Synthesis and biological evaluation of novel sinomenine derivatives as anti-inflammatory agents

Article abstract of DOI:10.1016/j.ejmech.2012.01.036

Sinomenine (1) is clinically available for the treatment of rheumatoid arthritis (RA), however, its efficacy is quite weak. In the present study, a library of novel sinomenine-based homodimers and monomers through variable-length linkers were designed and synthesized, and their bioactivities were evaluated using RAW264.7 cells and mice. Among the compounds, 2f and 3b possessed much more potent inhibitory effects on the production of nitric oxide (NO), interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) than 1. Preliminary mechanism investigation revealed that 3b inhibited nuclear factor-κB (NF-κB) signaling pathway specifically, 2f suppressed both NF-κB and mitogen-activated protein kinase (MAPK) cascades. Moreover, 3b and 2f significantly alleviated the lipopolysaccharide (LPS)-induced mortality. These two compounds might serve as valuable candidates for anti-inflammatory drug discovery.

Full text of DOI:10.1016/j.ejmech.2012.01.036

European Journal of Medicinal Chemistry 50 (2012) 63e74
Contents lists available at SciVerse ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Synthesis and biological evaluation of novel sinomenine derivatives
as anti-inflammatory agents
,
,
,
b
Peng Teng a 1, Hai-Liang Liu b 1, Lei Zhang a, Li-Li Feng b, Yue Huai a, Zhang-Shuang Deng c , Yang Sun ,
**
Qiang Xu b, Jian-Xin Li a
,
*
a State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing, 210093, PR China
b State Key Laboratory of Pharmaceutical Biotechnology, School of Life Science, Nanjing University, Nanjing 210093, PR China
c Hubei Key Laboratory of Natural Products Research and Development, College of Chemistry and Life Science, China Three Gorges University, 8 University Road, Yichang 443002,
Hubei, PR China
a r t i c l e i n f o
a b s t r a c t
Article history:
Sinomenine (1) is clinically available for the treatment of rheumatoid arthritis (RA), however, its efficacy
is quite weak. In the present study, a library of novel sinomenine-based homodimers and monomers
through variable-length linkers were designed and synthesized, and their bioactivities were evaluated
using RAW264.7 cells and mice. Among the compounds, 2f and 3b possessed much more potent
inhibitory effects on the production of nitric oxide (NO), interleukin-6 (IL-6) and tumor necrosis factor-
Received 25 October 2011
Received in revised form
15 January 2012
Accepted 17 January 2012
Available online 28 January 2012
a
(TNF-
a
) than 1. Preliminary mechanism investigation revealed that 3b inhibited nuclear factor-
kB (NF-
k
B) signaling pathway specifically, 2f suppressed both NF-
k
B and mitogen-activated protein kinase
Keywords:
Sinomenine
Anti-inflammatory
Nitric oxide
(MAPK) cascades. Moreover, 3b and 2f significantly alleviated the lipopolysaccharide (LPS)-induced
mortality. These two compounds might serve as valuable candidates for anti-inflammatory drug
discovery.
Ó 2012 Elsevier Masson SAS. All rights reserved.
Tumor necrosis factor-
Interleukin-6
a
1. Introduction
(TNF-a) and interleukin-6 (IL-6) by macrophages and T cells
predominantly have been involved in the pathogenesis of inflam-
matory diseases, including rheumatoid arthritis (RA) [7e9].
Suppression and blocking of excessive production of these cyto-
kines and NO could be adopted as important criteria to evaluate
anti-inflammatory effects of compounds. Although therapeutics
Inflammation is a complex process involving various mediators
located in cellular or plasma. Nitric oxide (NO) is a radical with
short half-life generated from L-arginine by NO synthesis isoen-
zymes, especially an isoform of NO synthase (iNOS) [1,2]. Over-
production of NO contributes to the pathogenesis of various human
diseases, including inflammation, septic shock, pain, cardiovascular
disease and cancer [3,4]. The NO inhibitors might allow us to
identify potential therapeutic opportunities [5]. Besides, increasing
evidences suggested that the aberrant proliferation and high
expression of pro-inflammatory cytokines incubated by murine
RAW264.7 macrophage plays a role of great importance in the
pathogenesis and therapeutic process of a variety of pathological
diseases, such as stroke, hypertension, cancer, colitis, and inflam-
mation [6]. Specifically, overproduction of tumor necrosis factor
neutralizing TNF-a, IL-6 and their receptors are already on the
market or in late-phase development [10], suppressive agents of
inflammatory diseases are still one of the hot spots in drug
discovery.
Sinomenine (1), a bioactive natural alkaloid isolated from stem
of a medicinal plant Sinomenium acutum, has been clinically avail-
able for the treatment of rheumatoid arthritis (RA) and inflamma-
tory diseases in China for a long time [11,12]. It also possesses
a variety of other bioactivities, such as inhibitory effects on
mesangial proliferative nephritis, adjuvant arthritis, osteoarthritis,
anti-inflammation mediated neurodegenerative disorders and
immunosuppressive activity [13e15]. However, the clinical use of
sinomenine has been limited because of its weak efficacy, a nee-
ded large dosage, and adverse effects [11,16,17]. To improve the
efficacy, a number of structural modifications of 1 mainly focusing
on rings C and D have been performed, nevertheless, only moderate
* Corresponding author. Tel./fax: þ86 25 83686419.
** Corresponding author. Tel./fax: þ86 717 6397478.
E-mail addresses: d.zhangshuang@gmail.com (Z.-S. Deng), lijxnju@nju.edu.cn
(J.-X. Li).
1
The two authors contributed equally and should be considered co-first authors.
0223-5234/$ e see front matter Ó 2012 Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.ejmech.2012.01.036

64
P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
improvements were achieved [18e21]. Therefore, there is a space
to explore more active molecules with better anti-inflammatory
effects.
concentrated on rings C and D due to the ease of synthesis [19,20],
also several derivatives have been prepared recently in ring B [31].
For ring A, the main modifications were focused on the 1-position
[32,33] and also a few derivatives were reported in 4-OH [34].
Despite the efforts, only some improvement of bioactivities was
achieved [35]. In the present study, aiming at the development of
sinomenine dimers, we chose the 4-OH as the connection site. In
the preparations of dimers, various linkers, such as oligoethylene
glycols, glycine oligomers and alkyl chains together with ester or
ether bond linkages have been reported [23,36e40]. Therefore,
alkyl chains, oligoethylene glycols with varying lengths and
aromatic alcohols were employed via ester or ether linkages to
prepare sinomenine dimers. The monomeric congeners were also
synthesized to better understand the structureeactivity relation-
ship (SAR).
Twin drug is defined as a compound that contains two phar-
macophore components exerting pharmacological effects in
a molecule. It is considered as a promising drug design strategy and
has led quite interesting results [22]. For instance, “bivalent ligand”
has been put forward by Portoghese and his co-workers to describe
molecules containing two recognition moieties in 1982 [23,24], and
has been widely subjected into the design of new lead structures in
drug discovery as one of the most promising and fundamentally
novel approaches [25]. Some morphine molecules targeted to
binding with both m- and d-opioid receptors of G protein-coupled
receptors (GPCRs) simultaneously were found to possess compa-
rable analgesic benefit to morphine and have no side effects
resulted from chronic exposure [26]. Homodimer derivatives also
emerged as enzyme inhibitors because of the active site of the
enzyme in a highly symmetrical fashion, for example, homodimers
of a benzolactam showed a 200-fold high affinity for the protein
2.1. Synthesis of derivatives with ester linkage
Terminal dicarboxylic acids with chain length ranged from 4 to 9
were applied in the formation of sinomenine dimers via an ester
linkage in our initial consideration. After converting the dicarbox-
ylic acids to chlorides with SOCl2 to improve the reactivity, the
produced chlorides were reacted with sinomenine under Et3N and
then subjected to a column chromatography to afford expected
dimers (Scheme 1). However, the same procedure did not give the
desired compounds 1a and 1c, therefore, an alternative strategy
was employed for the esterifications using a condensing agent N,N0-
dicyclohexylcarbodiimide (DCC). Fortunately, 1a and 1c were
successfully prepared when the dicarboxylic acids and sinomenine
were treated with DCC in the presence of catalytic amount of 4-
dimethylaminopyridine (DMAP). The DCC procedure was also
fully applied for the synthesis of monomers. The related mono-
carboxylic acids were reacted with sinomenine to afford the
target compounds 2bef except 2a. Accordingly, 2a was synthesized
via n-butyric chloride prepared from n-butyric acid.
kinase C-a (PKCa) enzyme than the corresponding monomer [27].
In our previous work, we have synthesized several sinomenine
dimers in which sinomenine and its derivatives were directly
coupled via a CeC bond at C-1 position, and found that the inhib-
itory activities of the (S)-dimers on the production of IL-6 and NO
were significantly elevated compared with those of sinomenine,
which however, still did not reach our expectation [28e30]. These
results, together with the reports above gave us a hint that
a bioactivity enhancement might be achieved via preparation of
sinomenine dimers by the means of some flexible spacer. In the
current study, a series of novel homodimers via sinomenine (1) as
the pharmacophore connected through different linkers with
various lengths (2e10 atoms), along with the corresponding
monomeric derivatives were synthesized. The inhibitory activity on
NO production and cytotoxicity of these derivatives were screened
using RAW264.7 cells. The suppressive effect on IL-6 and TNF-a of
the compounds with potent NO inhibitory activity and the
preliminary mechanism were examined in vitro, and finally the
anti-inflammatory effects of two compounds, 2f and 3b, were
further investigated in vivo.
2.2. Synthesis of derivatives with ether linkage
In the synthesis of ether dimers of sinomenine, dibromoalkanes
with different chain lengths (2e10 carbons) were employed.
Conventionally, the formation of ether products is apt to use Wil-
liamson ether synthesis method, including the formation of aryl
ether via aryl oxide ions [41,42]. Unfortunately, we found that the
sinomenine was prone to decompose in the presence of sodium
2. Chemistry
Efforts have been made to obtain sinomenine derivatives
with improved bioactivity, and majority of the modifications
Scheme 1. Synthesis of ester dimers and monomers. Reagents and conditions: (i) DCC, DMAP, CH2Cl2, room temperature, for 1a, 1c, and 2bef. (ii) SOCl2/DMF (cat.), CH2Cl2, reflux.
(iii) Et3N, CH2Cl2, room temperature, for 1b, 1def, and 2a.

