Bromo-deaza-SAH: A potent and selective DOT1L inhibitor

Article abstract of DOI:10.1016/j.bmc.2013.01.049

Chemical inhibition of proteins involved in chromatin-mediated signaling is an emerging strategy to control chromatin compaction with the aim to reprogram expression networks to alter disease states. Protein methyltransferases constitute one of the protei

Full text of DOI:10.1016/j.bmc.2013.01.049

Bioorganic & Medicinal Chemistry 21 (2013) 1787–1794
Contents lists available at SciVerse ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Bromo-deaza-SAH: A potent and selective DOT1L inhibitor
Wenyu Yu a, , David Smil a, , Fengling Li a, , Wolfram Tempel a, Oleg Fedorov b, Kong T. Nguyen a,
Yuri Bolshan a, Rima Al-Awar c, Stefan Knapp b, Cheryl H. Arrowsmith a, Masoud Vedadi a, Peter J. Brown a,
Matthieu Schapira a,d,
⇑
a Structural Genomics Consortium, University of Toronto, 101 College Street, MaRS Centre, South Tower, Toronto, Ontario, Canada M5G 1L7
b University of Oxford, Nuffield Department of Clinical Medicine, Structural Genomics Consortium, Old Road Campus Research Building, Roosevelt Drive, Oxford OX3 7LD, UK
c Medicinal Chemistry Platform, Ontario Institute for Cancer Research, 101 College Street, MaRS Centre, South Tower, Toronto, Ontario, Canada M5G 0A3
d Department of Pharmacology and Toxicology, University of Toronto, Toronto, Ontario, Canada
a r t i c l e i n f o
a b s t r a c t
Article history:
Chemical inhibition of proteins involved in chromatin-mediated signaling is an emerging strategy to con-
trol chromatin compaction with the aim to reprogram expression networks to alter disease states. Protein
methyltransferases constitute one of the protein families that participate in epigenetic control of gene
expression, and represent a novel therapeutic target class. Recruitment of the protein lysine methyltrans-
ferase DOT1L at aberrant loci is a frequent mechanism driving acute lymphoid and myeloid leukemias,
particularly in infants, and pharmacological inhibition of DOT1L extends survival in a mouse model of
mixed lineage leukemia. A better understanding of the structural chemistry of DOT1L inhibition would
accelerate the development of improved compounds. Here, we report that the addition of a single
halogen atom at a critical position in the cofactor product S-adenosylhomocysteine (SAH, an inhibitor
of SAM-dependent methyltransferases) results in an 8-fold increase in potency against DOT1L, and
reduced activities against other protein and non-protein methyltransferases. We solved the crystal struc-
ture of DOT1L in complex with Bromo-deaza-SAH and rationalized the observed effects. This discovery
reveals a simple strategy to engineer selectivity and potency towards DOT1L into the adenosine scaffold
of the cofactor shared by all methyltransferases, and can be exploited towards the development of clinical
candidates against mixed lineage leukemia.
Received 23 November 2012
Revised 11 January 2013
Accepted 20 January 2013
Available online 30 January 2013
Keywords:
Protein methyltransferase
DOT1L
Leukemia
Inhibitor
Crystallography
Ó 2013 Elsevier Ltd. All rights reserved.
