LSP2-9166, an orthosteric mGlu4 and mGlu7 receptor agonist, reduces cocaine self-administration under a progressive ratio schedule in rats

Article abstract of DOI:10.1016/j.neulet.2020.135603

Cocaine addiction is a serious health issue in Western countries. Despite the regular increase in cocaine consumption across the population, there is no specific treatment for cocaine addiction. Critical roles for glutamate neurotransmission in the rewarding effects of psychostimulants as well as relapse have been suggested and accumulating evidence indicates that targeting mGlu group III receptors could represent a promising strategy to develop therapeutic compounds to treat addiction. In this context, the aim of our study was to examine the effect of LSP2-9166, a mGlu4/mGlu7 receptor orthosteric agonist, on the motivation for cocaine intake. We used an intravenous self-administration paradigm in male Wistar rats as a reliable model of voluntary drug intake. We first evaluated the direct impact of cocaine on Grm4 and Grm7 gene expression. Voluntary cocaine intake under a fixed ratio schedule of injections induced an increase of both mGlu4 and mGlu7 receptor transcripts in nucleus accumbens and hippocampus. We then evaluated the ability of LSP2-9166 to affect cocaine self-administration under a progressive ratio schedule of reinforcement. We found that this compound inhibits the motivation to obtain the drug, although it induced a hypolocomotor effect which could biais motivation index. Our findings demonstrate that mGlu group III receptors represent new targets for decreasing motivation to self-administer cocaine.

Full text of DOI:10.1016/j.neulet.2020.135603

Journal Pre-proof
LSP2-9166, an orthosteric mGlu4 and mGlu7 receptor agonist, reduces
cocaine self-administration under a progressive ratio schedule in rats
David de sa Nogueira, Romain Bourdy, Dominique Filliol, Cyril
Quessada, Isabelle McCort-Tranchepain, Francine Acher, Jean
Zwiller, Pascal Romieu, Katia Befort
PII:
S0304-3940(20)30873-9
DOI:
https://doi.org/10.1016/j.neulet.2020.135603
NSL 135603
Reference:
To appear in:
Neuroscience Letters
Received Date:
Revised Date:
Accepted Date:
29 June 2020
18 December 2020
23 December 2020
Please cite this article as: de sa Nogueira D, Bourdy R, Filliol D, Quessada C,
McCort-Tranchepain I, Acher F, Zwiller J, Romieu P, Befort K, LSP2-9166, an orthosteric
mGlu4 and mGlu7 receptor agonist, reduces cocaine self-administration under a progressive
ratio schedule in rats, Neuroscience Letters (2020),
doi: https://doi.org/10.1016/j.neulet.2020.135603
This is a PDF file of an article that has undergone enhancements after acceptance, such as
the addition of a cover page and metadata, and formatting for readability, but it is not yet the
definitive version of record. This version will undergo additional copyediting, typesetting and
review before it is published in its final form, but we are providing this version to give early
visibility of the article. Please note that, during the production process, errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal
pertain.
© 2020 Published by Elsevier.

LSP2-9166, an orthosteric mGlu4 and mGlu7 receptor agonist, reduces
cocaine self-administration under a progressive ratio schedule in rats
Running title: Pharmacological activation of mGlu4 and mGlu7 receptors reduces cocaine
motivation
David de sa Nogueira1, Romain Bourdy1, Dominique Filliol1, Cyril Quessada1,2, Isabelle
McCort-Tranchepain3, Francine Acher3, Jean Zwiller1, Pascal Romieu1,#, Katia Befort1,#,*
1Université de Strasbourg, Laboratoire de Neurosciences Cognitives et Adaptatives (LNCA),
Faculté de Psychologie, UMR 7364, CNRS 12 rue Goethe, F-67000 Strasbourg, France
2Université de Strasbourg, Inserm, UMR-S1118, 11 rue Humann, F-67000 Strasbourg, France
3Laboratoire de Chimie et Biochimie Pharmacologiques et Toxicologiques, CNRS UMR8601,
Université de Paris 45 rue des Saints-Pères, F-75270, Paris Cedex 6, France
# Co-last authors
*Corresponding author: Katia Befort
E-mail: katia.befort@unistra.fr
Highlights
•
•
•
• Cocaine increases mGlu group III receptor transcript expression
• LSP inhibits motivation to self-administer cocaine
• mGlu group III as new targets to treat substance use disorder
ABSTRACT
Cocaine addiction is a serious health issue in Western countries. Despite the regular increase in
cocaine consumption across the population, there is no specific treatment for cocaine addiction.
Critical roles for glutamate neurotransmission in the rewarding effects of psychostimulants as
well as relapse have been suggested and accumulating evidence indicates that targeting mGlu
group III receptors could represent a promising strategy to develop therapeutic compounds to
treat addiction. In this context, the aim of our study was to examine the effect of LSP2-9166, a
mGlu4/mGlu7 receptor orthosteric agonist, on the motivation for cocaine intake. We used an
intravenous self-administration paradigm in male Wistar rats as a reliable model of voluntary
drug intake. We first evaluated the direct impact of cocaine on Grm4 and Grm7 gene expression.
Voluntary cocaine intake under a fixed ratio schedule of injections induced an increase of both
mGlu4 and mGlu7 receptor transcripts in nucleus accumbens and hippocampus. We then
1