P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
65
hydroxide under elevated temperature in N,N-dimethylformamide
(DMF). Thus we turned our steps to other pathway, using potassium
carbonate as a weaker base and acetone as a solvent to achieve mild
reaction conditions, the target ether dimers (3aei) were obtained
in acceptable yields (Scheme 2). It should be noted that the reac-
tions proceed quite slowly (generally about 1e3 days), however,
byproducts were hardly detected except for mono-sinomenine
substituted bromoalkane that was available for synthesis of
dimers. Other solvents such as N,N-dimethylacetamide (DMA) with
higher boiling point were also attempted to accelerate the rate of
the reaction, which nevertheless, produced a mixture of unidenti-
fiable materials.
Due to the low boiling point of bromoethane, monomeric
derivative 4a was synthesized via Mitsunobu reaction [EtOH, dii-
sopropyl azodicarboxylate (DIAD), Ph3P, tetrahydrofuran (THF)] in
a nearly quantitative yield [43]. Other compounds, 4bei were
prepared by reaction with bromoalkane directly under potassium
carbonate at 60 ꢀC. Compared with the preparation of dimers, all
the reactions of monomers were finished within several hours in
more than 96% yields.
with some compounds (1aec, 2a, 2b, 3a, 3m, 3n, 4a, and 4b)
displayed both weak activity and low cytotoxicity IC50 (more
than 100
mM, for simomenine, both activity and cytotoxicity
IC50 > 200
mM). Some compounds (1d, 1e, 2c, 2d, 3e, 3f, 3iek, 4e,
4h, and 4i) were quite cytotoxic, in which their cytotoxicity IC50
values were almost higher than activity IC50. Among all the tested
compounds, six compounds (1f, 2f, 2e, 3b, 3c, and 4f) exhibited
better inhibitory profiles on NO production without obvious
cytotoxicity.
From the data above, a preliminary structureeactivity relation-
ship (SAR) for the compounds could be summarized. For the ester
derivatives: (i) When the linker length is short (carbon number is
4e6 for dimers 1aec, 4 e 5 for monomers 2aeb), almost no impacts
on both activity and cytotoxicity were observed; (ii) When the
linker length is middle (carbon number is 7e8 for dimers, 6 e 7 for
monomers), clear negative effects were found, cytotoxicity IC50 was
higher than activity IC50; (iii) Compounds with longer linkers (1f,
2e, and 2f) showed good inhibitory profile on NO production
without obvious cytotoxicity (Table 1). The results above revealed
that the linker length in the ester-linked sinomenine derivatives
greatly impacted the bio-profiles of the compounds, and the longer
linkers could ameliorate the bioactivity on inhibition of NO
production.
Xylyl-disinomenines 3j and 3k were prepared through reactions
of sinomenine with p- and m-xylylene glycols by Mitsunobu reac-
tion as described before, respectively (Scheme 2). Glycol ethers of
sinomenine were obtained as described in Scheme 2. In
a THFeHMPA (5:1) mixed solvent, the reactions of sinomenine with
glycol di-p-tosylates under sodium hydroxide afforded 3len,
respectively.
For the ether linked compounds, however, an opposite effect
was observed compared with those of ester linked compounds. It
was of great interest that the ether dimers with shorter linker, such
as trimethylene and tetramethylene showed an obvious enhance-
ment in the capacity of inhibition on NO production, especially
3. Results and discussion
compound 3b and 4f possessed IC50 values of 15.2 and 21.3 mM,
respectively, while dimers with longer alkyl chain linkers (4gei)
induced obvious cytotoxicity (Table 1). The dimers with phenyl
dimethyl spacers (3j and 3k) could also lead to a visible inhibition
in cell viability. Glycol scaffolds seemed to reduce the capacity of
inhibition on NO production, serving little effects in the structural
modification with neither visible activity nor obvious cytotoxicity.
From Table 1, both ester and ether linked dimers or monomers
displayed an increased activity compared with sinomenine. It was
interesting that the ether liked dimers showed more potent activity
than ester ones, which gave us a useful direction for the further
research.
3.1. Biological activities
3.1.1. Inhibition of NO production and cytotoxicity in RAW264.7
cells
Initially, we evaluated the inhibitory activity on NO production
of all the synthesized compounds using RAW264.7 cells in the
absence or presence of 500 ng/ml LPS for 24 h to calculate their
activity IC50. The cytotoxicity against RAW246.7 cells was expressed
as cytotoxicity IC50 which inhibited 50% growth of the LPS-
untreated cells. As depicted in Table 1, sinomenine (1), together
Scheme 2. Synthesis of ether dimers and monomers. Reagents and conditions: (i) Dibromoalkane or bromoalkane, acetone, K2CO3, reflux. (ii) Alcohol, DIAD, Ph3P, THF, room
temperature. (iii) Xylylene glycol, DIAD, Ph3P, THF, room temperature. (iv) Glycol di-p-tosylate, THF/HMPA (5:1, v/v), NaOH, reflux.

66
P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
Table 1
sinomenine (1) displayed no inhibitory effects on neither TNF-
a nor
The inhibitory effects on NO production and cytotoxicity of the synthesized
compounds in RAW264.7 cells.
IL-6 production at 10 M (data not shown). These results suggested
m
that these compounds probably worked through distinct pathways,
which promoted us to investigate the possible anti-inflammatory
mechanism.
Compd
Cytotoxicity
IC50
M)a
Activity
IC50 M)
Compd
Cytotoxicity
IC50 M)
Activity
IC50 (mM)
(m
(m
(m
1
>200
>100
>100
>100
52.7
17.3
50.8
>100
>100
78.1
38.6
49.5
58.2
>200
>100
>100
>100
NS
3f
2.6
5.4
3.7
2.8
12.5
14.2
59.7
NS
3.8
2.9
NS
NS
NS
NS
>100
>100
>100
>100
59.6
38.8
NS
1a
1b
1c
1d
1e
1f
2a
2b
2c
2d
2e
2f
3a
3b
3c
3d
3e
3g
3h
3i
3j
3k
3l
3m
3n
4a
4b
4c
4d
4e
4f
3.2. Possible mechanism of inhibition
The most important downstream signal transduction regulators
that have been shown to mediate inflammatory responses include
NS
29.5
>100
>100
NS
nuclear factor (NF-
(MAPK) family [45,46]. LPS-induced activation of NF-
lated with the hyperphosphorylation and degradation of I
Normally in the cytoplasm, I retains NF- B through masking of
the nuclear localization sequences. Upon macrophage activation,
dissociates from the NF- B/I complex, leading to the
translocation of NF- B to the nucleus resulting in the transcription
k
B) and the mitogen-activated protein kinase
B is corre-
[47].
>100
k
>100
>100
>100
kBa
NS
kB
a
k
32.6
24.1
>100
15.2
24.6
3.6
68.1
53.4
29.1
33.8
17.6
14.5
1.9
IkBa
k
kBa
>100
41.1
36.7
4.2
21.3
14.2
NS
k
4g
4h
4i
of specific pro- and anti-inflammatory genes. LPS also stimulates
MAPK cascades, mainly including extracellular signal-regulated
kinase (ERK) 1/2, c-Jun NH2-terminal kinase (JNK), and p38 MAPK
[48]. Upon activation of MAP kinases, the transcription factors
located in the cytoplasm or nucleus are phosphorylated and then
activated, resulting expression of target genes and corresponding
biological responses. On the base of cellular viability and anti-
inflammatory activity in vitro, we chose two compounds 2f and
3b for the further investigation of signaling pathway, Western blot
analysis was applied to evaluate the effects on expression of
pathway-related protein.
9.5
NS
NS
NS: data not shown because activity IC50 is higher than cytotoxicity IC50
IC50 values are the mean values obtained from three separated experiments per-
formed in triplicate.
.
Aminoguanidine was used as a positive control with activity IC50 of 22.6
m
M.
Cytotoxicity IC50: the concentration to inhibit 50% growth of non-LPS activated
cells.
a
3.1.2. Inhibition of TNF-
a and IL-6 production in RAW264.7 cells
As TNF- and IL-6 were two of crucial cytokines among the pro-
a
In the Western blot analysis, 2f suppressed both LPS-induced
inflammatory mediators, their blockers have been recognized as
effective means for the treatment of inflammatory disease [44]. Six
compounds (1f, 2f, 2e, 3b, 3c, and 4f) with better inhibitory activity
on NO overproduction were further exposed to RAW264.7 cells to
investigate the inhibitory effects on TNF-
Time-dependent experiments were carried out at a fixed concen-
tration of 10 M (Table 2) in the current study.
The results revealed that only compound 3b evidently inhibited
LPS-induced TNF- release at 6 and 12 h, while other compounds
have unconspicuous effect on TNF- . However, compounds 2e, 2f,
activation of NF-
phosphorylations of I
MAPK were obviously inhibited by 10
for the phosphorylations of I at 4 h (Fig. 1). Especially, the
phosphorylations of p65 NF- B and p38 MAPK were obviously
k
B and MAPK family in RAW264.7 cells. The
, p65 NF- B, SAPK/JNK, ERK1/2, and p38
M of 2f from 4 to 6 h except
kBa
k
m
kBa
k
a and IL-6 production.
inhibited after treatment with 2f. Moreover, 2f could antagonize
m
a
a
and 4f, especially 2f, possessed remarkable inhibitory activity on
LPS-induced IL-6 production, while the parent compound
Table 2
The inhibitory effects on TNF-
(10 M) in RAW264.7 cells.
a and IL-6 production of the selected compounds
m
Compd
TNF-
6 h
a (pg/ml)
12 h
52.1 ꢁ 0.9
24 h
84.8 ꢁ 4.1
Control
LPS
50.9 ꢁ 0.4
2646.1 ꢁ 499.8
2107.1 ꢁ 133.2
2298.9 ꢁ 256.4
2338.5 ꢁ 108.2
1817.6 ꢁ 158.7a
2018.0 ꢁ 167.5
2248.7 ꢁ 257.8
4126.8 ꢁ 282.0
3614.3 ꢁ 162.2
3357.8 ꢁ 295.3a
4503.8 ꢁ 138.6
3501.9 ꢁ 251.3a
3732.8 ꢁ 209.2
4127.2 ꢁ 92.7
10124.4 ꢁ 1137.2
9003.6 ꢁ 769.8
7676.3 ꢁ 1551.4
9728.9 ꢁ 524.1
8303.2 ꢁ 1347.6
8744.4 ꢁ 1126.2
9134.7 ꢁ 786.3
1f þ LPS
2e þ LPS
2f þ LPS
3b þ LPS
3c þ LPS
4f þ LPS
IL-6 (pg/ml)
Control
LPS
3.1 ꢁ 1.8
1046.1 ꢁ 111.2
825.5 ꢁ 7.9a
229.9 ꢁ 39.5a
148.5 ꢁ 4.4a
949.7 ꢁ 114.3
853.3 ꢁ 64.1a
207.5 ꢁ 23.8a
7.2 ꢁ 3.4
44.4 ꢁ 7.8
2145.1 ꢁ 368.7
1577.1 ꢁ 148.7a
733.3 ꢁ 88.4a
223.7 ꢁ 86.5a
1667.8 ꢁ 231.6
1321.9 ꢁ 246.2a
513.9 ꢁ 34.3a
13412.0 ꢁ 1167.6
12863.3 ꢁ 1760.7
7143.8 ꢁ 1287.7a
486.3 ꢁ 221.0a
1f þ LPS
2e þ LPS
2f þ LPS
3b þ LPS
3c þ LPS
4f þ LPS
13096.9 ꢁ 1488.4
10038.7 ꢁ 1192.6
4370.2 ꢁ 1519.0a
Fig. 1. The effects of compounds 2f and 3b on LPS-induced phosphorylations of JNK,
ERK1/2, p38 MAPK, NF-
treated with 2f and 3b (10
MAPK, NF- B p65, I , and their phosphorylated forms (p-) at 2, 4 and 6 h incubations
in the cellular lysates were analyzed using Western blotting.
k
B p65, and I
kBa in RAW264.7 cells. RAW264.7 cells were
mM) and LPS (500 ng/mL). The levels of JNK, ERK1/2, p38
Results are shown as mean ꢁ SD (n ¼ 3).
k
kBa
a
p < 0.01, significant difference vs control.

P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
67
Fig. 2. Effects of 2f and 3b on NF-
unlabeled and p65 of NF- B antibody supershift assay. (B) RAW264.7 cells transfected with the NF-
presence of increasing concentrations of 2f and 3b (5, 10, or 20
M), then the luciferase activity was measured. Values are means ꢁ SD (n ¼ 3). #p < 0.01 versus normal (without any
treatments). *p < 0.05, **p < 0.01 versus control (treated with LPS only).
k
B binding to nuclear proteineDNA. (A) Specificity of DNAeprotein complex was confirmed with EMAS assay by competition with a 100ꢂ excess of
k
k
B-dependent reporter construct were incubated with LPS (500 ng/mL) in the
m
degradation of I
result and luciferase activity showed that 2f also significantly
inhibited NF- B-DNA interaction activity (Fig. 2). Interestingly, 2f
exhibited intensive effects on the phosphorylation of p65 NF-
and the effect lasted permanently during the whole process. These
data demonstrated that compound 2f influenced multiple inflam-
matory signal transduction regulators.
k
B
a
. Electrophoretic mobility shift assay (EMSA)
alone) to 80% at 19 h after LPS injection. At 24 h after LPS injection,
survival rate of 2f pretreated mice was 30% while that of untreated
mice was only 10% (Fig. 3). Pretreatment of 3b significantly allevi-
ated the LPS-induced mortality. After LPS challenge, survival rate of
3b pretreated mice was greatly improved to 70% compared with
10% of untreated mice, and 3b displayed a much better effect
compared with 2f.
k
kB
For the compound 3b, the results of Western blot analysis
We further investigated whether 3b and 2f could inhibit the
revealed that 10
m
M of 3b had no significant suppression on the
secretions of TNF-
mice. As shown in Fig. 4, after 3 h of LPS exposure, the serum TNF-
and IL-6 levels were markedly increased, pretreatments of 3b and
2f (15 mg/kg) significantly decreased the serum levels of both TNF-
and IL-6. It should be noted that in RAW246.7 cell assay, 3b
inhibited only TNF- production while 2f inhibited only IL-6
production, however, different from the in vitro data, 3b and 2f
suppressed both of TNF- and IL-6 in the experiment in vivo.
a and IL-6 in serum of LPS-induced septic shock
LPS-induced activation of MAPK family, including the phosphory-
lations of SAPK/JNK and p38 during whole experiment period.
Besides, 3b could even activate the phosphorylation of ERK. It was
reported that sinomenine augmented apoptosis of macrophages by
activation of ERK [49], which might be associated with the current
a
a
a
result. For the NF-
after treatment with 3b was decreased obviously especially at 6 h
(Fig. 1), also the phosphorylation of I at 6 h was suppressed
moderately. Moreover, 3b could antagonize degradation of I
from 4 to 6 h. EMSA result showed that 10 M of 3b had no obvious
effect on NF- B-DNA interaction activity (Fig. 2A), which was also
confirmed by luciferase assay (Fig. 2B), however, 20 M of 3b could
obviously suppress NF- B-DNA interaction activity as shown in NF-
B-luc activity. These results revealed that 3b suppressed LPS-
induced inflammatory response specifically through inhibition of
NF- B and I activation together with I degradation, not
kB pathway, the phosphorylation of p65 NF-kB
a
kB
a
The results might be an indirect effect of the compounds in animal
body, to clarify it, further research is essential. The same as
survival rate, 3b showed a more potent inhibitory effect on TNF-
kBa
m
k
m
k
k
k
kB
a
kBa
MAPK pathway. Taken all together, these results above encouraged
us to further explore the anti-inflammatory effect in vivo.
3.3. Treatment of LPS-induced septic shock
Sepsis, a leading cause of death in critically ill patients, is an
infection-related syndrome with two or more features of systemic
inflammation. As sepsis progresses to septic shock, the risk of death
increases substantially [50]. LPS-induced septic shock model that
mimics many of the initial clinical features of sepsis, including
increases in pro-inflammatory cytokines such as TNF-a and IL-6,
has been widely used for the evaluation of anti-inflammatory
effect [51]. Thus, we studied whether compounds provide the
protective effects against systemic inflammatory toxicity by LPS
using septic shock mice model.
Balb/c mice were pretreated with 2f and 3b for 3 days (15 mg/
kg/day, i.p.), and then exposed to LPS (20 mg/kg, i.p.) challenge.
Pretreatment of 2f elevated the survival rate from 30% (in LPS
Fig. 3. Effects of 3b and 2f on LPS-induced lethality in mice (n ¼ 10). Mice were
injected (i.p.) with 20 mg/kg LPS. Compounds (2f or 3b) were injected (i.p. 15 mg/kg)
once per day for
3 days prior to LPS injection. Results were evaluated by the
KaplaneMeier method. The differences between the control group (LPS only) and the
treatment groups are statistically significant.