1. Introduction
EPZ004777 retains the adenosine scaffold of SAM, but is a much lar-
ger and more hydrophobic compound due to the substitution of the
Chromosomal translocation at the mixed lineage leukemia
(MLL) gene can result in oncogenic fusions between MLL and a
number of proteins, including AF4, AF9 and AF10, and formation
of translocation complexes that recruit the H3K79 methyltransfer-
ase DOT1L at aberrant loci in leukemia. The resulting illicit methyl-
ation of H3K79 activates expression of genes essential for
leukemogenesis, and is a key driver in 70% of acute lymphoid and
over 35% of acute myeloid leukemias in infants.1–3 Pharmacological
amino-acid end by a tertbutyl-phenyl-urea group (Fig. 1). This
inhibitor, and analogs, reveal that important chemical modifica-
tions are tolerated at the homocysteine end of SAM, which can be
exploited to improve pharmacokinetics.4,5 Follow-up structural
analysis by Basavapathruni et al. and by us revealed that the pres-
ence of the tertbutyl-phenyl-urea group induced a dramatic
remodeling of the DOT1L catalytic site. Introduction of a bromine
on the adenosine scaffold improved IC50 from 0.5 to 0.3 nM, and
the effect on specificity was not characterized.6,7 Yao et al. identi-
fied more direct SAM analogs as specific inhibitors of DOT1L: (1)
while the reaction by-product S-adenosylhomocysteine (SAH)
binds with high affinity to numerous protein methyltransferases,8
and acts as SAM competitive inhibitor, increased selectivity was
achieved by alkylating the primary amine at the adenine ring of
SAH (see methyl-SAH in Fig. 1); (2) increased potency was obtained
through substitution at the homocysteine end, which induced
covalent binding to the substrate lysine.9 Unfortunately, no cellular
activity has been reported for these compounds, presumably owing
to their high hydrophilicity and poor cell penetrance.
inhibition of DOT1L as
a therapeutic strategy was recently
supported by the discovery of EPZ004777, a small molecule DOT1L
inhibitor that selectively kills mixed lineage leukemia (MLL) cells
and extends survival in
a
mouse MLL xenograft model.4
EPZ004777 competes with S-adenosylmethionine (SAM), the
cofactor shared by SAM-dependent methyltransferases including
lysine-, arginine-, DNA-, and small-molecule methyltransferases.
⇑
Corresponding author. Tel.: +1 416 978 3092; fax: +1 416 946 0880.
E-mail address: matthieu.schapira@utoronto.ca (M. Schapira).
These authors contributed equally to this work.
0968-0896/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.bmc.2013.01.049

1788
W. Yu et al. / Bioorg. Med. Chem. 21 (2013) 1787–1794
Figure 1. Structure of DOT1L inhibitors. All reported DOT1L inhibitors are mimetics of the cofactor by-product SAH. (a): Daigle et al.4; (b) Yao et al.9; (c) this work.
Here we demonstrate that bromination of the adenosine ring is
sufficient to engineer both potency and selectivity into SAH. The
accompanying structural analysis rationalizes this effect, and pro-
vides a framework for the development of improved inhibitors.
2. Results
2.1. BrSAH is a potent DOT1L inhibitor
DOT1L is one of three known protein lysine methyltransferases
(PKMT) that lack a catalytic SET domain, but are structurally re-
lated to protein arginine methyltransferases (PRMTs).10–12 Struc-
tural analysis indicates that the SAM binding site of DOT1L is
more enclosed and therefore more likely to be druggable than that
of other PKMTs.13 Since a common adenosine scaffold is shared by
the cofactor of methyltransferases and kinases, we screened a li-
brary of 3120 kinase inhibitors, assembled at the Structural
Genomics Consortium, by differential scanning fluorimetry (DSF)
Figure 2. BrSAH is a potent inhibitor of DOT1L. IC50 values for 5ITC, SAH and BrSAH
to find novel SAM-competitive inhibitors of DOT1L1. This screen,
and a virtual screen conducted previously (24 compounds selected,
8 compounds in stock and tested experimentally, Supplementary
Table 1), identified the kinase inhibitor 5-iodotubercidine
(5ITC—Fig. 1) as a potential DOT1L inhibitor.14,15 We found that
were determined (18.4, 0.6 and 0.077 lM respectively) at Km of SAM, using a
radioactivity based assay as described in Section 5.
replaced by a bromine to simplify chemical accessibility (Fig. 1).
