVB (form I) has a methoxy group at the
Many nucleic acid materials have been developed by fo-
cusing on base-pair hydrogen-bonding interactions,[35] stack-
ing within DNA helix,[36] the inversion of helicity,[37] the ac-
tivity of the 2’-hydroxyl group,[38] and recognition of the
Chem. Eur. J. 2011, 17, 7918 – 7926
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
7923

S. Obika et al.
photoirradiation and subsequent treatment with thiol trig-
gered a change in the secondary structure to generate 4’-C-
hydroxymethyl RNA. In contrast, the bridged structure of
BB was hydrolyzed under acidic conditions and that of 4-
NBB was hydrolyzed under reducing conditions. The sugar
conformational restriction of these BA-BNAs was lost upon
cleavage of the bridge. In conclusion, the duplex- and tri-
plex-forming abilities and nuclease resistance of these BA-
BNA-modified ONs could be changed at will in response to
an appropriate external stimulus.
Experimental Section
Synthesis and characterization of compounds: General aspects and in-
strumentation: All moisture-sensitive reactions were carried out in well-
dried glassware under an N2 atmosphere. Acetonitrile, pyridine, and tolu-
ene were distilled from CaH2. 6-NVB and 2-NBB were stable under ambi-
ent light conditions and did not need to be specially protected from light.
1H, 13C, 31P, NOESY, and H–H COSY spectra were recorded on JEOL
JNM-EX270, JEOL JNM-ECS400, and JEOL JNM-LA500 spectrome-
ters. Chemical shifts are reported in parts per million referenced to
CHCl3 (d=7.26 ppm) and CH3OH (d=3.30 ppm) for 1H NMR spectra,
and CDCl3 (d=77.0 ppm) and CD3OD (d=49.0 ppm) for 13C NMR spec-
tra. IR spectra were recorded on JASCO FT/IR-200 and JASCO FT/IR-
4200 spectrometers. Optical rotations were recorded on a JASCO DIP-
370 instrument. FAB mass spectra were measured on JEOL JMS-600 or
JEOL JMS-700 mass spectrometers. MALDI-TOF mass spectra were re-
corded on a Bruker Daltonics Autoflex II TOF/TOF mass spectrometer.
Fuji Silysia silica gel PSQ-100B (0.100 mm) and FL-100D (0.100 mm)
were used for column chromatography, and silica gel PSQ-60B
(0.060 mm) and FL-60D (0.060 mm) were used for flash column chroma-
tography. For HPLC, SHIMADZU LC-10ATVP, SHIMADZU SPD-
10AVP, and SHIMADZU CTO-10VP instruments were used.
Compound 2: Under an N2 atmosphere, a solution of 2-nitrobenzalde-
hyde (3.8 g, 25 mmol) in anhydrous toluene (5 mL) and zinc chloride
(150 mg, 1.1 mmol) were added to 1[13] (500 mg, 0.94 mmol) and the resul-
tant mixture was stirred at room temperature for 37 h. After the addition
of a saturated aqueous solution of NaHCO3 at 08C, the reaction mixture
was diluted with AcOEt, washed with water and brine, dried over
Na2SO4, and concentrated. The crude product was purified by column
Figure 9. Basic concept behind changing the properties of BA-BNA-
modified ONs by external stimuli. A) Change in the affinity of 6-NVB- or
2-NBB-modified ONs for ssRNA. B) Change in the affinity of BB- or 4-
NBB-modified ONs for ssRNA and the nuclease resistance of BB- or 4-
NBB-modified ONs.
