Discovery of the first-in-class dual PPARδ/γ partial agonist for the treatment of metabolic syndrome

Article abstract of DOI:10.1016/j.ejmech.2021.113807

The peroxisome proliferator-activated receptors (PPARs) exert vital function in the regulation of energy metabolism, which were considered as promising targets of metabolic syndrome. Until now, PPARδ/γ dual agonist is rarely reported, and thereby the pharmacologic action of PPARδ/γ dual agonist is still unclear. In this study, we identified a dual PPARδ/γ partial agonist 6 (ZLY06) based on the cyclization strategy of PPARα/δ dual agonist GFT505. ZLY06 revealed excellent pharmacokinetic profiles suitable for oral medication. Moreover, ZLY06 markedly improved glucolipid metabolism without weight gain, and alleviated fatty liver by promoting the β-oxidation of fatty acid and inhibiting hepatic lipogenesis. In contrast, weight gain and hepatic steatosis were observed in Rosiglitazone, a widely used PPARγ full agonist. All of these results indicated that ZLY06 exhibits potential benefits on metabolic syndrome, while no adverse effects related to PPARγ full agonist.

Full text of DOI:10.1016/j.ejmech.2021.113807

European Journal of Medicinal Chemistry 225 (2021) 113807
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Discovery of the first-in-class dual PPARd/g partial agonist for the
treatment of metabolic syndrome
,
b
,
, b,
Zheng Li a *, Qiang Ren a c, Zongtao Zhou a, Zongyu Cai a, Bin Wang a, Jing Han d,
Luyong Zhang a
, b, c, e, **
a School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou, 510006, PR China
b Key Laboratory of New Drug Discovery and Evaluation of Ordinary Universities of Guangdong Province, Guangdong Pharmaceutical University,
Guangzhou, 510006, PR China
c Guangzhou Key Laboratory of Construction and Application of New Drug Screening Model Systems, Guangdong Pharmaceutical University, Guangzhou,
510006, PR China
d School of Chemistry and Chemical Engineering, Jiangsu Key Laboratory of Green Synthetic Chemistry for Functional Materials, Jiangsu Normal University,
Xuzhou, 221116, PR China
e Jiangsu Key Laboratory of Drug Screening, China Pharmaceutical University, Nanjing, 210009, PR China
a r t i c l e i n f o
a b s t r a c t
Article history:
The peroxisome proliferator-activated receptors (PPARs) exert vital function in the regulation of energy
Received 9 July 2021
Received in revised form
24 August 2021
metabolism, which were considered as promising targets of metabolic syndrome. Until now, PPAR
dual agonist is rarely reported, and thereby the pharmacologic action of PPAR dual agonist is still
unclear. In this study, we identified a dual PPAR partial agonist 6 (ZLY06) based on the cyclization
strategy of PPAR dual agonist GFT505. ZLY06 revealed excellent pharmacokinetic profiles suitable for
oral medication. Moreover, ZLY06 markedly improved glucolipid metabolism without weight gain, and
alleviated fatty liver by promoting the -oxidation of fatty acid and inhibiting hepatic lipogenesis. In
contrast, weight gain and hepatic steatosis were observed in Rosiglitazone, a widely used PPAR full
agonist. All of these results indicated that ZLY06 exhibits potential benefits on metabolic syndrome,
while no adverse effects related to PPAR full agonist.
d/g
d/g
d/g
Accepted 24 August 2021
a/d
Keywords:
Diabetes
PPAR
Metabolic syndrome
Insulin resistance
Fatty liver
b
g
g
© 2021 Elsevier Masson SAS. All rights reserved.
1. Introduction
PPAR
improves energy metabolism by up-regulating GLP-1 receptor [12].
PPAR could improve insulin resistance and lipid metabolism by
up-regulating fatty acid transport [13]. Currently, many synthetic
PPARs agonists, especially for dual or pan PPARs agonists, are in
clinical studies of metabolic syndrome, such as dyslipidaemia, fatty
liver and type 2 diabetes [14e16]. There are many multiple agonists
such as PPARa/d (GFT505), PPARa/g (Saroglitazar), and PPARa/d/g
pan agonists (Lanifibranor) have been identified (Fig. 1) [17]. Our
previous studies have also identified several PPAR agonists [18e21].
d restores function of impaired pancreatic b cells [11], and
Metabolic syndrome affects around 25% of adults worldwide,
which including obesity, hyperlipemia, diabetes and fatty liver [1,2].
With the change of lifestyle, the prevalence of metabolic syndrome
is increasing and becoming major health burden in the world [3].
Therefore, the development of novel drugs of metabolic syndrome
with better efficacy and safety are urgently needed [4]. The
peroxisome proliferator-activated receptors (PPARs) exert vital
g
function in the regulation of energy metabolism [5e7]. PPARa,
PPAR
PPAR
b
a
/
d
, and PPAR
or PPAR improves glucose and lipid metabolism by up-
-oxidation [8e10]. Moreover,
g
are three isoforms of PPARs. The activation of
However, PPAR
pharmacologic action of PPAR
GFT505 (Elafibranor) is a PPARa/d
d
/
g
dual agonist is rarely reported, and thereby the
dual agonist is still unclear.
dual agonist (Fig. 1) in Phase
d
d/g
regulating genes of fatty acid
b
III of fatty liver, which exerts multiple benefits in serum lipid, in-
sulin resistance, and hepatoprotective effects [22e24]. Using
GFT505 as lead compound, conformational restriction was intro-
* Corresponding author. School of Pharmacy, Guangdong Pharmaceutical Uni-
versity, Guangzhou, 510006, PR China.
** Corresponding author. School of Pharmacy, Guangdong Pharmaceutical Uni-
versity, Guangzhou, 510006, PR China.
duced in the
Moreover, the easily oxidized methylthioyl group was replaced by a
more stable alkoxy. Unexpectedly, the first-in-class PPAR dual
a,b-unsaturated ketone scaffold by cyclization (Fig. 2).
d/g
E-mail addresses: li.zheng.sky@163.com (Z. Li), lyzhang@cpu.edu.cn (L. Zhang).
https://doi.org/10.1016/j.ejmech.2021.113807
0223-5234/© 2021 Elsevier Masson SAS. All rights reserved.

Z. Li, Q. Ren, Z. Zhou et al.
European Journal of Medicinal Chemistry 225 (2021) 113807
Fig. 1. Structure of representative PPARa, PPARg and PPARd agonists.
Fig. 2. Our design strategy on structural optimization of GFT505, which resulted in the unexpected discoveries of the first-in-class PPAR d/g dual agonist 6 (ZLY06).
partial agonists have been identified based on our design strategy
of conformational restriction. Notably, currently available PPAR
full agonists such as Rosiglitazone have side effects including he-
Williamson ether synthesis supplied intermediates 2a-g, which
were converted into aurones 4a-g exclusively in Z-configuration
under alkali conditions [27]. Alkylation of 4a-g with methyl chlor-
oacetate or methyl 2-bromo-2-methylpropanoate by using potas-
sium carbonate as acid binding agent, followed by hydrolysis under
basic condition, received compounds 1e12.
g
patic steatosis, fluid retention, weight gain, and cardiovascular risk.