BrSAH inhibited DOT1L methyltransferase activity with an IC50 va-
lue of 77 4 nM (Fig. 2). Recently published SAH analogs were also
designed to exploit the hydrophobic cleft juxtaposed to the cofac-
tor adenine ring.9 We note that these compounds, substituted at
the primary amine position of the adenine ring (e.g., methyl-SAH
Fig. 1), are less potent inhibitors than SAH with Ki values more than
double that reported for SAH.9 On the other hand, BrSAH is about 8
times more potent than SAH (the IC50 of SAH is 600 4 nM; Fig. 2).
We therefore conclude that a bulky hydrophobic group such as an
iodine or bromine substituent at the 7 position of the adenine ring
better exploits the DOT1L cofactor site.
5ITC stabilized DOT1L with a Tm shift of 2.5 °C at 50
lM. Follow-
up methyltransferase assay confirmed that 5ITC inhibits DOT1L
methyltransferase activity with an IC50 value of 18.2 2.1
(Fig. 2).
lM
Based on the chemical similarity between SAH and 5ITC, we
hypothesized that 5ITC was occupying the portion of the cofactor
site centered on the adenosine moiety of SAH. Superimposing
5ITC on the structure of SAH bound to DOT1L (PDB code 3qox) sug-
gested that (1) the iodine atom of 5ITC was occupied a hydropho-
bic cleft juxtaposed to the adenine ring, and significantly
contributed to the interaction, and (2) grafting the homocysteine
moiety of SAH on 5ITC would further enhance binding affinity.
To test this model, we synthesized N7-Bromo-deaza-S-adenosyl-
To verify the binding mode of BrSAH, we solved the DOT1L-
BrSAH co-crystal structure at 2.28 Å resolution (Supplementary
Table 2), and confirmed the overall similarity to the DOT1L–SAH
L-homocysteine (BrSAH), where the iodine present in 5ITC was

W. Yu et al. / Bioorg. Med. Chem. 21 (2013) 1787–1794
1789
Figure 3. Structure of DOT1L–BrSAH complex. BrSAH is buried in an enclosed pocket, and makes numerous hydrogen-bonds with surrounding polar residues, as previously
observed in the DOT1L-SAM complex12 (A,B). The bromine atom (magenta) is occupying a cleft formed by a cluster of hydrophobic side-chains (A,B). Superimposing our
structure of BrSAH with cofactor molecules co-crystallized with diverse methyltransferases shows that risks of cross-reactivity are low with SET domain PMTs, and moderate
with PRMTs, DNMTs and small-molecule methyltrasferases (C–F. See text for details). PDB codes are SETD7: 1o9s, PRMT3: 2fyt, DNMT1: 3pta, NNMT: 3rod. Molecular surface
coloring are green: hydrophobic, red: hydrogen-bond acceptors, blue: hydrogen-bond donor. Sticks color-code is blue: nitrogen, red: oxygen.
complex (RMSD of 0.5 Å). The bromine atom is located in a hydro-
phobic cavity composed of residues F245, V249, L224 and P133
(Fig. 3A and 3B).
groove and is engaged in a critical hydrogen-bond in all SET-do-
main PKMT structures.16 Introduction of a bulky group at this posi-
tion, such as a bromine, would break this hydrogen-bond, and
introduce unacceptable allosteric clashes in all SET domain PKMTs
(Fig. 3C). We confirmed experimentally that BrSAH is inactive
against the PKMTs MLL, EZH2 (present in the PRC2 complex),
EHMT2/G9a, EHMT1/GLP, SUV39H2, SETD7 and SETD8 (Fig. 4 and
Table 1).
2.2. BrSAH is selective for DOT1L
Structural analysis suggests that the bromide of BrSAH confers
selectivity towards DOT1L. First, it is located at the N7 position
of the adenine ring, a position that is facing the bottom of a binding
The observed specificity against PKMTs comes as no surprise,
but the cofactor binding sites of DOT1L, PRMTs, DNA methyltrans-
ferases (DNMTs) and small molecule methyltransferases are orga-
nized around the same SAM dependent MT-fold,17 and these
enzymes share a structurally similar cofactor binding domain
(Fig. 5). To further investigate possible cross-reactivity with these
classes of enzymes we characterized the effect of BrSAH on the cat-
alytic activities of PRMT3, PRMT5, DNMT1 and a small molecule
methyltransferase, nicotinamide-N-methyltransferase (NNMT).