68
P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
Fig. 4. Effects of 3b and 2f on LPS-induced TNF-
a
and IL-6 levels in serum (n ¼ 6). Mice were injected (i.p.) with 20 mg/kg LPS. Compounds (2f and 3b) were injected (i.p. 15 mg/kg)
once per day for 3 days prior to LPS injection. #p < 0.01 versus blank (without any treatments). *p < 0.05 versus control (treated with LPS only).
a
production compared with 2f, which might correlate with its
apparatus and were uncorrected. Chromatographic separations
were performed on silica gel columns chromatography (Kieselgel
300e400 mesh) with CH2Cl2/CH3OH (15:1e9:1, v/v) or EtOAc/
CH3OH/H2O (37:2:1e17:2:1, v/v/v) as eluents. All reactions were
monitored by TLC on GF254 plates that were visualized under a UV
lamp (254 nm) or with I2 detection. Evaporation of solvent was
performed in vacuo with rotating evaporator. The purity of the
final compounds was determined by HPLC on an Agilent 1200
system using a Agilent Eclipse XPB-C18 column (4.6 ꢂ 150 mm,
better survival rate. As shown above, the consequences of LPS-
induced septic shock model indicated that 2f and 3b were poten-
tial anti-inflammatory agents on antagonism of systemic inflam-
matory toxicity.
4. Conclusions
In this paper, sinomenine homodimers together with monomers
that linked via ester and ether bonds were synthesized and their
bioactivities were evaluated. The novel homodimer derivative (3b)
and monomer compound (2f) effectively inhibited LPS-induced
5 mm particle size) with a gradient mobile phase of CH3OH/H2O
(45:55, v/v) with 0.125% of ethylenediamine (EDA) to CH3OH/H2O
(80:20, v/v) with 0.125% of EDA to CH3OH/H2O (100:0, v/v) with
0.125% of EDA at a flow rate of 1 mL/min, with UV monitoring at
the wavelength of 254 nm with a runtime of 35 min. The
compound purity analysis data of final compounds (greater than
95%) were provided in the Supplementary data.
inflammatory mediators (NO, IL-6, or TNF-
Furthermore, 3b specifically inhibited the phosphorylation of NF-
B and the degradation of I in the NF- B signaling pathway;
while 2f not only suppressed I , p65 NF- B phosphorylations in
the NF- B signaling pathway, but also ERK1/2, JNK, and p38 MAP
a) in RAW264.7 cells.
k
kBa
k
kBa
k
k
kinase phosphorylations in the MAPK signaling pathway. Moreover,
in vivo assay demonstrated that 3b and 2f displayed the protective
effects against systemic inflammatory toxicity by LPS. These
observations suggested that sinomenine homodimers with short
ether linker (3b) and its monomers with long ester linker (2f)
might have a great potential to be new leads for anti-inflammatory
drug discovery. The current results might open new avenues
of realizing mechanism for sinomenine derivatives and investi-
gating new anti-inflammatory agents. Further synthesis of related
compounds and detailed mechanism studies of 3b and 2f are
undergoing in our laboratory.
5.1.2. General procedure for the synthesis of ester homodimers
(1aef)
Method A (1b, 1def): A mixture of dicarboxylic acid (0.6 mmol),
SOCl2 (10 mL) and two drops of dry DMF was refluxed for 4e6 h and
then the excessive SOCl2 was removed under vacuum. The afforded
chloride was added dropwise to a solution of sinomenine (329 mg,
1 mmol) and Et3N (1.5 mmol) in dry CH2Cl2 (10 mL) in an ice bath
over 10 min. Then the ice bath was removed, the reaction solution
was allowed to stir at ambient temperature overnight and then
added with saturated NaHCO3 (5 mL). The organic layer was
separated and then washed with brine, dried over anhydrous
Na2SO4, filtered, concentrated, and purified by silica gel column
chromatography (EtOAc/MeOH/NH4OH, 37:2:1e17:2:1, v/v/v),
affording the title compounds as a white solid.
5. Experimental protocols
5.1. Chemistry
Method B (1a, 1c): To a solution of sinomenine (1) (329 mg,
1 mmol) and dicarboxylic acid (0.6 mmol) in dichloromethane
(10 mL) was added DCC (412 mg, 2 mmol) and DMAP (0.2 mmol),
the mixture was stirred at ambient temperature for 2 days and then
filtered and washed with CH2Cl2 (10 mL ꢂ 2). The filtrate was
evaporated in vacuum and 10% ammonia (30 mL) was added and
then extracted with CH2Cl2 (30 mL ꢂ 3). The combined organic
layer was washed with brine, dried over anhydrous Na2SO4, filtered
and concentrated. Purification by silica gel column chromatography
(EtOAc/MeOH/NH4OH, 37:2:1e17:2:1, v/v/v) afforded the title
compounds.
5.1.1. General experimental information
Sinomenine was purchased from Great Dragon Natural Drug
Biotechnological Ltd. and other chemicals were purchased from
Alfa Aesar China (Tianjin) Co. or Acros Organics and were used
without further purification. 1H and 13C NMR spectra were
measured on a Bruker Advance II 300 (300 MHz) spectrometer
using tetramethylsilane (TMS) as internal standard. Chemical
shifts (d) are reported in parts per million (ppm) and coupling
constants (J) values are in hertz (Hz); 13C NMR spectra were fully
decoupled, and the following abbreviations are used: singlet (s),
doublet (d), triplet (t), doubleedouble (dd), doubleetriplet (dt),
tripletedouble (td), broad (br) and multiplet (m). Melting points
were determined on a Taike X-4 digital micromelting point
5.1.2.1. 4,40-Succinyl-disinomenine (1a). Yield 57%; white solid; mp
146e147 ꢀC. 1H NMR (300 MHz, CDCl3)
6.73 (d, J ¼ 8.4 Hz, 2H), 5.44 (d, J ¼ 1.5 Hz, 2H), 3.89 (d, J ¼ 15.9 Hz,
d
6.89 (d, J ¼ 8.4 Hz, 2H),