In contrast, PPAR
bolic syndrome, while no or less incidence of these adverse effects
related to PPAR full agonists [25,26]. Indeed, the optimal PPARd/g
g partial agonists have similar benefits on meta-
g
dual partial agonist 6 (ZLY06) exhibits significant improvement on
glucose and lipid metabolism without weight gain and hepatic
steatosis observed in Rosiglitazone group. Herein, the structure-
activity relationship (SAR) of the present series, molecular
modeling, pharmacokinetic profiles and pharmacologic action were
described.
2.2. SAR study
The synthetic compounds were evaluated by using cell-based
assays. For PPARa, d, and g potencies, the references were
GW7647, GW0742, and Rosiglitazone, respectively. As shown in
Table 1, replacing chalcone of GFT505 with aurone scaffold led to
compound 1, which revealed reduced potency on PPAR
improving activity on PPAR . Interestingly, ethyoxyl analog 2
revealed significantly increased potencies on PPAR and further
decreased activity on PPAR compared to compound 1, and thereby
exhibited a better selectivity against PPAR . Based on this positive
a, while
2. Results and discussion
g
d/g
2.1. Chemistry
a
a
Compounds 1e12 were obtained as described in Scheme 1.
Alkylation of 1a with alkyl halide under the standard method of
result, a series of alkoxy (compounds 3e7) were introduced to
explore the tolerability of substituents in this area. Incorporation of
Scheme 1. Reagents and conditions: (a) Alkyl halide, K2CO3, acetonitrile, KI, 45 ꢀC, 12 h; (b) DMF, EtOH, KOH, r.t., 38%e48%; (c) Methyl chloroacetate or methyl 2-bromo-2-
methylpropanoate, K2CO3, acetonitrile, KI, 45 ꢀC, 12 h, and then LiOH$H2O, THF/MeOH/H2O, r.t., 4 h, 38%e65%.
2

Z. Li, Q. Ren, Z. Zhou et al.
European Journal of Medicinal Chemistry 225 (2021) 113807
Table 1
Activities on PPARa/d/g.
Compd.
R1
R2
EC50 (nM)
hPPAR
(max%)a
a
hPPAR
g
(max%)
hPPARd (max%)
GW7647
Rosiglitazone
GW0742
9 (100%)
ND
ND
ND
156 (100%)
ND
ND
ND
18 (100%)
249 (81%)
913 (42%)
372 (58%)
539 (60%)
413 (60%)
652 (65%)
GFT505
375 (89%)
3962 (95%)
634 (61%)
285 (68%)
412 (64%)
335 (55%)
503 (59%)
1
2
3
4
5
Me
Et
n-Pr
n-Bu
Me
Me
Me
Me
Me
3680 (18%)
4635 (14%)
6914 (19%)
5024 (24%)
5316 (26%)
6 (ZLY06)
7
Me
Me
5793 (23%)
7725 (12%)
237 (70%)
764 (57%)
341 (68%)
958 (53%)
8
9
10
11
Me
Et
n-Pr
H
H
H
H
>10,000
>10,000
>10,000
>10,000
1579 (25%)
1323 (30%)
3962 (30%)
1745 (29%)
3217 (18%)
2203 (24%)
3512 (27%)
2679 (26%)
12
H
>10,000
1063 (35%)
1523 (32%)
b ND: no data.
a
EC50 value represents the mean of three determinations, max% is the maximal agonist activity of tested compound compared with positive control GW7647, Rosiglitazone,
and GW0742, respectively. The max% of positive control GW7647, Rosiglitazone, and GW0742 are set as 100%.
branched alkanes (5 and 7) resulted in reduced potency compared
to that of straight-chain alkanes (3 and 4). Interestingly, the
cyclopropyl methyl analog 6 (ZLY06) revealed best balance of ac-
However, the overly rigid conformation of compound 6 did not
match with the “U”-shaped pocket of PPAR , rationally explained
that the high selectivity against PPAR . In contrast, dual agonist 6
matched well with binding cavity of PPAR and PPAR (Fig. 3). For
PPAR (Fig. 3A), phenoxyacetic acid of 6 generated four hydrogen
bonds with amino acid His449, Tyr473 and His323. Besides,
cyclopropyl methyl group is inserted into a small hydrophobic
cavity, and oxygen atom formed hydrogen bond with Thr288. The
a
a
tivities on PPAR
More importantly, the partial activities of compound 6 (68% for
PPAR , 70% for PPAR ) might reduce side effects induced by full
d/g
and best selectivity for PPAR
a
in this series.
d
g
d
d
g
agonist [25]. Further SAR study was also explore the phenoxyacetic
acid moiety (compounds 8e12), while their agonistic activities
were rather low, indicating the importance of methyl groups in
phenoxyacetic acid moiety for the activities of PPAR.
binding insight of 6 in PPARd is very close to that in PPARg (Fig. 3B),
phenoxyacetic acid of compound 6 formed strong interaction with
residues His449, Tyr473 and His323. Furthermore, two hydrogen
bonds were engendered between oxygen atom of cyclopropyl
methoxy and Arg288. Therefore, it can be seen that compound 6
2.3. Docking study
has good activity on both PPARd and PPARg, while exhibiting high
To elucidate the activity and selectivity of compound 6 on
selectivity against PPAR
a
.
different isoforms of PPAR, we carried out a docking study based on
X-ray structure of PPARa (3vi8), PPARd (1GWX) and PPARg (2Q8S).
Fig. 3. The binding model of compound 6 in PPAR
d
(A) and PPAR
g
(B). Key residues are labeled in black, and hydrogen bonds are represented by yellow dashed lines.
3

Z. Li, Q. Ren, Z. Zhou et al.
European Journal of Medicinal Chemistry 225 (2021) 113807
Table 2
Rats PK profile of compound 6.
Compound
Dose (po)a
3 mg/kg
CL (mL/h/kg)
21.05 6.38
Cmax
(
m
g/mL)
AUC0e24h
(
m
g/mL∙h)
T1/2 (h)
6
8.67 1.53
51.08 15.26
3.85 1.23
a
po ¼ oral administration. Results are expressed as mean SD for four rats.
2.4. Pharmacokinetic (PK) study
treatment, the non-fasting and fasting blood sugar were markedly
reduced after 5-day treatment of compound 6 (Fig. 5). Moreover,
HbA1c levels, the biomarker of chronic glycemic control, were also
markedly reduced in treated groups (Fig. 5F). The diabetic symp-
toms of polydipsia and polyphagia were dramatically relieved by
compound 6, while food consumption was significantly increased
in Rosiglitazone‒treated group. After long-term treatment, the
adverse effect of gain weight was observed in Rosiglitazone‒treated
group. Notably, there was no significant difference of body weight
between compound 6 and vehicle-treated groups, which might be
more beneficial for the treatment of metabolic syndrome compared
to Rosiglitazone (Fig. 5E).
