Mutations in the Pseudomonas aeruginosa needle protein gene pscF confer resistance to phenoxyacetamide inhibitors of the type III secretion system

Article abstract of DOI:10.1128/AAC.02795-13

The type III secretion system (T3SS) is a clinically important virulence mechanism in Pseudomonas aeruginosa that secretes and translocates effector toxins into host cells, impeding the host's rapid innate immune response to infection. Inhibitors of T3SS may be useful as prophylactic or adjunctive therapeutic agents to augment the activity of antibiotics in P. aeruginosa infections, such as pneumonia and bacteremia. One such inhibitor, the phenoxyacetamide MBX 1641, exhibits very responsive structure-activity relationships, including striking stereoselectivity, in its inhibition of P. aeruginosa T3SS. These features suggest interaction with a specific, but unknown, protein target. Here, we identify the apparent molecular target by isolating inhibitor-resistant mutants and mapping the mutation sites by deep sequencing. Selection and sequencing of four independent mutants resistant to the phenoxyacetamide inhibitor MBX 2359 identified the T3SS gene pscF, encoding the needle apparatus, as the only locus of mutations common to all four strains. Transfer of the wild-type and mutated alleles of pscF, together with its chaperone and cochaperone genes pscE and pscG, to a ΔpscF P. aeruginosa strain demonstrated that each of the single-codon mutations in pscF is necessary and sufficient to provide secretion and translocation that is resistant to a variety of phenoxyacetamide inhibitor analogs but not to T3SS inhibitors with different chemical scaffolds. These results implicate the PscF needle protein as an apparent new molecular target for T3SS inhibitor discovery and suggest that three other chemically distinct T3SS inhibitors interact with one or more different targets or a different region of PscF. Copyright

Full text of DOI:10.1128/AAC.02795-13

Mutations in the Pseudomonas aeruginosa
Needle Protein Gene pscF Confer
Resistance to Phenoxyacetamide Inhibitors
of the Type III Secretion System
Nicholas O. Bowlin, John D. Williams, Claire A. Knoten,
Matthew C. Torhan, Tommy F. Tashjian, Bing Li, Daniel
Aiello, Joan Mecsas, Alan R. Hauser, Norton P. Peet, Terry
L. Bowlin and Donald T. Moir
Antimicrob. Agents Chemother. 2014, 58(4):2211. DOI:
10.1128/AAC.02795-13.
Published Ahead of Print 27 January 2014.
Updated information and services can be found at:
http://aac.asm.org/content/58/4/2211
These include:
REFERENCES
This article cites 45 articles, 23 of which can be accessed free
at: http://aac.asm.org/content/58/4/2211#ref-list-1
CONTENT ALERTS
Receive: RSS Feeds, eTOCs, free email alerts (when new
articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml
To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

Mutations in the Pseudomonas aeruginosa Needle Protein Gene pscF
Confer Resistance to Phenoxyacetamide Inhibitors of the Type III
Secretion System
Nicholas O. Bowlin,a John D. Williams,a Claire A. Knoten,b Matthew C. Torhan,a Tommy F. Tashjian,a Bing Li,a Daniel Aiello,a
Joan Mecsas,c Alan R. Hauser,b Norton P. Peet,a Terry L. Bowlin,a Donald T. Moira
Microbiotix, Inc., Worcester, Massachusetts, USAa; Departments of Microbiology/Immunology and Medicine, Northwestern University, Chicago, Illinois, USAb; Department
of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts, USAc
The type III secretion system (T3SS) is a clinically important virulence mechanism in Pseudomonas aeruginosa that secretes and
translocates effector toxins into host cells, impeding the host’s rapid innate immune response to infection. Inhibitors of T3SS
may be useful as prophylactic or adjunctive therapeutic agents to augment the activity of antibiotics in P. aeruginosa infections,
such as pneumonia and bacteremia. One such inhibitor, the phenoxyacetamide MBX 1641, exhibits very responsive structure-
activity relationships, including striking stereoselectivity, in its inhibition of P. aeruginosa T3SS. These features suggest interac-
tion with a specific, but unknown, protein target. Here, we identify the apparent molecular target by isolating inhibitor-resistant
mutants and mapping the mutation sites by deep sequencing. Selection and sequencing of four independent mutants resistant to
the phenoxyacetamide inhibitor MBX 2359 identified the T3SS gene pscF, encoding the needle apparatus, as the only locus of
mutations common to all four strains. Transfer of the wild-type and mutated alleles of pscF, together with its chaperone and co-
chaperone genes pscE and pscG, to a ⌬pscF P. aeruginosa strain demonstrated that each of the single-codon mutations in pscF is
necessary and sufficient to provide secretion and translocation that is resistant to a variety of phenoxyacetamide inhibitor ana-
logs but not to T3SS inhibitors with different chemical scaffolds. These results implicate the PscF needle protein as an apparent
new molecular target for T3SS inhibitor discovery and suggest that three other chemically distinct T3SS inhibitors interact with
one or more different targets or a different region of PscF.
ype III secretion systems (T3SSs) are complex nanomachines MATERIALS AND METHODS
T
made by many Gram-negative bacterial species for the pur-
Strains, plasmids, and growth media. Bacterial strains and plasmids used
for assays are described in Table 1. All P. aeruginosa strains were deriva-
tives of PAO1 (22) or PAK (23). Escherichia coli TOP10 (Invitrogen), E.
coli DB3.1 (Gateway host; Invitrogen), E. coli SM10 (24), and E. coli S17-1
(ATCC 47055) were used as hosts for molecular cloning. Vogel-Bonner
minimal medium (VBMM) was made as described previously (24). Luria-
Bertani (LB) medium (liquid and agar) was purchased from Difco. LB was
supplemented with gentamicin (LBG) at the indicated levels with 0.1 mM
isopropyl-␤-D-thiogalactopyranoside (IPTG) and 3 mM EGTA, as noted
in each experiment.
PCR and primers. Synthetic oligonucleotide primers (from Operon,
Inc.) were designed using the published genome sequence for P. aerugi-
nosa (25) and web-based PRIMER3 (Whitehead Institute) (Table 2).
Primers were used at 10 ␮M in PCR amplifications with PhusionGC poly-
merase (New England BioLabs) for P. aeruginosa chromosomal DNA
templates.
pose of injecting effector proteins into eukaryotic cells (1, 2). The
T3SS of the opportunistic pathogen Pseudomonas aeruginosa,
which consists of nearly 40 gene products, translocates effector
toxins into host macrophages and neutrophils, reducing the host’s
ability to respond to infection (3, 4). The T3SS is not essential for
P. aeruginosa viability in vitro but is crucial for the establishment
and dissemination of P. aeruginosa infections. This is evident by
the severely depleted bacterial burdens of T3SS mutant strains in
animal models of acute pneumonia (5, 6) and by the poorer clin-
ical outcomes associated with T3SS-competent P. aeruginosa
strains in patients with ventilator-associated pneumonia (VAP)
and bacteremia (7–11). These results validate the P. aeruginosa
T3SS as an important target for therapeutic and/or prophylactic
intervention. Indeed, several inhibitors of P. aeruginosa T3SS have
been described, both small molecules (12–16) and monoclonal
antibodies (17, 18). The most advanced of these agents, KB001, is
an anti-PcrV monoclonal antibody currently in clinical studies
(19, 20). PcrV is a needle-tip protein that mediates the folding and
insertion of PopB/PopD into host membranes as part of the trans-
location channel, and to date, it has been the only defined struc-
tural protein target of a T3SS inhibitor (21). We now describe
experiments to identify the molecular target of a series of phe-
noxyacetamide small-molecule inhibitors previously shown to ex-
hibit very responsive structure-activity relationships (SAR), in-
cluding an extremely high degree of stereoselectivity, in blocking
the P. aeruginosa T3SS (15). Results implicate the needle protein
PscF as a new T3SS target that is vulnerable to chemical interven-
tion.