chromatography (n-hexane/AcOEt 2/1) to give
2 as a white foam
(400 mg, 65%). M.p. 140–1438C; [a]2D3 =ꢀ47.0 (c=1.00 in CHCl3);
1H NMR (270 MHz, CDCl3): d=8.12 (brs, 1H; N3-H), 8.02 (t, J=8 Hz,
1H; Ar-H), 7.89 (t, J=8 Hz, 1H; Ar-H), 7.66 (t, J=8 Hz, 1H; Ar-H),
7.58 (s, 1H; H6), 7.49 (t, J=8 Hz, 1H; Ar-H), 6.91 (s, 1H; acetal-H),
6.15 (s, 1H; H1’), 4.65 (d, J=6 Hz, 1H; H3’), 4.41 (d, J=6 Hz, 1H; H2’),
4.03 (d, J=13 Hz, 1H; H5’), 4.00 (d, J=13 Hz, 1H; H1“), 3.71 (d, J=
13 Hz, 1H; H1”), 3.67 (d, J=13 Hz, 1H; H5’), 1.92 (s, 3H; CH3), 1.13–
1.08 ppm (m, 28H; TIPDS-H); 13C NMR (67.8 MHz, CDCl3): d=164.2,
150.1, 148.0, 134.7, 133.6, 133.3, 129.4, 128.1, 124.2, 110.2, 98.1, 91.9, 89.3,
79.3, 70.6, 68.2, 59.6, 17.3, 17.3, 17.2, 17.1, 17.1, 17.0, 16.9, 12.7, 12.6,
12.4 ppm; IR (KBr): n˜max =1274, 1465, 1528, 1681, 2947 cmꢀ1; MS (FAB):
m/z: 664 [M+H]+; HRMS (FAB): m/z calcd for C30H46N3O10Si2 [M+H]+:
664.2722; found: 664.2728.
phosphodiester linkage.[39] In this study, we have demon-
strated that regulation of sugar conformational restriction is
also an effective strategy for controlling the properties of
nucleic acids. Molecular devices that exhibit similar respons-
es to different stimuli are unique and attractive candidates
for new types of molecular tools. Furthermore, the develop-
ment of various types of BA-BNAs, in which each responds
to a different stimulus, could be easily designed and simply
achieved by altering the type of aryl moiety in the bridged
structure.
Compound 4: Under an N2 atmosphere, a solution of 4-nitrobenzalde-
hyde (4.3 g, 28 mmol) in anhydrous HFIP (12 mL) and zinc chloride
(130 mg, 0.94 mmol) were added to 1 (500 mg, 0.94 mmol) and the resul-
tant mixture was stirred at room temperature for 18 h. After the addition
of a saturated aqueous solution of NaHCO3 at 08C, the reaction mixture
was diluted with AcOEt, washed with water and brine, dried over
Na2SO4, and concentrated. The crude product was purified by column
chromatography (n-hexane/AcOEt 9/1!7/3) to give 4 as a yellow foam
(370 mg, 60%). M.p. 118–1208C; [a]2D3 =ꢀ5.4 (c=1.00 in CHCl3);
1H NMR (400 MHz, CDCl3): d=9.27 (brs, 1H; N3-H), 8.21 (t, J=8 Hz,
2H; Ar-H), 7.69 (t, J=8 Hz, 2H; Ar-H), 7.54 (s, 1H; H6), 6.27 (s, 1H;
Conclusion
We have synthesized BA-BNAs with a cleavable 2’,4’-
bridged structure containing an aryl moiety. Each BA-BNA
responds orthogonally to a specific external stimulus. The
bridged structures of 6-NVB and 2-NBB were cleaved by
7924
www.chemeurj.org
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 7918 – 7926

Benzylidene Acetal Type Bridged Nucleic Acids
FULL PAPER
acetal-H), 6.14 (s, 1H; H1’), 4.67 (d, J=6 Hz, 1H; H3’), 4.42 (d, J=6 Hz,
1H; H2’), 4.06 (d, J=13 Hz, 1H; H5’), 3.93 (d, J=13 Hz, 1H; H1“), 3.80
(d, J=13 Hz, 1H; H1”), 3.69 (d, J=13 Hz, 1H; H5’), 1.91 (s, 3H; CH3),
1.12–1.07 ppm (m, 28H; TIPDS-H); 13C NMR (100.5 MHz, CDCl3): d=
163.6, 149.7, 148.1, 145.5, 135.1, 127.3, 123.5, 110.3, 102.2, 92.4, 88.9, 79.3,
77.2, 70.8, 68.7, 60.1, 17.3, 17.3, 17.2, 17.2, 17.1, 17.1, 16.9, 13.4, 12.7, 12.6,
12.4 ppm; IR (KBr): n˜max =1347, 1525, 1695, 2946 cmꢀ1; MS (FAB): m/z:
664 [M+H]+; HRMS (FAB): m/z calcd for C30H46N3O10Si2 [M+H]+:
664.2722; found: 664.2712.