P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
69
2H), 3.72 (s, 6H), 3.46 (s, 6H), 3.09e3.18 (m, 4H), 2.93e3.06 (m, 6H),
2.71 (dd, J ¼ 18.3, 5.1 Hz, 2H), 2.39e2.46 (m, 4H), 2.39 (s, 6H),
5.1.3. General procedure for the synthesis of ester monomers (2aef)
Method A (2bef): To a solution of sinomenine (1) (329 mg,
1 mmol) and carboxylic acid (1.2 mmol) in dioxane (10 mL) was
added DCC (412 mg, 2 mmol) and DMAP (0.2 mmol), the mixture
was stirred under reflux for 20e48 h and then filtered and washed
with CH2Cl2 (10 mL ꢂ 2). The filtrate was evaporated in vacuum and
10% ammonia (30 mL) was added and then extracted with CH2Cl2
(30 mL ꢂ 3). The combined organic layer was washed with brine,
dried over anhydrous Na2SO4, filtered and concentrated. Purifica-
tion by silica gel column chromatography (CH2Cl2/MeOH, 15:1, v/v)
afforded the title compounds as a white solid.
Method B (2a): A mixture of carboxylic acid (0.6 mmol) and
SOCl2 (10 mL) was refluxed for 3e5 h and then the excessive SOCl2
was removed under vacuum. The afforded acid chloride was added
dropwise into a solution of sinomenine (329 mg, 1 mmol) and Et3N
(1.5 mmol) in dry CH2Cl2 (10 mL) over 10 min, then the reaction
solution was kept at ambient temperature overnight, quenched
with saturated NaHCO3 (5 mL) and diluted with dichloromethane
(20 mL). The organic layer was separated and then washed with
brine, dried over anhydrous sodium sulfate, filtered, and concen-
trated. The residual was purified by silica gel column chromatog-
raphy (CH2Cl2/MeOH, 15:1, v/v), affording the title compound as
a white solid at nearly quantitative yield.
1.99e2.10 (m, 6H); 13C NMR (75 MHz, CDCl3)
d 192.6, 170.7, 152.3,
149.5, 139.3, 130.0, 129.6, 125.3, 114.8, 110.6, 56.2, 55.8, 54.7, 49.8,
46.5, 45.7, 42.5, 40.5, 36.6, 28.9, 24.1. Positive ESIeMS m/z: 741
(M þ H)þ. HRMS: calcd for C42H49N2O10 (M þ H), 741.3387; found,
741.3375.
5.1.2.2. 4,40-Glutaryl-disinomenine (1b). Yield 51%; white solid; mp
138e140 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.89 (d, J ¼ 8.4 Hz, 2H),
6.73 (d, J ¼ 8.4 Hz, 2H), 5.45 (s, 2H), 3.71e3.84 (m, 2H), 3.74 (s, 6H),
3.46 (s, 6H), 3.16 (br, 2H), 2.97e3.06 (m, 4H), 2.81e2.91 (m, 2H),
2.74 (d, J ¼ 5.7 Hz, 2H), 2.68 (d, J ¼ 5.1 Hz, 2H), 2.52 (br, 2H), 2.46 (br,
2H), 2.41 (s, 6H), 2.22 (dt, J ¼ 14.1, 6.6 Hz, 2H), 1.96e2.14 (m, 4H),
1.85 (td, J ¼ 12.3, 4.2 Hz, 2H), 1.58 (d, J ¼ 8.1 Hz, 2H); 13C NMR
(75 MHz, CDCl3)
d 192.5, 170.6, 152.5, 149.8, 139.6, 130.0, 129.8,
125.5, 115.1, 110.8, 56.5, 56.0, 54.9, 50.2, 46.7, 46.0, 42.8, 40.7, 37.2,
33.4, 29.8, 24.3, 20.2. Positive ESIeMS m/z: 755 (M þ H)þ. HRMS:
calcd for C43H51N2O10 (M þ H), 755.3544; found, 755.3548.
5.1.2.3. 4,40-Adipoyl-disinomenine (1c). Yield 59%; white solid; mp
134e136 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.91 (d, J ¼ 5.1 Hz, 2H),
6.76 (d, J ¼ 5.1 Hz, 2H), 5.48 (d, J ¼ 0.9 Hz, 2H), 3.87 (d, J ¼ 9.6 Hz,
2H), 3.74 (s, 6H), 3.50 (s, 6H), 3.16e3.21 (m, 2H), 3.02e3.08 (m, 4H),
2.65e2.79 (m, 6H), 2.52e2.58 (m, 4H), 2.45 (s, 6H), 2.13 (t,
5.1.3.1. 4-Butyryl-sinomenine (2a). Yield 94%; white solid; mp
J ¼ 6.0 Hz, 2H),1.87e2.06 (m, 8H); 13C NMR (75 MHz, CDCl3)
d
192.2,
79e82 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.90 (d, J ¼ 8.4 Hz, 1H), 6.75
170.8, 152.3, 149.7, 139.5, 129.9, 129.6, 125.3, 114.8, 110.7, 56.3, 55.8,
54.7, 49.9, 47.0, 46.7, 46.5, 45.7, 42.5, 40.5, 36.9, 33.9, 24.1. Positive
ESIeMS m/z: 769 (M þ H)þ. HRMS: calcd for C44H53N2O10 (M þ H),
769.3700; found, 769.3686.
(d, J ¼ 8.4 Hz, 1H), 5.46 (d, J ¼ 1.8 Hz, 1H), 3.86 (d, J ¼ 16.2 Hz, 1H),
3.71 (s, 3H), 3.48 (s, 3H), 3.21 (t, J ¼ 4.2 Hz, 1H), 3.02e3.08 (br, 2H),
2.75 (dd, J ¼ 18.0, 5.4 Hz, 1H), 2.46e2.71 (m, 4H), 2.44 (s, 3H), 2.13
(td, J ¼ 12.0, 2.7 Hz, 1H), 1.75e1.92 (m, 3H), 1.58e1.67 (m, 1H), 1.05
(t, J ¼ 4.5 Hz, 3H); 13C NMR (75 MHz, CDCl3)
d 192.2, 171.3, 152.3,
5.1.2.4. 4,40-Pimeloyl-disinomenine (1d). Yield 44%; white solid; mp
149.6, 139.5, 129.8, 129.6, 125.2, 114.9, 110.7, 56.1, 55.7, 54.7, 49.9,
46.4, 45.6, 42.4, 40.4, 36.8, 36.2, 24.1, 18.2, 13.5. Positive ESIeMS m/
z: 400 (M þ H)þ, HRMS: calcd for C23H30NO5 (M þ H), 400.2124;
found, 400.2093.
128e130 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.89 (d, J ¼ 8.4 Hz, 2H),
6.63 (d, J ¼ 8.4 Hz, 2H), 5.46 (d, J ¼ 1.5 Hz, 2H), 3.83 (d, J ¼ 15.3 Hz,
2H), 3.71 (s, 6H), 3.47 (s, 6H), 3.18 (t, J ¼ 3.6 Hz, 2H), 2.99e3.06 (m,
4H), 2.47e2.77 (m, 10H), 2.41 (s, 6H), 1.98e2.13 (m, 4H), 1.78e1.91
(m, 6H), 1.54e1.62 (m, 2H); 13C NMR (75 MHz, CDCl3)
d
192.5,
5.1.3.2. 4-Valeryl-sinomenine (2b). Yield 86%; white solid; mp
171.7, 152.5, 149.9, 139.6, 130.0, 129.8, 125.5, 115.0, 110.9, 56.4, 56.0,
54.9, 50.1, 46.7, 45.8, 42.7, 40.6, 37.1, 34.5, 28.6, 24.6, 24.3, 19.3.
Positive ESIeMS m/z: 783 (M þ H)þ. HRMS: calcd for C45H55N2O10
(M þ H), 783.3857; found, 783.3906.
85e87 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.91 (d, J ¼ 8.4 Hz, 1H), 6.75
(d, J ¼ 8.4 Hz, 1H), 5.46 (d, J ¼ 1.8 Hz, 1H), 3.86 (d, J ¼ 15.6 Hz, 1H),
3.72 (s, 3H), 3.48 (s, 3H), 3.25 (t, J ¼ 3.9 Hz, 1H), 3.02e3.08 (m, 2H),
2.54e2.82 (m, 4H), 2.50 (d, J ¼ 15.6 Hz, 1H), 2.45 (s, 3H), 2.14 (td,
J ¼ 12.3, 2.7 Hz, 1H), 1.89 (td, J ¼ 12.6, 4.5 Hz, 1H), 1.73e1.78 (m, 2H),
1.60 (d, J ¼ 12.6 Hz, 1H), 1.45 (td, J ¼ 15.0, 4.5 Hz, 2H), 0.97 (t,
5.1.2.5. 4,40-Suberoyl-disinomenine (1e). Yield 49%; white solid; mp
119e121 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.90 (d, J ¼ 8.4 Hz, 2H),
J ¼ 7.2 Hz, 3H); 13C NMR (75 MHz, CDCl3)
d 192.1, 171.6, 152.3, 149.7,
6.75 (d, J ¼ 8.4 Hz, 2H), 6.46 (d, J ¼ 1.2 Hz, 2H), 3.81e3.86 (m, 2H),
3.72 (s, 6H), 3.48 (s, 6H), 3.20 (t, J ¼ 3.9 Hz, 2H), 3.01e3.08 (br, 4H),
2.51e2.79 (m, 8H), 2.44 (s, 6H), 2.14 (dd, J ¼ 12.0, 2.1 Hz, 2H),
2.01e2.07 (m, 4H), 1.90 (dd, J ¼ 12.9, 4.5 Hz, 2H), 1.79e1.83 (m, 4H),
139.5, 129.6, 129.3, 125.2, 114.4, 110.6, 56.1, 55.7, 54.7, 49.7, 46.4,
45.3, 42.2, 40.3, 36.6, 34.0, 26.7, 24.1, 22.0, 13.6. Positive ESIeMS m/
z: 414 (M þ H)þ, HRMS: calcd for C24H32NO5 (M þ H), 414.2280;
found, 414.2250.
1.51e1.62 (m, 4H); 13C NMR (75 MHz, CDCl3)
d 192.5, 171.7, 152.6,
150.0, 139.8, 130.1, 129.8, 125.4, 115.0, 111.0, 56.6, 56.1, 55.0, 50.2,
46.8, 45.9, 42.7, 40.7, 37.1, 34.5, 29.8, 28.9, 24.8, 24.4. Positive
ESIeMS m/z: 797 (M þ H)þ. HRMS: calcd for C46H57N2O10 (M þ H),
797.4013; found, 797.3988.
5.1.3.3. 4-Caproyl-sinomenine (2c). Yield 84%; white solid; mp
76e78 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.89 (d, J ¼ 8.4 Hz, 1H), 6.73
(d, J ¼ 8.4 Hz, 1H), 5.46 (d, J ¼ 2.1 Hz, 1H), 3.85 (d, J ¼ 16.2 Hz, 1H),
3.70 (d, 3H), 3.47 (s, 3H), 3.19 (t, J ¼ 4.2 Hz, 1H), 2.98e3.07 (m, 2H),
3.49e2.78 (m, 4H), 2.47 (d, J ¼ 16.2 Hz, 1H), 2.45 (s, 3H), 2.11 (td,
J ¼ 12.0, 2.7 Hz, 1H), 1.85 (td, J ¼ 12.6, 4.5 Hz, 1H), 1.72e1.79 (m, 2H),
1.58 (d, J ¼ 12.6 Hz, 1H), 1.34e1.43 (m, 4H), 0.92 (t, J ¼ 7.2 Hz); 13C
5.1.2.6. 4,40-Azelaoyl-disinomenine (1f). Yield 54%; white solid; mp
96e98 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.89 (d, J ¼ 8.4 Hz, 2H), 6.73
(d, J ¼ 8.4 Hz, 2H), 5.46 (d, J ¼ 1.2 Hz, 2H), 3.84 (d, J ¼ 15.9 Hz, 2H),
3.70 (s, 6H), 3.47 (s, 6H), 3.19 (t, J ¼ 3.9 Hz, 2H), 3.00e3.06 (br, 4H),
2.74 (dd, J ¼ 17.7, 5.4 Hz, 2H), 2.50e2.67 (m, 6H), 2.49 (d, J ¼ 15.9 Hz,
2H), 2.42 (s, 6H), 1.99e2.14 (m, 4H), 1.86 (td, J ¼ 12.6, 4.2 Hz, 2H),
1.75e1.80 (m, 2H), 1.43e1.60 (m, 8H); 13C NMR (75 MHz, CDCl3)
NMR (75 MHz, CDCl3) d 192.2, 171.6, 152.3, 149.6, 139.5, 129.8, 129.6,
125.1, 114.9, 110.7, 56.2, 55.7, 54.7, 49.9, 46.5, 45.6, 42.5, 40.4, 36.9,
34.2, 31.1, 24.3, 24.1, 22.2, 13.8. Positive ESIeMS m/z: 428 (M þ H)þ,
HRMS: calcd for C25H34NO5 (M þ H), 428.2437; found, 428.2406.
d
192.5, 172.0, 152.5, 149.9, 139.7, 130.0, 129.7, 125.4, 115.0, 111.0,
5.1.3.4. 4-Heptanoyl-sinomenine (2d). Yield 89%; white solid; mp
56.4, 56.0, 54.9, 50.1, 46.7, 45.8, 42.7, 40.6, 37.1, 34.5, 29.1, 24.9, 24.3,
22.7. Positive ESIeMS m/z: 811 (M þ H)þ. HRMS: calcd for
C47H59N2O10 (M þ H), 811.4170; found, 811.4150.
73e75 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.90 (d, J ¼ 8.4 Hz, 1H), 6.75
(d, J ¼ 8.4 Hz, 1H), 5.45 (d, J ¼ 1.8 Hz, 1H), 3.85 (d, J ¼ 15.9 Hz, 1H),
3.71 (s, 3H), 3.48 (s, 3H), 3.34 (t, J ¼ 3.9 Hz, 1H), 3.04 (br, 2H),