Construction of a mutant selection strain. A P. aeruginosa strain was
engineered to enable selection for mutants that are resistant to T3SS in-
hibitors. First, a transcriptional fusion of the gentamicin resistance (Gmr)
gene aacC1 to the T3SS effector gene exoT promoter was integrated
into the PAO1 efflux-deficient derivative PA0397 (26). Specifically, the
pGSV3-exoT-luxCDABE plasmid in strain MDM850 (Table 1) (15) was
Received 26 December 2013 Returned for modification 17 January 2014
Accepted 23 January 2014
Published ahead of print 27 January 2014
Address correspondence to Donald T. Moir, dmoir@microbiotix.com.
Copyright © 2014, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AAC.02795-13
April 2014 Volume 58 Number 4
Antimicrobial Agents and Chemotherapy p. 2211–2220
aac.asm.org 2211

Bowlin et al.
TABLE 1 Strains and plasmids
Strain
Description
Reference or source
E. coli
MDM468
MDM850
MDM1385
MDM1696
TOP10/pUCP24GW-lacIQPO
32
15
SM10/pGSV3-exoT-luxCDABE Spr
SM10/pGSV3-exoT-aacC1 Spr
This study
This study
S17.1/miniCTXexoS(E379A/E381A)-blaM
P. aeruginosa
MDM973
PA0397
PAK/pUCP24GW-lacIQPO-exoT-luxCDABE
PAO1 ⌬(mexAB-oprM) nfxB ⌬(mexCD-oprJ) ⌬(mexEF-oprN) ⌬(mexJKL)
⌬(mexXY) ⌬opmH362
PAO397::pGSV3-Spr-exoT’-aacC1
15
26
MDM1542
MDM1710
MDM1739
MDM1749
MDM1750
MDM1770
MDM1838
MDM1912
MDM1886
MDM1967
MDM1938
MDM1940
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
MDM1542::miniCTXexoS(E379A/E381A)-blaM
MDM1710 MBX-2359r [pscF(G223T; R75C)]
MDM1710 MBX-2359r [pscF(G224A; R75H)]
MDM1710 MBX-2359r [pscF(G184A; V62I)]
MDM1710 MBX-2359r [pscF(G239A, G80D)]
PAO1 ⌬pscF::miniCTX-exoS(E379A/E381A)-blaM
MDM1838/pUCP24GWGm-lacIQPO-pscE-pscF(WT)-pscG
MDM1838/pUCP24GWGm-lacIQPO-pscE-pscF(R75H)-pscG
MDM1838/pUCP24GWGm-lacIQPO-pscE-pscF(V62I)-pscG
MDM1838/pUCP24GWGm-lacIQPO-pscE-pscF(R75C)-pscG
MDM1838/pUCP24GWGm-lacIQPO-pscE-pscF(G80D)-pscG
modified by replacing its gentamicin resistance marker with a spectino- was removed from exoS using the primers exoSdeltastopF and exoSdel-
mycin resistance marker as described previously (27) and by replacing the
luxCDABE fragment with aacC1. This was accomplished by digestion with
NotI restriction endonuclease to release luxCDABE followed by ligation of
a NotI-ended aacC1 fragment amplified from pUCP24 DNA by PCR us-
ing primers aacC1ϩNot-F and aacC1ϩNot-R (Table 2). The resulting
plasmid, pGSV3-Spr-exoT-aacC1, was introduced into PA0397 by conju-
gation, and single-crossover integrants at exoT were confirmed by PCR
with primers exoT-out-F and aacC1ϩNot-R (Table 2). The resulting
strain MDM1542 (Table 1) exhibits Gmr that is dependent on induction
of T3SS and lost in the presence of T3SS inhibitors. A single copy of a gene
encoding full-length ExoS (lacking adenosine diphosphate ribosyltrans-
ferase [ADPRT] activity due to two mutations, E379A/E381A) fused to
TEM1 ␤-lactamase (BLA) on miniCTX1 (28) was constructed essentially
as described previously for miniCTXexoU-BLA (29). First, the stop codon
tastopR (Table 2). A fragment of TEM-1 ␤-lactamase (bla) was amplified
from pBR322 with 3= AgeI and 5= AgeI sites using primers blaCAgeUp and
blaCAgeDwn. These fragments were cloned into miniCTX to generate
miniCTXexoS-BLA. Site-directed mutagenesis was then performed using
the following primers to generate the ADPRT mutations: E379A/E381A-
forward and E379A/E381A-reverse. The resulting miniCTXexoS-BLA
was integrated into the chromosome of MDM1542 to yield selection
strain MDM1710 (Table 1).
Selection for phenoxyacetamide-resistant mutants. Selection strain
MDM1710 was subjected to mutagenesis with ethyl methanesulfonate
essentially as previously described (30) to a 1% auxotrophy rate, as deter-
mined by replica plating on rich (LB) and minimal (VBMM) media. In-
hibitor-resistant mutants of MDM1710 were selected from a total of
about 6 ϫ 106 mutagenized cells for growth on agar medium in the pres-
ence of 1 mM EGTA (to induce T3SS), 16 ␮g/ml Gm, and 25 ␮M T3SS
inhibitor MBX 2359. Gentamicin-resistant colonies were transferred to
nonselective medium, grown, and replica plated onto three VBMM plates
with the following supplements: 16 ␮g/ml Gm (plate a); 1 mM EGTA, 16
␮g/ml Gm (plate b); and 1 mM EGTA, 16 ␮g/ml Gm, 25 ␮M MBX 2359
(plate c). Mutants that were confirmed to exhibit gentamicin resistance,
which was dependent on the addition of EGTA (i.e., growth on plate b but
not on plate a) but independent of the addition of MBX 2359 (i.e., growth
on both plates b and c), were evaluated for T3SS-mediated secretion of the
ExoS-BLA fusion protein in the presence of MBX 2359 by colorimetric
assay (below). Mutant strains exhibiting significantly increased 50% in-
hibitory concentrations (IC50s) for MBX 2359 inhibition were character-
ized further.
TABLE 2 Primers
No.
Name
Sequencea
1
2
3
aacC1ϩNot-F
aacC1ϩNot-R
exoT-out-F
ataagaatgcggccgcccgcaaaatggatgttacgcagcagcaacga
acggtcagcggccgccgaattgttaggtggcggta
tagggaaagtccgctgtttt
4
5
6
exoSdeltastopF
exoSdeltastopR
blaCAgeUp
ggccttgatctggccggaccggtcgtaaa
cgtctttcttttacgaccggtccggccagat
aaaaccggtacacccagaaacgct
7
blaCAgeDwn
aaaaccggtattaccaatgcttaatcagtga
8
9
E379A/E381A-forward
E379A/E381A-reverse
pscF-Up-FϩGWL
pscF-Up-R
pscF-Dwn-F
pscF-Dwn-RϩGWR
pscF-Out-F
cgaactacaagaatgcaaaagcgatttctctataacaaag
ttgttatagagaatcgcttttgcattcttgtagttcgat
TACAAAAAAGCAGGCTgctcgtcgaaccctggtc
atcttctgcaggatgccttgcgcCATgcttagtcctctgt
acagaggactaagcATGgcgcaaggcatcctgcagaagat
TACAAGAAAGCTGGGTacagctccatctgcaactcc
gagttttcccgagcgtttc
tgggtcttcatcagggtttc
ggggacaagtttgtacaaaaaagcaggct
ggggaccactttgtacaagaaagctgggt
ggggacaagtttgtacaaaaaagcaggctgaggtgctccATGatgacag
ggggaccactttgtacaagaaagctgggtgacggatagacggcgaatc
10
11
12
13
14
15
16
17
18
19
Mapping mutations to resistance by sequencing. Genomic DNA was
prepared from three inhibitor-resistant mutants as well as from the wild-
type parent MDM1710 (TIP20 kit; Qiagen) and analyzed by Illumina
next-generation sequencing for single-nucleotide polymorphisms (SNPs)
between the parent and each mutant (SeqWright, Inc.).
Construction of a pscF deletion strain. Strain MDM1838 (Table 1),
an in-frame, markerless deletion of the pscF gene leaving 2 amino-termi-
nal and 7 carboxy-terminal codons, was generated from P. aeruginosa
strain PAO1 containing an integrated miniCTX-exoS(E379A/E381A)-
blaM construct by standard Gateway and PCR splicing by overlap exten-
pscF-Out-R
GW-Universal-attB1
GW-Universal-attB2
pscEFG-FϩattB1
pscEFG-RϩattB2
a Partial attB1 and attB2 tails are in uppercase letters, as are the pscF start and stop
codons.