evaluated the ability of LSP2-9166 to affect cocaine self-administration under a progressive
ratio schedule of reinforcement. We found that this compound inhibits the motivation to obtain
the drug, although it induced a hypolocomotor effect which could biais motivation index. Our
findings demonstrate that mGlu group III receptors represent new targets for decreasing
motivation to self-administer cocaine.
Abbreviations
Amy: amygdala ; CPP: conditioned place preference ; DA: dopamine; DS: dorsal striatum ; G-
protein coupled metabotropic glutamate: mGlu; HPC: hippocampus; LTP: long-term
potentiation; PFC: prefrontal cortex; PR: progressive ratio; NAc: Nucleus Accumbens; SA:
self-administration; VTA: ventral tegmental area
Keywords: operant self-administration, LSP2-9166, Grm4, Grm7, cocaine, motivation
Introduction
Cocaine addiction is a chronic brain disease characterised by a high level of motivation
for the drug and relapse in cocaine users [1]. Given the multifaceted health issue that results
from this, including mortality and morbidity, research aimed at identifying the neurobiological
mechanisms underlying cocaine’s rewarding effects may lead to a better understanding of the
processes involved in addiction and potential therapeutic strategies. It is well established that
the dopamine (DA) neurotransmission system, particularly the mesolimbic pathway connecting
the ventral tegmental area (VTA) to the nucleus accumbens (NAc), is crucial for the
motivational component of behavior. This is classically measured in rodents using a progressive
ratio (PR) schedule of cocaine self-administration (SA) [2]. In addition, emerging evidence
points to a major role for glutamate in the progressive elaboration of cocaine-seeking behaviors
[3] and glutamate levels are modified during relapse [4]. Glutamate acts on fast-acting ligand-
gated ion channels, the ionotropic receptors, and slow-acting G-protein coupled metabotropic
glutamate (mGlu) receptors. Three groups of mGlu receptors exist in the brain. Group I
receptors (mGlu1/5 receptors) were the first to be demonstrated playing a role in drug
dependence [5]. However, mnesic processes were also altered by these compounds [6]. Also,
activation of group II mGlu receptors (mGlu2/3) reduces both seeking and taking behavior
towards distinct drugs of abuse in rodents, through normalization of an altered glutamatergic
neurotransmission induced by drug exposure [4]. However, activation of mGlu2/3 produced
2

reduced food-seeking behaviors [7] and a decrease in cognitive performance [8, 9]. Among
receptors of group III, mGlu6 and mGlu8 receptors lack precise behavioral function, whereas
mGlu4/7 receptors negatively control glutamate transmission and have been recently proposed
as targets for several neurodegenerative and neuropsychiatric conditions [10, 11].
The mGlu4 and mGlu7 receptors are expressed in the basal ganglia and structures of the
reward circuit [12, 13]. L-AP4, an agonist of group III mGlu receptors, inhibits Glu and/or
GABA release in key structures of the basal ganglia, such as striatum and globus pallidus [14,
15], therefore blocking cocaine-induced hyperlocomotion in rats [16]. Interestingly, a selective
mGlu4 agonist, LSP1-2111, reduced the expression of cocaine sensitization [17]. A selective
allosteric agonist of mGlu7 receptors, AMN082 [18], reduced cocaine SA [19] and altered both
alcohol preference and intake [20]. Side-effects of this compound were observed, with a
reduction of sucrose intake [21], and decreased locomotor activity at high doses [22]. Anti-
depressive and anxyolitic effects were also observed and proposed to be linked to a rapid
internalization process induced by AMN082 [23, 24].
The design of an orthosteric brain permeant subtype-selective ligand has facilitated new
investigations. Indeed, LSP2-9166, a mGlu4/7 receptor orthosteric agonist [25], represents the
most powerful orthosteric compound synthezised so far. Remarkably, it was recently shown to
inhibit both morphine-induced place preference and reinstatement after extinction in mice [26],
and ethanol intake in rats [27]. To complete this work on drug abuse, we first examined brain
transcript levels for both mGlu4 and mGlu7 receptors following voluntary cocaine intake. We
then examined whether the LSP2-9166 could modulate cocaine motivation in an intravenous
(i.v.) SA procedure in rats.
Materials and methods
Chemical compound
LSP2-9166 was prepared according to an improved synthesis [25]. Briefly, Figure 1
illustrates these improvements from recently reported preparation of derivatives [28, 29] to
avoid L-AP4 formation, a side product with selective and potent group III mGluR agonist
activity. We first improved a straightforward synthesis of the N-Boc-(S)-vinylglycine-O-tert-
butyl ester from Boc-Asp-OtBu in two steps without intermediate purification affording a scale-
up [30, 31]. Purity was checked by NMR (31P), with no detectable L-AP4, and confirmed before
use
by
a
pharmacological
approach
(ARPEGE
Platform,
Montpellier
3