[a]2D6 =+7.80 (c=1.00 in MeOH); 1H NMR (270 MHz, CDCl3): d=8.52
(brs, 1H; N3-H), 7.52–6.83 (m, 19H), 6.27 (s, 1H; acetal-H), 6.23 (s, 1H;
H1’), 4.79 (dd, J=4, 6 Hz, 1H; H3’), 4.50 (d, J=6 Hz, 1H; H2’), 3.97 (d,
J=13 Hz, 1H; H1“), 3.87 (d, J=13 Hz, 1H; H1”), 3.79 (s, 6H; OCH3 ꢂ
2), 3.43 (d, J=11 Hz, 1H; H5’), 3.34 (d, J=11 Hz, 1H; H5’), 2.77 (d, J=
4 Hz, 1H; OH), 1.64 ppm (s, 3H; CH3); 13C NMR (67.8 MHz, CDCl3):
d=164.3, 158.6, 150.0, 144.2, 139.3, 136.3, 135.3, 135.2, 130.0, 128.8, 128.3,
128.0, 127.1, 126.1, 113.3, 110.3, 103.8, 92.6, 88.3, 86.7, 79.1, 71.1, 69.9,
62.3, 60.4, 55.2, 21.0, 14.1, 12.1 ppm; IR (KBr): n˜max =1252, 1691, 2930,
3062, 3382 cmꢀ1; MS (FAB): m/z: 701 [M+Na]+; HRMS (FAB): m/z
calcd for C39H39N2O9 [M+H]+: 679.2656; found: 679.2692.
Compound 5: TBAF (1.0m in THF, 1.2 mL, 1.2 mmol) was added to a so-
lution of 2 (370 mg, 0.60 mmol) in THF (17 mL) at 08C and the mixture
was stirred at 08C for 1 h. The reaction mixture was concentrated and
the crude product was purified by column chromatography (AcOEt/
MeOH 30/1) to give 5 as a white powder (220 mg, 87%). M.p. 153–
1568C; [a]2D7 =ꢀ59.9 (c=1.00 in MeOH); 1H NMR (270 MHz, CD3OD):
d=8.04 (d, J=8 Hz, 1H; Ar-H), 8.02 (d, J=1 Hz, 1H; H6), 7.86 (dd, J=
1, 8 Hz, 1H; Ar-H), 7.70 (dt, J=1, 8 Hz, 1H; Ar-H), 7.56 (dt, J=1, 8 Hz,
1H; Ar-H), 6.91 (s, 1H; acetal-H), 6.14 (s, 1H; H1’), 4.60 (d, J=6 Hz,
1H; H3’), 4.37 (d, J=6 Hz, 1H; H2’), 3.95 (d, J=12 Hz, 1H; H1“), 3.76
(d, J=12 Hz, 1H; H1”), 3.72 (d, J=12 Hz, 1H; H5’), 3.70 (d, J=12 Hz,
1H; H5’), 1.87 ppm (d, J=1 Hz, 3H; CH3); 13C NMR (75.5 MHz,
CD3OD): d=166.5, 152.2, 150.0, 137.7, 135.0, 133.8, 130.6, 128.9, 125.0,
Compound 10: Under an N2 atmosphere, DMTrCl (150 mg, 0.45 mmol)
was added to a solution of 7 (140 mg, 0.34 mmol) in anhydrous pyridine
(9 mL) and the resultant mixture was stirred at room temperature for
21 h. After the addition of a saturated aqueous solution of NaHCO3, the
reaction mixture was diluted with AcOEt, washed with water and brine,
dried over Na2SO4, and concentrated. The crude product was purified by
column chromatography (0.5% triethylamine in n-hexane/AcOEt=1/1)
to give 10 as a yellow foam (180 mg, 74%). M.p. 160–1628C; [a]2D4 =+5.2
1
(c=1.00 in CHCl3); H NMR (400 MHz, CDCl3): d=9.70 (s, 1H; N3-H),
8.06 (d, J=8 Hz, 2H; Ar-H), 7.55 (d, J=8 Hz, 2H; Ar-H), 7.37–7.12 (m,
9H), 6.74 (d, J=8 Hz, 4H; Ar-H), 6.24 (s, 1H; acetal-H), 6.03 (s, 1H;
H1’), 4.76 (s, 1H; H3’), 4.45 (d, J=6 Hz, 1H; H2’), 3.88 (s, 2H; H1“),