2212 aac.asm.org
Antimicrobial Agents and Chemotherapy

T3SS Inhibitor Escape Mutations in pscF
sion technology and confirmed by sequencing as described previously
(31). Primers 10 to 17 were used (Table 2; partial attB1 and attB2 tails are
in uppercase letters, as are the pscF start and stop codons).
Complementation of pscF deletion strains. The three-gene cluster
pscE-pscF-pscG was amplified by PCR from wild-type and mutant strains
using primers pscEFG-FϩattB1 and pscEFG-RϩattB2 (Table 2), cloned
into pDONR221 by Gateway cloning, sequenced to confirm that the ap-
propriate pscF mutations were present, and moved into the pUPC24GW-
lacIQPO recipient vector (Table 1) for expression from the lac promoter
(32). Resulting pUPC24GW-lacIQPO plasmids carrying pscF mutant al-
leles were transferred by electroporation (33) to ⌬pscF P. aeruginosa cells
to confirm their role in inhibitor resistance. Cells were grown in the pres-
ence of 0.1 mM isopropyl-␤-D-thiogalactopyranoside (IPTG) for expres-
sion of pscF alleles.
Colorimetric detection of T3SS-mediated secretion of ExoS-BLA.
Secretion of ExoS-BLA fusion protein into culture medium was detected
by measuring the hydrolysis of the chromogenic ␤-lactamase substrate
nitrocefin (Acme Bioscience, Inc., Palo Alto, CA) by A490 in clear 96-well
microplates as described previously (15).
FIG 1 Structures of small-molecule inhibitors of P. aeruginosa T3SS used in
this study. (A) Five analogs of the phenoxyacetamide series, including MBX
2359, which was used for selection of resistant mutants. (B) Representatives of
three published nonphenoxyacetamide scaffolds.
ChemBridge Corp. (San Diego, CA), and a third one, INP0007, was syn-
thesized as previously described (35).
Homology model of polymerized PscF. A homology model of PscF
assembled in a needle was generated using a comparative modeling ap-
ImmunoblottingdetectionofT3SS-mediatedeffectorsecretioninto
culture broth. Overnight cultures of MDM1710 were grown in LB me-
dium (5 ml in a 14-ml tube) at 37°C at Ն250 rpm. Overnight cultures (50
␮l, 1:100 dilution) were used to inoculate 5 ml of LB plus 5 mM EGTA. proach, which was implemented with the Schrödinger computational
software (Schrödinger, LLC). The structure of the Salmonella enterica se-
rovar Typhimurium T3SS needle composed of assembled PrgI subunits,
generated by cryoelectron microscopy and solid-state nuclear magnetic
resonance (NMR) (36), was used as the template (PDB entry 2LPZ). A
total of 29 PscF subunits were constructed in the homology model.
MBX 2359 was added at the concentrations indicated. Cultures were
grown for 4 h at 37°C at Ն250 rpm. Supernatant from each culture, nor-
malized to cell number, was precipitated with trichloroacetic acid and
resuspended in 40 ␮l of 1ϫ sample buffer, and 30 ␮l from each sample was
applied to an SDS-PAGE gel. The samples were electrophoresed at 150 V
for an hour using Tris-glycine gels in 1ϫ Tris-glycine-SDS buffer. The
proteins were then transferred to a nitrocellulose membrane (Bio-Rad) by
wet transfer using 1ϫ transfer buffer (1ϫ Tris-glycine, 10% methanol) at
100 V for 1 h. Blots were incubated with primary antibody against ExoS
(34), followed by a proprietary goat anti-rabbit secondary antibody (Li-
Cor). Blots were imaged using the LiCor imager, channel 700, for 2 min.
All edits were done to entire images. A LiCor 928-40000 protein ladder
was used to estimate protein molecular weights.
T3SS-mediated translocation assays. The translocation of ExoS-BLA
was assayed as follows. J774 cells seeded in 96-well black tissue culture-
treated plates (Costar, Corning Inc.) were infected at a multiplicity of
infection (MOI) of 10, centrifuged at 1,000 rpm for 5 min, and then
incubated at 37°C for 90 min. The cells were loaded with a final concen-
tration of 1.2 ␮M hydroxycoumarin cephalosporin fluorescein-ace-
toxymethyl ester (CCF2-AM) (Invitrogen) and incubated for 1 h at room
temperature. The plates were analyzed in a bottom-read SynergyH1
(BioTek) fluorescence plate reader. Excitation was set at 410 nm; emis-
sions at 460 nm and 530 nm were recorded. The blue/green fluorescence
ratio was calculated by the formula (RFU460 nm Ϫ RFU460 nm, background)/
(RFU530 nm Ϫ RFU530 nm, background), where RFU is relative fluorescence
units and background fluorescence is fluorescence emission from cells
that were infected but not loaded with CCF2-AM.
Chemistry. Phenoxyacetamide MBX 1641 was prepared as described
previously (15). The phenoxyacetamide analogs MBX 2614 and MBX
2727 were prepared in a similar manner from the commercially available
acid 2-(2,4-dichlorophenoxy)propanoic acid and the corresponding
amine or hydrazine using the peptide coupling reagent HATU. MBX 2164
was synthesized by HATU-promoted peptide coupling of 2-(2,4-dichlo-
rophenylthio)propanoic acid. 2-(3,5-Dichloropyridy-2-oxy)propanoic
acid was synthesized via a Mitsunobu reaction of 3,5-dichloro-2-pyridone
and ethyl lactate followed by saponification and coupled to 5-aminom-
ethylbenzothiophene to provide MBX 2359. The (R)- and (S)-stereoiso-
mers of MBX 2359, denoted as MBX 2401 and MBX 2402, respectively,
were separated from the racemate MBX 2359 by using chiral high-perfor-
mance liquid chromatography (HPLC). Two nonphenoxyacetamide
RESULTS
A more potent phenoxyacetamide analog for resistance selec-
tion. The previously reported selectivity of T3SS inhibition and
responsive SAR, including pronounced stereoselectivity of inhibi-
tion, suggested that the phenoxyacetamide inhibitors specifically
target one or more components of the T3SS (15). To test this
hypothesis, we undertook an identification of the phenoxyacet-
amide target by isolating and characterizing suppressor mutants.
First, we developed a more potent optimized analog of the original
phenoxyacetamide T3SS inhibitor to facilitate resistance selec-
tion. Based on the SAR gleaned from about 300 analogs (15) (J. D.
Williams, unpublished data), the pyridyloxy-acetamide com-
pound MBX 2359 (Fig. 1) was synthesized. This analog is approx-
imately 8-fold more potent than the original screening hit MBX
1641 (IC50, ϳ15 ␮M) for inhibition of T3SS-mediated secretion
and retains the pronounced stereoselectivity (Fig. 2). Specifically,
the (R)-isomer MBX 2401 (IC50, ϳ1.2 ␮M) is about twice as po-
tent as the racemate MBX 2359 (IC50, ϳ2.5 ␮M), and the (S)-
isomer MBX 2402 is inactive at concentrations of up to 50 ␮M
(Fig. 2). Since it is more potent than the previously published
phenoxyacetamide inhibitor (MBX 1641) and is more feasible to
prepare on a moderate scale than is the (R)-isomer (MBX 2401;
see Materials and Methods), the racemate MBX 2359 was used in
agar medium to select for mutant P. aeruginosa clones whose T3SS
exhibited significant resistance to the analog as described below.
Mutations conferring resistance to the T3SS inhibitor MBX
2359 reside in the pscF gene. Identifying bacterial mutations that
provide resistance to small-molecule antibacterial compounds is a
commonly used approach to identify the likely target of inhibitors.