To determine whether oral administration of compound 6 is
appropriate, PK parameters are evaluated in SD rats. As shown in
Table 2, compound 6 provided considerable PK profile with high
plasma exposure. Notably, the Cmax of compound 6 was 60-fold
higher than its EC50 values, which ensured sufficient concentra-
tion of compound 6 to activate PPARd and PPARg in vivo. Further-
more, compound 6 has low metabolic clearance and sustained half-
life suitable for oral medication.
2.5. Dose-response relationship in HF/STZ mice
After 30-day treatment, compound 6‒treated group signifi-
cantly reduced the blood lipid level in ob/ob mice, including total
cholesterol (TC), triglyceride (TG), and low-density lipoprotein
(LDL) (Fig. 6). Moreover, the hepatic levels of TG and TC were
markedly lower in compound 6‒treated group (Fig. 6E and F).
However, Rosiglitazone has no significant effect on plasma LDL,
hepatic triglyceride and cholesterol levels (Fig. 6).
The in vivo dose-response relationship of compound 6 was
evaluated in HF/STZ mice, a diabetic model with insulin deficiency
and resistance [28]. In this study, we expect to explore the advan-
tages of partial agonist 6 compared to the full agonist Rosiglitazone.
Therefore, Rosiglitazone was selected as positive control, while
GFT505 was not selected due to its quite different pharmacological
Fatty liver is a metabolic syndrome closely related to insulin
resistance, obesity, and diabetes. We evaluated whether the fatty
liver of ob/ob mice could be improved by compound 6. As shown in
mechanism (PPAR
a/d agonist) and structure type compared to
PPAR agonist 6. After 7-day treatment in HF/STZ model, com-
d/g
pound 6 improved glucose tolerance in a dose-response manner.
Moreover, the glucose-lowering effects of compound 6 (10 and
20 mg/kg) was equivalent to that of Rosiglitazone, and there was no
significant difference between these groups (Fig. 4). These results
indicated that the partial agonist may have a similar therapeutic
effect with full agonist. Moreover, the dose of 20 mg/kg was iden-
tified as a right dosage suitable for exploring long-term studies.
Fig. 7C, only
a slight improvement of hepatic steatosis in
Rosiglitazone-treated group. Notably, compound 6 distinctly alle-
viated the hepatic steatosis and ballooning (Fig. 7D), suggesting
that compound 6 improved fatty liver in vivo. In line with the his-
tological change, hepatic function index alanine aminotransferase
(ALT) and aspartate transaminase (AST) were markedly lowered in
compound 6-treated group, which was distinctly better than that of
Rosiglitazone (Fig. 7E). Indeed, PPARd agonist could decrease the
hepatic function index and steatosis [31]. Quantitative RT-PCR
2.6. Chronic effects on ob/ob mice
(Fig. 7F) showed that compound 6 significantly up-regulated
Based on the dose-response study in HF/STZ mice, we selected
the higher dose of compound 6 (20 mg/kg) in further study to
explore the safety advantages compared to full agonist Rosiglita-
zone at a lower dose of 10 mg/kg. A 30-day treatment of compound
6 was performed in ob/ob mice, a typical model of metabolic syn-
drome with obesity, fatty liver and diabetes [29,30]. During
genes related to PPAR
GK, and CD36). These results suggested that compound 6 exerts
therapeutic effects by activating PPAR and PPAR in vivo. The up-
regulation of these lipid metabolism-related genes also indicating
that the increased -oxidation of hepatic fatty acid might
d (HMGCS2 and PDK4), and PPARg (GLUT2,
d
g
b
Fig. 4. Dose-response relationship of compound 6 on plasma glucose levels (A) and corresponding AUC0e120min (B) after 7-day treatment in HF/STZ mice. Values are mean SD
(n ¼ 6). *p ꢁ 0.05 and **p ꢁ 0.01 were analyzed using a one-way ANOVA with Tukey's multiple-comparison post hoc test.
4

Z. Li, Q. Ren, Z. Zhou et al.
European Journal of Medicinal Chemistry 225 (2021) 113807
Fig. 5. The plasma glucose levels of non-fasting (A) and fasting (B), cumulative food (C) and water intake (D), body weight (E) and HbA1c (F) in ob/ob mice. Values are expressed as
mean SD (n ¼ 6). *p ꢁ 0.05 and **p ꢁ 0.01 compared to vehicle group by Student's t-test. #p ꢁ 0.05 were analyzed using a one-way ANOVA with Tukey's multiple-comparison post
hoc test.
Fig. 6. The plasma levels of TC (A), TG (B), HDL (C) and LDL (D), hepatic levels of TG (E) and TC (F) in ob/ob mice. Values are expressed as mean SD (n ¼ 6). *p ꢁ 0.05, **p ꢁ 0.01 and
***p ꢁ 0.001 were analyzed using a one-way ANOVA with Tukey's multiple-comparison post hoc test.
contributes to the improvement of hepatic steatosis. Moreover,
compound 6 significantly decreased the expressions of hepatic
lipogenesis-related genes, such as ADD1, ACC, and FAS. On the
contrary, Rosiglitazone significantly promoted these genes ex-
pressions in liver, partly explaining the reason for weight gain and
hepatic steatosis observed in Rosiglitazone group.
3. Conclusion
In conclusion, the first-in-class dual partial agonist 6 (ZLY06) has
been discovered based on the strategy of conformational restric-
tion, which has excellent PK profiles. Moreover, compound 6
significantly reduced blood glucose level in HF/STZ and ob/ob mice.
5

Z. Li, Q. Ren, Z. Zhou et al.
European Journal of Medicinal Chemistry 225 (2021) 113807
Fig. 7. Representative liver slices (400ꢂ magnification) stained with Hematoxylin-Eosin (A: normal control; B: vehicle group; C: Rosiglitazone-treated group; D: compound 6-
treated group). Steatosis: red arrow, ballooning: blue arrow. (E) show the plasma levels of AST and ALT. (F) The relative gene expression levels related to fatty acid oxidation and
hepatic lipogenesis. Values are expressed as mean SD (n ¼ 6). *p ꢁ 0.05, **p ꢁ 0.01 and ***p ꢁ 0.001 compared to vehicle group were analyzed using a one-way ANOVA with
Tukey's multiple-comparison post hoc test.
Notably, dual partial agonist 6 not only exhibited significant
improvement on glucolipid metabolism without weight gain, but
also alleviated fatty liver by promoting the fatty acid oxidation and
inhibiting hepatic lipid accumulation. However, the weight gain
2a-g. To the stirred solution of 2a-g (1 equiv) in 20 mL solvent
(ethanol/DMF, 1:1) were added 4-hydroxy-3,5-
dimethylbenzaldehyde (1 equiv) and 2.3 mL potassium hydroxide
solution (50%). After stirred for 4e6 h, 50 mL water was added to
this reaction and adjusting pH to 1e2 using concentrated hydro-
chloric acid. The reaction was extracted with ethyl acetate and
purified by column chromatography (petroleum ether/ethyl ace-
tate, 10:1) to provide 4a-g as yellow solid.
and hepatic steatosis were observed in PPAR
tazone. These discoveries indicated dual PPARd/g
g
full agonist Rosigli-
partial agonist 6
(ZLY06) might be a potential candidate of metabolic syndrome.