3.67 (s, 6H; OCH3 ꢂ2), 3.32 (t, J=12 Hz, 2H; H5’), 2.15 (s, 1H; OH),
1.45 ppm (s, 3H; CH3); 13C NMR (100.5 MHz, CDCl3): d=164.5, 158.6,
150.1, 147.9, 145.8, 144.2, 136.3, 135.2, 135.0, 130.0, 127.98, 128.01, 127.3,
127.1, 123.5, 113.3, 110.4, 102.0, 93.5, 88.4, 86.8, 79.3, 77.2, 71.3, 69.9, 62.2,
55.2, 12.1 ppm; IR (KBr): n˜max =1348, 1511, 1691, 3211 cmꢀ1; MS (FAB):
m/z: 746 [M+Na]+; HRMS (FAB): m/z calcd for C39H37N3NaO11
[M+Na]+: 746.2326; found: 746.2312.
110.8, 99.2, 93.1, 90.6, 81.4, 72.0, 69.1, 60.8, 12.5 ppm; IR (KBr): n˜max
=
1272, 1356, 1471, 1528, 1692, 3378 cmꢀ1; MS (FAB): m/z: 422 [M+H]+;
HRMS (FAB): m/z calcd for C18H20N3O9 [M+H]+: 422.1220; found:
422.1171.
Compound 7: TBAF (1.0m in THF, 0.96 mL, 0.96 mmol) was added to a
solution of 4 (320 mg, 0.48 mmol) in THF (12 mL) at 08C and the resul-
tant mixture was stirred at 08C for 1 h. The reaction mixture was concen-
trated and the crude product was purified by column chromatography
(AcOEt/MeOH 30/1) to give 7 as a yellow powder (160 mg, 81%). M.p.
164–1678C; [a]2D4 =+59.9 (c=1.00 in MeOH); 1H NMR (400 MHz,
CD3OD): d=8.24 (d, J=8 Hz, 2H; Ar-H), 7.97 (s, 1H; H6), 7.76 (d, J=
8 Hz, 2H; Ar-H), 6.46 (s, 1H; acetal-H), 6.21 (s, 1H; H1’), 4.62 (d, J=
6 Hz, 1H; H3’), 4.35 (d, J=6 Hz, 1H; H2’), 4.02 (d, J=12 Hz, 1H; H1“),
3.85 (d, J=12 Hz, 1H; H1”), 3.78 (d, J=12 Hz, 1H; H5’), 3.71 (d, J=
12 Hz, 1H; H5’), 1.88 ppm (s, 3H; CH3); 13C NMR (100.5 MHz,
CD3OD): d=166.5, 152.2, 149.4, 148.0, 137.8, 128.6, 124.3, 110.8, 103.0,
93.1, 90.6, 81.4, 71.9, 69.2, 60.9, 12.6 ppm; IR (KBr): n˜max =1349, 1522,
1693, 3396 cmꢀ1; MS (FAB): m/z: 422 [M+H]+; HRMS (FAB): m/z calcd
for C18H20N3O9 [M+H]+: 422.1220; found: 422.1171.
Compound 11: Under an N2 atmosphere, 2-cyanoethyl-N,N,N’,N’-tetraiso-
propylphosphane (0.29 mL, 0.90 mmol) and 4,5-dicyanoimidazole (0.25m
in CH3CN, 1.3 mL, 0.33 mmol) were added to a solution of 8 (220 mg,
0.30 mmol) in anhydrous CH3CN (4 mL) and the resultant mixture was
stirred at room temperature for 17 h. After the addition of a saturated
aqueous solution of NaHCO3, the reaction mixture was diluted with
AcOEt, washed with water and brine, dried over Na2SO4, and concen-
trated. The crude was purified by column chromatography (0.5% tri-
AHCTUNGERTGeNNUN thylamine in n-hexane/AcOEt 1/1) followed by the precipitation from
n-hexane/AcOEt to give 11 as a white foam (102 mg, 37%). M.p. 113–
1178C; 31P NMR (202 MHz, CDCl3): d=150.7, 150.2 ppm; MS (FAB):
m/z: 924 [M+H]+; HRMS (FAB): m/z calcd for C48H55N5O12P [M+H]+:
924.3585; found: 924.3575.