However, application of this approach to inhibitors of T3SS is
complicated by the fact that this virulence factor is not required
for growth of P. aeruginosa cells in culture. Accordingly, we engi-
T3SS inhibitors, CBG-5376648 and CBG-6594330, were purchased from neered a strain of P. aeruginosa to enable selection for resistant
April 2014 Volume 58 Number 4
aac.asm.org 2213

Bowlin et al.
type III secretory activity with T3SS transcription (37, 38). The
gentamicin resistance element aacC1 was placed under the control
of the T3SS-regulated exoT promoter, resulting in a P. aeruginosa
strain that was resistant to gentamicin when type III secretion was
induced by growth in low-calcium medium (e.g., addition of
EGTA) but sensitive to gentamicin when type III secretion was
blocked by addition of an inhibitor. The screening strain was also
engineered to contain a chromosomally integrated copy of a re-
porter fusion protein gene consisting of the effector protein ExoS
tagged with ␤-lactamase (designated ExoS-BLA) to enable conve-
nient direct measurements of T3SS-mediated secretion.
To identify the target of MBX 2359 by mapping mutations to
resistance, we selected gentamicin-resistant clones of ethyl meth-
anesulfonate-mutagenized MDM1710 in the presence of both
EGTA and MBX 2359. However, most of the resulting clones ap-
peared to meet the selection by breaking the link between type III
secretory activity and transcription and, consequently, constitu-
tively expressing accC1 rather than by escaping inhibition of se-
cretion by MBX 2359. To discriminate between such regulatory
mutants and true T3SS secretion-resistant mutants, the selected
gentamicin-resistant clones were evaluated further in a screen for
those that retained EGTA-dependent gentamicin resistance (i.e.,
gentamicin resistant in the presence of EGTA but gentamicin sus-
ceptible in the absence of EGTA). Clones that retained EGTA de-
pendence were then assayed directly for ongoing type III secretion
in the presence of inhibitor. This was accomplished by measuring
hydrolysis of extracellular nitrocefin in the presence of bacteria
secreting ExoS-BLA.
FIG 2 Stereoselective inhibition of T3SS-mediated secretion by phenoxyacet-
amide inhibitors. Inhibition of T3SS-mediated secretion of ExoS-BLA from P.
aeruginosa strain MDM973 is shown. Inhibitors include the original screening
hit, racemate MBX 1641 (⌬), its (R)-isomer, MBX 1684 (O), its (S)-isomer,
MBX 1686 (ᮀ), and an analog optimized for potency, the racemate MBX 2359
(Œ), together with its (R)-isomer MBX 2401 (ꢀ) and (S)-isomer MBX 2402
(ꢁ). The fraction of secretion of ExoS-BLA into culture medium with respect
to the control (uninhibited secretion), as measured by the change in absor-
bance at 490 nm per min resulting from the cleavage of nitrocefin (⌬A490/
min), is plotted versus the concentration of compound added.
mutants. Our goal was to generate a strain that required ongoing
type III secretion for viability. Addition of the phenoxyacetamide
type III secretion inhibitor would then result in bacterial death,
except in the presence of mutations that conferred resistance to
the inhibitor. To construct such a strain (designated MDM1710),
Four mutants with pronounced resistance of ExoS-BLA secre-
tion to MBX 2359 were identified from about 1,200 gentamicin-
we took advantage of the previously described tight coupling of resistant colonies selected. The MBX 2359 IC50s shifted from
FIG 3 T3SS-mediated secretion by selected mutants is resistant to inhibition by MBX 2359. (A) Concentration dependence of MBX 2359 inhibition of
T3SS-mediated secretion of ExoS-BLA by the P. aeruginosa screening strain MDM1710 (o) and four selected mutants, MDM1739 [PscF(R75C)] (ꢀ),
MDM1749 [PscF(R75H)] (ꢁ), MDM1750 (PscF(V62I)] (Œ), and MDM1770 [PscF(G80D)] (}). Secretion was measured by the rate of hydrolysis of nitrocefin
by ExoS-BLA. Results are plotted as a fraction of that of the uninhibited control versus the concentration of T3SS inhibitor MBX 2359 added. (B) Inhibition by
MBX 2359 of T3SS-mediated secretion of native effector ExoS and ExoS-BLA fusion proteins into the culture medium was measured by immunoblot analysis.
Supernatants (normalized to cell number) of the screening strain MDM1710, the highly resistant mutant MDM1749 [PscF(R75H)], and the moderately resistant
mutant MDM1750 [PscF(V62I)] were analyzed. Detection was by primary anti-ExoS antibody and LiCor goat anti-rabbit as the secondary antibody. Blots were
imaged using the LiCor imager. (C) Image-Studio (LiCor) was used to perform densitometry on each band. Densities were normalized to the no-inhibitor value
and are shown graphically for MDM1710 (o), MDM1749 [PscF(R75H)] (ꢁ), and MDM1750 [PscF(V62I)] (Œ) for ExoS (upper) and ExoS-BLA (lower).
2214 aac.asm.org
Antimicrobial Agents and Chemotherapy

T3SS Inhibitor Escape Mutations in pscF
TABLE 3 Change in potency of inhibition of T3SS-mediated secretion or translocation by P. aeruginosa cells containing wild-type or mutant pscF
allelesa
IC50 (␮M)
Fold shift
V62I
Inhibitor and IC50
measured
WT
V62I
R75C
R75H
G80D
R75C
R75H
G80D
Secretion
MBX 1641
MBX 2359
MBX 2164
MBX 2614
MBX 2727
INP-0007
5.2
1.1
4
3.6
3.9
0.8
5
18
10
18
10
15
0.9
6
Ͼ100
70
Ͼ100
80
100
0.7
6
Ͼ100
Ͼ100
Ͼ100
Ͼ100
Ͼ100
1
Ͼ100
80
Ͼ100
100
100
1.3
3.5
9.1
4.5
2.8
3.8
1.1
1.2
0.6
Ͼ19
64
Ͼ25
22
Ͼ19
Ͼ90
Ͼ25
Ͼ27
Ͼ25
1.3
Ͼ19
72
Ͼ25
28
26
26
0.9
1.2
1.2
1.6
1.6
0.6
CBG-5376648
CBG-6594330
7
50
8
40
1.4
0.8
65
40
75
Translocation
MBX 2359
10
20
Ͼ100
Ͼ100
Ͼ100
2.0
Ͼ10
Ͼ10
Ͼ10
a Strains used for each pscF allele were MDM1912 (WT), MDM1967 (V62I), MDM1938 (R75C), MDM1886 (R75H), and MDM1940 (G80D).
about 1.5 ␮M for the parent to Ͼ100 ␮M for three mutants and to previously as SNPs were the only mutations present in the pscEFG
10 ␮M for the fourth mutant (Fig. 3A). Similar relative shifts in fragments. The mutant MBX 2359-resistant phenotype was trans-
susceptibility to MBX 2359 were observed when secretion of na- ferred along with the pscF allele in each pscEFG minioperon, con-
tive effector toxin ExoS and ExoS-BLA were measured directly by firming that the mutant pscF alleles are necessary and sufficient to
immunoblotting of culture medium from P. aeruginosa wild-type provide T3SS secretion that is resistant to MBX 2359 (Table 3 and
and mutant cells induced for T3SS and treated with inhibitor (Fig. Fig. 4). Furthermore, the mutant pscF alleles provided resistance
3B and C), although results were more variable and accompanied to four diverse analogs (Fig. 1) of phenoxyacetamide inhibitors
by a high background of secreted ExoS and ExoS-BLA. Genomic that exhibit approximately equal potency against T3SS by cells
DNA was prepared from three of the mutants (MDM1739, carrying wild-type pscF (Table 3 and Fig. 4). These include the
MDM1749, and MDM1750) and the parent strain MDM1710 and original screening hit MBX 1641 as well as three analogs with
subjected to Illumina sequencing to identify single-nucleotide significant alterations in the linker region of the scaffold, MBX
polymorphisms (SNPs) between the mutants and parent. All 2164, MBX 2614, and MBX 2727. These results confirm that spe-
three mutant strains harbored codon-altering SNPs in the same cific mutations in the pscF gene render P. aeruginosa resistant to
T3SS structural gene, pscF. Two mutant strains (MDM1739 and phenoxyacetamide-mediated inhibition of type III secretion.
