A highly fluorescent DNA toolkit: Synthesis and properties of oligonucleotides containing new Cy3, Cy5 and Cy3B monomers

Article abstract of DOI:10.1093/nar/gks303

Cy3B is an extremely bright and stable fluorescent dye, which is only available for coupling to nucleic acids post-synthetically. This severely limits its use in the fields of genomics, biology and nanotechnology. We have optimized the synthesis of Cy3B, and for the first time produced a diverse range of Cy3B monomers for use in solid-phase oligonucleotide synthesis. This molecular toolkit includes phosphoramidite monomers with Cy3B linked to deoxyribose, to the 5-position of thymine, and to a hexynyl linker, in addition to an oligonucleotide synthesis resin in which Cy3B is linked to deoxyribose. These monomers have been used to incorporate single and multiple Cy3B units into oligonucleotides internally and at both termini. Cy3B Taqman probes, Scorpions and HyBeacons have been synthesized and used successfully in mutation detection, and a dual Cy3B Molecular Beacon was synthesized and found to be superior to the corresponding Cy3B/DABCYL Beacon. Attachment of Cy3, Cy3B and Cy5 to the 5-position of thymidine by an ethynyl linker enabled the synthesis of an oligonucleotide FRET system. The rigid linker between the dye and nucleobase minimizes dye-dye and dye-DNA interactions and reduces fluorescence quenching. These reagents open up new future applications of Cy3B, including more sensitive single-molecule and cell-imaging studies. The Author(s) 2012.

Full text of DOI:10.1093/nar/gks303

Nucleic Acids Research Advance Access published April 11, 2012
Nucleic Acids Research, 2012, 1–10
doi:10.1093/nar/gks303
A highly fluorescent DNA toolkit: synthesis and
properties of oligonucleotides containing
new Cy3, Cy5 and Cy3B monomers
Lucy M. Hall, Marta Gerowska and Tom Brown*
School of Chemistry, University of Southampton, SO17 1BJ, UK
Received February 23, 2012; Revised March 20, 2012; Accepted March 22, 2012
which leads to loss of fluorescence upon excitation, par-
ABSTRACT
ticularly at elevated temperatures (1). In contrast to other
Cy-Dyes, Cy3B is conformationally locked; it is therefore
not prone to photo-isomerization and has superior fluor-
escence properties. However, it is not available as a
phosphoramidite monomer, only as an N-hydroxysuc-
cinimide (NHS) ester or maleimide derivative.
Consequently it has to be introduced into oligonucleotides
post-synthetically. This makes it difficult to synthesize
oligonucleotides containing Cy3B together with other
dyes that are added after oligonucleotide synthesis, and
limits its range of applications. Post-synthetic labelling
of one oligonucleotide with different dyes could be
achieved by using two orthogonal methods e.g. click
chemistry (2–4) in combination with amide bond forma-
tion. However, this approach is complex, time consuming
and relatively low yielding. It would therefore be advan-
Cy3B is an extremely bright and stable fluorescent
dye, which is only available for coupling to nucleic
acids post-synthetically. This severely limits its use
in the fields of genomics, biology and nanotechnol-
ogy. We have optimized the synthesis of Cy3B, and
for the first time produced a diverse range of Cy3B
monomers for use in solid-phase oligonucleotide
synthesis. This molecular toolkit includes phosphor-
amidite monomers with Cy3B linked to deoxyribose,
to the 5-position of thymine, and to a hexynyl linker,
in addition to an oligonucleotide synthesis resin
in which Cy3B is linked to deoxyribose. These
monomers have been used to incorporate single
and multiple Cy3B units into oligonucleotides intern-
ally and at both termini. Cy3B Taqman probes,
Scorpions and HyBeacons have been synthesized
and used successfully in mutation detection, and a
dual Cy3B Molecular Beacon was synthesized and
found to be superior to the corresponding Cy3B/
DABCYL Beacon. Attachment of Cy3, Cy3B and
Cy5 to the 5-position of thymidine by an ethynyl
linker enabled the synthesis of an oligonucleotide
FRET system. The rigid linker between the dye and
nucleobase minimizes dye–dye and dye–DNA inter-
actions and reduces fluorescence quenching. These
reagents open up new future applications of Cy3B,
including more sensitive single-molecule and
cell-imaging studies.
tageous to have recourse to
a
range of Cy3B
phosphoramidite monomers and resins for incorporation
of this very bright fluorophore into DNA during
solid-phase synthesis.
When designing phosphoramidite monomers for at-
taching Cy-Dyes to oligonucleotides the nature of the
linker warrants careful consideration. The commonly
used linkers are long and unstructured, allowing the
fluorophore to sample a large volume of space, thereby
introducing imprecision into fluorescence resonance
energy transfer (FRET) distance measurements. There is
a particular problem at short dye–dye distances where the
linker length can be comparable to the dye separation (5).
In this situation contact quenching can occur, and para-
doxically oligonucleotides with several fluorophores have
low fluorescence. The imprecision in FRET distance meas-
urement can be partially overcome if the Cy-Dye is added
at the 50-end of the oligonucleotides. In this case the
dye stacks on the end of the DNA duplex and is held in
a rigid position (6,7). However, a significant proportion
of the dye molecules remain unstacked (1), so this is an
inadequate method of immobilizing Cy-Dyes for FRET
studies. For quantitative biophysical applications an
INTRODUCTION
Cy-Dyes are a group of highly fluorescent molecules that
cover a wide spectral range. They are important fluoro-
phores which are used in many DNA-related applications.
Despite their great utility, most Cy-Dyes are vulnerable
to cis/trans isomerization about the polymethine linker
*To whom correspondence should be addressed. Tel: +44 23 8059 2974; Fax: +44 23 8059 3781; Email: tb2@soton.ac.uk
ß The Author(s) 2012. Published by Oxford University Press.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2
Nucleic Acids Research, 2012
elegant solution has been developed in which
a
We have achieved these objectives and now describe
the synthesis of the requisite fluorescent phosphoramidites
and other monomers for the site-specific incorporation of
Cy3, Cy5 and Cy3B analogues into DNA (Figure 1A).