70
P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
2.51e2.87 (m, 4H), 2.50 (d, J ¼ 15.9 Hz, 1H), 2.46 (s, 3H), 2.78 (t,
J ¼ 7.5 Hz, 1H), 2.17 (td, J ¼ 12.0, 2.4 Hz, 1H), 1.92 (td, J ¼ 12.6, 4.5 Hz,
1H), 1.71e1.81 (m 2H), 1.57e1.62 (m, 2H), 1.25e1.44 (m, 6H), 0.90 (t,
5.1.4.3. 4,40-Tetramethylene-disinomenine (3c). Yield 61%; white
solid; mp 124e125 ꢀC. 1H NMR (300 MHz, CDCl3)
6.70 (s, 4H), 5.47
d
(s, 2H), 4.11e4.23 (m, 6H), 3.77 (s, 6H), 3.48 (s, 6H), 3.15 (s, 2H), 2.98
(d, J ¼ 16.8 Hz, 4H), 2.76 (td, J ¼ 17.7, 4.8 Hz, 2H), 2.46e2.52 (m, 4H),
J ¼ 7.2 Hz); 13C NMR (75 MHz, CDCl3)
d 192.0, 171.6, 152.3, 149.9,
139.5, 129.4, 128.6, 125.3, 114.2, 110.9, 55.9, 55.7, 54.7, 49.5, 46.3,
44.7, 41.7, 40.0, 36.2, 34.3, 31.3, 28.6, 24.6, 24.2, 22.4, 13.9. Positive
ESIeMS m/z: 442 (M þ H)þ, HRMS: calcd for C26H36NO5 (M þ H),
442.2593; found, 442.2563.
2.41 (s, 6H), 1.91e2.04 (m, 12H); 13C NMR (75 MHz, CDCl3)
d 193.9,
152.6, 151.6, 148.3, 130.2, 130.1, 122.6, 115.6, 111.6, 72.1, 56.7, 55.9,
54.9, 50.0, 47.2, 46.1, 42.8, 41.0, 37.4, 27.0, 24.8. Positive ESIeMS m/z:
713 (M þ H)þ. HRMS: calcd for C42H53N2O8 (M þ H), 713.3802;
found, 713.3782.
5.1.3.5. 4-Capryloyl-sinomenine (2e). Yield 91%; white solid; mp
70e72 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.88 (d, J ¼ 8.4 Hz, 1H), 6.72
5.1.4.4. 4,40-Pentamethylene-disinomenine (3d). Yield 65%; white
(d, J ¼ 8.4 Hz, 1H), 5.46 (d, J ¼ 1.8 Hz, 1H), 3.85 (d, J ¼ 15.9 Hz, 1H),
3.70 (s, 3H), 3.47 (s, 3H), 3.17 (t, J ¼ 4.2 Hz, 1H), 2.96e3.06 (br, 2H),
2.47e2.76 (m, 4H), 2.46 (d, J ¼ 15.9 Hz, 1H), 2.41 (s, 3H), 2.09 (td,
J ¼ 12.0, 2.4 Hz, 1H), 1.71e1.89 (m, 3H), 1.58 (d, J ¼ 12.0 Hz, 1H),
1.29e1.41 (m, 8H), 0.88 (t, J ¼ 6.9 Hz, 3H); 13C NMR (75 MHz, CDCl3)
solid; mp 100e102 ꢀC. 1H NMR (300 MHz, CDCl3)
d 6.70 (d,
J ¼ 8.4 Hz, 2H), 6.67 (d, J ¼ 8.4 Hz, 2H), 5.47 (s, 2H), 4.18 (d, J ¼ 15.9
Hz, 2H), 4.05 (dt, J ¼ 19.8, 6.9 Hz, 4H), 3.76 (s, 6H), 3.47 (s, 6H), 3.13
(t, J ¼ 3.9 Hz, 2H), 2.97 (d, J ¼ 17.1 Hz, 4H), 2.71 (dd, J ¼ 18.0, 4.8 Hz,
2H), 2.44e2.51 (m, 4H), 2.39 (s, 6H), 1.86e2.03 (m, 10H), 1.66 (d,
d
192.2, 171.5, 152.2, 149.5, 139.4, 129.8, 129.7, 125.1, 115.0, 110.6,
J ¼ 15.0, 7.5 Hz, 2H); 13C NMR (75 MHz, CDCl3)
d 194.0, 152.6, 151.6,
56.1, 55.6, 54.6, 49.9, 46.4, 45.7, 42.5, 40.4, 36.9, 34.2, 31.5, 28.8, 28.7,
24.6, 24.0, 22.4, 13.9. Positive ESIeMS m/z: 456 (M þ H)þ, HRMS:
calcd for C27H38NO5 (M þ H), 456.2750; found, 456.2714.
148.2, 130.1, 130.0, 122.6, 115.5,111.4, 72.3, 56.7, 55.9, 54.9, 49.9, 47.1,
46.1, 42.8, 40.8, 37.4, 30.4, 24.7, 22.4. Positive ESIeMS m/z: 727
(M þ H)þ. HRMS: calcd for C43H55N2O8 (M þ H), 727.3958; found,
727.3941.
5.1.3.6. 4-Nonanoyl-sinomenine (2f). Yield 82%; white solid; mp
66e68 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.90 (d, J ¼ 8.4 Hz, 1H), 6.75
5.1.4.5. 4,40-Hexamethylene-disinomenine (3e). Yield 63%; white
(d, J ¼ 8.4 Hz, 1H), 5.45 (d, J ¼ 1.5 Hz, 1H), 3.85 (d, J ¼ 15.9 Hz, 1H),
3.71 (s, 3H), 3.47 (s, 3H), 3.28 (t, J ¼ 3.6 Hz, 1H), 3.03 (br, 2H), 2.79
(dd, J ¼ 18.6, 5.4 Hz,1H), 2.50e2.71 (m, 3H), 2.49 (d, J ¼ 15.9 Hz,1H),
2.45 (s, 3H), 2.15 (td, J ¼ 12.3, 2.4 Hz, 1H), 2.02 (d, J ¼ 4.8 Hz, 1H),
1.90 (td, J ¼ 12.6, 4.5 Hz, 1H), 1.73e1.76 (m, 2H), 1.59 (d, J ¼ 12.6 Hz,
1H), 1.23e1.40 (m, 9H), 0.88 (t, J ¼ 6.9 Hz, 3H); 13C NMR (75 MHz,
solid; mp 68e69 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.72 (d, J ¼ 8.4 Hz,
2H), 6.68 (d, J ¼ 8.4 Hz, 2H), 5.49 (s, 2H), 4.25 (d, J ¼ 16.5 Hz, 2H),
4.03e4.11 (m, 4H), 3.77 (s, 6H), 3.48 (s, 6H), 3.16 (s, 2H), 2.99 (d,
J ¼ 18.0 Hz, 4H), 2.73 (dd, J ¼ 18.0, 4.8 Hz, 2H), 2.50 (t, J ¼ 4.8 Hz,
2H), 2.41 (s, 6H), 2.35 (d, J ¼ 6.3 Hz, 2H), 1.90e1.99 (m, 8H),
1.57e1.70 (m, 6H); 13C NMR (75 MHz, CDCl3)
d 193.9, 152.5, 151.5,
CDCl3)
d
192.0, 171.7, 152.3, 150.0, 139.5, 129.6, 129.1, 125.2, 114.4,
148.1, 130.1, 130.0, 122.5, 115.5, 111.4, 72.2, 56.5, 55.8, 54.8, 49.9, 47.1,
46.1, 42.7, 40.8, 37.3, 30.3, 25.9, 24.6. Positive ESIeMS m/z: 741
(M þ H)þ. HRMS: calcd for C44H57N2O8 (M þ H), 741.4115; found,
741.4106.
110.8, 56.1, 55.8, 54.7, 49.7, 46.4, 45.0, 42.0, 40.2, 36.5, 34.3, 31.7,
29.1, 29.0, 28.9, 24.7, 24.1, 22.5, 14.0. Positive ESIeMS m/z: 470
(M þ H)þ, HRMS: calcd for C28H40NO5 (M þ H), 470.2906; found,
470.2872.
5.1.4.6. 4,40-Heptamethylene-disinomenine (3f). Yield 66%; white
5.1.4. General procedure for synthesis of ether homodimers (3aei)
To a solution of sinomenine (1) (329 mg, 1 mmol) and dibro-
moalkane (0.5 mmol) in dry acetone (2 mL) was added potassium
carbonate (690 mg, 5 mmol). The mixture was stirred at 60 ꢀC until
the starting material was no longer detected by TLC. The reaction
mixture was then filtered and solvent was removed under vacuum
to afford the crude product, which was purified by gel column
chromatography to give title compounds as a foamy pale-white
solid.
solid; mp 57e59 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.70 (t, J ¼ 9.0 Hz,
4H), 5.48 (d, J ¼ 1.5 Hz, 2H), 4.18 (d, J ¼ 15.9 Hz, 2H), 4.00e4.07 (m,
4H), 3.77 (s, 6H), 3.49 (s, 6H), 3.20 (br t, 2H), 2.96e3.02 (br, 4H), 2.77
(dd, J ¼ 18.0, 5.4 Hz, 2H), 2.56 (d, J ¼ 11.1 Hz, 2H), 2.48 (d, J ¼ 15.9 Hz,
2H), 2.45 (s, 6H), 1.86e2.07 (m, 10H), 1.50 (br, 6H); 13C NMR
(75 MHz, CDCl3) d 193.6, 152.4, 151.5, 148.1, 130.0, 122.3, 115.0, 111.3,
72.2, 56.6, 55.6, 54.7, 49.6, 47.1, 45.7, 42.5, 40.6, 37.0, 30.2, 29.4, 25.8,
24.5. Positive ESIeMS m/z: 755 (M þ H)þ, HRMS: calcd for
C45H59N2O8 (M þ H), 755.4271; found, 755.4262.
5.1.4.1. 4,40-Dimethylene-disinomenine (3a). Yield 36%; white solid;
5.1.4.7. 4,40-Octamethylene-disinomenine (3g). Yield 70%; white
mp 210e212 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.19e6.25 (m, 4H),
solid; mp 58e60 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.68 (d, J ¼ 8.1 Hz,
5.41 (d, J ¼ 1.5 Hz, 2H), 4.37 (d, J ¼ 15.6 Hz, 2H), 3.64 (s, 6H), 3.62 (d,
J ¼ 1.5 Hz, 2H), 3.46 (s, 6H), 3.18 (t, J ¼ 4.2 Hz, 2H), 3.00 (br, 2H),
2.75e2.81 (m, 2H), 2.54 (dd, J ¼ 6.0, 2.7 Hz, 2H), 2.31e2.46 (m, 4H),
2H), 6.65 (d, J ¼ 8.1 Hz, 2H), 5.46 (d, J ¼ 1.5 Hz, 2H), 4.16 (d,
J ¼ 16.2 Hz, 2H), 3.98e4.07 (m, 4H), 3.74 (s, 6H), 3.46 (s, 6H), 3.12 (t,
J ¼ 4.2 Hz, 2H), 2.96 (d, J ¼ 17.1 Hz, 4H), 2.70 (dd, J ¼ 18.0, 5.4 Hz,
2H), 2.46e2.50 (m, 4H), 2.39 (s, 6H), 1.97 (t, J ¼ 4.5 Hz, 2H),
1.84e1.87 (m, 8H), 1.42e1.48 (m, 8H); 13C NMR (75 MHz, CDCl3)
2.28 (s, 6H), 1.86e2.03 (m, 8H); 13C NMR (75 MHz, CDCl3)
d 193.8,
152.3, 144.9, 143.0, 128.1, 127.7, 122.8, 114.9, 110.1, 56.4, 56.0, 54.6,
49.0, 47.1, 45.4, 42.5, 40.5, 35.7, 35.6, 21.5. Positive ESIeMS m/z: 685
(M þ H)þ, HRMS: calcd for C40H49N2O8 (M þ H), 685.3489; found,
685.3472.
d
194.0, 152.6, 151.6, 148.3, 130.2, 130.1, 122.5, 115.5, 111.5, 72.4, 56.6,
55.9, 54.9, 50.0, 47.2, 46.2, 42.8, 40.9, 37.4, 30.5, 29.7, 26.0, 24.7.
Positive ESIeMS m/z: 769 (M þ H)þ. HRMS: calcd for C46H61N2O8
(M þ H), 769.4428; found, 769.4419.
5.1.4.2. 4,40-Trimethylene-disinomenine (3b). Yield 53%; white
solid; mp 101e103 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.99e6.66 (m,
5.1.4.8. 4,40-Nonamethylene-disinomenine (3h). Yield 68%; white
4H), 5.46 (s, 2H), 4.35e4.14 (m, 6H), 3.78 (s, 6H), 3.47 (s, 6H),
3.16e3.14 (m, 2H), 2.95e2.76 (m, 4H), 2.72 (dd, J ¼ 12.0, 6.0 Hz, 2H),
2.53e2.45 (m, 6H), 2.41 (s, 6H), 2.07e1.87 (m, 8H); 13C NMR
solid; mp 75e78 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.70 (t, J ¼ 8.7 Hz,
4H), 5.47 (d, J ¼ 1.8 Hz, 2H), 4.18 (d, J ¼ 15.9 Hz, 2H), 4.03e4.09 (m,
4H), 3.77 (s, 6H), 3.50 (s, 6H), 3.18 (t, J ¼ 4.5 Hz, 2H), 2.93e3.02 (m,
4H), 2.75 (dd, J ¼ 18.3, 4.8 Hz, 2H), 2.46e2.56 (m, 4H), 2.44 (s, 6H),
1.86e2.05 (m, 12H), 1.39e1.46 (m, 10H); 13C NMR (75 MHz, CDCl3)
(75 MHz, CDCl3) d 193.6, 152.3, 151.3, 148.0, 129.8, 122.7, 122.4, 115.1,
111.4, 69.5, 56.4, 55.7, 54.6, 49.8, 47.0, 45.9, 42.5, 40.7, 37.2, 31.3,
24.4. Positive ESIeMS m/z: 699 (M þ H)þ, HRMS: calcd for
C41H51N2O8 (M þ H), 699.3645; found, 699.3625.
d
193.7, 152.4, 151.4, 148.0, 130.0, 129.9, 122.3, 115.3, 111.2, 72.2, 56.4,
55.6, 54.6, 49.7, 47.0, 46.0, 42.6, 40.7, 37.2, 30.2, 29.5, 29.4, 25.8, 24.5.