MDM1749) contained different changes in the same codon,
To assess the effects of pscF mutations on T3SS-mediated
G223T and G224A, altering the Arg75 codon to two different translocation of effectors into mammalian cells in the presence of
codons, Cys and His, respectively, and the third mutant strain MBX 2359, a cell culture model was used. The complemented
(MDM1750) altered the nearby Val62 codon to Ile (G184A). No ⌬pscF strains, which secrete ExoS-BLA fusion protein, were incu-
other single gene contained codon-altering SNPs in all three mu- bated with cultured J774 macrophage cells either alone or with
tant strains compared to the wild-type parent. Direct sequencing various concentrations of phenoxyacetamide inhibitor. Translo-
of the pscF gene from the fourth mutant (MDM1770) revealed an cation was quantified by using the fluorescent substrate CCF2-
alteration (G239A) of the Gly80 codon to an Asp codon. These AM, which shifts its fluorescence from green to blue upon cleav-
results suggest that the PscF protein, which forms the T3SS needle age of the cephalosporin linker by a ␤-lactamase (40). Thus,
apparatus of P. aeruginosa, is the target of MBX 2359.
injection of ExoS-BLA into J774 cells was quantified by measuring
Mutations in pscF are necessary and sufficient to confer in- the ratio of blue to green fluorescence from J774 cells following
hibitor resistance to T3SS-mediated secretion and transloca- incubation with the complemented ⌬pscF strains. Similar to se-
tion. Since the selection strain had been subjected to chemical cretion, ExoS-BLA translocation into J774 cells was resistant to
mutagenesis prior to selection, mutant pscF alleles were generated MBX 2359 inhibition when mutant pscF alleles were expressed
in a previously unmutagenized background to confirm that they (Table 3 and Fig. 5). These results confirm that specific mutations
were solely responsible for the altered sensitivity of T3SS-medi- in the pscF gene render P. aeruginosa resistant to phenoxyacet-
ated secretion to MBX 2359. Prior to assembly into the T3SS nee- amide-mediated inhibition of the injection of T3SS effector pro-
dle, intracellular PscF is complexed with a chaperone, PscG, and a teins.
cochaperone, PscE, to maintain PscF in its monomeric form in the
Mutant pscF alleles do not provide resistance of T3SS-medi-
bacterial cytoplasm (39). Therefore, we generated pscEFG mini- ated secretion to inhibitors with different chemical scaffolds.
operons containing pscF from each of the resistant mutant strains, Several other chemical classes of inhibitors of P. aeruginosa T3SS
inserted them into the extrachromosomal replicating plasmid have been described (14, 15, 35). We wished to determine whether
pUCP24GW-lacIQPO (Table 1), and introduced them by electro- the pscF mutations conferred protection against a broad range of
poration into a P. aeruginosa strain (MDM1838) (Table 1) carry- T3SS inhibitors or whether they were specific for the phenoxyac-
ing a markerless, in-frame deletion of pscF and an integrated etamide series. Therefore, we examined the potency of a diverse
ExoS-BLA reporter gene. Sequencing of each complementing set of inhibitors against T3SS-mediated secretion of the ExoS-BLA
plasmid insert confirmed that the pscF gene mutations identified reporter fusion protein by the same ⌬pscF strains carrying each of
April 2014 Volume 58 Number 4
aac.asm.org 2215

Bowlin et al.
FIG 4 Mutant pscF alleles provide T3SS secretion resistance to five phenoxyacetamide analogs. The original screening hit, MBX 1641 (छ), and analogs MBX 2359
(ᮀ), MBX 2164 (o), MBX 2614 (Œ), and MBX 2727 (✖) were tested for inhibition of T3SS-mediated secretion of ExoS-BLA carried out by ⌬pscF PAO1 cells
complemented with lac-promoted pscEFG on extrachromosomal plasmid pUCP24. The strains and pscF alleles were wild-type MDM1912 (A), MDM1967
[PscF(V62I)] (B), and MDM1886 [PscF(R75H)] (C). For reference, the MBX 2359 concentration response versus the wild-type pscF allele from panel A is shown
in panels B and C as a dotted line.
the four mutant pscF alleles on pUCP24. T3SS-mediated secretion PscE and PscG. In addition, a binding site mapping calculation
of ExoS-BLA by cells carrying each of the four mutant pscF alleles also failed to identify any small-molecule binding sites in this het-
was not cross-resistant to inhibitors with nonphenoxyacetamide erotrimeric structure (B. Li, unpublished data). Hence, we rea-
scaffolds (Table 3 and Fig. 6), including an acylated hydrazone soned that this soluble intracellular form of PscF does not interact
(35), a phenylmaleimide (15), and a thiazoloindole (14) (Fig. 1). with the inhibitors. Structural models for the assembled T3SS nee-
These results suggest that these other scaffolds do not interact with dle have been proposed for two needle proteins with significant
PscF or that they interact with a different region of the PscF pro- homology to PscF, the Salmonella T3SS protein PrgI, based on
tein.
cryoelectron microscopy and solid-state NMR data (36, 44), and
Residues capable of conferring inhibitor resistance are in the Shigella MxiH, based on X-ray data of the truncated monomer
close proximity in a T3SS needle homology model. Full-length and cryoelectron microscopy (43, 45). Recent immunoelectron
isolated T3SS needle proteins are not amenable to crystal structure microscopy studies indicate that the N-terminal region of the nee-
studies because of their tendency to form needles in vitro sponta- dle protein is on the outer surface of assembled PrgI and MxiH
neously; however, truncated versions and cocrystal structures needles (36, 44), and we used the corresponding model of assem-
with chaperoned forms of PscF and its Yersinia homolog YscF bled PrgI (36) to estimate the structure of PscF in a T3SS needle
have been solved (41–43). These structures indicate that the three (Fig. 7A and B). In this homology model, the 85-residue PscF
amino acid residues capable of conferring resistance to the phe- adopts a rigid conformation comprising four structural elements:
noxyacetamide inhibitors are not close enough to form a small- an N-terminal extended domain (residues 1 to 11), an ␣-helix
molecule binding site in the relatively rigid alpha-helical C-termi- (␣1) (residues 12 to 39), a loop (residues 40 to 48), and a C-ter-
nal portion of monomeric PscF complexed with its chaperones, minal ␣-helix (␣2) (residues 49 to 85). The PscF subunits form a
FIG 5 Mutant pscF alleles provide T3SS translocation resistance to phenoxyacetamide MBX 2359. Inhibitor or diluent (dimethylsulfoxide) was tested at the
indicated concentration for inhibition of T3SS-mediated translocation detected by the ␤-lactamase-sensitive fluorescent substrate CCF2-AM and carried out by
⌬pscF P. aeruginosa PAO1 cells complemented with lac-promoted pscEFG on extrachromosomal plasmid pUCP24. The strains and pscF alleles were wild-type
MDM1912 (A), MDM1967 [PscF(V62I)] (B), and MDM1886 [PscF(R75H)] (C). The J774 bar indicates the addition of CCF2-AM to J774 cells in the absence of
bacteria. The WT and ⌬pscF bars indicate the addition of CCF2-AM to J774 cells infected with wild-type P. aeruginosa and with uncomplemented ⌬pscF P.
aeruginosa, respectively. *, P Ͻ 0.005 by two-tailed paired Student t test.