4. Experimental section
4.1.1.1. (Z)-2-(4-hydroxy-3,5-dimethylbenzylidene)-6-
4.1. Chemistry
methoxybenzofuran-3(2H)-one (4a). Yield: 48%; 1H NMR (300 MHz,
DMSO‑d6)
d
: 8.07 (s, 1H), 7.73e7.61 (m, 3H), 7.15 (d, J ¼ 1.8 Hz, 1H),
Reagents and solvents were commercially available without
purification. Chromatographic purification was performed on silica
gel (200e300 mesh), and monitored by TLC on GF254 plates.
Melting points were measured by RY-1 apparatus. 1H and 13C NMR
spectra were recorded by Bruker ACF-300Q instrument. High res-
olution mass spectrometry (HRMS) was performed on AB SCIEX
X500R system. Elemental analysis was recorded on Heraeus
CHNeO-Rapid analyzer. GW7647, GW0742, GFT505 and Rosiglita-
zone were purchased from MedChemExpress (Shanghai, China).
6.85, 6.82 (dd, J ¼ 8.7, 2.1 Hz, 1H), 6.68 (s, 1H), 3.95 (s, 3H), 2.32 (s,
6H).
4.1.1.2. (Z)-6-ethoxy-2-(4-hydroxy-3,5-dimethylbenzylidene)benzo-
furan-3(2H)-one (4b). Yield: 43%; 1H NMR (300 MHz, DMSO‑d6)
d:
8.09 (s, 1H), 7.75e7.62 (m, 3H), 7.09 (s, 1H), 6.83 (d, J ¼ 8.6 Hz, 1H),
6.69 (s, 1H), 4.23 (q, J ¼ 6.8 Hz, 2H), 2.32 (s, 6H), 1.38 (t, J ¼ 6.8 Hz,
3H).
4.1.1. General procedure for 4a-g
To a solution of 6-hydroxy-2,3-dihydrobenzo [b]furan-3-one (1
equiv) and halogenated hydrocarbon (1.2 equiv) in acetonitrile was
added K2CO3 (3 equiv) and catalyzer potassium iodide. After stirred
for 12 h at 45 ꢀC, the reaction was filtrated and purified by column
chromatography (petroleum ether/ethyl acetate, 20:1) to provide
4.1.1.3. (Z)-2-(4-hydroxy-3,5-dimethylbenzylidene)-6-
propoxybenzofuran-3(2H)-one (4c). Yield: 38%; 1H NMR (300 MHz,
DMSO‑d6)
d
: 8.07 (s, 1H), 7.76e7.63 (m, 3H), 7.11 (d, J ¼ 1.6 Hz, 1H),
6.84, 6.81 (dd, J ¼ 8.5, 1.8 Hz,1H), 6.69 (s, 1H), 4.12 (t, J ¼ 6.5 Hz, 2H),
2.31 (s, 6H), 1.85e1.73 (m, 2H), 1.01 (t, J ¼ 7.4 Hz, 3H).
6

Z. Li, Q. Ren, Z. Zhou et al.
European Journal of Medicinal Chemistry 225 (2021) 113807
4.1.2. General procedure for 1-12
175.39, 168.40, 167.21, 154.79, 147.19, 133.73, 132.16, 127.98, 125.77,
114.25, 113.57, 111.18, 97.83, 81.26, 75.27, 28.01, 25.47, 19.34, 18.13.
HRMS (ESI) m/z: calcd. for C21H21O4 [M-C(CH3)2COOH]-: 337.1445;
found 337.1450; error: þ1.48 ppm. Anal. calcd. For C25H28O6: C,
70.74; H, 6.65; Found: C, 70.56; H, 6.59.
To a mixture of 4a-g (1 equiv) and methyl chloroacetate or
methyl 2-bromo-2-methylpropanoate (1.2 equiv) in MeCN was
added K2CO3 (3 equiv) and catalyzer potassium iodide. After stirred
for 12 h at 45 ꢀC, the reaction was filtrated and purified by column
chromatography (petroleum ether/ethyl acetate, 10:1) to afford a
yellow solid, which was dissolved in 20 mL THF/MeOH/H2O (2:3:1).
Then LiOH$H2O (4 equiv) was added to above reaction mixture.
After stirred for 4 h, the solvent was removed and acidified with
diluted hydrochloric acid. After filtered, the residue was purified by
column chromatography (petroleum ether/ethyl acetate, 2:1e1:1)
to provide 1e12 as yellow solid.
4.1.2.6. (Z)-2-(4-((6-(cyclopropylmethoxy)-3-oxobenzofuran-2(3H)-
ylidene)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (6).
Yield: 54%; m.p. 141e143 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d:
7.70e7.58 (m, 3H), 7.07 (s, 1H), 6.81 (d, J ¼ 8.6 Hz, 1H), 6.67 (s, 1H),
3.98 (d, J ¼ 6.9 Hz, 2H), 2.23 (s, 6H), 1.37 (s, 6H), 1.22e1.15 (m, 1H),
0.64e0.56 (m, 2H), 0.40e0.31 (m, 2H). 13C NMR (75 MHz, DMSO‑d6)
d
: 181.99, 175.74, 168.39, 167.08, 147.14, 133.79, 132.12, 127.80,
4.1.2.1. (Z)-2-(4-((6-methoxy-3-oxobenzofuran-2(3H)-ylidene)
125.74, 114.18, 113.66, 111.28, 97.78, 81.68, 73.90, 25.67, 18.18, 10.26,
3.65. HRMS (ESI) m/z: calcd. for C21H19O4 [M-C(CH3)2COOH]-:
335.1289; found 335.1292; error: þ0.89 ppm. Anal. calcd. For
methyl)-2,6-dimethylphenoxy)-2-methylpropanoic
acid
(1).
: 12.79
Yield: 52%; m.p. 150e152 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d
(brs, 1H), 7.77e7.52 (m, 3H), 7.10 (s, 1H), 6.83 (d, J ¼ 7.4 Hz, 1H), 6.67
C
25H26O6: C, 71.07; H, 6.20; Found: C, 71.15; H, 6.27.
(s, 1H), 3.93 (s, 3H), 2.25 (s, 6H), 1.42 (s, 6H). 13C NMR (75 MHz,
DMSO‑d6) d: 170.30, 164.68, 154.03, 152.84, 150.78, 140.81, 130.14,
4.1.2.7. (Z)-2-(4-((6-(isopentyloxy)-3-oxobenzofuran-2(3H)-ylidene)
methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (7).