Available structures suggest that BrSAH should have reduced
activity against PRMTs. The 7 position of the adenine ring is located
at the putative entrance of the cofactor pocket, next to a mobile al-
pha-X helix that can adopt diverse conformations depending on
the presence of cofactor and peptide substrate (Fig. 5A).18 It is
therefore likely that small structural rearrangements would be
necessary to accommodate the presence of a hydrophobic substitu-
ent at this position. However, none of the available PRMT struc-
tures present a cluster of hydrophobic residues as observed in
DOT1L (Fig. 3D), and the presence of a bromine should come at
an energetic cost. We confirmed experimentally that BrSAH was
about 25 times less active against PRMT3 and PRMT5
(IC50 = 2.3 lM) than DOT1L (Fig. 4 and Table 1).
Figure 4. Selectivity profile of BrSAH across
a panel of methyltransferases.
Inhibitory effect of BrSAH on lysine methyltransferases MLL1, EZH2 (PRC2
complex), EHMT2/G9a, GLP/EHMT1, SUV39H2, SETD7, SETD8, and protein arginine
methyltransferases PRMT3, PRMT5 as well as DNA-methyltransferase DNMT1 and
the small molecule methyltransferase NNMT were assessed as described in
materials and methods. BrSAH inhibited NNMT, DNMT1, PRMT3 and PRMT5 with
Superimposing BrSAH on the structure of SAH in complex with
DNMT1 places the bromine across the surface of the cofactor bind-
ing pocket, into the core of the protein structure, at a position par-
tially occupied by L1247, P1225, and next to F1145 (Fig. 3E). It is
unclear from the structure whether conformational rearrangements
IC50 values of 1.5, 1.9, 2.3, and 2.3 lM respectively.

1790
W. Yu et al. / Bioorg. Med. Chem. 21 (2013) 1787–1794
Figure 5. The SAM-dependant MT-fold is shared by non-SET domain methyltransferases. PRMTs (A), small-molecule methyltransferases (B), DOT1L (C), and DNMTs (D) share
a common SAM binding fold (dashed-line square). A structural element variable in length and geometry (orange), immediately upstream of this conserved fold, covers the
bound cofactor (cyan), contributes to formation of the site of methyl transfer (solid-line square), and to the recruitment of the methyl-accepting substrate (indicated in green
by the co-crystallized substrate in B). In the absence of cofactor (A) or in the absence of the cofactor’s homocysteine end (C), this element can adopt different conformations
(blue) that alter the binding pocket of SAM. The specificity of substrate recruitment and accuracy of substrate presentation relies on the nature of this critical and diverse
structural element. PDB codes: CARM1: 3b3f (orange), 3b3j (blue), COMT: 1vid, DOT1L; 1nw3 (orange), 3uwp (blue); DNMT: 3pta. (structurally diverse domains not
participating in cofactor binding were removed, and DNA substrate is not shown in D, for clarity).
Table 1
Finally, even though the design of BrSAH was derived from 5ITC,
Selectivity profile of BrSAH across a panel of
methyltransferases
a potent inhibitor of the protein kinase haspin and adenosine ki-
nase,14,15 addition of the homocysteine tail is likely to preclude
MTase
Ki (l
M)*
binding at ATP binding sites, and BrSAH is expected to be inactive
against kinases. We confirmed that no binding to the haspin
DOT1L
NNMT
DNMT1
PRMT3
PRMT5
MLL
PRC2
G9a
EHMT1
SUV39H2
SETD7
SETD8
0.038 0.002
0.75 0.05
0.95 0.1
1.15 0.1
1.15 0.15
No inhibition
No inhibition
No inhibition
No inhibition
No inhibition
No inhibition
No inhibition
catalytic domain was observed with 10
scanning fluorimetry (see Section 5).