Compound 8: Under an N2 atmosphere, DMTrCl (200 mg, 0.58 mmol)
was added to a solution of 5 (190 mg, 0.44 mmol) in anhydrous pyridine
(11 mL) and the resultant mixture was stirred at room temperature for
15 h. After the addition of a saturated aqueous solution of NaHCO3, the
reaction mixture was diluted with AcOEt, washed with water and brine,
dried over Na2SO4, and concentrated. The crude was purified by column
chromatography (0.5% triethylamine in n-hexane/AcOEt 1/2) to give 8
as a white foam (250 mg, 79%). M.p. 140–1428C; [a]2D6 =ꢀ24.0 (c=1.00
Compound 12: Under an N2 atmosphere, 2-cyanoethyl-N,N,N’,N’-tetraiso-
propylphosphane (0.35 mL, 1.1 mmol) and 4,5-dicyanoimidazole (0.25m
in CH3CN, 1.6 mL, 0.40 mmol) were added to a solution of 9 (250 mg,
0.36 mmol) in anhydrous CH3CN (5 mL) and the resultant mixture was
stirred at room temperature for 40 h. After the addition of a saturated
aqueous solution of NaHCO3, the reaction mixture was diluted with
AcOEt, washed with water and brine, dried over Na2SO4, and concen-
trated. The crude was purified by column chromatography (0.5% tri-
1
in MeOH); H NMR (270 MHz, CDCl3): d=9.27 (s, 1H; N3-H), 7.97 (d,
J=8 Hz, 1H; Ar-H), 7.76 (d, J=8 Hz, 1H; Ar-H), 7.54 (t, J=8 Hz, 1H;
Ar-H), 7.47–6.76 (m, 15H), 6.10 (s, 1H; H1’), 4.74 (t, J=5 Hz, 1H; H3’),
4.46 (d, J=6 Hz, 1H; H2’), 3.93 (d, J=13 Hz, 1H), 3.79–3.72 (m, 2H),
3.72 (s, 6H; OCH3 ꢂ2), 3.36–3.26 (m, 3H), 1.47 ppm (s, 3H; CH3);
13C NMR (67.8 MHz, CDCl3): d=163.7, 158.2, 149.6, 147.4, 143.7, 135.1,
134.7, 134.6, 133.2, 132.8, 129.5, 128.9, 127.6, 127.5, 126.7, 123.6, 112.9,
109.9, 98.0, 92.2, 88.1, 86.4, 79.1, 70.9, 69.1, 61.4, 54.7, 11.7 ppm; IR
(KBr): n˜max =1252, 1693, 3008 cmꢀ1; MS (FAB): m/z: 746 [M+Na]+;
HRMS (FAB): m/z calcd for C39H37N3NaO11 [M+Na]+: 746.2326; found:
746.2325.
AHCTUNGERTGeNNUN thylamine in n-hexane/AcOEt 1/1) followed by precipitation from n-
hexane/AcOEt to give 12 as a white foam (220 mg, 68%). M.p. 116–
1188C; 31P NMR (202 MHz, CDCl3): d=151.2, 150.5 ppm; MS (FAB):
m/z: 879 [M+H]+; HRMS (FAB): m/z calcd for C48H56N4O10P [M+H]+:
879.3734; found: 879.3712.
Compound 13: Under an N2 atmosphere, 2-cyanoethyl-N,N,N’,N’-tetraiso-
propylphosphane (0.16 mL, 0.51 mmol) and 4,5-dicyanoimidazole (0.25m
in CH3CN, 0.80 mL, 0.20 mmol) were added to a solution of 8 (130 mg,
0.17 mmol) in anhydrous CH3CN (3 mL) and the resultant mixture was
stirred at room temperature for 15 h. After the addition of a saturated
aqueous solution of NaHCO3, the reaction mixture was diluted with
AcOEt, washed with water and brine, dried over Na2SO4, and concen-
trated. The crude product was purified by column chromatography
(0.5% triethylamine in n-hexane/AcOEt 1/1) followed by precipitation
from n-hexane/AcOEt to give 13 as a white foam (120 mg, 77%). M.p.