https://www.igf.cnrs.fr/index.php/fr/research-fr/facility-fr). Final deprotection under milder
conditions led to the final product LSP2-9166 in higher yield, with a high purity.
Subjects
Male Wistar rats (Janvier Labs, France), aged five weeks and weighting 150-175 g upon
arrival, were housed in standard home cages (5 rats/cage), under a reversed 12h light/dark cycle
(lights on at 7pm), with water and food ad libitum. All procedures involving animal care were
conducted in compliance with current laws and policies, validated by a Comité d’Ethique en
Expérimentation Animale (CREMEAS) and authorised by the Ministère de l’Enseignement
Supérieur, de la Rechercher et de l’Innovation (APAFIS#7050-2016093016163350). Eighteen
rats were used for the molecular study and 69 for the SA procedure and locomotor activity.
Pharmacological treatment
Cocaine hydrochloride (Cooper, France) solution was adjusted with 0.9% NaCl to
infuse an i.v. dose of 0.33 or 0.5 mg/kg/injection for SA and 1.5 mg/kg for locomotor activity.
LSP2-9166 was first diluted into water at 20 mg/ml, pH was adjusted to 7.4 and final
concentration was set at 2 or 5 mg/ml using phosphate-buffered-saline (PBS). LSP2-9166 (2 or
5 mg/kg, i.v.) or vehicle (PBS) was administered 15 min before each SA session.
Surgery and cocaine operant self-administration
All rats went through an i.v. catheterization procedure for operant SA, performed as
described in detail previously [32]. Rats were anesthetized by an intraperitoneal injection (2
ml/kg) of a mixture containing ketamine (Imalgene 1000, 90 mg/kg, Centravet) and xylazine
(Rompun, 10 mg/kg; Centravet) to perform surgical implantation of a chronic indwelling
catheter in the right jugular vein. Catheters were flushed daily with heparin (100 U/mL) and
ampicillin (50 mg/mL) to prevent clotting and infection. Animals were then housed
individually. Following a 7-day recovery period, rats were submitted to behavioral experiments
conducted during the dark period. Each operant chamber was equipped with two 2.5 cm-
diameter holes, 4 cm above the floor. Holes were selected as active (delivering cocaine), and
inactive (without programmed consequence), and counterbalanced across groups. When the
required number of active nose-pokes was reached, cocaine 60 µL was delivered [32]. For
molecular studies, rats followed a fixed ratio (FR) 1 schedule of reinforcement (cocaine, 0.33
mg/kg/injection, 2h/session/10d) concurrently with saline control rats. For the pharmacological
study, rats were first trained for 2 h daily sessions under FR1 (3d) and FR5 (6d) and then
4

submitted to a PR schedule, in which the number of nose-pokes required to earn an injection
escalated within the session. Rats were trained for 6 consecutive daily sessions before the
pharmacological treatment with LSP2-9166 or vehicle (5d). Each session lasted for 5h or until
animals did not achieve the ratio for delivery of an injection within 1h. The breaking point to
extinguish SA behavior was determined in each animal.
Horizontal locomotor activity
Locomotor activity was measured in individual dedicated home-cages with two infrared
light beams. Numbers of longitudinal crossings were counted in 5 min bins. Three groups of
rats implanted with catheters were processed (vehicle/NaCl; vehicle /Cocaine; LSP/Cocaine).
Rats were first habituated to the actimetry cages and injections (vehicle) (3d). Following
habituation to the cages (1h), rats received either LSP2-9166 (5 mg/kg, i.v.) or vehicle, and
locomotor activity was recorded for 15 min. Then rats received cocaine (1.5 mg/kg, iv) or NaCl
0.9%, and activity was recorded for 1h.
Brain sample dissection and quantitative real-time PCR
Animals were given an overdose of pentobarbital (182 mg/kg, i.p.), 24h following the
last SA session, brains were removed and sliced (1-mm coronal brain matrix, Harvard
apparatus, MA, USA). Structures of interest were collected [33] (see Figure 2). Samples were
frozen on dry ice and kept at -80°C. Total RNA was extracted using Ribozol (VWR, France).
Reverse transcription was performed on 750 ng of total RNA, with iScript (iScriptTM cDNA
Synthesis Kit, Biorad, France). Real-time PCR was performed in triplicate using a CFX96
TouchTM apparatus and Sso AdvancedTM Universal SYBR Green supermix (Biorad, France).
Thermal cycling parameters were 30sec at 95°C followed by 40 cycles of 5sec at 95°C and
45sec at 60°C. Primer sequences: Rplp0 Fw CTGCCCGAGCCGGTGCCATC, Rv
TTCAATGGTACCTCTGGAG
;
Grm4, Fw TCCAGGACCAACGGACACTT Rv
ACGTGACCATCAGCAGCATG ; Grm7 Fw AGACACAGAAGGGAACGCCT, Rv
TCGGTTCTCATTGGGCCTCT. Expression levels were normalized to rplp0 housekeeping
gene levels and compared between saline and treated samples using the 2-ΔΔCt method [34].
Statistical analysis
All results are expressed as mean  sem. Data from qPCR were analyzed using unpaired
student’s t-test. Data from SA experiments were analyzed using repeated measures ANOVAs
with group as between-subject factor and treatment and session as within-subject factors. Data
5