lM BrSAH by differential
3. Discussion
We have established that BrSAH is a novel, potent and selective
DOT1L inhibitor. We note here that we were unable to find cellular
activity reported for any close SAH analog against any methyl-
transferase, even though biochemically active compounds were re-
ported in the literature.9,19 We attribute this liability—an
apparently general phenomenon—to the high polarity of SAH ana-
logs, which prevents crossing cell membranes. The discovery of
EPZ004777 as a potent SAM competitor teaches us an important
lesson: DOT1L tolerates significant chemical modifications at the
amino-acid end of the cofactor (Fig. 1). Together, these observa-
tions outline a strategy towards the development of improved
SAM-competitive inhibitors, where (1) addition of a bulky hydro-
phobic group such as a bromine or tri-fluoromethyl at the N7 posi-
tion of the adenine ring enhances potency, increases selectivity,
and reduces hydrophilicity of the adenosine moiety of SAH and
(2) chemical modifications at the homocysteine, such as the one
observed in EPZ004777, increase hydrophobicity at the amino-acid
end to further improve cell penetrance.
*
IC50 values were determined at cofactor
concentration equal to Km value for SAM for
each enzyme, and used to calculate Ki values
as described by Cer et al.29
of these hydrophobic residues that would be necessary to
accommodate the bromide are energetically acceptable. To explore
this possibility, we tested the ability of BrSAH to inhibit DNMT1, and
determined an IC50 of 1.9 lM (Fig. 4 and Table 1). This suggests that
binding of BrSAH to DNMT1 is accompanied by unfavorable
conformational strain. Superimposing BrSAH on a cofactor molecule
co-crystallized with the small molecule methyltransferase NNMT
highlights moderate steric clashes with A169 that may be accom-
modated by the enzyme at an energetic cost (Fig. 3F). We verified
Available structures clearly indicate the presence of a strong
electrostatic potential at the amino-acid end of the native cofactor
pocket that can only be satisfied with polar, and poorly bioavailable
that BrSAH inhibits NNMT with a moderate IC50 of 1.5
and Table 1).
lM (Fig. 4

W. Yu et al. / Bioorg. Med. Chem. 21 (2013) 1787–1794
1791
molecules. Overcoming this paradigm shared by SAM mimetics
appears particularly challenging. Yet, EPZ004777, a hydrophobic
SAM competitor that lacks the amino-acid moiety of the cofactor,
contradicts this paradigm, suggesting that the cofactor pocket
may adopt an altered conformation in the absence of the cofactor’s
homocysteine moiety. The recent crystal structures of DOT1L in
complex with 5ITC and EPZ004777 confirm this hypothesis (PDB
codes 3uwp and 4er3/4eki respectively): a large loop immediately
N-terminal to the conserved methyltransferase fold closes like a lid
on the cofactor (PDB code 1nw3), but adopts dramatically altered
conformations in the 5ITC and EPZ004777 complexes (Fig. 5C).6,7
This loop motion significantly alters the size and electrostatics of
the cofactor pocket, which may be sufficient to accommodate more
hydrophobic and cell penetrant SAM analogs. Interestingly, this
structural rearrangement observed in the DOT1L structure is
reminiscent of another structural rearrangement reported for
PRMTs: the alpha-X helix of CARM1, positioned at the N-terminus
of the conserved methyltransferase fold, closes like a lid on the
bound cofactor, but in the absence of SAM or SAH, this helix is
partially disordered, which again alters the geometry and electro-
statics of the cofactor pocket (Fig. 5A).18 Cell-penetrant SAM ana-
logs that exploit this altered geometry may be able to inhibit
CARM1 or other PRMTs.
protein was further purified by gel filtration (Superdex 200, GE
Healthcare).