109–1118C; 31P NMR (161.8 MHz, CDCl3): d=151.2, 150.6 ppm; MS
Compound 9: Under an N2 atmosphere, DMTrCl (150 mg, 0.45 mmol)
was added to a solution of 6[15] (130 mg, 0.35 mmol) in anhydrous pyri-
dine (9 mL) and the resultant mixture was stirred at room temperature
for 11 h. After the addition of a saturated aqueous solution of NaHCO3,
the reaction mixture was diluted with AcOEt, washed with water and
brine, dried over Na2SO4, and concentrated. The crude product was puri-
fied by column chromatography (0.5% triethylamine in n-hexane/AcOEt
1/1!1/2) to give 9 as a white foam (200 mg, 84%). M.p. 165–1688C;
Chem. Eur. J. 2011, 17, 7918 – 7926
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
7925

S. Obika et al.
(FAB): m/z: 924 [M+H]+; HRMS (FAB): m/z calcd for C48H55N5O12P
[M+H]+: 924.3585; found: 924.3585.
[17] A. Bendich, L. J. Machlin, O. Scandura, G. W. Burton, D. D. M.
Wayner, Adv. Free. Radical Biol. Med. 1986, 2, 419–444.
[18] E. S. Krol, J. L. Bolton, Chem.-Biol. Interact. 1997, 104, 11–27.
[19] W. W. Cleland, Biochemistry 1964, 3, 480–482.
[20] W. Guoyao, Y-Z. Fang, S. Yang, J. R. Lupton, N. D. Turner, J. Nutr.
2004, 134, 489–492.
[21] M. J. Matteucci, W. J. Reed, D. A. Tanen, Acad. Emeerg. Med. 2003,
10, 299–302.
[22] K. K. Park, C. H. Oh, W. K. Joung, Tetrahedron Lett. 1993, 34,
7445–7446.
[23] M. Sekine, Y. Oeda, Y. Iijima, H. Taguchi, A. Ohkubo, K. Seio, Org.
Biomol. Chem. 2011, 9, 210–218.
[24] a) A. Patchornik, B. Amit, R. B. Woodward, J. Am. Chem. Soc.
1970, 92, 6333–6335; b) B. Amit, U. Zehavi, A. Patchornik, J. Org.
Chem. 1974, 39, 192–196.
[25] a) J. A. Barltrop, P. J. Plant, P. Schofield, Chem. Commun. (London)
1966, 822–823; b) Y. V. Ilꢀichev, M. A. Schwçrer, J. Wirz, J. Am.
Chem. Soc. 2004, 126, 4581–4595.
Acknowledgements
This work was supported in part by a Grant-in Aid for Science Research
from the Japan Society for the Promotion of Science (JSPS) and the Min-
istry of Education, Culture Sports, Science and Technology (MEXT),
Japan, the Program for Promotion of Fundamental Studies in Health Sci-
ences of the National Institute of Biomedical Innovation (NIBIO), and a
Grant for Industrial Technology Research from the New Energy and In-
dustrial Technology Development Organization (NEDO) of Japan. K.M.
is grateful for a Research Fellowship from the Japan Society for the Pro-
motion of Science (JSPS) for Young Scientists.
[26] V. N. R. Pillai, Synthesis 1980, 1–26.
[1] a) C. Hꢃlꢄne, J. J. Toulmꢃ, Biochim. Biophys. Acta Gene Struct. Ex-
pression. 1990, 1049, 99–125; b) E. Uhlmann, A. Peyman, Chem.
Rev. 1990, 90, 543–584; c) L. J. Maher III, Cancer Invest. 1996, 14,
66–82; d) G. J. Hannon, Nature 2002, 418, 244–251.