2216 aac.asm.org
Antimicrobial Agents and Chemotherapy

T3SS Inhibitor Escape Mutations in pscF
FIG 6 Mutant pscF alleles fail to provide T3SS secretion resistance to three nonphenoxyacetamide inhibitors. The sensitivity of secretion to a concentration
dilution series of T3SS inhibitors INP0007 (छ), CBG-5376648 (o), CBG-6594330 (Œ), and the phenoxyacetamide MBX 2359 (ꢁ) is shown versus ⌬pscF PAO1
cells complemented with lac-promoted pscEFG on extrachromosomal plasmid pUCP24. The strains and pscF alleles were wild-type MDM1912 (A), MDM1967
[PscF(V62I)] (B), and MDM1886 [PscF(R75H)] (C).
right-handed helical assembly with roughly 11 subunits per two noxyacetamides when altered, exhibit the following properties: (i)
turns. The extended amino-terminal domain of each PscF subunit all three appear sufficiently close to one another in the ␣2 domains
is positioned on the surface of the needle, and the ␣-helical car- of the polymerized form to participate in a single phenoxyacet-
boxy-terminal domain of each PscF (␣2 helix) subunit is posi- amide binding site (Fig. 7C and D), (ii) each of the three residues
tioned inside the needle. Intersubunit interactions are formed by is provided by a different PscF subunit (Fig. 7CD), and (iii) two of
hydrophobic helix-helix packing, while the C-terminal ␣2 helix the three (R75 and G80) face the lumen of the needle, while the
hydrophilic residues, which are highly conserved, form the hydro- third (V62) is close to and behind R75 (Fig. 7B). These findings
philic lumen of the needle (36). In this model, the three amino suggest that the phenoxyacetamide inhibitors bind to the assem-
acid residues, which are capable of conferring resistance to phe- bled PscF needle and that they may block T3SS function by affect-
FIG 7 Comparative homology model of the P. aeruginosa T3SS needle complex. Ribbon representations show different subunits. (A) Side view. (B) Top view
with residues Val62 (red), Arg75 (green), and Gly80 (yellow) shown in space-filling format for three different putative inhibitor interaction sites (circled). Loops
joining ␣ helices are shown in purple, as are extended chains positioned on the surface of the needle complex representing the N-terminal domains. Cyan helices
represent the ␣1 and ␣2 helical structures. Closeup view of three PscF subunits shown in ribbon format, with residues Val62, Arg75, and Gly80 highlighted in stick
format (C) and with inter-␣-carbon distances shown (D). Each residue is in a different PscF subunit, and the alpha-helical ribbons are colored differently to
represent the three different subunits.
April 2014 Volume 58 Number 4
aac.asm.org 2217

Bowlin et al.
ing subunit-subunit interactions to inhibit needle assembly or sta- tinct from the phenoxyacetamide site, it is also possible that they
bility or by binding in, and altering the hydrophilicity of, the target other proteins and can be used to define additional inhibi-
needle lumen to inhibit function.
tor vulnerabilities in T3SS. For this reason, we have initiated stud-
ies utilizing the same selection strain and scheme to identify mu-
tations providing resistance to these other scaffolds. It is not yet
DISCUSSION
The results of this study suggest a new vulnerable molecular target possible to predict whether these selections will yield useful mu-
in the complex P. aeruginosa T3SS apparatus, the needle protein tants, as the success of the selection using the phenoxyacetamide
PscF. Use of the highly potent and selective phenoxyacetamide scaffold was at least in part due to the exquisite specificity of this
inhibitor series to select mutations in pscF conferring resistance compound series for T3SS inhibition. The approach of converting
implicates both the PscF needle protein and the specific small- the T3SS virulence factor into an essential function through the
molecule inhibitor as a useful receptor-ligand pair for the poten- linkage between secretory activity and transcription may be trans-
tial development of therapeutics or prophylactics. Indeed, the ferrable to other bacterial species, such as those of Yersinia, which
T3SS is one of the most validated virulence targets for drug devel- have a T3SS that is evolutionarily close to that of P. aeruginosa and
opment based on a wealth of animal infection model and human which preserve the function/transcription linkage.
association studies as well as ongoing clinical studies of the anti-
The success in isolating mutations providing resistance to a
PcrV monoclonal antibody KB001 (19, 20). Prior to this report, T3SS inhibitor raises the question of whether resistance will
PcrV was the only validated structural protein target for interven- emerge in clinical use of optimized versions of these inhibitors.
tion in T3SS. This new discovery of a putative second vulnerable First, it is important to note that spontaneous inhibitor resistance-
T3SS component, the PscF needle protein, may increase the feasi- conferring mutations did not arise at a particularly high fre-
bility of discovering useful inhibitors of T3SS. Inhibition of PscF quency. Initially, the spontaneous mutant selection process was
may block T3SS at a more proximal stage in the secretion/trans- overwhelmed by apparent transcriptional regulatory mutants,
location process than does inhibition of PcrV, and the use of com- possibly in regulatory elements encoded by exsA, exsD, or exsCEB,
binations of inhibitors of both targets may provide synergy and among others (1). These mutants answered the selection by induc-
reduce the development of resistance. Furthermore, the fact that ing expression of the gentamicin resistance gene aacC1 from the
both PcrV and the putative target PscF are extracellular eliminates exoT promoter in the presence of MBX 2359 as well as in the
the possibility of resistance to small-molecule inhibitors by efflux, absence of EGTA (which allowed us to eliminate them rapidly
a frequent cause of antibiotic resistance in P. aeruginosa.
from further analysis) but did not provide T3SS secretion that was
In principle, it is possible that PscF is not the direct target of the truly resistant to MBX 2359, as measured in the nitrocefin-based
phenoxyacetamide inhibitors and that the observed alterations in ExoS-BLA assay. Therefore, we used a chemical mutagen to in-
PscF transmit conformational changes to a different protein tar- crease the odds of obtaining target mutants. While this approach
get, which is the actual site of interaction with phenoxyacet- was effective, it precludes direct measurement of the spontaneous
amides. However, this seems unlikely for three reasons. First, mu- target mutation frequency. However, rough estimates suggest that
tations capable of generating inhibitor-resistant T3SS were not the spontaneous frequency of true inhibitor-resistant mutants is
found in other genes despite mutagenesis and selection sufficient Յ10Ϫ9. Another unknown is the strength of selection for resis-
to identify four independent pscF mutants, each of which is capa- tance in the context of clinical use. Since T3SS plays an important
ble of generating an inhibitor-resistant T3SS apparatus. Second, role in establishing and disseminating infection, it seems likely
all three of the amino acid residues critical for MBX 2359-medi- that some selection pressure will be exerted in vivo. Three factors
ated inhibition of T3SS appear to be in close enough proximity in mitigate this concern to some degree: (i) since T3SS inhibitors do
structural models of polymerized PscF to interact with an inhibi- not kill P. aeruginosa cells directly, the selective pressure is ex-
tor of the size of the phenoxyacetamides. Third, even a conserva- pected to be less than that from an antibiotic; (ii) drugs derived
tive substitution of His for Arg75, which is arguably less likely to from these T3SS inhibitors would be used clinically, at least ini-
produce conformational changes in PscF, provides over 100-fold tially, in combination with an antipseudomonal antibiotic, likely
resistance to phenoxyacetamide inhibitors without affecting T3SS providing some synergy and reducing development of resistance
function detectably. Therefore, our results strongly support the to either component; and (iii) resistance to T3SS inhibitors may
idea that the multimeric form of PscF is the target of the phenoxy- confer a fitness cost. In fact, we plan to evaluate the existing mu-
acetamide T3SS inhibitors. Although the precise mechanism of tants for virulence in animal models of infection.
action of the inhibitors is not yet clear, biochemical studies are
under way to confirm the target and define the mechanism of implicate a new target in the complex T3SS nanomachine that is
action of the inhibitors. susceptible to inhibition by small molecules. The highly respon-
In summary, the phenoxyacetamide series of T3SS inhibitors
The inhibitor specificity of the resistance provided by the pscF sive SAR, including exquisite stereoselectivity, of these inhibitors
mutant alleles is quite striking. All four pscF mutant alleles pro- indicates a very specific interaction with PscF. These properties,
vided resistance only to the phenoxyacetamide series of inhibitors, together with the absence of a human PscF homolog, suggest that
including a range of varied phenoxyacetamides. We have not ex- this class of compounds may be optimized to produce a novel
amined all of the Ͼ300 analogs available, but it seems possible that antivirulence factor drug. Such drugs will likely be used in com-
analogs exhibit a range of potencies against the mutants depend- bination with antipseudomonal antibiotics to inhibit the T3SS-
ing on precisely how they interact with the binding site. Such data mediated intoxication of phagocytes and thereby potentiate a ro-
may help probe the nature of the binding site. The potency of three bust host innate immune response and enhance the antibacterial
other chemotypes of published P. aeruginosa T3SS inhibitors was activity of the coadministered antibiotics. Given the propensity of
not affected by the mutant pscF alleles. While these other classes of P. aeruginosa to develop resistance to conventional antibiotics,
T3SS inhibitors may interact with PscF at one or more sites dis- such novel therapies are urgently needed.