The design of an efficient synthesis of the Cy3B dye
fluorophore is integrated into the structure of a nucleobase
which is held firmly in place by base pairing (8–10).
Several such fluorescent nucleobases have been studied
and are proving to be useful in nucleic acid research
(11). However, their applications are somewhat restricted
by their low extinction coefficients and poor quantum
yields, resulting in weak fluorescence, in stark contrast
to the Cy-Dyes.
facilitated the development of
a range of Cy3B
phosphoramidite monomers and a DNA synthesis resin.
This ‘molecular toolkit’ provides a flexible approach for
incorporation of Cy3B into DNA by solid-phase
phosphoramidite chemistry and enables the synthesis of
fluorescent oligonucleotides that were previously unob-
tainable. Oligonucleotides containing multiple additions
of these fluorophores can be readily prepared, and the
biophysical properties of fluorogenic DNA probes
labelled with these dyes have been determined. The syn-
thesis of oligonucleotides containing the highly fluorescent
Cy3B dye is now greatly simplified, extending the potential
applications of this important fluorophore.
Integration of the fluorophore into the structure of the
nucleobase is not a feasible approach for Cy-Dyes due to
their large size and the complex synthesis that would be
required. Therefore alternative methods are needed to
restrict the mobility of Cy-Dyes in DNA. In this context,
Balasubramanian et al. have devised a method to attach
Cy-Dyes to the 5-position of thymine bases in DNA via a
rigid ethynyl linkage (12). They achieved this by reacting
oligonucleotides containing 5-ethynyl-dU with iodo-
derivatives of Cy3 and Cy5 under Sonogashira conditions
on the DNA synthesis support. In DNA duplexes the rigid
linker restricts the mobility of the dye so that it samples a
reduced volume of space, minimizing dye/DNA inter-
actions and potentially reducing fluorescence quenching
caused by interactions with the nucleobases (Figure 1B).
The above approach to oligonucleotide labelling is ingeni-
ous but it is complicated and precludes the synthesis
of oligonucleotides containing mixed internal Cy-Dyes.
A simpler and more efficient strategy would be to
synthesize the equivalent rigid Cy-Dye dT phosphor-
amidite monomers and directly incorporate them into
oligonucleotides during automated solid-phase synthesis.
This would allow the efficient synthesis of oligonucleotides
containing multiple and mixed Cy-Dyes.
MATERIALS AND METHODS
Methods for the synthesis of the Cy-Dye monomers,
oligonucleotide synthesis, UV and fluorescence protocols
and analytical data on synthetic oligonucleotides are
described in the Supplementary Methods.
Polymerase chain reaction protocols
Polymerase chain reaction (PCR) mixtures were prepared
under sterile conditions using a LabCaire PCR worksta-
tion and pipetted into 0.2 ml low-profile white 8-tube
strips with optically clear lids (BioRad). All samples were
made up to a total volume of 20 ml using a Precision HRM
Figure 1. (A) Cy-Dye molecular toolkit; Cy3BdT phosphoramidite A; 5-(hexyn-1-ol)-6-Cy3B phosphoramidite for 50-addition B; b-Cy3BdR
phosphoramidite C; a-Cy3BdR oligonucleotide synthesis resin for 30-addition D; 5-ethynyl-Cy3B E; Cy3dT phosphoramidite F; Cy5dT
phosphoramidite G. The CydT and b-Cy3BdR phosphoramidite monomers can be added either internally or at the 50-end of oligonucleotides
but the latter will not form a base pair. 5-Ethynyl-Cy3B can be used for modification of oligonucleotides by click chemistry. (B) Flexible dye
linker (left) and short rigid dye linker (right) in the context of a DNA helix cross-section (only labelled strand shown). Blue shading (Cy5) and pink
shading (Cy3) suggests the volume of space that can be sampled by the dyes when the bases are paired. A short rigid linker restricts the dye and
prevents dye–DNA interactions.

Nucleic Acids Research, 2012
3
Mastermix (Primer Design, 0.25 U Taq DNA polymerase,
2.5 mM Mg2+, 100 mM of each dNTP) and 1 pg of template
[ODN-1 wild-type template (wt), ODN-2 mutant template
(mt)]. Template was replaced with sterile water in the
negative control samples. Reactions were performed
using a BioRad CFX96 Real-Time PCR Detection
System with CFX Manager software, monitoring in
Channel 3 (excitation range 560–590 nm, detector range
610–650 nm), and all samples were run in triplicate.
Primer/probe concentration and thermal protocols are
detailed below.
For the Molecular Beacon probes, asymmetric PCR
was performed using 0.05 mM forward primer (ODN-3),
0.5 mM reverse primer (ODN-4) and 0.15 mM probe
(ODN-8/ODN-9). The thermal protocol was initiated
with 8 min at 95ꢀC followed by 50 cycles of 95ꢀC (15 s),
58ꢀC (15 s) and 72ꢀC (15 s). For the Taqman probe, sym-
metric PCR was performed using 0.5 mM forward primer
(ODN-5), 0.5 mM reverse primer (ODN-4) and 0.15 mM
probe (ODN-6). The thermal protocol was initiated with
8 min at 95ꢀC followed by 40 cycles of 95ꢀC (15 s), 55ꢀC
(15 s) and 68ꢀC (30 s). For the Scorpion probe, symmetric
PCR was performed using 0.5 mM forward primer
(ODN-3) and 0.5 mM Scorpion probe (ODN-10). The
thermal protocol was initiated with 8 min at 95ꢀC
followed by 40 cycles of 95ꢀC (15 s), 55ꢀC (15 s) and
61ꢀC (30 s). For the HyBeacon probes asymmetric PCR
was performed using 0.5 mM forward primer (ODN-3),
0.05 mM reverse primer (ODN-4) and 0.15 mM probe
(ODN-7). The thermal protocol was initiated with 8 min
at 95ꢀC followed by 50 cycles of 95ꢀC (15 s), 50ꢀC (15 s)
and 72ꢀC (15 s) followed by a melt from 35 to 80ꢀC on the
RotorGene3000 (0.5ꢀC increments, 5 s per step).