from locomotor activity experiments were analyzed using ANOVA with group as between-
subject factor and bin as within-subject factor. The ANOVAs were followed by a Tukey HSD
posthoc test when required. Significance was set at p ≤ 0.05 (Statistica v13).
Results
Effect of cocaine on mGlu4 and mGlu7 receptor gene expression
We first examined whether voluntary cocaine intake would modulate mGlu4 and mGlu7
receptor gene expression in reward-related brain structures. Following 10 days of cocaine SA
(2h/d/FR1), rats displayed a stable level of cocaine intake (>100 injections/session) and directed
more than 90% of the nose-pokes onto the active hole (data not shown). Rats receiving saline
did not differentiate between holes (37.8±1.34% in the active hole). Microdissected brain
samples were processed to measure gene expression levels by qPCR (Figure 2). Both mGlu4
and mGlu7 transcripts were detectable, with a higher expression (> 2-fold) of mGlu7 compared
to mGlu4 in NAc, PFC and HPC, as previously described [12, 13] (data not shown). Expression
of both transcripts were significantly higher in cocaine- compared to saline-treated animals in
NAc (Figure 2B) (Grm4 p=0.0011; Grm7 p=0.0005) and HPC (Figure 2D) (Grm4 p=0.0023;
Grm7 p=0.0047). A significant decrease was observed for mGlu4 in Amy (Figure 2E) (Grm4
p=0.0024) while no regulations were observed for mGlu7 in Amy and for both receptors in PFC
(Figure 2A) and DS (Figure 2C).
Effect of LSP-9166 on cocaine motivation
We performed cocaine SA under a PR schedule of reinforcement (see methods). Treatment with
LSP2-9166 (0, 2 or 5 mg/kg i.v.) began 15 min before each session, for 5 days. The choice of
the doses was based on preliminary experiments and literature [26, 27, 35]. Several SA sessions
were necessary for the rats to display stable behavior, the ANOVA analysis showing no
statistical difference between sessions 5 and 6 [F(1, 38)=5.36, p=0.97] (Figure 3A). Therefore,
statistical analysis was performed on data from the last two sessions of each treatment (sessions
5/6 and sessions 10/11). The ANOVA (treatment, group, session) revealed a significant
treatment effect [F(1, 38)=6.97, p=0.012] and a significant treatment x group interaction [F(2,
38)=3.66, p=0.035)], without significant effect of the sessions nor interaction between session
and the other factors. Tukey HSD posthoc test showed that rats receiving vehicle or LSP2-9166
2 mg/kg did not display any behavioral changes in comparison to baseline (vehicle, p=0.97 and
LSP2-9166 2 mg/kg p=0.99). In contrast, administration of LSP2-9166 5 mg/kg resulted in a
6

significant reduction in the breaking point (p=0.004). We noted similar results for the active
nose-pokes (treatment x group interaction, F(2,38)=5, p=0.012), with significant difference
between baseline and LSP2-9166 5 mg/kg (p<0.001). A global decrease was observed for the
inactive nose-poke (significant treatment effect, F(1,38)=5, p=0.016) but without any
significant group effect (p=0.69), suggesting a motivational rather than a motor effect of the
compound (Figure 3B).
Effect of LSP-9166 on locomotor activity
We then evaluated the effect of LSP2-9166 (5 mg/kg) on spontaneous locomotor activity (first
injection) and on cocaine-induced hyperlocomotion (second injection) (Figure 3C). Following
the first injection (bin 60-75), the ANOVA revealed a significant interaction (bin x treatment,
F(6, 72) = 2.24, p=0.049). Locomotor activity increased only in vehicle/NaCl and
vehicle/Cocaine groups (bin 60-65, p<0.0002; LSP/Cocaine, p=0.75) (Tukey HSD test). No
significant differences were observed between the 3 groups for all the bins (60-75). This
indicates that LSP2-9166 reduced spontaneous activity-induced by the injection. For the second
injection (bin 75-135) a significant interaction (bin x group F(24, 288) = 3.03, p= 0.000006)
was observed. The Tukey HSD posthoc analysis showed a significant increase of locomotor
activity in all three groups compared to their baseline (bin 75-80 p<0.0004). A significant
difference was observed at bin 80 between vehicle/Cocaine and the two other groups (p<0.002),
suggesting a reduction of cocaine-induced locomotor activity in presence of LSP2-9166. No
significant differences were observed between the 3 groups for the other bins of the analyzed
period. These results indicated a global hypolocomotor activity induced by LSP2-9166.
Discussion
In this study, we show that voluntary cocaine intake induces an increase of mGlu4 and
mGlu7 receptor transcripts in NAc and HPC. The orthosteric agonist LSP2-9166 inhibits the
motivation to obtain the drug in a PR schedule of reinforcement, although this ligand induces a
hypolocomotor effect. An increasing interest has emerged in the addiction field directed to
mGlu receptors, which are well known to regulate glutamatergic neurotransmission [36, 37].
Group III mGlu receptor ligands were developped, with LSP1-2111 [29], an agonist for mGlu4,
and AMN802 [18], acting as the first allosteric mGlu7 agonist. Recently, the orthosteric LSP2-
9166 efficaciously decreased expression and reinstatement of a morphine CPP in mice [26] as
well as ethanol consumption, motivation for ethanol and reacquisition of ethanol SA following
abstinence in rats [27]. Our hypothesis that such modulatory effects may be expanded to cocaine
7