Yield: 38%; m.p. 146e148 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
128.73, 128.62, 127.53, 116.74, 116.68, 116.45, 111.24, 104.87, 81.29,
66.51, 25.24, 15.45. HRMS (ESI) m/z: calcd. for C18H15O4 [M-
C(CH3)2COOH]-: 295.0976; found 295.0972; error: ꢃ1.36 ppm. Anal.
calcd. For C22H22O6: C, 69.10; H, 5.80; Found: C, 69.35; H, 5.61.
d:
7.69e7.53 (m, 3H), 7.11 (s, 1H), 6.79 (d, J ¼ 8.6 Hz, 1H), 6.67 (s, 1H),
4.14 (t, J ¼ 6.1 Hz, 2H), 2.25 (s, 6H), 1.67e1.58 (m, 2H), 1.32 (s, 6H),
1.21e1.11 (m, 1H), 0.91 (d, J ¼ 6.6 Hz, 6H). 13C NMR (75 MHz,
4.1.2.2. (Z)-2-(4-((6-ethoxy-3-oxobenzofuran-2(3H)-ylidene)
DMSO‑d6) d: 181.99, 177.53, 174.91, 168.35, 167.08, 156.35, 146.92,
methyl)-2,6-dimethylphenoxy)-2-methylpropanoic
acid
(2).
: 12.78
134.13, 131.93, 127.01, 114.33, 113.56, 111.68, 97.81, 84.40, 67.82,
Yield: 46%; m.p. 142e144 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d
37.57, 26.79, 25.05, 24.03, 22.83, 18.48. HRMS (ESI) m/z: calcd. for
(brs, 1H), 7.79e7.42 (m, 3H), 7.08 (s, 1H), 6.81 (d, J ¼ 7.9 Hz,1H), 6.68
C
22H23O4 [M-C(CH3)2COOH]-: 351.1602; found 351.1600;
(s, 1H), 4.22 (d, J ¼ 6.3 Hz, 2H), 2.25 (s, 6H), 1.41e1.21 (m, 9H). 13
C
error: ꢃ0.57 ppm. Anal. calcd. For C26H30O6: C, 71.21; H, 6.90;
NMR (75 MHz, DMSO‑d6) d: 182.02, 175.39, 168.43, 167.01, 154.78,
Found: C, 71.45; H, 6.79.
147.19, 133.74, 132.16, 128.00, 125.81, 114.25, 113.57, 111.19, 97.82,
81.27, 65.04, 25.46, 18.13, 14.81. HRMS (ESI) m/z: calcd. for C19H17O4
[M-C(CH3)2COOH]-: 309.1132; found 309.1132; error: 0 ppm. Anal.
calcd. For C23H24O6: C, 69.68; H, 6.10; Found: C, 69.44; H, 6.25.
4.1.2.8. (Z)-2-(4-((6-methoxy-3-oxobenzofuran-2(3H)-ylidene)
methyl)-2,6-dimethylphenoxy)acetic acid (8). Yield: 65%; m.p.
243e245 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d
: 7.75e7.62 (m, 3H),
7.13 (d, J ¼ 1.9 Hz,1H), 6.86, 6.83 (dd, J ¼ 8.6, 2.0 Hz,1H), 6.69 (s,1H),
4.45 (s, 2H), 3.94 (s, 3H), 2.31 (s, 6H). 13C NMR (75 MHz, DMSO‑d6)
4.1.2.3. (Z)-2-(2,6-dimethyl-4-((3-oxo-6-propoxybenzofuran-2(3H)-
d:
ylidene)methyl)phenoxy)-2-methylpropanoic acid (3). Yield: 57%;
182.06, 170.55, 168.43, 167.77, 157.19, 147.14, 132.41, 131.59, 128.20,
125.82, 114.40, 113.27, 111.31, 97.57, 69.25, 56.88, 16.65. HRMS (ESI)
m/z: calcd. for C20H17O6 [M ꢃ H]-: 353.1031; found 353.1035;
error: þ1.13 ppm. Anal. calcd. For C20H18O6: C, 67.79; H, 5.12;
Found: C, 67.54; H, 5.23.
m.p. 145e147 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d: 7.69e7.56 (m,
3H), 7.09 (s, 1H), 6.80 (d, J ¼ 8.5 Hz, 1H), 6.67 (s, 1H), 4.08 (t,
J ¼ 6.5 Hz, 2H), 2.24 (s, 6H), 1.81e1.68 (m, 2H), 1.38 (s, 6H), 0.98 (t,
J ¼ 7.4 Hz, 3H). 13C NMR (75 MHz, DMSO‑d6)
d: 181.97, 175.70,
168.37, 167.11, 155.05, 147.13, 133.77, 132.11, 127.80, 125.74, 114.25,
113.53, 111.26, 97.79, 81.67, 70.70, 25.67, 22.24, 18.19, 10.69. HRMS
(ESI) m/z: calcd. for C20H19O4 [M-C(CH3)2COOH]-: 323.1289; found
323.1285; error: ꢃ1.24 ppm. Anal. calcd. For C24H26O6: C, 70.23; H,
6.38; Found: C, 70.45; H, 6.31.
4.1.2.9. (Z)-2-(4-((6-ethoxy-3-oxobenzofuran-2(3H)-ylidene)
methyl)-2,6-dimethylphenoxy)acetic acid (9). Yield: 61%; m.p.
248e250 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d: 7.76e7.62 (m, 3H),
7.08 (s, 1H), 6.81 (d, J ¼ 8.5 Hz, 1H), 6.68 (s, 1H), 4.45 (s, 2H), 4.22 (q,
J ¼ 6.8 Hz, 2H), 2.31 (s, 6H),1.39 (t, J ¼ 6.8 Hz, 3H). 13C NMR (75 MHz,
4.1.2.4. (Z)-2-(4-((6-butoxy-3-oxobenzofuran-2(3H)-ylidene)
DMSO‑d6) d: 181.97, 170.40, 168.41, 167.02, 157.19, 147.18, 132.37,
methyl)-2,6-dimethylphenoxy)-2-methylpropanoic
acid
(4).
Yield: 51%; m.p. 118e120 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d
:
131.50, 128.20, 114.31, 112.32, 109.64, 100.35, 69.37, 65.04, 16.61,
14.78. HRMS (ESI) m/z: calcd. for C21H19O6 [M ꢃ H]-: 367.1187;
found 367.1190; error: þ0.82 ppm. Anal. calcd. For C21H20O6: C,
68.47; H, 5.47; Found: C, 68.62; H, 5.31.
7.69e7.57 (m, 3H), 7.11 (s, 1H), 6.80 (d, J ¼ 8.6 Hz, 1H), 6.67 (s, 1H),
4.13 (t, J ¼ 6.4 Hz, 2H), 2.22 (s, 6H), 1.78e1.66 (m, 2H), 1.53e1.41 (m,
2H),1.38 (s, 6H), 0.93 (t, J ¼ 7.5 Hz, 3H). 13C NMR (75 MHz, DMSO‑d6)
d
: 182.02, 175.35, 168.42, 167.18, 154.78, 147.18, 133.74, 132.16,
127.97, 125.79, 114.21, 113.61, 111.20, 97.82, 81.25, 69.03, 30.87,
25.46, 19.09, 18.13, 14.09. HRMS (ESI) m/z: calcd. for C21H21O4 [M-
C(CH3)2COOH]-: 337.1445; found 337.1441; error: ꢃ1.19 ppm. Anal.
calcd. For C25H28O6: C, 70.74; H, 6.65; Found: C, 70.85; H, 6.77.