which were converted to phosphoramidite monomers
(A, Scheme 1, F, Supplementary Scheme S1, G,
Supplementary Scheme S2). Due to their high polarity
and affinity for silica gel, it was not feasible to purify the
monomers by chromatography. Instead, they were purified
by repeated precipitation using hexane and dichloro-
methane. The phosphitylation reactions were monitored
by thin layer chromatography (TLC) to ensure no more
phosphitylation reagent was added than absolutely neces-
sary, and under these conditions precipitation was an
effective means of purification. Incorporation of the
CydT monomers into oligonucleotides during solid-phase
synthesis was achieved in high yield (ꢁ98.0% by trityl
analysis) and multiple additions were straightforward, as
demonstrated by the synthesis of an oligonucleotide con-
taining five additions of Cy3dT (Figure 2A). In addition,
oligonucleotides containing both Cy3dT and Cy5dT were
readily prepared (Figure 2B). All oligonucleotides were
purified by high performance liquid chromatography
(HPLC), analysed by capillary gel electrophoresis and
characterized by mass spectrometry.
To expand the Cy3B toolkit, a monomer for the 50-
addition of Cy3B was synthesized by reacting iodo-Cy3B
with 5-hexyn-1-ol then converting the product to the
phosphoramidite (B, Scheme 2). Iodo-Cy3B was also
used as an intermediate in the synthesis of 5-ethynyl-
Cy3B (E, Scheme 3), which was used for the incorporation
of Cy3B into DNA by reverse click chemistry (18). The
Cy3B compounds were found to have a very high affinity
for silica and so special care was taken during purification;
methanolic ammonia was used in the mobile phase to
prevent retention of the compounds on the column. To
complete the series of Cy3B labelling reagents, Cy3BdR
(dR = deoxyribose) was synthesized by reacting iodo-
Cy3B with 10-hexynyl deoxyribose (Scheme 4).
Phosphitylation of the b-anomer provided a phosphor-
amidite monomer for internal or end-addition (C), and
attachment of the a-anomer to a solid support gave
a-Cy3BdR resin D, which provided a means of adding
Cy3B to the 30-end of oligonucleotides. The above
monomers and solid supports enable the facile incorpor-
ation of Cy-Dyes into oligonucleotides at any internal or
terminal position during oligonucleotide synthesis.
RESULTS AND DISCUSSION
Synthesis of Cy-Dye monomers, solid supports and
oligonucleotides
The synthesis of 5-iodo-Cy3B (7; Scheme 1) was adapted
from the procedure described in the patent literature for
the synthesis of Cy3B (13), which involves the addition of
a 3,3-diethyloxypropyl group at the 1N position of the
indole ring. This product was very unstable, so instead
the ethyldioxolane group was used. The resulting indoles
with protected aldehydes (2 and 4, Scheme 1) were used
immediately after synthesis to prevent deprotection of the
dioxolane and cyclization of the indole. The protection
was sufficiently robust during the subsequent reactions
to enable the synthesis of the hemicyanine dye
(5, Scheme 1) and the cyanine dye (6, Scheme 1). The
aldehyde groups were deprotected using aqueous sul-
phuric acid in chloroform allowing rapid tandem
cyclization to produce 5-iodo-Cy3B in high yield (96%).
The syntheses of 5-iodo-Cy3 (21, Supplemen-
tary Scheme S1) and 5-iodo-Cy5 (23, Supplementary
Scheme S2) were carried out using a combination of litera-
ture sources (12,14–16). The iodo derivatives of Cy3B, Cy3
and Cy5 were coupled to 5-ethynyl-dU (17) in moderate
yield by palladium cross-coupling chemistry to give the
corresponding Cy3BdT, Cy3dT and Cy5dT derivatives
Properties of oligonucleotides containing Cy-Dyes
The effects of Cy3dT, Cy5dT and Cy3BdT on DNA
duplex stability were evaluated by UV melting using a
series of 23- to 25-mer oligonucleotides. Each dye
slightly destabilized the duplex; Cy3BdT (ꢂ3.4ꢀC),
Cy5dT (ꢂ3.1ꢀC) and Cy3dT (ꢂ2.4ꢀC), as is often
observed for nucleobases labelled with fluorophores
(Supplementary Table S1, sequences in Supplementary
Table S2). Nevertheless, these results demonstrate that
the Cy-dT monomers can be used as thymidine analogues
without greatly perturbing the DNA duplex. This was con-
firmed by comparing the CD spectra of oligonucleotides
containing Cy-Dyes with their unmodified counterparts
(Supplementary Figure S1).
The fluorescence quantum yields of the Cy3B monomers
were, as expected, significantly higher than Cy3, Cy5 or

4
Nucleic Acids Research, 2012
Scheme 1. Synthesis of Cy3BdT phosphoramidite. Reagents and conditions: (i) Bromoethyl-1,3-dioxolane, KI, MeCN, reflux, 45 h, 29%;
(ii) bromoethyl-1,3-dioxolane, KI, MeCN, reflux, 45 h, 56%; (iii) N,N0-diphenylformamidine, EtOH, triethylorthoformate, 97ꢀC, 16 h, 65%; (iv) 2,
pyridine, Ac2O, 50ꢀC, 24 h, 79%; (v) CHCl3, 50% aqueous H2SO4, room temperature, 20 min, 96%; (vi) 5-ethynyl-dU, CuI, Pd(PPh3)4, Et3N, DMF,
room temperature, 1.5 h, 42%; (vii) 2-cyanoethyl-N,N-diisopropyl-chlorophosphoramidite, DIPEA, DCM, room temperature, 45 min, 63%.
(ODN-20) and Cy5dT (ODN-21) exhibited significant
temperature dependence, whereas the Cy3B oligonucleo-
tides (ODN-23, ODN-11) showed virtually no reduction in
fluorescence with increased temperature (Supplementary
Figure S2). The above results indicate that oligonucleo-
tides containing the new Cy3BdT monomers will be
particularly suitable in biochemical and biological appli-
cations which require high sensitivity, and in studies that
are carried out at elevated temperatures (e.g. high-
resolution DNA melting).