behavioral responses has been tested here and we confirm a reduced motivation for drug taking
in an operant paradigm.
Our results on locomotor activity have to be taken into account in the interpretation of
the effects of LSP2-9166 on the motivation for cocaine. We observed a decreased spontaneous
locomotor activity following a single injection of LSP2-9166 and a reduction in cocaine-
induced hyperlocomotion. Interestingly, hypolocomotor effect of acute LSP2-9166 was
previously reported in rats [27], at high doses in mice [26], with a small transient inactive state
resembling catalepsy [35], with no effect on motor coordination in this latter study. Also no
difference was detected on circular locomotor activity or rotarod test following systemic
injection of LSP2-9166 (10 mg/kg ip,14 d) [35]. In addition, it did not impact other behaviors
like sucrose intake or spatial memory [26, 27], suggesting a moderate locomotor impact on
behavior. Moreover, mice deficient for mGlu4 receptor showed a higher basal locomotor
activity [38], and mGlu7 receptor knockout mice presented a significant reduction of
amphetamine-induced hyperlocomotor activity [39], compared with wild-type animals. Also,
activation of mGlu7 receptors by AMN802 decreased activity in rodents [21, 22] whereas no
effect on locomotor activity was reported following LSP1-2111, a mGlu4 receptor orthostetic
agonist, used at a lower dose [17]. In addition, anxiety may play a role in the effect of LSP2-
9166 on cocaine-induced behavior, as it is known that a higher level of anxiety may decrease
the motivation for cocaine in a PR paradigm [40]. Both anxiogenic and anxiolytic effects of
LSP2-9166 have been described, at a high dose in mice [26], and following chronic LSP2-9166
treatment in rats [35], respectively. Altogether, such effect may depend on the dose and the
species under study and we can not exclude any impact in our paradigm.
We show here that voluntary cocaine intake increased both Grm4 and Grm7 in NAc and
HPC, whereas a decrease was observed for Grm4 in the Amy. These regulations may play a
direct role on motivation (NAc) counterbalanced by an increase in anxiety (Amy). Such
adaptations may participate to a global homeostatic regulation following cocaine intake, that
involves complex neuronal circuitry.These regulations are region-specific as no modification
were detected in the PFC or DS. Also, they were observed following 10 d of cocaine intake, 24
h after the last drug exposure, suggesting that they do not result from short term effects of
cocaine. It would be of crucial interest to evaluate whether these regulations are long-lasting,
reversible and whether they occur at distinct stages of addiction (withdrawal, seeking events),
to highlight changes that could specifically mediate active drug seeking. No data are yet
available on the regulation of these receptors by other drugs of abuse, at the protein level.
8