[2] a) S. A. E. Marras, S. Tyagi, F. R. Kramer, Clin. Chim. Acta 2006,
363, 48–60; b) M. Famulok, J. S. Hartig, G. Mayer, Chem. Rev. 2007,
107, 3715–3743.
[3] a) D. Sen, C. R. Geyer, Curr. Opin. Chem. Biol. 1998, 2, 680–687;
b) L. Q. Sun, M. J. Cairns, E. G. Saravolac, A. Baker, W. L. Gerlach,
Phamacol. Rev. 2000, 52, 325–347.
[4] a) S. Jꢅger, G. Rasched, H. Kornreich-Leshem, M. Engeser, O.
Thum, M. Famulok, J. Am. Chem. Soc. 2005, 127, 15071–15081;
b) F. E. Alemdaroglu, A. Herrmann, Org. Biomol. Chem. 2007, 5,
1311–1320.
[5] a) G. Mayer, A. Heckel, Angew. Chem. 2006, 118, 5020–5042;
Angew. Chem. Int. Ed. 2006, 45, 4900–4921; b) X. Tang, I. J. Dmo-
chowski, Mol. Biosyst. 2007, 3, 100–110; c) D. D. Young, A. Deiters,
Org. Biomol. Chem. 2007, 5, 999–1005; d) J. P. Casey, R. A. Bildner,
W. T. Monroe, Mol. Pharm. 2009, 6, 669–685; e) H. M. Lee, D. R.
Larson, D. S. Lawrence, ACS Chem. Biol. 2009, 4, 409–427; f) H.
Yu, J. Li, D. Wu, Z. Qiu, Y. Zhang, Chem. Soc. Rev. 2010, 39, 464–
473.
[6] a) T. Ohmichi, Y. Kawamoto, P. Wu, D. Miyoshi, H. Karimata, N.
Sugimoto, Biochemistry 2005, 44, 7125–7130; b) J. A. Lee, M. C.
DeRosa, Chem. Commun. 2010, 46, 418–420.
[7] R. Tashiro, H. Sugiyama, J. Am. Chem. Soc. 2005, 127, 2094–2097.
[8] A. Hatano, S. Makita, M. Kirihara, Tetrahedron 2005, 61, 1723–
1730.
[27] P. G. W. Wuts, T. W. Greene, Greeneꢀs Protective Groups in Organic
Synthesis, 4th ed., Wiley, New York, 2006, pp. 322–323.
[28] a) M. O. Terpko, R. F. Heck, J. Org. Chem. 1980, 45, 4992–4993;
b) K. Mukkanti, Y. V. S. Rao, B. M. Choudary, Tetrahedron Lett.
1989, 30, 251–252; c) C. Bourget, E. Trevisiol, I. Bridon, M. Kotera,
J. Lhomme, A. Laayoun, Bioorg. Med. Chem. 2005, 13, 1453–8176.
[29] a) K. Morita, M. Takagi, C. Hasegawa, M. Kaneko, S. Tsutsumi, J.
Sone, T. Ishikawa, T. Imanishi, M. Koizumi, Bioorg. Med. Chem.
2003, 11, 2211–2226; b) Y. Hari, S. Obika, R. Ohnishi, K. Eguchi, T.
Osaki, H. Ohishi, T. Imanishi, Bioorg. Med. Chem. 2006, 14, 1029–
1038; c) Y. Mitsuoka, T. Kodama, R. Ohnishi, Y. Hari, T. Imanishi,
S. Obika, Nucleic Acids Res. 2009, 37, 1225–1238; d) M. Nishida, T.
Baba, T. Kodama, A. Yahara, T. Imanishi, S. Obika, Chem.
Commun. 2010, 46, 5283–5285.
[30] a) C. Altona, M. Sundaralingam, J. Am. Chem. Soc. 1972, 94, 8205–
8212; b) S. Arnott, D. W. L. Hukins, S. D. Dover, Biochem. Biophys.
Res. Commun. 1972, 48, 1392–1399.
[31] T. Wu, K. Nauwelaerts, A. Vam Aerschot, M. Froeyen, E. Lescrini-
er, P. Herdewijn, J. Org. Chem. 2006, 71, 5423–5431.