5.2. Virtual screening
Receptor preparation: The DOT1L–SAM complex structure (PDB
code 1nw3) was used. The receptor was prepared with Maestro
Protein Preparation Wizard (Schrodinger, NY) using default set-
tings. One important structural water molecule W1025 was re-
tained and included during docking. Protonation states were set
at pH 7.4 using Epik. H-bond assignment was optimized by Protas-
sign, including exhaustive sampling and minimization of hydro-
gens of altered species at neutral pH. Water orientation was also
sampled for the conserved water molecule. The receptor was re-
fined during Impref minimization with RMSD = 0.3 Angstrom set
for heavy atoms convergence under OPLS2005 forcefield. A recep-
tor grid was centered on bound SAM. All hydroxyl groups accessi-
ble from the cofactor binding site were set rotatable.
Chemical library: the ZINC clean-drug-like set (downloaded on
January 13, 2011) containing 3.7 million commercially available
compounds was used as ligand library for docking. The library
was prepared with LigPrep (Schrodinger, NY) during which proton-
ation states of all ligands were set at pH 7.4 using Epik.
A sequential mechanism of substrate binding has been pro-
posed for SET-domain HKMTs, whereby cofactor binding is neces-
sary for proper folding of the Post-SET domain and formation of the
substrate binding groove.16 A striking parallel can be made for
PRMTs and DOT1L, where cofactor binding stabilizes the catalyti-
cally competent conformation of the secondary element (alpha-he-
lix in PRMTs, activation loop in DOT1L) immediately adjacent to
the conserved methyltransferase fold. Whether this similarity in
structural mechanism is driven by related evolutionary pressures
remains an open question.
Docking: The virtual screening was implemented in two consec-
utive steps using Schrodinger Glide Virtual Screening Workflow.
Initially, the whole 3.7-million-compound library was docked into
the receptor using Glide HTVS mode. The resulting top 100,000 li-
gands were retained for docking with Glide SP where six hydrogen
bond constraints were set based on previous analysis.13 N of F223,
N of K187, OE2 of E186, O of G163, O of water W1025, and O of
D161. The top 777 compounds satisfying at least 4 out of the six
constraints were retained and clustered based on their chemical
similarity. Twelve representatives of each cluster and 12 SAM ana-
logs occupying a previously identified hydrophobic cleft at Val249,
including 5ITC (docking score: ꢀ9.54), were selected for experi-
mental validation.
4. Conclusion
We have shown here that addition of a single halogen atom can
dramatically increase the potency of DOT1L inhibitors, and im-
prove their selectivity versus other lysine, arginine, DNA and small
molecule methyltransferases. The structural mechanism underly-
ing these improved properties was dissected. This discovery,
combined with chemical modifications at the homocysteine
end, provide a framework for future developments of DOT1L
inhibitors.
5.3. Differential scanning fluorimetry screening
Thermal denaturation experiments were carried out in
Mx3005p real-time PCR machine (Agilent) using a protein concen-
tration of 2 M and an inhibitor concentration of 10 M. Samples
a
l
l
were buffered in 10 mM HEPES, pH 7.5, 500 mM NaCl and a
1:1000 dilution of Sypro Orange (Invitrogen, CA). The assay and
data evaluation were carried out as previously described.20
5. Materials and methods
5.4. DOT1L methyltransferase assay
5.1. Protein expression and purification
The assay conditions reported by Daigle et al. were used with
minor modifications.4 Nucleosome purified from chicken blood
cells was used as substrate. Nucleosome (final concentration of
A construct of human DOT1L covering residues 1–420 was sub-
cloned into a modified pET28-MHL vector with an N-terminal His
tag. The protein was overexpressed in E. coli BL21 (DE3) V2R-
60 nM) was added into 20 ll assay mixture (20 nM Tris–HCl,
pRARE in Terrific Broth medium in the presence of 50
kanamycin and chloramphenicol. Cells were grown at 37 °C to an
OD600 of 1.5, induced by isopropyl-1-thio- -galactopyranoside
l
g/ml of
5 mM DTT, 10 mM MgCl2, 0.01% Triton X-100, 0.25 nM recombi-
nant DOT1L (1–420) with inhibitors at different concentrations
or DMSO as a control). The mixture was incubated at room temper-
ature for 30 min before 3H-SAM (Perkin–Elmer, catalog number
NET155001MC) was added to start the reaction (final concentra-
D
(IPTG, final concentration 1 mM) and incubated overnight at
15 °C. The cell pellets were frozen in liquid nitrogen and stored
at ꢀ80 °C. For purification, the cell paste was thawed and resus-
pended in lysis buffer with 1 mM phenylmethyl sulfonyl fluoride
(PMSF). DOT1L (1–420) was purified by Ni-NTA column (Qiagen)
and processed by TEV protease to remove the His tag. The protein
was then incubated in 50 mM Tris–HCl pH 8.0, 0.1 mg/ml BSA,
1 mM MgCl2 with benzonase nuclease for 2 h at room temperature.