2218 aac.asm.org
Antimicrobial Agents and Chemotherapy

T3SS Inhibitor Escape Mutations in pscF
15. Aiello D, Williams JD, Majgier-Baranowska H, Patel I, Peet NP, Huang J,
Lory S, Bowlin TL, Moir DT. 2010. Discovery and characterization of in-
hibitors of Pseudomonas aeruginosa type III secretion. Antimicrob. Agents
Chemother. 54:1988–1999. http://dx.doi.org/10.1128/AAC.01598-09.
16. Grier MC, Garrity-Ryan LK, Bartlett VJ, Klausner KA, Donovan PJ,
Dudley C, Alekshun MN, Tanaka SK, Draper MP, Levy SB, Kim OK.
2010. N-hydroxybenzimidazole inhibitors of ExsA MAR transcription
factor in Pseudomonas aeruginosa: in vitro anti-virulence activity and
metabolic stability. Bioorg. Med. Chem. Lett. 20:3380–3383. http://dx.doi
.org/10.1016/j.bmcl.2010.04.014.
17. Baer M, Sawa T, Flynn P, Luehrsen K, Martinez D, Wiener-Kronish JP,
Yarranton G, Bebbington C. 2009. An engineered human antibody fab
fragment specific for Pseudomonas aeruginosa PcrV antigen has potent
antibacterial activity. Infect. Immun. 77:1083–1090. http://dx.doi.org/10
.1128/IAI.00815-08.
18. Frank DW, Vallis A, Wiener-Kronish JP, Roy-Burman A, Spack EG,
Mullaney BP, Megdoud M, Marks JD, Fritz R, Sawa T. 2002. Generation
and characterization of a protective monoclonal antibody to Pseudomo-
nas aeruginosa PcrV. J. Infect. Dis. 186:64–73. http://dx.doi.org/10.1086
/341069.
19. Francois B, Luyt CE, Dugard A, Wolff M, Diehl JL, Jaber S, Forel JM,
Garot D, Kipnis E, Mebazaa A, Misset B, Andremont A, Ploy MC,
Jacobs A, Yarranton G, Pearce T, Fagon JY, Chastre J. 2012. Safety and
pharmacokinetics of an anti-PcrV PEGylated monoclonal antibody frag-
ment in mechanically ventilated patients colonized with Pseudomonas
aeruginosa: a randomized, double-blind, placebo-controlled trial. Crit.
Care Med. 40:2320–2326. http://dx.doi.org/10.1097/CCM.0b013e318253
34f6.
ACKNOWLEDGMENTS
We thank Stephen Lory (Harvard Medical School) and Timothy Opper-
man (Microbiotix) for helpful discussions and suggestions. We thank
Ming Di and Debra Mills for assistance in plasmid and strain construction
and in assaying inhibitor potency. We thank Heather Howell, Greg Tyson,
Stephanie Rangel, and Egon Ozer for assistance with the immunoblotting
and translocation assays and the whole-genome sequence analysis.
This project was supported by award numbers AI068185 and
AI099269 (to D.T.M.) and award numbers AI075191 and AI053674 (to
A.R.H.) by the National Institute of Allergy and Infectious Disease of the
National Institutes of Health. The content is solely the responsibility of the
authors and does not necessarily represent the official views of the Na-
tional Institutes of Health. The funders had no role in study design, data
collection and analysis, decision to publish, or preparation of the manu-
script.
REFERENCES
1. Hauser AR. 2009. The type III secretion system of Pseudomonas aerugi-
nosa: infection by injection. Nat. Rev. Microbiol. 7:654–665. http://dx
.doi.org/10.1038/nrmicro2199.
2. Izore T, Job V, Dessen A. 2011. Biogenesis, regulation, and targeting of
the type III secretion system. Structure 19:603–612. http://dx.doi.org/10
.1016/j.str.2011.03.015.
3. Engel J, Balachandran P. 2009. Role of Pseudomonas aeruginosa type III
effectors in disease. Curr. Opin. Microbiol. 12:61–66. http://dx.doi.org/10
.1016/j.mib.2008.12.007.
20. Milla CE, Chmiel JF, Accurso FJ, Vandevanter DR, Konstan MW,
Yarranton G, Geller DE, KB001 Study Group. 2013. Anti-PcrV antibody
in cystic fibrosis: a novel approach targeting Pseudomonas aeruginosa
airway infection. Pediatr. Pulmonol. doi:http://dx.doi.org/10.1002/ppul
.22890.
21. Sato H, Hunt ML, Weiner JJ, Hansen AT, Frank DW. 2011. Modified
needle-tip PcrV proteins reveal distinct phenotypes relevant to the control
of type III secretion and intoxication by Pseudomonas aeruginosa. PLoS
One 6:e18356. http://dx.doi.org/10.1371/journal.pone.0018356.
22. Holloway BW, Krishnapillai V, Morgan AF. 1979. Chromosomal genet-
ics of Pseudomonas. Microbiol. Rev. 43:73–102.
23. Bradley DE. 1974. The adsorption of Pseudomonas aeruginosa pilus-
dependent bacteriophages to a host mutant with nonretractile pili. Virol-
ogy 58:149–163. http://dx.doi.org/10.1016/0042-6822(74)90150-0.
24. de Lorenzo V, Timmis KN. 1994. Analysis and construction of stable
phenotypes in gram-negative bacteria with Tn5- and Tn10-derived mini-
transposons. Methods Enzymol. 235:386–405. http://dx.doi.org/10.1016
/0076-6879(94)35157-0.
4. Coburn B, Sekirov I, Finlay BB. 2007. Type III secretion systems and
disease. Clin. Microbiol. Rev. 20:535–549. http://dx.doi.org/10.1128
/CMR.00013-07.
5. Shaver CM, Hauser AR. 2004. Relative contributions of Pseudomonas
aeruginosa ExoU, ExoS, and ExoT to virulence in the lung. Infect. Immun.
72:6969–6977. http://dx.doi.org/10.1128/IAI.72.12.6969-6977.2004.
6. Smith RS, Wolfgang MC, Lory S. 2004. An adenylate cyclase-controlled
signaling network regulates Pseudomonas aeruginosa virulence in a
mouse model of acute pneumonia. Infect. Immun. 72:1677–1684. http:
//dx.doi.org/10.1128/IAI.72.3.1677-1684.2004.
7. El Solh AA, Akinnusi ME, Wiener-Kronish JP, Lynch SV, Pineda LA,
Szarpa K. 2008. Persistent infection with Pseudomonas aeruginosa in
ventilator-associated pneumonia. Am. J. Respir. Crit. Care Med. 178:513–
519. http://dx.doi.org/10.1164/rccm.200802-239OC.
8. El-Solh AA, Hattemer A, Hauser AR, Alhajhusain A, Vora H. 2012.
Clinical outcomes of type III Pseudomonas aeruginosa bacteremia. Crit.
Care Med. 40:1157–1163. http://dx.doi.org/10.1097/CCM.0b013e318237
7906.
25. Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey
MJ, Brinkman FS, Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL,
Goltry L, Tolentino E, Westbrock-Wadman S, Yuan Y, Brody LL,
Coulter SN, Folger KR, Kas A, Larbig K, Lim R, Smith K, Spencer D,
Wong GK, Wu Z, Paulsen IT, Reizer J, Saier MH, Hancock RE, Lory S,
Olson MV. 2000. Complete genome sequence of Pseudomonas aerugi-
nosa PAO1, an opportunistic pathogen. Nature 406:959–964. http://dx
.doi.org/10.1038/35023079.
26. Chuanchuen R, Murata T, Gotoh N, Schweizer HP. 2005. Substrate-
dependent utilization of OprM or OpmH by the Pseudomonas aeruginosa
MexJK efflux pump. Antimicrob. Agents Chemother. 49:2133–2136. http:
//dx.doi.org/10.1128/AAC.49.5.2133-2136.2005.
9. Hauser AR, Cobb E, Bodi M, Mariscal D, Valles J, Engel JN, Rello J.
2002. Type III protein secretion is associated with poor clinical outcomes
in patients with ventilator-associated pneumonia caused by Pseudomonas
aeruginosa. Crit. Care Med. 30:521–528. http://dx.doi.org/10.1097
/00003246-200203000-00005.