P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
71
Positive ESIeMS m/z: 783 (M þ H)þ, HRMS: calcd for C47H63N2O8
(M þ H), 783.4584; found, 783.4583.
J ¼ 4.2 Hz, 2H), 2.94e2.99 (m, 4H), 2.72 (dd, J ¼ 18.3, 5.1 Hz, 2H),
2.45e2.50 (m, 4H), 2.40 (s, 6H), 1.98e2.00 (m, 6H), 1.87 (td, J ¼ 12.9,
3.6 Hz, 2H); 13C NMR (75 MHz, CDCl3)
d 193.8, 152.4, 151.3, 147.6,
5.1.4.9. 4,40-Decamethylene-disinomenine (3i). Yield 67%; white
129.9, 129.8, 122.5, 115.0,111.3, 71.0, 70.6, 56.3, 55.6, 54.6, 49.6, 46.9,
45.8, 42.4, 40.8, 36.7, 24.5. Positive ESIeMS m/z: 729 (M þ H)þ,
HRMS: calcd for C42H54N2O9 (M þ H), 729.3751; found, 729.3774.
solid; mp 70e72 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.70 (d, J ¼ 8.4 Hz,
2H), 6.67 (d, J ¼ 8.4 Hz, 2H), 5.47 (d, J ¼ 1.8 Hz, 2H), 4.18 (d,
J ¼ 16.2 Hz, 2H), 3.99e4.11 (m, 4H), 3.76 (s, 6H), 3.49 (s, 6H), 3.16 (t,
J ¼ 3.6 Hz, 2H), 2.96e3.02 (br, 4H), 2.73 (dd, J ¼ 18.3, 5.4 Hz, 2H),
2.51 (br, 2H), 2.46 (d, J ¼ 16.2 Hz, 2H), 2.42 (s, 6H), 1.83e2.04 (m,
5.1.8. 4,40-Triethylene glycol-disinomenine (3m)
Compound 3m was obtained following the same procedure
described for compound 3l. Purification was performed by means
of silica gel column chromatography (EtOAc/MeOH/NH4OH,
460:25:15, v/v/v). The title compound was obtained as a white solid
12H), 1.35e1.44 (m, 12H); 13C NMR (75 MHz, CDCl3)
d 193.6, 152.4,
151.4, 148.0, 129.9, 129.8, 122.3, 115.2, 111.3, 72.2, 56.4, 55.6, 54.7,
49.7, 47.0, 45.9, 42.6, 40.7, 37.1, 30.2, 29.5, 29.4, 25.8, 24.5. Positive
ESIeMS m/z: 797 (M þ H)þ, HRMS: calcd for C48H65N2O8 (M þ H),
797.4741; found, 797.4787.
(278 mg, 72% yield); mp 90e92 ꢀC. 1H NMR (300 MHz, CDCl3)
d 6.70
(d, J ¼ 8.7 Hz, 2H), 6.66 (d, J ¼ 8.7 Hz, 2H), 5.44 (d, J ¼ 1.2 Hz, 2H),
4.17e4.32 (m, 6H), 3.77e3.93 (m, 8H), 3.74 (s, 6H), 3.36 (s, 6H), 3.17
(br t, J ¼ 4.2 Hz, 2H), 2.94e2.98 (br, 2H), 2.73 (dd, J ¼ 18.6, 5.1 Hz,
2H), 2.44e2.53 (m, 4H), 2.40 (s, 3H), 1.96e2.03 (m, 4H), 1.86 (td,
5.1.5. 4,40-p-Xylyl-disinomenine (3j)
To a solution of sinomenine (658 mg, 2 mmol), p-xylylene glycol
(138 mg, 1 mmol) and triphenylphosphine (768 mg, 3 mmol) in
dried THF (10 mL) was added a solution of diisopropyl azodi-
carboxylate (0.59 mL, 3 mmol) in dry THF (2 mL) over a period of
30 min. The reaction mixture was stirred at room temperature for
12 h and then the solvent THF was removed under vacuum. Puri-
fication by silica gel column chromatography (EtOAc/CH2Cl2/MeOH,
100:0:0e0:6:1, v/v/v) afforded the title compounds (403 mg, 53%);
J ¼ 12.9, 3.6 Hz, 2H); 13C NMR (75 MHz, CDCl3)
d 193.8, 152.4, 151.3,
147.6, 129.8, 129.7, 122.6, 115.0, 111.3, 70.9, 70.7, 70.5, 56.4, 55.6,
54.7, 49.6, 47.0, 45.7, 42.4, 40.7, 36.6, 24.5. Positive ESIeMS m/z: 773
(M þ H)þ, HRMS: calcd for C44H58N2O10 (M þ H), 773.4013; found,
773.3984.
5.1.9. 4,40-Tetraethylene glycol-disinomenine (3n)
white solid; mp 140e142 ꢀC. 1H NMR (300 MHz, CDCl3)
d
7.62 (s,
Compound 3n was obtained following the same procedure
described for compound 3l. Purification was performed by means
of silica gel column chromatography (EtOAc/MeOH/NH4OH,
460:25:15, v/v/v). The title compound was obtained as a white solid
4H), 6.77 (d, J ¼ 8.4 Hz, 2H), 6.74 (d, J ¼ 8.4 Hz, 2H), 5.50 (d,
J ¼ 1.5 Hz, 2H), 5.30 (d, J ¼ 11.4 Hz, 2H), 5.10 (d, J ¼ 11.4 Hz, 2H), 4.18
(d, J ¼ 15.9 Hz, 2H), 3.81 (s, 6H), 3.51 (s, 6H), 3.17 (t, J ¼ 3.6 Hz, 2H),
2.98e3.04 (br, 4H), 2.75 (d, J ¼ 12.6, 5.4 Hz, 2H), 2.44e2.49 (m, 4H),
2.41 (s, 6H), 1.97 (td, J ¼ 11.7, 3.9 Hz, 2H), 1.77e1.90 (m, 4H); 13C
(310 mg, 76% yield); mp 70e72 ꢀC. 1H NMR (300 MHz, CDCl3)
d 6.72
(d, J ¼ 8.4 Hz, 2H), 6.67 (d, J ¼ 8.4 Hz, 2H), 5.46 (d, J ¼ 1.8 Hz, 2H),
4.16e4.33 (m, 6H), 3.67e3.80 (m, 12H), 3.75 (s, overlapped, 6H),
3.47 (s, 6H), 3.15 (t, J ¼ 3.9 Hz, 2H), 2.95e3.00 (m, 4H), 2.72 (dd,
J ¼ 18.3, 5.4 Hz, 2H), 2.43e2.52 (m, 4H), 2.41 (s, 6H), 1.94e2.03 (m,
NMR (75 MHz, CDCl3) d 194.2, 152.6, 151.7, 147.6, 137.8, 130.3, 130.2,
128.2, 127.1, 123.0, 115.5, 111.3, 73.1, 56.6, 55.8, 54.9, 49.9, 47.1, 46.1,
42.8, 41.0, 37.2, 24.7. Positive ESIeMS m/z: 761 (M þ H)þ, HRMS:
calcd for C46H53N2O8 (M þ H), 761.3802; found, 761.3790.
6H), 1.85 (td, J ¼ 13.2, 4.2 Hz, 2H); 13C NMR (75 MHz, CDCl3)
d 193.9,
152.3, 151.2, 147.4, 130.0, 129.9, 122.6, 115.3, 111.2, 70.8, 70.6, 70.5,
70.4, 56.3, 55.6, 54.6, 49.6, 46.9, 45.9, 42.5, 40.8, 36.8, 24.4. Positive
ESIeMS m/z: 817 (M þ H)þ, HRMS: calcd for C46H62N2O11 (M þ H),
817.4275; found, 817.4315.
5.1.6. 4,40-m-Xylyl-disinomenine (3k)
Compound 3k was obtained following the same procedure
described for compound 3j. Purification was performed by means
of silica gel column chromatography (EtOAc/CH2Cl2/MeOH,
100:0:0e0:9:1, v/v/v). The title compound was obtained as a pale-
yellow solid (372 mg, 49% yield); mp 133e134 ꢀC. 1H NMR
5.1.10. Procedure for synthesis of ether monomer (4a)
To a solution of sinomenine (329 mg, 1 mmol) and triphenyl-
phosphine (768 mg, 3 mmol) in dry THF (10 mL) was added
a solution of alcohol (3 mmol) and diisopropyl azodicarboxylate
(0.59 mL, 3 mmol) in dry THF (2 mL) over a period of 30 min.
The reaction mixture was stirred at room temperature for 12 h
and then the solvent THF was removed under vacuum.
Purification by silica gel column chromatography (EtOAc/CH2Cl2/
MeOH, 100:0:0e0:15:1, v/v/v) furnished the target compounds.
(300 MHz, CDCl3)
d
7.71 (s, 1H), 7.56 (dd, J ¼ 7.2, 1.2 Hz, 2H), 7.42 (t,
J ¼ 7.8 Hz, 1H), 6.75 (d, J ¼ 8.4 Hz, 2H), 6.72 (d, J ¼ 8.4 Hz, 2H), 5.49
(d, J ¼ 1.8 Hz, 2H), 5.26 (d, J ¼ 11.4 Hz, 2H), 5.14 (d, J ¼ 11.4 Hz, 2H),
4.19 (d, J ¼ 15.9 Hz, 2H), 3.80 (s, 6H), 3.49 (s, 6H), 3.15 (t, J ¼ 4.2 Hz,
2H), 2.96e3.03 (br, 4H), 2.73 (dd, J ¼ 18.0, 5.1 Hz,1H), 2.43e2.49 (m,
4H), 2.40 (s, 6H), 1.77e2.00 (m, 6H); 13C NMR (75 MHz, CDCl3)
d
193.9, 152.4, 151.5, 147.5, 138.3, 130.2, 130.0, 128.3, 127.5, 127.2,
122.7, 115.2, 111.2, 73.1, 56.4, 55.6, 54.7, 49.7, 47.0, 46.0, 42.6, 40.8,
37.0, 24.5. Positive ESIeMS m/z: 761 (M þ H)þ, HRMS: calcd for
C46H53N2O8 (M þ H), 761.3802; found, 761.3782.
5.1.10.1. 4-Ethyl-sinomenine (4a). Yield 99%; white solid; mp
77e78 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.72 (d, J ¼ 8.4 Hz, 1H), 6.69
(d, J ¼ 8.4 Hz, 1H), 5.47 (d, J ¼ 1.5 Hz, 1H), 4.09e4.20 (m, 3H), 3.77 (s,
3H), 3.49 (s, 3H), 3.22 (t, J ¼ 4.5 Hz, 1H), 2.99 (br d, J ¼ 18.0 Hz, 2H),
2.77 (dd, J ¼ 18.4, 4.6 Hz, 1H), 2.56 (dt, J ¼ 11.7, 2.4 Hz, 1H), 2.49 (d,
J ¼ 16.2 Hz, 1H), 2.43 (s, 3H), 1.89e2.06 (m, 3H), 1.43 (t, J ¼ 6.9 Hz,
5.1.7. 4,40-Diethylene glycol-disinomenine (3l)
To a solution of sinomenine (329 mg, 1 mmol) and diethylene
glycol di-p-tosylate (207 mg, 0.5 mmol) in dry THF (15 mL) and
HMPA (3 mL) was added sodium hydroxide (60 mg, 1.5 mmol), then
the reaction mixture was refluxed for 16 h and solvent was
removed under vaccum, the residue was added with chloroform
(50 mL) and washed with water (20 mL ꢂ 3). The organic layer
was dried over anhydrous Na2SO4 and then concentrated. Purifi-
cation by silica gel column chromatography (EtOAc/MeOH/NH4OH,
460:25:15, v/v/v) afforded the title compound (229 mg, 63%); white
3H). 13C NMR (CDCl3)
d: 193.6, 152.4, 151.5, 147.9, 129.6, 129.5, 122.4,
115.0, 111.3, 67.8, 56.3, 55.6, 54.7, 49.6, 46.9, 45.5, 42.3, 40.5, 36.8,
24.6, 15.7. Positive ESIeMS m/z: 358 (M þ H)þ, HRMS: calcd for
C21H28NO4 (M þ H), 358.2018; found, 358.1986.
5.1.11. General procedure for synthesis of ether monomers (4bei)
To a solution of sinomenine (1) (329 mg, 1 mmol) and bro-
moalkane (2 mmol) in dry acetone (2 mL) was added potassium
carbonate (690 mg, 5 mmol). The mixture was stirred at 60 ꢀC until
the starting material was no longer detected by TLC. The reaction
solid; mp 96e98 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.71 (d, J ¼ 8.4 Hz,
2H), 6.67 (d, J ¼ 8.4 Hz, 2H), 5.44 (d, J ¼ 1.5 Hz, 2H), 4.15e4.38 (m,
6H), 3.97 (t, J ¼ 4.8 Hz, 4H), 3.75 (s, 6H), 3.46 (s, 6H), 3.16 (t,