[32] a) J. J. Sørensen, J. T. Nielsen, M. Petersen, Nucleic Acids Res. 2004,
32, 6078–6085; b) S. M. A. Rahman, S. Seki, S. Obika, H. Yoshika-
wa, K. Miyashita, T. Imanishi, J. Am. Chem. Soc. 2008, 130, 4886–
4896; c) J. Xu, Y. Liu, C. Dupouy, J. Chattopadhyaya, J. Org. Chem.
2009, 74, 6534–6554; d) C. Zhou, J. Chattopadhyaya, J. Org. Chem.
2010, 75, 2341–2349.
[33] a) A. Meister, M. E. Anderson, Annu. Rev. Biochem. 1983, 52, 711–
760; b) R. R. Perry, J. Mazetta, M. Levin, S. C. Barranco, Cancer
1993, 72, 783–787; c) S. C. Barranco, R. R. Perry, M. E. Duem, M.
Quraishi, A. L. Werner, S. G. Gregorcyk, P. Kolm, Dis. Colon
Rectum 2000, 43, 1133–1140.
[9] T. Wada, N. Minamimoto, Y. Inaki, Y. Inoue, J. Am. Chem. Soc.
2000, 122, 6900–6910.
[10] a) S. Obika, D. Nanbu, Y. Hari, K. Morio, Y. In, T. Ishida, T. Ima-
nishi, Tetrahedron Lett. 1997, 38, 8735–8738; b) S. K. Singh, P. Niel-
sen, A. Koshkin, J. Wengel, Chem. Commun. 1998, 455–456.
[11] S. Obika, D. Nanbu, Y. Hari, J. Ando, K. Morio, T. Doi, T. Imanishi,
Tetrahedron Lett. 1998, 39, 5401–5404.
[34] a) D. F. Bainton, J. Cell Biol. 1981, 91, 66s-76s; b) V. M. Arlt, H. G.
Glatt, E. Muckel, U. Pabel, B. L. Sorg, A. Seidel, H. Frank, H. H.
Schmeiser, D. H. Phillips, Int. J. Cancer 2003, 105, 583–592; c) Y.
Chen, L. Hu, Med. Res. Rev. 2009, 29, 29–64.
[35] L. Krçck, A. Heckel, Angew. Chem. 2005, 117, 475–477; Angew.
Chem. Int. Ed. 2005, 44, 471–473.
[12] S. Obika, Y. Hari, T. Sugimoto, M. Sekiguchi, T. Imanishi, Tetrahe-
dron Lett. 2000, 41, 8923–8927.
[36] H. Asanuma, T. Ito, T. Yoshida, X. G. Liang, M. Komiyama, Angew.
Chem. 1999, 111, 2547–2549; Angew. Chem. Int. Ed. 1999, 38, 2393–
2395.
[37] E. Yashima, K. Maeda, Y. Okamoto, Nature 1999, 399, 449–451.
[38] S. G. Chaulk, A. M. MacMillan, Nucleic Acids Res. 1998, 26, 3173–
3178.
[13] a) K. Morihiro, T. Kodama, M. Nishida, T. Imanishi, S. Obika,
ChemBioChem 2009, 10, 1784–1788; b) K. Morihiro, T. Kodama, M.
Nishida, T. Imanishi, S. Obika, Nucleic Acids Symp. Ser. 2009, 53,
187–188.
[14] K. D. Nielsen, F. Kirpekar, P. Roepstorff, J. Wengel, Bioorg. Med.
Chem. 1995, 3, 1493–1502.
[39] P. Ordoukhanian, J.-S. Taylor, J. Am. Chem. Soc. 1995, 117, 9570–
9571.
[15] We previously reported the syntheses of compound 3 and 6 in the
following manuscript: Y. Kasahara, S. Kitadume, K. Morihiro, M.
Kuwahara, H. Ozaki, H. Sawai, T. Imanishi, S. Obika, Bioorg. Med.
Chem. Lett. 2010, 20, 1626–1629.
[16] R. Buff, H. S. Evans, J. Hunziker, Acta Crystallogr. Sect. C 1998, 54,
1860–1862.
Received: February 18, 2011
Published online: June 3, 2011
7926
www.chemeurj.org
ꢁ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 7918 – 7926