4.1.2.10. (Z)-2-(2,6-dimethyl-4-((3-oxo-6-propoxybenzofuran-
2(3H)-ylidene)methyl)phenoxy)acetic acid (10). Yield: 52%; m.p.
214e216 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d: 7.76e7.63 (m, 3H),
7.11 (d, J ¼ 1.6 Hz, 1H), 6.84, 6.81 (dd, J ¼ 8.5, 1.8 Hz, 1H), 6.69 (s, 1H),
4.45 (s, 2H), 4.12 (t, J ¼ 6.5 Hz, 2H), 2.31 (s, 6H), 1.85e1.73 (m, 2H),
4.1.2.5. (Z)-2-(4-((6-isobutoxy-3-oxobenzofuran-2(3H)-ylidene)
1.01 (t, J ¼ 7.4 Hz, 3H). 13C NMR (75 MHz, DMSO‑d6)
d: 181.93,
methyl)-2,6-dimethylphenoxy)-2-methylpropanoic
acid
(5).
170.42, 167.20, 162.52, 157.15, 147.20, 132.37, 131.51, 128.21, 114.32,
111.16,109.64, 97.95, 70.77, 69.39, 22.25, 16.63, 10.65. HRMS (ESI) m/
z: calcd. for C22H21O6 [M ꢃ H]-: 381.1344; found 381.1349;
error: þ1.31 ppm. Anal. calcd. For C22H22O6: C, 69.10; H, 5.80;
Found: C, 69.35; H, 5.71.
Yield: 42%; m.p. 121e123 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d
:
7.68e7.55 (m, 3H), 7.10 (s, 1H), 6.81 (d, J ¼ 8.6 Hz, 1H), 6.67 (s, 1H),
3.90 (d, J ¼ 6.3 Hz, 2H), 2.23 (s, 6H), 2.06e1.97 (m, 1H), 1.39 (s, 6H),
0.99 (d, J ¼ 6.6 Hz, 6H). 13C NMR (75 MHz, DMSO‑d6)
d: 182.00,
7

Z. Li, Q. Ren, Z. Zhou et al.
European Journal of Medicinal Chemistry 225 (2021) 113807
4.1.2.11. (Z)-2-(4-((6-isobutoxy-3-oxobenzofuran-2(3H)-ylidene)
4.5. Pharmacokinetic studies
methyl)-2,6-dimethylphenoxy)acetic acid (11). Yield: 57%; m.p.
163e165 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d
: 7.68e7.54 (m, 3H),
The fasted SD rats were orally administered compound 6 (3 mg/
kg), and blood was gathered at 5, 15, 30, 45 min and 1, 2, 4, 6, 8, 12,
18, 24 h. The plasma was separated and acetonitrile containing
internal standard was added to precipitate proteins. The superna-
tant was evaluated by LC-MS/MS (Triple Quad 4500, AB SCIEX) to
provide the drug concentration. PK profile was analyzed by DAS
2.1.1.
7.11 (d, J ¼ 1.7 Hz, 1H), 6.87e6.76 (m, 1H), 6.68 (s, 1H), 4.45 (s, 2H),
3.94 (d, J ¼ 6.5 Hz, 2H), 2.30 (s, 6H), 2.14e2.03 (m, 1H), 1.01 (d,
J ¼ 6.7 Hz, 6H). 13C NMR (75 MHz, DMSO‑d6)
d: 181.98, 170.56,
168.41, 167.21, 157.16, 147.16, 132.40, 131.53, 128.21, 125.75, 114.25,
113.55, 111.19, 97.84, 75.27, 69.26, 28.02, 19.35, 16.64. HRMS (ESI) m/
z: calcd. for C23H23O6 [M ꢃ H]-: 395.1500; found 395.1501;
error: þ0.25 ppm. Anal. calcd. For C23H24O6: C, 69.68; H, 6.10;
Found: C, 69.84; H, 6.31.
4.6. Dose-effect study in HF/STZ mice
4.1.2.12. (Z)-2-(4-((6-(cyclopropylmethoxy)-3-oxobenzofuran-
C57BL/6 mice were fed with high‒fat diet (45% calories from fat,
Mediscience Ltd., China) for four weeks and then injected intra-
peritoneally with STZ (80 mg/kg). The mice were fed for another
four weeks to generate HF/STZ diabetic mice. The fasted HF/STZ
mice were orally administered once daily with vehicle, Rosiglita-
zone (10 mg/kg), or compound 6 (5, 10, and 20 mg/kg) for 7-day
treatment. At the end of treatment, fasting mice were adminis-
trated with vehicle, Rosiglitazone, or compound 6. After 30 min,
mice were dosed orally with 2 g/kg glucose. Blood was collected
at ꢃ30, 0, 15, 30, 60 and 120 min post‒dose. The plasma glucose
was determined using blood glucose test strips (SanNuo ChangSha,
China).
2(3H)-ylidene)methyl)-2,6-dimethylphenoxy)acetic
acid
(12).
: 12.85
Yield: 63%; m.p. 172e174 ꢀC; 1H NMR (300 MHz, DMSO‑d6)
d
(s, 1H), 7.66e7.56 (m, 3H), 7.09 (s, 1H), 6.83 (d, J ¼ 8.6 Hz, 1H), 6.69
(s, 1H), 4.45 (s, 2H), 4.02 (d, J ¼ 5.7 Hz, 2H), 2.31 (s, 6H), 0.87e0.81
(m, 1H), 0.65e0.58 (m, 2H), 0.42e0.36 (m, 2H). 13C NMR (75 MHz,
DMSO‑d6) d: 181.98, 170.38, 168.44, 167.17, 157.21, 147.22, 132.38,
131.53, 128.22, 125.75, 114.27, 113.63, 111.18, 97.94, 73.89, 69.40,
16.62, 10.28, 3.59. HRMS (ESI) m/z: calcd. for C23H21O6 [M ꢃ H]-:
393.1344; found 393.1348; error: þ1.02 ppm. Anal. calcd. For
C
23H22O6: C, 70.04; H, 5.62; Found: C, 70.22; H, 5.43.
4.2. PPARa, PPARg and PPARd assay
4.7. Chronic administration in ob/ob mice
The cell-based assays of PPAR
a
, PPARg and PPARd were per-
formed according to our previous reports [18e21]. After trans-
fection for 24 h, test compounds were added and incubated for 18 h.
Ob/ob mice were orally administered once daily with vehicle,
Rosiglitazone (10 mg/kg), or compound 6 (20 mg/kg) for 30 days.
Water and diet consumption were measured daily. Body weight,
non-fasting and fasting plasma glucose were measured every 5
days. At the end of treatment, alanine aminotransferase (ALT),
aspartate transaminase (AST), total cholesterol (TC), triglyceride
(TG), high-density lipoprotein (HDL), low-density lipoprotein (LDL)
and HbA1c levels were measured using automatic biochemical
analyzer (Beckman Coulter, AU5811, Tokyo). Hepatic TG and TC
were measured according to the corresponding kits (Nanjing Jian-
cheng Bioengineering Institute). The liver sections were stained
with Hematoxylin-Eosin.