In a preliminary study, duplexes containing Cy3dT and
Cy5dT in complementary strands showed the expected
inverse correlation between FRET efficiency and the
distance between the dyes (Supplementary Figure S4,
Supplementary Table S5). The dyes are located in the
major groove on the periphery of the duplex (5-position
of thymine) which means that increasing the base pair
Figure 2. Capillary electrophoresis analysis (monitored at 260 nm).
separation between Cy-Dye labelled bases along the
(A) An oligonucleotide containing five additions of Cy3dT (ODN-38).
helical axis sometimes brings the dyes closer together
about the helix axis (Supplementary Figure S5), an effect
also seen by Clegg et al. (24). This effect is unavoidable for
any dye that is attached to a DNA base. The rigidity of the
ethynyl linker imposes another important restriction on
dye mobility; FRET measurements at shorter
dye-acceptor distances are possible as the dyes cannot
reach each other to give contact quenching.
As indicated by Seidel et al. (5), short linkers are
required for measuring short distances in DNA, because
the length of long linkers is comparable to the absolute
distances between donor and acceptor dyes. They also
note that ꢀ2-related uncertainties for short linkers are out-
weighed by better defined dye positions. Hence, although
rotation about the short linker of the Cy-dT monomers
imposes uncertainty in the ꢀ2 value, this is compensated by
the precise dye positioning along the helical axis. This is
(B) An oligonucleotide containing both Cy3dT and Cy5dT (ODN-16).
the corresponding Cy3dT and Cy5dT monomers (0.5 and
0.8 for Cy3BdT and b-Cy3BdR, respectively, compared to
0.15 and 0.28 for Cy3 and Cy5 NHS esters and 0.05 and
0.06 for Cy3dT and Cy5dT, respectively, Supplementary
Table S3). Cy3B is not normally vulnerable to the
photo-induced cis/trans isomerization or the temper-
ature-dependent decrease in fluorescence exhibited by
Cy3 and Cy5 because the rigid cyclized polymethine
linker prevents rotation (1,19–23). To demonstrate this
holds true for our derivatives, Cy3dT, Cy5dT and Cy3B
oligonucleotides ODN-20, ODN-21, ODN-23, ODN-11
(Supplementary Table S4) were subjected to fluorescence
melting. The oligonucleotides containing Cy3dT

Nucleic Acids Research, 2012
5
Scheme 2. Synthesis of 5-(hexyn-1-ol)-6-Cy3B phosphoramidite. Reagents and conditions: (i) 5-hexyn-1-ol, CuI, Pd(PPh3)4, DMF, Et3N, room
temperature, 5 h, 82%; (ii) 2-cyanoethyl-N,N-diisopropyl-chlorophosphoramidite, DIPEA, DCM, room temperature, 45 min, 93%.
Scheme 3. Synthesis of 5-ethynyl-Cy3B. Reagents and conditions: (i) trimethylsilylacetylene, CuI, Pd(PPh3)4, Et3N, DMF, 16 h, room temperature,
71%; (ii) TBAF, THF, 5 min, room temperature, 75%.
Scheme 4. Synthesis of b-Cy3BdR phosphoramidite and a-Cy3BdR solid support. Reagents and conditions; (i) MeOH, 1% methanolic HCl, room
temperature, 30 min; (ii) pyridine, p-toluoyl-chloride, 0ꢀC then room temperature, 16 h; (iii) acetic acid, saturated HCl in acetic acid, acetyl chloride,
0ꢀC then room temperature, 64% over three steps; (iv) THF, DCM, DMAP, 5-hexyn-1-ol, room temperature, 3.5 h, 53%; (v) methanolic ammonia,
45ꢀC, 16 h, 82%; (vi) DMTCl, pyridine, DMAP, 1 h, room temperature, a 47%, b 41% (total 88%); (vii) 7, CuI, Pd(PPh3)4, Et3N, DMF, 52 h, room
temperature, a 66%, b 73%; (viii) 2-cyanoethyl-N,N-diisopropyl-chlorophosphoramidite, DIPEA, DCM, room temperature, 45 min, 94%; (ix)
succinylated amino-link resin, N-(3-dimethylaminopropyl)-N0-ethylcarbodiimide hydrochloride, DMAP, Et3N.

6
Nucleic Acids Research, 2012
Figure 3. The mechanism of action of (A) Molecular Beacon probes, (B) Taqman probes, (C) Scorpion probes and (D) HyBeacon probes.
clearly a complicated issue made more complex by the
dynamics of the DNA duplex, and a detailed study will
be undertaken by us in due course.
dual-fluorophore Molecular Beacon have been studied
using several chromophores (45–47) but it remains a chal-
lenge to obtain good closed-Beacon quenching yet retain
high fluorescence in the hybridized form. It was hoped
that both these requirements could be fulfilled using
Cy3B dual-fluorophore Molecular Beacons. Asymmetric
real-time PCR using both Beacons gave successful wt/mt
discrimination using ODN-8 (Supplementary Figure S3)
and ODN-9 (Figure 4A). In both probe formats the
wild-type template had a cycle-threshold (CT) value of
20 whereas the mutant-type template showed no
real-time fluorescence accumulation. This is because the
duplexes formed between the mutant template and
the Molecular Beacon probes are unstable due to the
mismatch, so are not formed at the monitoring tempera-
ture during the PCR (58ꢀC). The dual-fluorophore
Molecular Beacon gave a far superior real-time amplifica-
tion than the traditional Molecular Beacon giving almost
double the fluorescence signal.
Studies on fluorogenic PCR probes containing
Cy3B monomers
Several fluorogenic PCR probes (Figure 3) containing
Cy3B were synthesized; a Taqman probe (25,26), a
HyBeacon (27–30), a Molecular Beacon (31–36) and a
Scorpion probe (37–39); along with synthetic tem-
plates and primers for the cystic fibrosis transmembrane
conductance regulatory (CFTR) gene (R516G mutation)
(ODN-1 wt, ODN-2 mt, ODN-3 forward primer, ODN-4
reverse primer, Table 1).