In our conditions, the breaking point under a PR schedule was reduced, indicating that
the LSP2-9166 compound was able to reduce the motivational properties of cocaine. Our results
are in accordance with previous publications showing that AMN082 reduces cocaine intake
under a PR schedule of reinforcement [19]. Nevertheless, the neurobiological mechanisms
involved in these effects are still not clear. The LSP2-9166 reduced cocaine reward-related
effects probably through attenuation, via group III mGlu receptors activation, of the
hyperglutamatergic state. Indeed, LSP2-9166 was demonstrated to be highly potent at mGlu4
(EC50 = 0.06 µM) and mGlu7 (EC50 = 2.2 µM) [25] receptors. By increasing the activity of
mGlu4/7 located in presynaptic terminals of glutamatergic afferents coming from the PFC,
Amy and/or HPC, LSP2-9166 may lower glutamate release. Consequently, this would decrease
the strength of goal-directed behavior to obtain the drug. Another hypothesis would be that the
effects of LSP2-9166 are mediated by a reduction of GABA release on NAc neuronal targets,
such as ventral pallidum and/or pars reticulata of the substantia nigra. Indeed, activation of
group III mGlu receptors is able to weaken GABA neurotransmission, for instance in globus
pallidum [14]. Future electrophysiological or neurochemical studies will investigate these
effects on cocaine-induced glutamate and/or GABA neurotransmission.
The LSP2-9166 ligand also blocked morphine CPP expression and reinstatement after
extinction [26]. Noticeably, it was more efficient in Hajasova et al.’s study since effects were
already observed at lower doses (0.5 mg/kg, ip). The explanations for such discrepancies are
still unclear and may be related to differences in species, behavioral paradigms, and/or the
nature of the drug studied. Another explanation could be that mGlu receptors form heterodimers
that may strongly modify the ligand affinity, as very recently described for mGlu2/7 receptors
[28], or their constitutive activity, for mGlu4/7 [28, 41]. Such molecular interactions could
occur between mGlu4/7 in specific reward-related brain structures, in a distinct manner
depending on the drugs of abuse, and thus participate to the different effective doses observed
between the studies.
Credit Author Statement
Author’s contribution
PR, JZ, KB conceived the study and wrote the paper. PR, DN, CQ, DF performed the
experiments. PR, DN, RB, KB analyzed the data and designed the figures. FA and IMT designed
and synthesized the mGlu compound. All authors approved the final version of the manuscript.
The authors declare no conflict of interest.
9

Author’s contribution
PR, JZ, KB conceived the study and wrote the paper. PR, DN, CQ, DF performed the
experiments. PR, DN, RB, KB analyzed the data and designed the figures. FA and IMT
designed and synthesized the mGlu compound. All authors approved the final version of the
manuscript.
Aknowledgments
This project was supported by the Université de Strasbourg, the Centre National de la
Recherche Scientifique (CNRS) and by the « Innovation thérapeutique pour les maladies
mentales » (ITMM CNRS). DN and CC received a PhD fellowship from the French Ministère
de l’Enseignement Supérieur et de la Recherche”. DN received a 4th year PhD funding from
Fonds Paul Mandel. We thank C Correia, Dr MC Olmstead and Dr F Noble for fruitful
discussions and careful reading of the manuscript, Dr A Barbelivien for statistical advices. The
authors declare no conflict of interest.
References
[1]
[2]
[3]
P.W. Kalivas, N.D. Volkow, The neural basis of addiction: a pathology of motivation
and choice, Am J Psychiatry 162 (2005) 1403-1413.
E.L. Gardner, What we have learned about addiction from animal models of drug self-
administration, Am J Addict 9 (2000) 285-313.
M.D. Scofield, J.A. Heinsbroek, C.D. Gipson, Y.M. Kupchik, S. Spencer, A.C. Smith,
et al., The Nucleus Accumbens: Mechanisms of Addiction across Drug Classes Reflect
the Importance of Glutamate Homeostasis, Pharmacol Rev 68 (2016) 816-871.
L.A. Knackstedt, P.W. Kalivas, Glutamate and reinstatement, Current Opinion in
Pharmacology 9 (2009) 59-64.
Y. Mihov, G. Hasler, Negative Allosteric Modulators of Metabotropic Glutamate
Receptors Subtype 5 in Addiction: a Therapeutic Window., The international journal of
neuropsychopharmacology 19 (2016) pyw002.
[4]
[5]
[6]
[7]
J.T. Gass, M.F. Olive, Glutamatergic substrates of drug addiction and alcoholism,
Biochem Pharmacol 75 (2008) 218-265.
J. Peters, P.W. Kalivas, The group II metabotropic glutamate receptor agonist,
LY379268, inhibits both cocaine- and food-seeking behavior in rats.,
Psychopharmacology 186 (2006) 143-149.
[8]
[9]
J.M. Aultman, B. Moghaddam, Distinct contributions of glutamate and dopamine
receptors to temporal aspects of rodent working memory using a clinically relevant
task., Psychopharmacology 153 (2001) 353-364.
G.A. Higgins, T.M. Ballard, J.N.C. Kew, J.G. Richards, J.A. Kemp, G. Adam, et al.,
Pharmacological manipulation of mGlu2 receptors influences cognitive performance in
the rodent., Neuropharmacology 46 (2004) 907-917.
10