72
P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
mixture was then filtered and solvent was removed under vacuum
to afford the crude product, which was purified by gel column
chromatography to give title compounds.
5.47 (d, J ¼ 2.1 Hz, 1H), 4.18 (d, J ¼ 15.9 Hz, 1H), 4.05 (dt, J ¼ 7.2,
3.3 Hz, 2H), 3.77 (s, 3H), 3.49 (s, 3H), 3.17 (t, J ¼ 3.3 Hz, 1H),
2.96e3.01 (m, 2H), 2.74 (dd, J ¼ 18.4, 5.4 Hz, 1H), 2.52 (br, 1H), 2.47
(d, J ¼ 15.9 Hz, 1H), 2.43 (s, 3H), 1.79e2.05 (m, 5H), 1.26e1.47 (m,
5.1.11.1. 4-Propyl-sinomenine (4b). Yield 98%; white solid; mp
10H), 0.89 (t, J ¼ 6.9 Hz, 3H). 13C NMR (CDCl3)
d: 193.6, 152.3, 151.3,
126e128 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.71 (t, J ¼ 8.4 Hz, 2H), 5.47
148.0, 130.0, 129.8, 122.3, 115.3, 111.2, 72.1, 56.3, 55.5, 54.6, 49.7,
46.9, 45.9, 42.5, 40.6, 37.1, 31.7, 30.1, 29.3, 29.1, 25.7, 24.4, 22.5, 14.0.
Positive ESIeMS m/z: 442 (M þ H)þ, HRMS: calcd for C27H40NO4
(M þ H), 442.2957; found, 442.2924.
(d, J ¼ 1.8 Hz, 1H), 4.18 (d, J ¼ 15.9 Hz, 1H), 3.96e4.08 (m, 2H), 3.76
(s, 3H), 3.49 (s, 3H), 3.25 (t, J ¼ 4.2 Hz, 1H), 2.96e3.04 (m, 2H), 2.79
(d, J ¼ 18.0, 5.4 Hz, 1H), 2.59 (dt, J ¼ 11.7, 2.7 Hz, 1H), 2.48 (d,
J ¼ 15.9 Hz, 1H), 2.44 (s, 3H), 1.95e2.08 (m, 2H), 1.78e1.94 (m, 4H),
1.04 (t, J ¼ 7.5 Hz, 3H); 13C NMR (CDCl3)
d: 193.5, 152.5, 151.5, 148.0,
5.1.11.7. 4-Nonyl-sinomenine (4h). Yield 98%; white oil; 1H NMR
129.6, 129.4, 122.4, 114.6, 111.4, 73.7, 56.3, 55.6, 54.7, 49.5, 46.9, 45.3,
42.1, 40.4, 36.7, 24.5, 23.4, 10.3. Positive ESIeMS m/z: 372 (M þ H)þ,
HRMS: calcd for C22H30NO4 (M þ H), 372.2175; found, 372.2148.
(300 MHz, CDCl3)
d
6.71 (t, J ¼ 8.7 Hz, 2H), 5.46 (d, J ¼ 1.8 Hz, 1H),
4.17 (d, J ¼ 15.9 Hz, 1H), 4.06 (t, J ¼ 6.9 Hz, 2H), 3.77 (s, 3H), 3.50 (s,
3H), 3.29 (t, J ¼ 3.9 Hz, 1H), 2.96e3.08 (m, 2H), 2.82 (dd, J ¼ 18.6,
5.4 Hz, 1H), 2.63 (br, 1H), 2.49 (d, J ¼ 15.9 Hz, 1H), 2.46 (s, 3H),
1.79e2.11 (m, 5H), 1.29e1.46 (m, 12H), 0.89 (t, J ¼ 6.9 Hz, 3H). 13C
5.1.11.2. 4-Butyl-sinomenine (4c). Yield 96%; white solid; mp
143e145 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.71 (d, J ¼ 8.4 Hz, 1H),
NMR (CDCl3) d: 193.4, 152.4, 151.5, 148.0, 129.4, 129.2, 122.4, 114.7,
6.69 (d, J ¼ 8.4 Hz, 1H), 5.48 (d, J ¼ 2.1 Hz, 1H), 4.18 (d, J ¼ 16.2 Hz,
1H), 4.07 (dt, J ¼ 6.9, 3.0 Hz, 2H), 3.77 (s, 3H), 3.49 (s, 3H), 3.17 (t,
J ¼ 4.2 Hz, 1H), 2.96e3.02 (m, 2H), 2.74 (dd, J ¼ 18.3, 5.1 Hz, 1H),
2.52 (dt, J ¼ 9.0, 2.7 Hz, 1H), 2.47 (d, J ¼ 16.2 Hz, 1H), 2.43 (s, 3H),
1.78e2.05 (m, 5H), 1.45e1.57 (m, 2H), 1.00 (t, J ¼ 7.2 Hz, 3H); 13C
111.4, 72.2, 56.2, 55.5, 54.6, 49.4, 46.8, 45.1, 41.9, 40.3, 36.5, 31.7, 30.1,
29.4, 29.3, 29.1, 25.7, 24.6, 22.5, 14.0. Positive ESIeMS m/z: 456
(M þ H)þ, HRMS: calcd for C28H42NO4 (M þ H), 456.3114; found,
456.3081.
NMR (CDCl3)
d
: 193.6, 152.4, 151.4, 148.0, 129.9, 129.8, 122.3, 115.2,
5.1.11.8. 4-Decyl-sinomenine (4i). Yield 96%; white oil; 1H NMR
111.3, 56.4, 55.6, 54.7, 49.7, 47.0, 45.9, 42.6, 40.6, 37.1, 32.3, 24.5,19.0,
13.9. Positive ESIeMS m/z: 386 (M þ H)þ, HRMS: calcd for
C23H32NO4 (M þ H), 386.2331; found, 386.2305.
(300 MHz, CDCl3)
d
6.71 (t, J ¼ 8.7 Hz, 2H), 5.46 (d, J ¼ 1.8 Hz, 1H),
4.17 (d, J ¼ 15.9 Hz, 1H), 4.06 (t, J ¼ 6.9 Hz, 2H), 3.77 (s, 3H), 3.49 (s,
3H), 3.29 (t, J ¼ 3.9 Hz, 1H), 2.96e3.07 (m, 2H), 2.82 (dd, J ¼ 18.3,
5.1 Hz, 1H), 2.50e2.66 (m, 2H), 2.46 (s, 3H), 1.80e2.10 (m, 5H),
5.1.11.3. 4-Amyl-sinomenine (4d). Yield 96%; white solid; mp
1.27e1.46 (m,14H), 0.88 (t, J ¼ 6.9 Hz, 3H). 13C NMR (CDCl3)
d: 193.4,
50e52 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.72 (d, J ¼ 8.4 Hz, 1H), 6.69
152.4, 151.5, 148.0, 129.5, 129.2, 122.4, 114.6, 111.4, 72.2, 56.2, 55.6,
54.6, 49.4, 46.8, 45.1, 42.0, 40.3, 36.5, 31.8, 30.2, 29.5 (2H), 29.4, 29.2,
25.8, 24.6, 22.5, 14.0. Positive ESIeMS m/z: 470 (M þ H)þ, HRMS:
calcd for C29H44NO4 (M þ H), 470.3270; found, 470.3237.
(d, J ¼ 8.4 Hz, 1H), 5.47 (d, J ¼ 2.1 Hz, 1H), 4.17 (d, J ¼ 15.9 Hz, 1H),
4.05 (td, J ¼ 7.2, 2.1 Hz, 2H), 3.76 (s, 3H), 3.49 (s, 3H), 3.17 (t,
J ¼ 3.9 Hz, 1H), 2.96e3.02 (br, 2H), 2.74 (dd, J ¼ 18.3, 5.4 Hz, 1H),
2.53 (dt, J ¼ 11.4, 2.7 Hz, 1H), 2.47 (d, J ¼ 15.9 Hz, 1H), 2.43 (s, 3H),
1.81e2.05 (m, 5H), 1.36e1.51 (m, 4H), 0.94 (t, J ¼ 6.9 Hz, 3H); 13C
5.2. Biological assays and procedures
NMR (CDCl3) d: 193.6, 152.4, 151.4, 148.0, 129.9, 129.8, 122.3, 115.2,
111.3, 72.1, 56.4, 55.6, 54.6, 49.7, 46.9, 45.8, 42.5, 40.6, 37.1, 29.9,
27.9, 24.5, 22.5, 13.9. Positive ESIeMS m/z: 400 (M þ H)þ, HRMS:
calcd for C24H34NO4 (M þ H), 400.2488; found, 400.2457.
5.2.1. Cell culture
Murine monocyte-macrophage RAW264.7 cells maintained in
Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carls-
bad, CA) supplemented with 5% fetal bovine serum (FBS) (Invi-
5.1.11.4. 4-Hexyl-sinomenine (4e). Yield 97%; white solid; mp
trogen), 100 units/mL penicillin, and 100 mg/mL streptomycin and
42e44 ꢀC. 1H NMR (300 MHz, CDCl3)
d
6.71 (d, J ¼ 8.4 Hz, 1H), 6.68
incubated at 37 ꢀC in a humidified atmosphere containing 5% CO2.
(d, J ¼ 8.4 Hz, 1H), 5.47 (d, J ¼ 1.8 Hz, 1H), 4.18 (d, J ¼ 15.9 Hz, 1H),
4.05 (td, J ¼ 6.9, 2.4 Hz, 1H), 3.76 (s, 3H), 3.49 (s, 3H), 3.16 (t,
J ¼ 3.9 Hz, 1H), 2.96e3.02 (m, 2H), 2.74 (d, J ¼ 18.3, 5.1 Hz, 1H),
2.44e2.55 (m, 2H), 2.42 (s, 3H), 1.79e2.04 (m, 5H), 1.33e1.49 (m,
5.2.2. Cell viability assay
Cell cytotoxicity was evaluated by MTT method and expressed
as IC50. RAW264.7 cells were plated at a density of 1 ꢂ 105 cells in
a 96-well plate, and compounds were added to each plate as the
indicated concentrations. Untreated cells were served as blank.
After a 24 h incubation period at 37 ꢀC, 5% CO2, medium on cells was
replaced with fresh medium, 20 mL MTT reagents (5 mg/mL) were
added, and then the cells were incubated for another 4 h. The
supernatants were aspirated, and the formazan crystals in each
6H), 0.89e0.93 (m, 3H). 13C NMR (CDCl3)
d: 193.6, 152.4, 151.4,
148.0, 129.9, 129.8, 122.3, 115.2, 111.3, 72.2, 56.4, 55.6, 54.6, 49.7,
47.0, 45.9, 42.5, 40.6, 37.1, 31.6, 30.1, 25.4, 25.0, 22.5, 14.0. Positive
ESIeMS m/z: 414 (M þ H)þ, HRMS: calcd for C25H36NO4 (M þ H),
414.2644; found, 414.2622.
5.1.11.5. 4-Heptyl-sinomenine (4f). Yield 96%; white oil; 1H NMR
well were dissolved in 200 mL of dimethyl sulphoxide (DMSO) for
(300 MHz, CDCl3)
d
6.72 (d, J ¼ 8.7 Hz, 1H), 6.68 (d, J ¼ 8.7 Hz, 1H),
30 min at 37 ꢀC. The absorbance value was monitored by microplate
reader at 570 nm (OD570). The density of formazan formed in blank
(medium alone) cells was set as 100% of viability.
5.47 (d, J ¼ 2.1 Hz, 1H), 4.18 (d, J ¼ 15.9 Hz, 1H), 4.05 (td, J ¼ 6.9,
2.4 Hz, 2H), 3.77 (s, 3H), 3.49 (s, 3H), 3.18 (t, J ¼ 4.5 Hz, 1H),
2.96e3.02 (m, 2H), 2.75 (dd, J ¼ 18.3, 5.1 Hz, 1H), 2.53 (dt, J ¼ 11.4,
3.0 Hz, 1H), 2.47 (d, J ¼ 15.9 Hz, 1H), 2.43 (s, 3H), 1.80e2.03 (m, 5H),
5.2.3. Nitrite assay
1.31e1.46 (m, 8H), 0.90 (t, J ¼ 3.6 Hz, 3H). 13C NMR (CDCl3)
d: 193.6,
The nitrite assay was performed following the reported method
152.4, 151.4, 148.0, 129.9, 129.8, 122.3, 115.2, 111.3, 72.2, 56.4, 55.6,
54.6, 49.6, 47.0, 45.8, 42.5, 40.6, 37.0, 31.7, 30.2, 29.1, 25.7, 24.5, 22.5,
14.0. Positive ESIeMS m/z: 428 (M þ H)þ, HRMS: calcd for
C26H38NO4 (M þ H), 428.2801; found, 428.2778.
[52]. In brief, RAW264.7 cells were plated at a density of
1 ꢂ 105 cells in a 96-well plate. RAW264.7 cells were treated with
compounds at various concentrations (0.5e100
mM) and LPS
(500 ng/mL) simultaneously. After a 24 h incubation period, 100 mL
of culture medium was mixed with an equal volume of Griess
reagent (0.2% naphthylethylenediamine dihydrochloride and 2%
sulfanilamide in 5% phosphoric acid). After 10 min incubation at
5.1.11.6. 4-Octyl-sinomenine (4g). Yield 99%; white oil; 1H NMR
(300 MHz, CDCl3)
d
6.72 (d, J ¼ 8.4 Hz, 1H), 6.68 (d, J ¼ 8.4 Hz, 1H),