Filtered protein sample was diluted with 50 mM K2HPO4/KH2PO4
pH 7.0, and further purified by HiTrap-SP (GE Healthcare). The
tion of 0.75
l
M). Reaction mixture was incubated at room temper-
l of 10%
ature for one hour and quenched by adding 160
l
trichloroacetic acid (TCA). The mixture was transferred into a glass
fiber filter plate (Millipore, catalog number MSFBN6B) and washed
twice with 10% TCA and once with ethanol. 100 ll Microscint Zero
(PerkinElmer, catalog number 6013611) was finally added into fil-
ter plates and centrifuged to flow through filters. Tritium incorpo-
ration was monitored using TopCount (PerkinElmer).

1792
W. Yu et al. / Bioorg. Med. Chem. 21 (2013) 1787–1794
5.5. Crystallization
(Perkin Elmer). The CPM counts in the absence of compound
for each data set were defined as 100% activity. The CPM counts
in the absence of the enzyme in each data set were defined as
background (0%). IC50 values were calculated with the software
SigmaPlot.
Purified protein DOT1L (1–420) was concentrated to 16 mg/mL
in a buffer containing 20 mM Tris–HCl pH 8.0, 200 mM NaCl, 1 mM
EDTA, and 1 mM TCEP. To prepare the complex, DOT1L (1–420)
was mixed with BrSAH by directly adding a 5-fold excess of com-
pound to the protein solution and crystallized by using the sitting
drop vapor diffusion method at 18 °C. Crystals of DOT1L with
BrSAH were grown in conditions containing 1.5 M (NH4)2SO4,
100 mM sodium acetate, pH 4.6. Prior to flash-freezing the crystals
in liquid nitrogen, the crystals were soaked in reservoir solution
with added glycerol (20%) as a cryoprotectant.
For DNMT1, the IC50 determination was performed as described
above by using dsDNA as a substrate. The dsDNA substrate was
prepared by annealing two complementary strands (biotinylated
forward strand: B-GAGCCCGTAAGCCCGTTCAGGTCG and reverse
strand: CGACCTGAACGGGCTTACGGGCTC), synthesized by Eurofins
MWG Operon. DNMT1 (100 nM) was incubated with dsDNA sub-
strate (100 nM), 3H-SAM (2
Tris–HCl, pH 8.0, 5 mM DTT, 0.01% Triton X-100) and the reactions
l
M, ꢁ60
lCi/ml) in buffer (20 mM
5.6. Diffraction data collection and model refinement
were incubated for 1 h at 37 °C before quenching.