10. Roy-Burman A, Savel RH, Racine S, Swanson BL, Revadigar NS, Fu-
jimoto J, Sawa T, Frank DW, Wiener-Kronish JP. 2001. Type III protein
secretion is associated with death in lower respiratory and systemic Pseu-
domonas aeruginosa infections. J. Infect. Dis. 183:1767–1774. http://dx
.doi.org/10.1086/320737.
11. Zhuo H, Yang K, Lynch SV, Dotson RH, Glidden DV, Singh G, Webb
WR, Elicker BM, Garcia O, Brown R, Sawa Y, Misset B, Wiener-
Kronish JP. 2008. Increased mortality of ventilated patients with endo-
tracheal Pseudomonas aeruginosa without clinical signs of infection. Crit.
Care Med. 36:2495–2503. http://dx.doi.org/10.1097/CCM.0b013e318183
f3f8.
27. Moir DT, Di M, Moore RA, Schweizer HP, Woods DE. 2008. Cellular
reporter screens for inhibitors of Burkholderia pseudomallei targets in
Pseudomonas aeruginosa. Trans. R. Soc. Trop. Med. Hyg. 102(Suppl 1):
S152–S162. http://dx.doi.org/10.1016/S0035-9203(08)70033-6.
12. Negrea A, Bjur E, Ygberg SE, Elofsson M, Wolf-Watz H, Rhen M. 2007. 28. Hoang TT, Kutchma AJ, Becher A, Schweizer HP. 2000. Integration-
Salicylidene acylhydrazides that affect type III protein secretion in Salmo-
nella enterica serovar Typhimurium. Antimicrob. Agents Chemother. 51:
2867–2876. http://dx.doi.org/10.1128/AAC.00223-07.
proficient plasmids for Pseudomonas aeruginosa: site-specific integration
and use for engineering of reporter and expression strains. Plasmid 43:59–
72. http://dx.doi.org/10.1006/plas.1999.1441.
13. Kauppi AM, Nordfelth R, Uvell H, Wolf-Watz H, Elofsson M. 2003. 29. Diaz MH, Hauser AR. 2010. Pseudomonas aeruginosa cytotoxin ExoU is
Targeting bacterial virulence: inhibitors of type III secretion in Yersinia.
injected into phagocytic cells during acute pneumonia. Infect. Immun.
Chem. Biol. 10:241–249. http://dx.doi.org/10.1016/S1074-5521(03)00046-2.
78:1447–1456. http://dx.doi.org/10.1128/IAI.01134-09.
14. Harmon DE, Davis AJ, Castillo C, Mecsas J. 2010. Identification and 30. Roehl RA, Phibbs PV, Jr. 1982. Characterization and genetic mapping of
characterization of small-molecule inhibitors of Yop translocation in Yer-
sinia pseudotuberculosis. Antimicrob. Agents Chemother. 54:3241–3254.
http://dx.doi.org/10.1128/AAC.00364-10.
fructose phosphotransferase mutations in Pseudomonas aeruginosa. J.
Bacteriol. 149:897–905.
31. Wolfgang MC, Lee VT, Gilmore ME, Lory S. 2003. Coordinate regula-
April 2014 Volume 58 Number 4
aac.asm.org 2219

Bowlin et al.
tion of bacterial virulence genes by a novel adenylate cyclase-dependent 39. Quinaud M, Chabert J, Faudry E, Neumann E, Lemaire D, Pastor A,
signaling pathway. Dev. Cell 4:253–263. http://dx.doi.org/10.1016/S1534
-5807(03)00019-4.
Elsen S, Dessen A, Attree I. 2005. The PscE-PscF-PscG complex controls
type III secretion needle biogenesis in Pseudomonas aeruginosa. J. Biol.
Chem. 280:36293–36300. http://dx.doi.org/10.1074/jbc.M508089200.
40. Zlokarnik G, Negulescu PA, Knapp TE, Mere L, Burres N, Feng L,
Whitney M, Roemer K, Tsien RY. 1998. Quantitation of transcription
and clonal selection of single living cells with beta-lactamase as reporter.
Science 279:84–88. http://dx.doi.org/10.1126/science.279.5347.84.
41. Quinaud M, Ple S, Job V, Contreras-Martel C, Simorre JP, Attree I,
Dessen A. 2007. Structure of the heterotrimeric complex that regulates
type III secretion needle formation. Proc. Natl. Acad. Sci. U. S. A. 104:
7803–7808. http://dx.doi.org/10.1073/pnas.0610098104.
32. Moir DT, Di M, Opperman T, Schweizer HP, Bowlin TL. 2007. A
high-throughput, homogeneous, bioluminescent assay for Pseudomonas
aeruginosa gyrase inhibitors and other DNA-damaging agents. J. Biomol.
Screen. 12:855–864. http://dx.doi.org/10.1177/1087057107304729.
33. Choi KH, Kumar A, Schweizer HP. 2006. A 10-min method for prepa-
ration of highly electrocompetent Pseudomonas aeruginosa cells: applica-
tion for DNA fragment transfer between chromosomes and plasmid
transformation. J. Microbiol. Methods 64:391–397. http://dx.doi.org/10
.1016/j.mimet.2005.06.001.
34. Hauser AR, Kang PJ, Engel JN. 1998. PepA, a secreted protein of Pseudomo-
nas aeruginosa, is necessary for cytotoxicity and virulence. Mol. Microbiol.
27:807–818. http://dx.doi.org/10.1046/j.1365-2958.1998.00727.x.
35. Nordfelth R, Kauppi AM, Norberg HA, Wolf-Watz H, Elofsson M.
2005. Small-molecule inhibitors specifically targeting type III secretion.
Infect. Immun. 73:3104–3114. http://dx.doi.org/10.1128/IAI.73.5.3104
-3114.2005.
36. Loquet A, Sgourakis NG, Gupta R, Giller K, Riedel D, Goosmann C,
Griesinger C, Kolbe M, Baker D, Becker S, Lange A. 2012. Atomic model
of the type III secretion system needle. Nature 486:276–279. http://dx.doi
.org/10.1038/nature11079.
42. Sun P, Tropea JE, Austin BP, Cherry S, Waugh DS. 2008. Structural
characterization of the Yersinia pestis type III secretion system needle
protein YscF in complex with its heterodimeric chaperone YscE/YscG. J.
Mol. Biol. 377:819–830. http://dx.doi.org/10.1016/j.jmb.2007.12.067.
43. Deane JE, Roversi P, Cordes FS, Johnson S, Kenjale R, Daniell S, Booy
F, Picking WD, Picking WL, Blocker AJ, Lea SM. 2006. Molecular model
of a type III secretion system needle: implications for host-cell sensing.
Proc. Natl. Acad. Sci. U. S. A. 103:12529–12533. http://dx.doi.org/10.1073
/pnas.0602689103.
44. Demers JP, Sgourakis NG, Gupta R, Loquet A, Giller K, Riedel D,
Laube B, Kolbe M, Baker D, Becker S, Lange A. 2013. The common
structural architecture of Shigella flexneri and Salmonella typhimurium
type three secretion needles. PLoS Pathog. 9:e1003245. http://dx.doi.org
/10.1371/journal.ppat.1003245.
37. Rietsch A, Vallet-Gely I, Dove SL, Mekalanos JJ. 2005. ExsE, a secreted
regulator of type III secretion genes in Pseudomonas aeruginosa. Proc.
Natl. Acad. Sci. U. S. A. 102:8006–8011. http://dx.doi.org/10.1073/pnas
.0503005102.
45. Fujii T, Cheung M, Blanco A, Kato T, Blocker AJ, Namba K. 2012.
Structure of a type III secretion needle at 7-A resolution provides insights
into its assembly and signaling mechanisms. Proc. Natl. Acad. Sci. U. S. A.
109:4461–4466. http://dx.doi.org/10.1073/pnas.1116126109.
38. Urbanowski ML, Lykken GL, Yahr TL. 2005. A secreted regulatory
protein couples transcription to the secretory activity of the Pseudomonas
aeruginosa type III secretion system. Proc. Natl. Acad. Sci. U. S. A. 102:
9930–9935. http://dx.doi.org/10.1073/pnas.0504405102.
2220 aac.asm.org
Antimicrobial Agents and Chemotherapy