[10] R. Crupi, D. Impellizzeri, S. Cuzzocrea, Role of Metabotropic Glutamate Receptors in
Neurological Disorders., Frontiers in molecular neuroscience 12 (2019) 20.
[11] F. Nicoletti, R. Orlando, L. Di Menna, M. Cannella, S. Notartomaso, G. Mascio, et al.,
Targeting mGlu Receptors for Optimization of Antipsychotic Activity and Disease-
Modifying Effect in Schizophrenia., Frontiers in psychiatry 10 (2019) 49.
[12] C. Corti, L. Aldegheri, P. Somogyi, F. Ferraguti, Distribution and synaptic localisation
of the metabotropic glutamate receptor 4 (mGluR4) in the rodent CNS., Neuroscience
110 (2002) 403-420.
[13] C.M. Kosinski, S. Risso Bradley, P.J. Conn, A.I. Levey, G.B. Landwehrmeyer, J.B.
Penney, et al., Localization of metabotropic glutamate receptor 7 mRNA and mGluR7a
protein in the rat basal ganglia., The Journal of comparative neurology 415 (1999) 266-
284.
[14] N. Macinnes, S. Duty, Group III metabotropic glutamate receptors act as hetero-
receptors modulating evoked GABA release in the globus pallidus in vivo., European
journal of pharmacology 580 (2008) 95-99.
[15] O. Valenti, M.J. Marino, M. Wittmann, E. Lis, A.G. DiLella, G.G. Kinney, et al., Group
III metabotropic glutamate receptor-mediated modulation of the striatopallidal synapse.,
The Journal of neuroscience : the official journal of the Society for Neuroscience 23
(2003) 7218-7226.
[16] L. Mao, J.Q. Wang, Distinct inhibition of acute cocaine-stimulated motor activity
following microinjection of a group III metabotropic glutamate receptor agonist into the
dorsal striatum of rats, Pharmacol Biochem Behav 67 (2000) 93-101.
[17] M. Zaniewska, E. Przegaliński, M. Filip, A. Pilc, D. Doller, Inhibitory actions of mGlu4
receptor ligands on cocaine-, but not nicotine-, induced sensitizing and conditioning
locomotor responses in rats., Pharmacological reports : PR 66 (2014) 205-211.
[18] K. Mitsukawa, R. Yamamoto, S. Ofner, J. Nozulak, O. Pescott, S. Lukic, et al., From
The Cover: A selective metabotropic glutamate receptor 7 agonist: Activation of
receptor signaling via an allosteric site modulates stress parameters in vivo, Proceedings
of the National Academy of Sciences 102 (2005) 18712-18717.
[19] X. Li, J. Li, X.-Q. Peng, K. Spiller, E.L. Gardner, Z.-X. Xi, Metabotropic Glutamate
Receptor 7 Modulates the Rewarding Effects of Cocaine in Rats: Involvement of a
Ventral Pallidal GABAergic Mechanism, Neuropsychopharmacology 34 (2009) 1783-
1796.
[20] A. Bahi, The selective metabotropic glutamate receptor 7 allosteric agonist AMN082
prevents reinstatement of extinguished ethanol-induced conditioned place preference in
mice, Pharmacology Biochemistry and Behavior 101 (2012) 193-200.
[21] M.C. Salling, S. Faccidomo, C.W. Hodge, Nonselective suppression of operant ethanol
and sucrose self-administration by the mGluR7 positive allosteric modulator AMN082,
Pharmacol Biochem Behav 91 (2008) 14-20.
[22] A. Palucha, K. Klak, P. Branski, H. van der Putten, P.J. Flor, A. Pilc, Activation of the
mGlu7 receptor elicits antidepressant-like effects in mice, Psychopharmacology 194
(2007) 555-562.
[23] R.M. O'Connor, J.F. Cryan, The effects of mGlu₇ receptor modulation in behavioural
models sensitive to antidepressant action in two mouse strains., Behavioural
pharmacology 24 (2013) 105-113.
[24] K.A. Pelkey, X. Yuan, G. Lavezzari, K.W. Roche, C.J. McBain, mGluR7 undergoes
rapid internalization in response to activation by the allosteric agonist AMN082.,
Neuropharmacology 52 (2007) 108-117.
11