Then each well was lysed with lysis buffer, and added 30
mL
Luciferase Assay Reagent II. The firefly and renilla luciferase signal
was measured by Promega's Dual Luciferase Reporter Assay Sys-
tem. The values are normalized by Firefly signal/Renilla signal (F/R).
The %Activation value is calculated by the following equation: %
Activation ¼ [(X-Min)/(Max-Min)] ꢂ 100% (X is the “F/R” value in
each concentration point. Min is the mean “F/R” value from no
compound control. Max is the mean “F/R” value from reference
compound control). EC50 value was calculated by GraphPad 5.00
(San Diego, CA, USA).
4.3. Docking study
4.8. RT-PCR
Molecular modeling study was carried out by AutoDock vina
RNA was extracted from liver by Trizol Reagent (Invitrogen), and
cDNA was synthesized using ReverTra Ace reverse transcriptase
(TOYOBO, Japan) on the basic of the operating regulations. RT-PCR
was performed with the SYBR Green Realtime PCR Master Mix
(TOYOBO, Japan) on iCycler (Bio-rad) accordance with the operating
regulations. The gene expressions were calculated by DDCT method
and normalized against GADPH mRNA. Primer sequences were as
1.1.2. The crystal structures of PPAR
a (3vi8), PPARd (1GWX) and
PPAR (2Q8S) were downloaded from PDB database. Firstly, the
g
protein was added polar hydrogen and gasteiger charge, deleted
water, and assigned atoms as AD4 based on AutoDockTools. Dock-
ing was operated using full flexibility of ligand, and kept other
parameters as default values. Pymol 2.3.1 was performed to analyze
the molecular modeling results.
follows: 3-hydroxy-3-methylglutaryl-Coenzyme
A synthase 2
(HMGCS2) forward primer: AGAGAGCGATGCAGGAAACTT, HMGCS2
4.4. Animals
reverse primer: AAGGATGCCCACATCTTTTGG; Pyruvate dehydro-
genase kinase
4 (PDK4) forward primer: CCGCTTAGTGAA-
Eight-week-old male C57BL/6 mice and SD rats were purchased
from Guangdong Medical Laboratory Animal Center (Guangdong,
China), and eight-week-old male ob/ob mice were purchased from
Model Animal Research Center of Nanjing university (Jiangsu,
China). All animals were fed adaptively for 7 days, and feeding
CACTCCTTC, PDK4 reverse primer: TGACCAGCGTGTCTACAAACT;
Glucose transporter 2 (GLUT2) forward primer: TTCCAGTTCGGC-
TATGACATCG,
TAAGTGGGG;
GLUT2
Glycerol
reverse
kinase
primer:
(GK)
CTGGTGTGACTG-
forward primer:
TGAACCTGAGGATTTGTCAGC, GK reverse primer: CCATGTGGAG-
TAACGGATTTCG; CD36 forward primer: ATGGGCTGTGATCG-
GAACTG, CD36 reverse primer: GTCTTCCCAATAAGCATGTCTCC;
Adipocyte determination and diferentiation-dependent factor 1
(ADD1) forward primer: GGAACATGGCACCAGACCTTC, ADD1
reverse primer: AAGGCAGGACTCTGTAGAATCA; Acetyl-CoA
carboxylase (ACC) forward primer: ACCCACTCCACTGTTTGTGA,
ACC reverse primer: CCTTGGAATTCAGGAGAGGA; Fatty acid
chamber was keep under the conditions of 23
midity 5 10%, continuous light/dark cycle for 12h. The testing
2
ꢀC, relative hu-
protocols were approved by the ethical committee at Guangdong
Pharmaceutical University and conducted according to the Labo-
ratory Animal Management Regulations in China and adhered to
guidelines for Care and Use of Laboratory Animals (NIH Publication
NO. 85e23).
8

Z. Li, Q. Ren, Z. Zhou et al.
European Journal of Medicinal Chemistry 225 (2021) 113807
[12] Y. Yang, Y. Tong, M. Gong, Y. Lu, C. Wang, M. Zhou, Q. Yang, T. Mao, N. Tong,
Activation of PPAR beta/delta protects pancreatic beta cells from palmitate-
induced apoptosis by upregulating the expression of GLP-1 receptor, Cell.
Signal. 26 (2014) 268e278.
synthase (FAS) forward primer: TAAAGCATGACCTCGTGATGAA, FAS
reverse primer: GAAGTTCAGTGAGGCGTAGTAG.
[13] M. Ahmadian, J.M. Suh, N. Hah, C. Liddle, A.R. Atkins, M. Downes, R.M. Evans,
PPAR gamma signaling and metabolism: the good, the bad and the future, Nat.
Med. 19 (2013) 557e566.
[14] G. Derosa, A. Sahebkar, P. Maffioli, The role of various peroxisome proliferator-
activated receptors and their ligands in clinical practice, J. Cell. Physiol. 233
(2018) 153e161.
[15] A.Z. Mirza, Althagafi II, H. Shamshad, Role of PPAR receptor in different dis-
eases and their ligands: physiological importance and clinical implications,
Eur. J. Med. Chem. 166 (2019) 502e513.
[16] F. Hong, P. Xu, Y. Zhai, The opportunities and challenges of peroxisome
proliferator-activated receptors ligands in clinical drug discovery and devel-
opment, Int. J. Mol. Sci. 19 (2018).
4.9. Statistical analysis
GraphPad 5 Software was used to analyze data. General effects
analysis used a one-way ANOVA with Tukey's multiple-comparison
post hoc test.
Declaration of competing interest
The authors declare no competing financial interest.
Acknowledgments
[17] I. Takada, M. Makishima, Peroxisome proliferator-activated receptor agonists
and antagonists: a patent review (2014-present), Expert Opin. Ther. Pat. 30
(2020) 1e13.
[18] Z. Zhou, L. Deng, L. Hu, Q. Ren, Z. Cai, B. Wang, Z. Li, L. Zhang, Hepatoprotective
This study was supported by the Key Field R&D Plan Project of
Guangdong province (No. 2019B020201002), Guangdong Basic and
Applied Basic Research Foundation (Grant 2019A1515011036), the
Natural Science Foundation of Xuzhou (No. KC19154), the Innova-
tive strong school project of Guangdong Pharmaceutical University
(Grant 2018KTSCX111), the Innovation Team Projects in Universities
of Guangdong Province (No. 2018KCXTD016).
effects of ZLY16,
agonist, in rodent model of nonalcoholic steatohepatitis, Eur. J. Pharmacol.
882 (2020), 173300.
[19] Z. Li, Y. Chen, Z. Zhou, L. Deng, Y. Xu, L. Hu, B. Liu, L. Zhang, Discovery of first-
in-class thiazole-based dual FFA1/PPAR agonists as potential anti-diabetic
a dual peroxisome proliferator-activated receptor a/
d
d
agents, Eur. J. Med. Chem. 164 (2019) 352e365.
[20] Z. Li, Z. Zhou, F. Deng, Y. Li, D. Zhang, L. Zhang, Design, synthesis, and bio-
logical evaluation of novel pan agonists of FFA1, PPARg and PPARd, Eur. J. Med.
Chem. 159 (2018) 267e276.