Molecular Beacon probes containing b-Cy3BdR
phosphoramidite and a-Cy3BdR resin
Molecular Beacons are optical switches that have very low
fluorescence in the closed form and highly intense fluores-
cence in the hybridized form. Cy3B Molecular Beacons
were designed to probe the antisense strand (instead of
the sense strand ODN-1) in order to achieve a good wt/
mt discrimination by forming an AC mismatch which is
particularly unstable at neutral pH and above, instead of a
relatively stable TG mismatch (40–42). Two Molecular
Beacon probes were evaluated. Firstly, a conventional
Molecular Beacon was designed with a 30-DABCYL
quencher and 50-b-Cy3BdR fluorophore (ODN-8). It has
been established (43) that DABCYL is a suitable contact
quencher for Cy3B with minimal unwanted FRET
quenching in the open Beacon. Secondly, a dual-
fluorophore Molecular Beacon (ODN-9) was synthesized
using the a-Cy3BdR solid support at the 30-end and the
b-Cy3BdR phosphoramidite monomer at the 50-end.
Dual-fluorophore Molecular Beacons have been described
previously (44). In the closed form the two dyes stack to
form a quenched dimer, whereas in the hybridized form
they give increased fluorescence compared to standard
dye-quencher Molecular Beacons. Variations on the
Taqman probe containing 50-Cy3B phosphoramidite
A Taqman probe with 50-Cy3B (5-(hexyn-1-ol)-6-Cy3B
phosphoramidite) and internal BHQ2 was synthesized
(ODN-6, Table 1). BHQ2 was chosen as the FRET
quencher due to its strong absorbance at the emission
wavelength of Cy3B (BHQ2 abs max 580 nm). In a con-
ventional Taqman probe (normally ꢃ20 bases in length)
the fluorophore is located at the 50-end so that it is cleaved
efficiently by the DNA polymerase, and the quencher is
located at the 30-end (25). A longer probe (29 bases) was
designed for the AT-rich CFTR R516G locus to ensure
that the probe was annealed to the template at the PCR
extension temperature. The quencher was located cen-
trally within the probe to allow for efficient FRET
quenching of the fluorophore. Symmetric real-time PCR
was carried out to give successful discrimination between
the wild-type and mutant templates (Figure 4B). The
wild-type had a CT value of 16 indicating that probe
cleavage during the extension step was very efficient,
whereas the mutant had a CT value of 19; in this case

Nucleic Acids Research, 2012
7
Table 1. Oligonucleotide sequences used in the PCR study
ODNs
Sequences
ODN descriptions
ODN-1
TCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTG
TTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAA
GAGGTAAGAAACTATGTGAAAACTTTTTGA
TCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGT
TTCCTATGATGAATATGGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGA
GGTAAGAAACTATGTGAAAACTTTTTGA
Wild-type template
Mutant template
ODN-2
ODN-3
ODN-4
ODN-5
ODN-6
ODN-7
ODN-8
CAGTTTTCCTGGATTATGCC
CAAAAAGTTTTCACATAGTTTCTT
GGCACCATTAAAGAAAATATCA
hTTCCTATGAqGAATATAGATACAGAAGCGp
CGCTTCbGTATCbATATTCATCp
sCCTAGCATGATGAATATAGATACAGAAGCGTCGCTAGGd
Forward primer
Reverse primer
Reverse Taqman primer
Taqman probe
HyBeacon
Dye-quencher
Molecular Beacon
Dual-fluorophore
Molecular Beacon
Scorpion probe
ODN-9
sCCTAGCATGATGAATATAGATACAGAAGCGTCGCTAGGr
ODN-10
sCCGCGGGATGAATATAGATACAGAAGCGCCGCGGQHTCTTCTAGTTGGCATGCT
Key; b = Cy3BdT phosphoramidite; p = propanol resin; h = 5-(hexyn-1-ol)-6-Cy3B phosphoramidite; d = DABCYL resin; Q = DABCYL-dT
phosphoramidite; r = a-Cy3BdR resin; s = b-Cy3BdR phosphoramidite; H = Hexaethylene glycol; q = BHQ2-dT phosphoramidite. PCR templates
(ODN-1 wt, ODN-2 mt) show the mutation site underlined. PCR primers (ODN-3 forward, ODN-4 reverse and ODN-5 reverse primer for Taqman
probe).
Figure 4. Wild-type template (blue), mutant template (red) and negative control (black). Samples performed in triplicate. (A) Fluorescence accu-
mulation during real-time PCR using the dual-fluorophore Molecular Beacon (ODN-9). (B) Fluorescence accumulation of real-time PCR using a
Taqman probe containing Cy3B and BHQ2 (ODN-6). (C) Fluorescence accumulation of real-time PCR using a Scorpion probe containing Cy3B and
DABCYL (ODN-10). (D) Fluorescence accumulation of real-time PCR using a HyBeacon probe containing Cy3BdT (ODN-7). (E) The derivative of
the fluorescence melting curve, giving Tm values for the wild-type (50ꢀC) and mutant (45ꢀC).
the probe-template duplex is unstable and so the probe
was cleaved at a far slower rate. The ratio of fluorescence
intensity (ꢃ6.5:1 wt:mt) is also a clear indicator of good
wt/mt discrimination.
real-time PCR was carried out and excellent wt/mt discrim-
ination was obtained (Figure 4C). The wild-type template
had a CT value of 18 and the final fluorescence intensity was
high, indicating efficient probe-template duplex formation.
This was anticipated, as Scorpion probe-amplicon binding
is kinetically favoured over re-annealing of the amplicon,
and is thermodynamically favoured over re-folding into a
hairpin structure, thereby providing a rapid and robust
signalling mechanism (37,38).
Scorpion probe containing b-Cy3BdR
phosphoramidite monomer
A Scorpion probe was synthesized containing b-Cy3BdR
and a DABCYL quencher (ODN-10) (Table 1). Symmetric

8
Nucleic Acids Research, 2012
HyBeacon probe containing Cy3BdT
phosphoramidite monomer
oligonucleotide synthesis, purification and biophysical
studies) and Supplementary References [12–18,48–62].