[25] F. Acher, J.-P. Pin, C. Goudet, A. Eschalier, J. Busserolles, D. Rigault, et al.,
Hypophosphorous acid derivatives having antihyperalgic activity and biological
applications thereof, (2012).
[26] Z. Hajasova, C. Canestrelli, F. Acher, F. Noble, N. Marie, Role of mGlu7 receptor in
morphine rewarding effects is uncovered by a novel orthosteric agonist,
Neuropharmacology 131 (2018) 424-430.
[27] S. Lebourgeois, C. Vilpoux, J. Jeanblanc, F. Acher, N. Marie, F. Noble, et al.,
Pharmacological activation of mGlu4 and mGlu7 receptors, by LSP2-9166, reduces
ethanol consumption and relapse in rat, Neuropharmacology 133 (2018) 163-170.
[28] C.H. Habrian, J. Levitz, V. Vyklicky, Z. Fu, A. Hoagland, I. McCort-Tranchepain, et
al., Conformational pathway provides unique sensitivity to a synaptic mGluR, Nat
Commun 10 (2019) 5572.
[29] C. Selvam, I.A. Lemasson, I. Brabet, N. Oueslati, B. Karaman, A. Cabaye, et al.,
Increased Potency and Selectivity for Group III Metabotropic Glutamate Receptor
Agonists Binding at Dual sites, J Med Chem 61 (2018) 1969-1989.
[30] D.B. Kastrinsky, P. Kumar, G.A. Marriner, C.E. Barry III, A convergent synthesis of
chiral diaminopimelic acid derived substrates for mycobacterial L,D-transpeptidases,
Synthesis 44 (2012) 3043-3048.
[31] A.H.G. Siebum, W.S. Woo, J. Raap, J. Lugtenburg, Access to any site-directed
isotopomer of methionine, selenomethionine, cysteine, and selenocysteine − Use of
simple, efficient modular synthetic reaction schemes for isotope Incorporation, Eur. J.
Org. Chem. (2004) 2905-2913.
[32] P. Romieu, L. Host, S. Gobaille, G. Sandner, D. Aunis, J. Zwiller, Histone deacetylase
inhibitors decrease cocaine but not sucrose self-administration in rats, J Neurosci 28
(2008) 9342-9348.
[33] G. Paxinos, C. Watson, The rat brain in stereotaxic coordinates, (2007).
[34] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (2001) 402-408.
[35] B. Girard, P. Tuduri, M.P. Moreno, S. Sakkaki, C. Barboux, T. Bouschet, et al., The
mGlu7 receptor provides protective effects against epileptogenesis and epileptic
seizures, Neurobiol Dis 129 (2019) 13-28.
[36] J. Cartmell, D.D. Schoepp, Regulation of Neurotransmitter Release by Metabotropic
Glutamate Receptors, Journal of Neurochemistry 75 (2002) 889-907.
[37] M.S. D'Souza, Glutamatergic transmission in drug reward: implications for drug
addiction, Frontiers in Neuroscience 9 (2015) 404.
[38] Y.A. Blednov, D. Walker, E. Osterndorf-Kahanek, R.A. Harris, Mice lacking
metabotropic glutamate receptor 4 do not show the motor stimulatory effect of ethanol,
Alcohol 34 (2004) 251-259.
[39] N.M. Fisher, R.W. Gould, R.G. Gogliotti, A.J. McDonald, H. Badivuku, S.
Chennareddy, et al., Phenotypic profiling of mGlu7 knockout mice reveals new
implications for neurodevelopmental disorders, Genes Brain Behav (2020).
[40] D.E. Bush, F.J. Vaccarino, Individual differences in elevated plus-maze exploration
predicted progressive-ratio cocaine self-administration break points in Wistar rats,
Psychopharmacology (Berl) 194 (2007) 211-219.
[41] P.J. Kammermeier, Constitutive activity of metabotropic glutamate receptor 7, BMC
Neurosci 16 (2015) 17.
12

Figure 1. Optimization of LSP2-9166 synthesis. Reagents and conditions: (i) NH4H2PO2 (2.5
eq), Et3B (1 eq), O2, MeOH, RT, 30 min, 2 times; (ii) tert-butyl 2-(4-formyl-2-
13

(trifluoromethoxy)phenoxy) acetate (1 eq), N,O-bis(trimethylsilyl) acetamide (BSA) (4 eq),
degassed CH2Cl2, RT, 24 h; (iii) a) 3 M aqueous HCl, THF, RT, 48 h; b) C-18 flash
chromatography. Bu: butyl; Boc; tert-butoxycarbonyl; BSA: N,O-bis(trimethylsilyl)acetamide;
eq: equivalent; RT: room temperature.
Figure 2. Cocaine effect on mGlu group III receptor gene expression. Transcript levels for
Grm4 and Grm7 genes were examined by qPCR in PFC (A, 7-8/group), NAc (B, 7-9/group),
DS (C, 6-8/group), HPC (D, 5-10/group) and Amy (E, 6-8/group) following cocaine SA. Bars
represent mean ± SEM fold change vs saline group for each receptor. **p < 0.01; ***p < 0.001.
Samples were dissected with large (3 mm) or small (1.9 mm) punchers as indicated.
14

Figure 3. Effect of LSP2-9166 on cocaine-self administration and locomotor activity.
Effect of LSP2-9166 (2 and 5 mg/kg i.v., 15 min before the operant session) on cocaine SA in
a progressive ratio (PR) schedule of reinforcement. Number of injections (A) and number of
nose-pokes (B) are presented across all sessions. Results are expressed as mean ± SEM for each
group (vehicle, n=18; LSP2-9166, 2mg/kg, n=8; LSP2-9166, 5mg/kg, n=15). **p < 0.01,
baseline (S5/S6) vs treatment (S10/S11) of LSP2-9166 5mg/kg. Locomotor activity (C) was
recorded following habituation (1h), i.v. injection of LSP2-9166 (5 mg/kg, iv) or vehicle (bin
60-75), and then cocaine (1.5 mg/kg) or NaCl 0.9% (bin 75-135); (vehicle/NaCl n=8;
vehicle/cocaine n=10; LSP2-9166/cocaine n=9). ***p<0.001 vehicle/cocaine vs LSP/cocaine
at bin 80.
15