P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
73
room temperature with protection from light, the absorbance value
was measured at 540 nm (OD540) with a microplate reader.
In cell cultures, each compound was prepared in DMSO followed
by dilution with culture medium to the indicated concentrations,
and DMSO final concentration was 0.1%. DMSO at 0.1% was added
into control (RAW264.7 cells were treated with LPS only) and blank
(RAW264.7 cells only, without any treatments) groups and showed
no effects on cells. Aminoguanidine was used as positive control.
increasing concentrations of 2f or 3b (5, 10, and 20
m
M) in presence
of 500 ng/ml LPS for 6 h. The luciferase activity of cell extracts from
each sample was measured using a luciferase assay kit according to
the manufacturer’s protocol.
5.2.8. LPS-induced septic shock model
The Balb/c mice (body weight about 20 g) were procured from
Model Animal Research Center of Nanjing University. Animals were
housed in a climate-controlled room, 12 h light/dark photoperiod.
All the mice had free access to food and water.
Mice (10 mice per group) were injected intraperitoneally (i.p.)
with 20 mg/kg LPS. Compounds, dissolved in olive oil, were injected
intraperitoneally (15 mg/kg) for 3 days prior to LPS injection.
Cumulative proportions of mice surviving after injecting LPS were
observed. After injection of LPS for 3 h, blood samples were
collected from mice and serum samples were separated, then the
5.2.4. ELISA assays of TNF-
The cell culture procedure was the same as that described in
Nitrite Assay, only 10 M of compounds was added. At indicated
incubation time points 6, 12 and 24 h, the TNF- and IL-6 levels of
a and IL-6 in RAW264.7 cells
m
a
cell supernatant were measured using ELISA kits from R&D systems
(Minneapolis, MN) following kit instructions.
5.2.5. Western blot assay
levels of TNF-a and IL-6 were analyzed by ELISA methods.
The cell culture procedure was the same as ELISA Assays of
The present animal studies were approved by the Institutional
Animal Care and Use Committee and all of the protocols complied
with the Guide for the Care and Use of Laboratory Animals.
TNF-
a and IL-6. The cells incubated for 2, 4 and 6 h after LPS
treatment were used for the assay. Western Blot was performed as
described in literature [53]. Briefly, cells were washed with
phosphate-buffered saline and lysed in the lysis buffer containing
Triton X-100. After 10,000 g centrifugation at 4 ꢀC for 10 min, the
protein content of the supernatant was determined by a BCAÔ
protein assay Kit (Pierce, Rochford, IL). The protein lysates were
separated by 10% SDS-PAGE and subsequently electro-transferred
onto a polyvinylidene difluoride membrane (Millipore Corp.,
Bedford, MA). The membrane was blocked with 5% nonfat milk for
1e2 h at room temperature. The blocked membrane was incu-
bated with the indicated primary antibodies. Primary antibodies
used were anti-phosphorylation of SAPK/JNK (Thr183/Tyr185),
anti-SAPK/JNK, anti-phosphorylation of ERK1/2 (Thr202/Tyr204),
anti-ERK1/2, anti-phosphorylation of p38 (Thr180/Tyr182),
Acknowledgment
This work was supported by National Natural Science Founda-
tion of China (20872060, 90913023), and the National Natural
Science Fund for Creative Research Groups of China (20821063). We
are grateful to Dr. Yin Ding (Nanjing University, China) for HRMS
measurements.
Appendix. Supplementary data
Supplementary data associated with this article can be found in
the online version, at doi:10.1016/j.ejmech.2012.01.036. These data
include MOL files and InChiKeys of the most important compounds
described in this article.
anti-p38, anti-phosphorylation of I
k
B
a
(Ser32/36), anti-I
kBa, anti-
phosphorylation of NF- B, anti-NF-
k
kB (Cell Signaling Technology,
Danvers, MA) and anti-GAPDH (Santa Cruz Biotechnology,
Santa Cruz, CA), and the secondary antibody were horseradish
peroxidase-conjugated goat anti-mouse or anti-rabbit immuno-
globulin (1:10,000, KPL, Gaithersburg, MD). Protein bands were
visualized using Western blotting detection system according to
the manufacturer’s instructions.
References
[1] R. Bruckdorfer, Mol. Aspects Med. 26 (2005) 3e31.
[2] B. Bruene, Pharmacol. Res. 61 (2010) 265e268.
[3] P.B. Anning, B. Coles, J. Morton, H.B. Wang, J. Uddin, J.D. Morrow, S.K. Dey,
L.J. Marnett, V.B. O’Donnell, Blood 108 (2006) 4059e4062.
[4] G. Nagy, J.M. Clark, E.I. Buzas, C.L. Gorman, A.P. Cope, Immunol. Lett. 111
(2007) 1e5.
[5] P. Vallance, Fundam. Clin. Pharmacol. 17 (2003) 1e10.
[6] J. MacMicking, Q.W. Xie, C. Nathan, Annu. Rev. Immunol. 15 (1997)
323e350.
5.2.6. Electrophoretic mobility shift assay (EMSA) assay
Nuclear extracts of the cells were subjected to EMSA assay.
Consensus biotin-labeled double-strand oligo-deoxynucleotide
[7] C.F. Nathan, J. Clin. Invest. 80 (1987) 1550e1560.
[8] G.J. Wu, T.L. Chen, Y.F. Ueng, R.M. Chen, Toxicol. Appl. Pharmacol. 228 (2008)
105e113.
[9] D.R. Littman, A.Y. Rudensky, Cell 140 (2010) 845e858.
[10] M. Kopf, M.F. Bachmann, B.J. Marsland, Nat. Rev. Drug Discov. 9 (2010)
703e718.
[11] H. Yamasaki, Acta Med. Okayama 30 (1976) 1e20.
[12] Z. Tai, S.J. Hopkins, Drug Future 23 (1998) 45e49.
[13] Y. Wang, Y.F. Fang, W.H. Huang, X. Zhou, M.H. Wang, B. Zhong, D.Z. Peng,
J. Ethnopharmacol. 98 (2005) 37e43.
[14] B.D. Huang, A.S. He, M. Fu, P.Y. Sheng, W.M. Liao, J. Med. Plant Res. 4 (2010)
1830e1836.
[15] Z.Q. Liu, K. Chan, H. Zhou, Z.H. Jiang, Y.F. Wong, H.X. Xu, L. Liu, Life Sci. 77
(2005) 3197e3209.
[16] S.H. Song, X.Y. Shen, Y. Tang, Z.X. Wang, W.Y. Guo, G.S. Ding, Q.X. Wang,
Z.R. Fu, Int. Immunopharmacol. 10 (2010) 679e684.
[17] G.D. Huang, J.B. Li, Y.H. Huang, D.F. Huang, L.J. Tang, S. Zhang, Q. Li, J. Emerg.
Tradit. Chin. Med. 16 (2007) 416e421.
probes for NF-kB (AGTTGAGGGGACTTTCCCAGGC) were obtained
from Beyotime Institute of Biotechnology (China). Reactions for
nuclear proteineDNA binding were performed using the Light Shift
Chemiluminescent EMSA kit. Briefly, 5
mg of nuclear protein was
incubated in a 20 L reaction volume at room temperature for
m
20 min and then loaded onto a 6% nondenaturing polyacrylamide
gel in 0.5 ꢂ tris-borate-ethylenediaminetetraacetic acid (TBE)
buffer at 4 ꢀC, and then the binding reactions were transferred to
nylon membrane. After cross-link transferred DNA to membrane,
the bands were detected by chemiluminesecence. Specificity of
DNAeprotein complex was confirmed by competition with a 100-
fold excess of unlabeled and p65 of NF-kB antibody supershift
assay (Cell Signaling Technology, Danvers, MA).
[18] L.C. Yan, E.G. Bi, Y.T. Lou, X.D. Wu, Z.D. Liu, J. Zhou, Y. Wang, Z. Ma, G.M. Lin,
S.H. Sun, C. Bian, A.Z. Chen, Z.J. Yao, B. Sun, Biochem. Biophys. Res. Commun.
391 (2010) 1093e1098.
[19] Y. Pan, Y. Li, Q. Bu, L. Huang, J. Wang, J. Li, CN1962638A, 2007.
[20] Y. Pan, Y. Li, Q. Bu, L. Huang, J. Wang, J. Li, CN1821244A, 2006.
[21] Y. Pan, Y. Li, Q. Bu, L. Huang, J. Wang, J. Li, CN1785977A, 2006.
[22] C.G. Wermuth, The Practice of Medicinal Chemistry, third ed. Elsevier/
Academic Press, Amsterdam, Boston, 2008.
5.2.7. Luciferase reporter assay
RAW264.7 cells were plated and cultured overnight in 100 mm
dish (1 ꢂ 107 cells/well). The pNF-
kB-luc containing NF-kB binding
motifs (GGGAATTTCC) was transfected into cells using Lipofect-
amine 2000 reagents (Invitrogen, USA). At 24 h post-transfection,
the cells were plated in 24-wells plates and then treated with

74
P. Teng et al. / European Journal of Medicinal Chemistry 50 (2012) 63e74
[23] M. Erez, A.E. Takemori, P.S. Portoghese, J. Med. Chem. 25 (1982)
847e849.
[38] X.M. Peng, B.I. Knapp, J.A. Bidlack, J.L. Neumeyer, J. Med. Chem. 49 (2006)
256e262.
[24] P.S. Portoghese, M. Erez, C.B. Yim, L.M. Sayre, A.E. Takemori, Abstr. Am. Chem.
Soc. 183 (1982) (54eMEDI).
[39] P.S. Portoghese, D.L. Larson, L.M. Sayre, C.B. Yim, G. Ronsisvalle, S.W. Tam,
A.E. Takemori, J. Med. Chem. 29 (1986) 1855e1861.
[25] P.I. Kitov, H. Shimizu, S.W. Homans, D.R. Bundle, J. Am. Chem. Soc. 125 (2003)
3284e3294.
[40] P.S. Portoghese, G. Ronsisvalle, D.L. Larson, A.E. Takemori, J. Med. Chem. 29
(1986) 1650e1653.
[26] J. Owens, Nat. Rev. Drug Discov. 5 (2006) 105.
[41] E. Fuhrmann, J. Talbiersky, Org. Process Res. Dev. 9 (2005) 206e211.
[42] W. Williamson, Justus Liebigs Ann. Chem. 77 (1851) 37e49.
[43] A.J. Reynolds, M. Kassiou, Curr. Org. Chem. 13 (2009) 1610e1632.
[44] C.A. Dinarello, Chest 118 (2000) 503e508.
[45] B. Kaminska, Biochim. Biophys. Acta 1754 (2005) 253e262.
[46] A. Salminen, J. Huuskonen, J. Ojala, A. Kauppinen, K. Kaarniranta, T. Suuronen,
Ageing Res. Rev. 7 (2008) 83e105.
[47] A.S. Baldwin, Annu. Rev. Immunol. 14 (1996) 649e683.
[48] C. Dong, R.J. Davis, R.A. Flavell, Annu. Rev. Immunol. 20 (2002) 55e72.
[49] X.B. He, J.L. Wang, Z.H. Guo, Q.Y. Liu, T.Y. Chen, X.J. Wang, X.T. Cao, Immunol.
Lett. 98 (2005) 91e96.
[27] J. Sridhar, Z.-L. Wei, I. Nowak, N.E. Lewin, J.A. Ayres, L.V. Pearce,
P.M. Blumberg, A.P. Kozikowski, J. Med. Chem. 46 (2003) 4196e4204.
[28] Z.S. Deng, J.X. Li, P. Teng, P. Li, X.R. Sun, Org. Lett. 10 (2008) 1119e1122.
[29] Z.S. Deng, Y. Zhao, C.C. He, J. Jin, Y.M. He, J.X. Li, Org. Lett. 10 (2008)
3879e3882.
[30] P. Teng, H.L. Liu, Z.S. Deng, Z.B. Shi, Y.M. He, L.L. Feng, Q. Xu, J.X. Li, Bioorg.
Med. Chem. 19 (2011) 3096e3104.
[31] Z.J. Yao, B. Sun, Y.T. Lou, A.Z. Chen, Z. Ma, CN101798285A, 2010.
[32] J. Luo, H.Y. Zeng, Y. Li, S.F. Yin, Chin. J. Org. Chem. 27 (2007) 648e652.
[33] J. Jin, J.X. Li, CN101948430A, 2011.
[34] L. Luo, J. Yang, J.C. Song, S.D. Luo, Chin. Hosp. Pharm. J. 25 (2005) 196e198.
[35] Y.T. Lou, H.B. Zhou, J. Zou, L.C. Yan, E.G. Bi, B. Sun, Z.J. Yao, Tetrahedron Lett. 51
(2010) 485e488.
[50] E. Lolis, R. Bucala, Nat. Rev. Drug Discov. 2 (2003) 635e645.
[51] K. Doi, A. Leelahavanichkul, P.S.T. Yuen, R.A. Star, J. Clin. Invest. 119 (2009)
2868e2878.
[36] P.S. Portoghese, J. Med. Chem. 44 (2001) 2259e2269.
[37] A.P. Tamiz, B.C. Bandyopadhyay, J.R. Zhang, J.L. Flippen-Anderson, M. Zhang,
C.Z. Wang, K.M. Johnson, S. Tella, A.P. Kozikowski, J. Med. Chem. 44 (2001)
1615e1622.
[52] G.B. Liu, J.L. Xu, M. Geng, R. Xu, R.R. Hui, J.W. Zhao, Q. Xu, H.X. Xu, J.X. Li,
Bioorg. Med. Chem. 18 (2010) 2864e2871.
[53] F. Qian, Y.P. Li, X. Sheng, Z.C. Zhang, R. Song, W. Dong, S.X. Cao, Z.C. Hua, Q. Xu,
Mol. Med. 13 (2007) 151e159.