HyBeacon probes can be used to monitor the PCR in real-
time, but their major benefit stems from post-amplification
melting which gives precise discrimination between wild-
type and mutant targets (matched and mismatched). A
HyBeacon probe was synthesized containing two Cy3BdT
units (ODN-7, Table 1). Asymmetric PCR was carried out
followed by post-PCR fluorescence melting and the results
are shown in Figure 4. The wild-type has a CT value of 22
while the mutant has a CT value of 25 (Figure 4D). In
addition, the ratio of fluorescence intensity is ꢃ4:1
(wt:mt) as a result of the mutant duplex being less stable
at the monitoring temperature. The derivative of a
post-amplification melting curve (Figure 4E) gives clearly
defined Tm values of 50ꢀC for the wt and 45ꢀC for the
mutant, making it possible to unambiguously discriminate
between them.
ACKNOWLEDGEMENTS
We thank ATDBio for oligonucleotide synthesis and
Dr Rob Powell (Primer Design) and Jane Theaker
(Qiagen) for assistance with probe design.
FUNDING
The UK Biotechnology and Biological Sciences Research
Council and ATDBio via a BBSRC Ph.D. studentship (to
L.H.) and a CASE studentship (to M.G.). Funding for
open access charge: University of Southampton.
Conflict of interest statement. None declared.
REFERENCES
CONCLUSIONS
1. Sanborn,M.E., Connolly,B.K., Gurunathan,K. and Levitus,M.
(2007) Fluorescence properties and photophysics of the
sulfoindocyanine Cy3 linked covalently to DNA.
J. Phys. Chem. B, 111, 11064–11074.
2. El-Sagheer,A.H. and Brown,T. (2010) Click chemistry with DNA.
Chem. Soc. Rev., 39, 1388–1405.
3. Gierlich,J., Burley,G.A., Gramlich,P.M., Hammond,D.M. and
Carell,T. (2006) Click chemistry as a reliable method for the
high-density postsynthetic functionalization of alkyne-modified
DNA. Org. Lett., 8, 3639–3642.
4. Seela,F. and Sirivolu,V.R. (2007) Nucleosides and oligonucleotides
with diynyl side chains: the Huisgen-Sharpless cycloaddition
‘‘click reaction’’ performed on DNA and their constituents.
Nucleosides Nucleotides Nucleic Acids., 26, 597–601.
5. Sindbert,S., Kalinin,S., Nguyen,H., Kienzler,A., Clima,L.,
A new range of Cy-Dye phosphoramidite monomers
have been synthesized and incorporated into synthetic
oligonucleotides. The phosphoramidite method of
insertion during DNA synthesis allows for efficient
multiple and mixed dye additions and provides a con-
venient and efficient site-specific method of inserting
cyanine dyes into oligonucleotides. A Cy3B molecular
toolkit has been produced based on an efficient synthe-
sis of iodo and ethynyl derivatives of the Cy3B dye.
These new Cy3B phosphoramidite monomers and
solid supports offer major advantages over the commer-
cially available post-synthetic Cy3B labelling reagents, as
they provide a convenient way to incorporate single or
multiple Cy3B units at any oligonucleotide position in
high yield, as demonstrated by the synthesis of oligo-
nucleotides labelled internally and at both ends. As
anticipated, Cy3B oligonucleotides have superior fluores-
cence properties compared to Cy3 and Cy5 analogues.
The synthesis of a Taqman probe, a HyBeacon probe, a
Molecular Beacon and a Scorpion probe containing
various Cy3B monomers demonstrates the utility of the
Cy3B molecular toolkit and a dual-fluorophore Molecular
Beacon containing a Cy3B monomer at both termini was
found to be superior to a corresponding Cy3B/DABCYL
Molecular Beacon. A preliminary study indicated that the
rigid ethynyl Cy-dT monomers can be used to measure
FRET within an oligonucleotide, and detailed studies of
this type will be undertaken in the future. It is envisaged
that oligonucleotide probes containing this new range of
Cy-Dye monomers could be used for single-molecule and
cell-imaging studies.
Bannwarth,W., Appel,B., Muller,S. and Seidel,C.A.M. (2011)
¨
Accurate distance determination of nucleic acids via Forster
¨
resonance energy transfer: implications of dye linker length and
rigidity. J. Am. Chem. Soc., 133, 2463–2480.
6. Iqbal,A., Arslan,S., Okumus,B., Wilson,T.J., Giraud,G.,
Norman,D.G., Ha,T. and Lilley,D.M.J. (2008) Orientation
dependence in fluorescent energy transfer between Cy3 and Cy5
terminally attached to double-stranded nucleic acids.
Proc. Natl Acad. Sci. USA, 105, 11176–11181.
7. Ouellet,J., Schorr,S., Iqbal,A., Wilson,T.J. and Lilley,D.M.J.
(2011) Orientation of cyanine fluorophores terminally attached to
DNA via long, flexible tethers. Biophys. J., 101, 1148–1154.
8. Borjesson,K., Preus,S., El-Sagheer,A.H., Brown,T., Albinsson,B.
¨
and Wilhelmsson,L.M. (2009) Nucleic acid base analog
FRET-pair facilitating detailed structural measurements in nucleic
acid containing systems. J. Am. Chem. Soc., 131, 4288–4293.
9. Hudson,R.H.E. and Ghorbani-Choghamarani,A. (2007)
Oligodeoxynucleotides incorporating structurally simple
5-alkynyl-2’-deoxyuridines fluorometrically respond to
hybridization. Org. Biomol. Chem., 5, 1845–1848.
10. Xie,Y., Maxson,T. and Tor,Y. (2010) Fluorescent nucleoside
analogue displays enhanced emission upon pairing with guanine.
Org. Biomol. Chem., 8, 5053–5055.
11. Wilhelmsson,L.M. (2010) Fluorescent nucleic acid base analogues.
Q. Rev. Biophys., 43, 159–183.
12. Fegan,A., Shirude,P.S. and Balasubramanian,S. (2008) Rigid
cyanine dye nucleic acid labels. Chem. Commun., 2004–2006.
13. Waggoner,A.S. and Mujumdar,R. (2001) Rigidized trimethine
cyanine dyes. U.S. Patent No, 6133445A.
14. Zimmermann,T. and Hennig,L. (2002) Ring transformations of
heterocyclic compounds. XXII. Pyrido[1,2-a]indolium salts from
2-methyl-3H-indoles by pyrylium mediated three carbon
annelation. J. Heterocycl. Chem., 39, 263–269.