[21] Y. Chen, Q. Ren, Z. Zhou, L. Deng, L. Hu, L. Zhang, Z. Li, HWL-088, a new potent
free fatty acid receptor 1 (FFAR1) agonist, improves glucolipid metabolism
and acts additively with metformin in ob/ob diabetic mice, Br. J. Pharmacol.
177 (2020) 2286e2302.
[22] M.J. Westerouen Van Meeteren, J.P.H. Drenth, E. Tjwa, Elafibranor: a potential
drug for the treatment of nonalcoholic steatohepatitis (NASH), Expet Opin.
Invest. Drugs (2019) 1e7.
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.ejmech.2021.113807.
[23] V. Ratziu, S.A. Harrison, S. Francque, P. Bedossa, P. Lehert, L. Serfaty,
M. Romero-Gomez, J. Boursier, M. Abdelmalek, S. Caldwell, J. Drenth,
Q.M. Anstee, D. Hum, R. Hanf, A. Roudot, S. Megnien, B. Staels, A. Sanyal,
Elafibranor, an agonist of the peroxisome proliferator-activated receptor-
alpha and -delta, induces resolution of nonalcoholic steatohepatitis without
fibrosis worsening, Gastroenterology 150 (2016) 1147e1159.
[24] J.D. Roth, S.S. Veidal, L.K.D. Fensholdt, K.T.G. Rigbolt, R. Papazyan, J.C. Nielsen,
M. Feigh, N. Vrang, M. Young, J. Jelsing, L. Adorini, H.H. Hansen, Combined
obeticholic acid and elafibranor treatment promotes additive liver histological
improvements in a diet-induced ob/ob mouse model of biopsy-confirmed
NASH, Sci. Rep. 9 (2019) 9046.
[25] S. Chigurupati, S.A. Dhanaraj, P. Balakumar, A step ahead of PPARgamma full
agonists to PPARgamma partial agonists: therapeutic perspectives in the
management of diabetic insulin resistance, Eur. J. Pharmacol. 755 (2015)
50e57.
[26] A.A. Amato, S. Rajagopalan, J.Z. Lin, B.M. Carvalho, A.C. Figueira, J. Lu,
S.D. Ayers, M. Mottin, R.L. Silveira, P.C. Souza, R.H. Mourao, M.J. Saad,
M. Togashi, L.A. Simeoni, D.S. Abdalla, M.S. Skaf, I. Polikparpov, M.C. Lima,
S.L. Galdino, R.G. Brennan, J.D. Baxter, I.R. Pitta, P. Webb, K.J. Phillips,
F.A. Neves, GQ-16, a novel peroxisome proliferator-activated receptor gamma
(PPARgamma) ligand, promotes insulin sensitization without weight gain,
J. Biol. Chem. 287 (2012) 28169e28179.
References
[1] J. Kaur, A comprehensive review on metabolic syndrome, Cardiol. Res. Pract.
2014 (2014), 943162.
[2] S. O'Neill, L. O'Driscoll, Metabolic syndrome: a closer look at the growing
epidemic and its associated pathologies, Obes. Rev. 16 (2015) 1e12.
[3] C.A. Aguilar-Salinas, T. Viveros-Ruiz, Recent Advances in Managing/under-
standing the Metabolic Syndrome, F1000Research, 2019, p. 8.
ꢀ
[4] C. Villarroel-Vicente, S. Gutierrez-Palomo, J. Ferri, D. Cortes, N. Cabedo, Natural
products and analogs as preventive agents for metabolic syndrome via
peroxisome proliferator-activated receptors: an overview, Eur. J. Med. Chem.
221 (2021), 113535.
[5] Z.-H. Zhao, Y.-C. Fan, Q. Zhao, C.-Y. Dou, X.-F. Ji, J. Zhao, S. Gao, X.-Y. Li,
K. Wang, Promoter methylation status and expression of PPAR-gamma gene
are associated with prognosis of acute-on-chronic hepatitis B liver failure,
Clin. Epigenet. 7 (2015).
[6] F. Hong, S. Pan, Y. Guo, P. Xu, Y. Zhai, PPARs as nuclear receptors for nutrient
and energy metabolism, Molecules (2019) 24.
[7] B. Gross, M. Pawlak, P. Lefebvre, B. Staels, PPARs in obesity-induced T2DM,
dyslipidaemia and NAFLD, Nat. Rev. Endocrinol. 13 (2017) 36e49.
[8] Y.X. Wang, C.H. Lee, S. Tiep, R.T. Yu, J.Y. Ham, H.J. Kang, R.M. Evans, Peroxi-
some-proliferator-activated receptor delta activates fat metabolism to pre-
vent obesity, Cell 113 (2003) 159e170.
[9] H. Kim, M. Haluzik, Z. Asghar, D. Yau, J.W. Joseph, A.M. Fernandez,
M.L. Reitman, S. Yakar, B. Stannard, L. Heron-Milhavet, M.B. Wheeler,
D. LeRoith, Peroxisome proliferator-activated receptor-alpha agonist treat-
ment in a transgenic model of type 2 diabetes reverses the lipotoxic state and
improves glucose homeostasis, Diabetes 52 (2003) 1770e1778.
[10] X. Palomer, E. Barroso, J. Pizarro-Delgado, L. Pena, G. Botteri, M. Zarei,
D. Aguilar, M. Montori-Grau, M. Vazquez-Carrera, PPAR beta/delta: a Key
therapeutic target in metabolic disorders, Int. J. Mol. Sci. 19 (2018).
[11] M. Daoudi, N. Hennuyer, M.G. Borland, V. Touche, C. Duhem, B. Gross,
R. Caiazzo, J. Kerr-Conte, F. Pattou, J.M. Peters, B. Staels, S. Lestavel, PPAR beta/
delta activation induces enteroendocrine L cell GLP-1 production, Gastroen-
terology 140 (2011) 1564e1574.
[27] B.A. Brady, M.M. Healy, J.A. Kennedy, W.I. O’Sullivan, E.M. Philbin, The
Configuration of Aurones Tetrahedron, vol. 29, 1973, pp. 359e362.
[28] J. Luo, J. Quan, J. Tsai, C.K. Hobensack, C. Sullivan, R. Hector, G.M. Reaven,
Nongenetic mouse models of non-insulin-dependent diabetes mellitus,
Metabolism 47 (1998) 663e668.
[29] A.J.F. King, The use of animal models in diabetes research, Br. J. Pharmacol. 166
(2012) 877e894.
[30] A. King, J. Bowe, Animal models for diabetes: understanding the pathogenesis
and finding new treatments, Biochem. Pharmacol. 99 (2016) 1e10.
[31] H.E. Bays, S. Schwartz, T. Littlejohn III, B. Kerzner, R.M. Krauss, D.B. Karpf, Y.-
J. Choi, X. Wang, S. Naim, B.K. Roberts, MBX-8025, A novel peroxisome pro-
liferator receptor-delta agonist: lipid and other metabolic effects in dyslipi-
demic overweight patients treated with and without atorvastatin, J. Clin.
Endocrinol. Metab. 96 (2011) 2889e2897.
9