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online:
Supplementary Schemes 1 and 2, Supplementary Tables
1–5, Supplementary Figures 1–5, Supplementary Methods
(synthesis of the Cy-Dye monomers, methods for

Nucleic Acids Research, 2012
9
15. Tomasulo,M., Sortino,S. and Raymo,F.M. (2008) Bichromophoric
photochromes based on the opening and closing of a single
oxazine ring. J. Org. Chem., 73, 118–126.
36. Marras,S.A.E., Kramer,F.R. and Tyagi,S. (1999) Multiplex
detection of single-nucleotide variations using molecular beacons.
Genet. Anal. -Biomol. Eng., 14, 151–156.
16. Mason,S.J., Hake,J.L., Nairne,J., Cummins,W.J. and
Balasubramanian,S. (2005) Solid-phase methods for the synthesis
of cyanine dyes. J. Org. Chem., 70, 2939–2949.
37. Whitcombe,D., Theaker,J., Guy,S.P., Brown,T. and Little,S.
(1999) Detection of PCR products using self-probing amplicons
and fluorescence. Nat. Biotechnol., 17, 804–807.
17. Graham,D., Parkinson,J.A. and Brown,T. (1998) DNA duplexes
stabilized by modified monomer residues: synthesis and stability.
J. Chem. Soc.-Perkin Trans. I, 1131–1138.
18. Gerowska,M., Hall,L.M., Richardson,J.A., Shelbourne,M. and
Brown,T. (2012) Efficient reverse click labeling of azide
oligonucleotides with multiple alkynyl Cy-Dyes applied to the
synthesis of HyBeacon probes for genetic analysis. Tetrahedron,
68, 857–864.
19. Aramendia,P.F., Negri,R.M. and Sanroman,E. (1994)
Temperature-dependence of fluorescence and photoisomerisation
in symmetrical carbocyanines - influence of medium viscosity and
molecular-structure. J. Phys. Chem., 98, 3165–3173.
20. Chibisov,A.K., Zakharova,G.V., Goerner,H., Sogulyaev,Y.A.,
Mushkalo,I.L. and Tolmachev,A.I. (1995) Photorelaxation
processes in covalently-linked indocarbocyanine and
thiacarbocyanine dyes. J. Phys. Chem., 99, 886–893.
21. Chibisov,A.K., Zakharova,G.V. and Goerner,H. (1996) Effects of
substituents in the polymethine chain on the photoprocesses in
indodicarbocyanine dyes. J. Chem. Soc.-Faraday Trans., 92,
4917–4925.
38. Thelwell,N., Millington,S., Solinas,A., Booth,J. and Brown,T.
(2000) Mode of action and application of Scorpion primers to
mutation detection. Nucleic Acids Res., 28, 3752–3761.
39. Solinas,A., Brown,L.J., McKeen,C., Mellor,J.M., Nicol,J.T.G.,
Thelwell,N. and Brown,T. (2001) Duplex Scorpion primers in
SNP analysis and FRET applications. Nucleic Acids Res., 29,
E96.
40. Ikuta,S., Takagi,K., Wallace,R.B. and Itakura,K. (1987)
Dissociation kinetics of 19 base paired oligonucleotide-DNA
duplexes containing different single mismatched base pairs.
Nucleic Acids Res., 15, 797–811.
41. Ke,S.H. and Wartell,R.M. (1993) Influence of nearest neighbour
sequence on the stability of base pair mismatches in long DNA;
determination by temperature-gradient gel electrophoresis.
Nucleic Acids Res., 21, 5137–5143.
42. Allawi,H.T. and SantaLucia,J. (1998) Nearest-neighbor
thermodynamics of internal A.C mismatches in DNA: sequence
dependence and pH effects. Biochemistry, 37, 9435–9444.
43. Marras,S.A.E., Kramer,F.R. and Tyagi,S. (2002) Efficiencies
of fluorescence resonance energy transfer and
22. Harvey,B.J. and Levitus,M. (2009) Nucleobase-specific
enhancement of Cy3 fluorescence. J. Fluoresc., 19, 443–448.
23. Levitus,M. and Ranjit,S. (2011) Cyanine dyes in biophysical
research: the photophysics of polymethine fluorescent dyes in
biomolecular environments. Q. Rev. Biophys., 44, 123–151.
24. Clegg,R.M., Murchie,A.I.H., Zechel,A. and Lilley,D.M.J. (1993)
Observing the helical geometry of double-stranded DNA in
solution by fluorescence resonance energy transfer. Proc. Natl
Acad. Sci. USA, 90, 2994–2998.
25. Livak,K.J., Flood,S.J.A., Marmaro,J., Giusti,W. and Deetz,K.
(1995) Oligonucleotides with fluorescent dyes at opposite ends
provide a quenched probe system useful for detecting PCR
product and nucleic acid hybridisation. PCR Methods Appl., 4,
357–362.
26. Holland,P.M., Abramson,R.D., Watson,R. and Gelfand,D.H.
(1991) Detection of specific polymerase chain-reaction product by
utilising the 5’-3’ exonuclease activity of thermus-aquaticus
DNA-polymerase. Proc. Natl Acad. Sci. USA, 88, 7276–7280.
27. French,D.J., Archard,C.L., Andersen,M.T. and McDowell,D.G.
(2002) Ultra-rapid DNA analysis using HyBeacon probes and
direct PCR amplification from saliva. Mol. Cell. Probes, 16,
319–326.
28. French,D.J., Archard,C.L., Brown,T. and McDowell,D.G. (2001)
HyBeacon (TM) probes: a new tool for DNA sequence detection
and allele discrimination. Mol. Cell. Probes, 15, 363–374.
29. Dobson,N., McDowell,D.G., French,D.J., Brown,L.J.,
Mellor,J.M. and Brown,T. (2003) Synthesis of HyBeacons and
dual-labelled probes containing 2’-fluorescent groups for use in
genetic analysis. Chem. Commun., 1234–1235.
30. Richardson,J.A., Gerowska,M., Shelbourne,M., French,D. and
Brown,T. (2010) Six-colour HyBeacon probes for multiplex
genetic analysis. ChemBioChem, 11, 2530–2533.
31. Piatek,A.S., Tyagi,S., Pol,A.C., Telenti,A., Miller,L.P.,
Kramer,F.R. and Alland,D. (1998) Molecular beacon sequence
analysis for detecting drug resistance in Mycobacterium
tuberculosis. Nat. Biotechnol., 16, 359–363.
32. Tyagi,S., Bratu,D.P. and Kramer,F.R. (1998) Multicolor
molecular beacons for allele discrimination. Nat. Biotechnol., 16,
49–53.
33. Tyagi,S. and Kramer,F.R. (1996) Molecular beacons: probes that
fluoresce upon hybridization. Nat. Biotechnol., 14, 303–308.
34. Marras,S.A.E., Tyagi,S. and Kramer,F.R. (2006) Real-time assays
with molecular beacons and other fluorescent nucleic acid
hybridization probes. Clin. Chim. Acta, 363, 48–60.
35. Vet,J.A.M., Majithia,A.R., Marras,S.A.E., Tyagi,S., Dube,S.,
Poiesz,B.J. and Kramer,F.R. (1999) Multiplex detection of four
pathogenic retroviruses using molecular beacons. Proc. Natl Acad.
Sci. USA, 96, 6394–6399.
contact-mediated quenching in oligonucleotide probes. Nucleic
Acids Res., 30, e122.
44. Venkatesan,N., Seo,Y.J. and Kim,B.H. (2008) Quencher-free
molecular beacons: a new strategy in fluorescence based nucleic
acid analysis. Chem. Soc. Rev., 37, 648–663.
45. Bernacchi,S. and Mely,Y. (2001) Exciton interaction in molecular
beacons: a sensitive sensor for short range modifications of the
nucleic acid structure. Nucleic Acids Res., 29, e62.
46. Conley,N.R., Pomerantz,A.K., Wang,H., Twieg,R.J. and
Moerner,W.E. (2007) Bulk and single-molecule characterization of
an improved molecular beacon utilizing H-dimer excitonic
behavior. J. Phys. Chem. B, 111, 7929–7931.
47. Nesterova,I.V., Erdem,S.S., Pakhomov,S., Hammer,R.P. and
Soper,S.A. (2009) Phthalocyanine dimerization-based molecular
beacons using Near-IR fluorescence. J. Am. Chem. Soc., 131,
2432–2433.
48. Gottlieb,H.E., Kotlyar,V. and Nudelman,A. (1997) NMR
chemical shifts of common laboratory solvents as trace impurities.
J. Org. Chem., 62, 7512–7515.
49. Booth,J., Brown,T., Vadhia,S.J., Lack,O., Cummins,W.J.,
Trent,J.O. and Lane,A.N. (2005) Determining the origin of the
stabilization of DNA by 5-aminopropynylation of pyrimidines.
Biochemistry, 44, 4710–4719.
50. Sonogashira,K., Tohda,Y. and Hagihara,N. (1975) Convenient
synthesis of acetylenes - catalytic substitutions of acetylenic
hydrogen with bromoalkenes, iodoarenes, and bromopyridines.
Tetrahedron Lett., 16, 4467–4470.
51. Hobbs,F.W. (1989) Palladium-catalyzed synthesis of alkynylamino
nucleosides - a universal linker for nucleic acids. J. Org. Chem.,
54, 3420–3422.
52. Crisp,G.T. and Flynn,B.L. (1993) Palladium-catalyzed coupling of
terminal alkynes with 5-(trifluoromethanesulfonyloxy)pyrimidine
nucleosides. J. Org. Chem., 58, 6614–6619.
53. Cai,C. and Vasella,A. (1995) Oligosaccharide analogs of
polysaccharides.3. A new protecting group for alkynes -
orthogonally protected dialkynes. Helv. Chim. Acta, 78, 732–757.
54. El-Sagheer,A.H. and Brown,T. (2008) Synthesis of alkyne- and
azide-modified oligonucleotides and their cyclization by the
CuAAC (click) reaction. Curr. Protoc. Nucleic Acid Chem., 35,
4.33.1–4.33.21.
55. Kocalka,P., El-Sagheer,A.H. and Brown,T. (2008) Rapid and
efficient DNA strand cross-linking by click chemistry.
ChemBioChem, 9, 1280–1285.
56. Deglane,G., Morvan,F., Debart,F. and Vasseur,J.J. (2007)
5-Propynylamino alpha-deoxyuridine promotes DNA duplex
stabilization of anionic and neutral but not cationic
alpha-oligonucleotides. Bioorg. Med. Chem. Lett., 17, 951–954.

10 Nucleic Acids Research, 2012
57. Rolland,V., Kotera,M. and Lhomme,J. (1997) Convenient
preparation of 2-deoxy-3,5-di-O-p-toluoyl-alpha-D-erythro-
pentofuranosyl chloride. Synth. Commun., 27, 3505–3511.
58. Morvan,F., Rayner,B., Leonetti,J.P. and Imbach,J.L. (1988)
alpha-DNA. VII. Solid-phase synthesis of alpha-anomeric
oligodeoxyribonucleotides. Nucleic Acids Res., 16, 833–847.
59. Damha,M.J., Giannaris,P.A. and Zabarylo,S.V. (1990) An
improved procedure for derivatization of controlled-pore
glass-beads for solid-phase oligonucleotide synthesis.
Nucleic Acids Res., 18, 3813–3821.
hairpin and hammerhead ribozymes. Proc. Natl Acad. Sci. USA,
107, 15329–15334.
61. Karstens,T. and Kobs,K. (1980) Rhodamine-B and
rhodamine-101 as reference substances for fluorescence quantum
yield measurements. J. Phys. Chem., 84, 1871–1872.
62. Langley,G.J., Herniman,J.M., Davies,N.L. and Brown,T. (1999)
Simplified sample preparation for the analysis of
oligonucleotides by matrix-assisted laser desorption/ionisation
time-of-flight mass spectrometry. Rapid Commun. Mass Spectrom.,
13, 1717–1723.
60. El-Sagheer,A.H. and Brown,T. (2010) New strategy for the
synthesis of chemically modified RNA constructs exemplified by