Inhibition of methyltransferase activity of recombinant full-
length human NNMT was measured using SAHH-coupled assay.30
Diffraction data were collected at GM/CA collaborative access
team (GMCA-CAT) beamline 23ID-D of the Advanced Photon
The reaction mixture (15
l
L) consisted of 50 mM Tris–HCl, pH
nicotinamide, SAH hydrolase,
(Calbiochem), 0.5 NNMT and variable
M. The methyl-
Source, Argonne National Laboratory, at
a
wavelength of
7.5,
15
5
M
l
M
SAM, 150
l
M
5 lM
1.0332 Å. For the refinement data set, intensities from one hundred
consecutive single-degree oscillation frames were integrated with
DENZO and scaled with SCALEPACK.21 Amplitudes were derived
with the program TRUNCATE.22 The unit cell was isomorphous to
Protein Data Bank (PDB) entry 3QOW8 which provided initial coor-
dinates for refinement, as well as flags for cross-validation.23
Geometry restraints for BrSAH were calculated with PRODRG.24
The current model was deposited in the PDB after iterative geom-
etry validation on the MOLPROBITY server,25 re-building with
COOT26 and refinement with REFMAC.27
l
ThioGlo
1
lM
amount of BrSAH ranging between 0.1 and 100
l
ation reaction was followed by measuring the increase in fluores-
cence using Synergy 4 microplate reader (BioTek) with 360/40 nm
excitation filter and 528/20 nm emission filter for 30 min in
384-well plate format. Reaction rates were calculated from the
initial linear slopes using Gen5 Software (BioTek). Data was con-
verted to percent activity, assuming 100% activity in the absence
of BrSAH. IC50 values were calculated using a four parameter
logistic equation using Sigma Plot software (Systat Software).
Standard deviations were calculated from three independent
experiments.
5.7. Selectivity assays
Selectivity assays for histone methyltransferases (HMTs) were
performed as described by Siarheyeva et al.28 Selectivity experi-
ments for compounds using different HMTs (G9a, EHMT1,
SUV39H2, PRMT3, SETD7, SETD8, and PRMT5-MEP50, PRC2 and
MLL1 complexes) were performed by monitoring the incorpora-
tion of tritium-labeled methyl group to lysine or arginine residues
of peptide substrates using scintillation proximity assay (SPA).
The enzymatic reactions were conducted in triplicate at room
5.8. Chemistry
All oxygen and/or moisture sensitive reactions were carried out
under N2 atmosphere in glassware purged with N2 prior to use. All
reagents and laboratory grade solvents were purchased from com-
mercial vendors and used as received, without further purification.
Nuclear Magnetic Resonance (NMR) spectra were recorded on a
Bruker Avance-III 500 MHz spectrometer (500 MHz 1H, 125 MHz
13C). Proton chemical shifts are reported in ppm (d) referenced to
the NMR solvent; DMSO-d6 (2.50 ppm for 1H) or D2O (4.79 ppm
for 1H). Data are reported as follows: chemical shifts (d), multiplic-
ity (br = broad, s = singlet, d = doublet, t = triplet, q = quartet,
quint = quintuplet, m = multiplet); coupling constant(s) (J) in Hz;
integration; assignment. Unless otherwise noted, NMR data were
collected at 25 °C. Flash column chromatography was performed
using a Biotage SP1 system fitted with a KP-SIL SNAP Silica Gel
(60 Å mesh) Flash Cartridge (FSKO-1107). Purity determination
was conducted by UV absorbance at 254 nm during Tandem Liquid
temperature with 1 h incubation of a 20 ll reaction mixture in
20 mM Tris–HCl, pH 8.0, 5 mM DTT, and 0.01% Triton X-100 con-
taining 3H-SAM (Cat. # NET155V250UC; Perkin Elmer), around Km
value for each enzyme (G9a, 8
l
l
M; EHMT1, 8
M ; SETD8, 60
M and MLL1, 2 M). Protein concentra-
l
M; SUV39H2,
3
lM; PRMT3, 14
lM; SETD7, 2
l
M; PRMT5-
MEP50, 2
l
M; PRC2, 2
l
l
tion in the assay for each HMT was as follows: G9a (5 nM),
EHMT1 (5 nM), SUV39H2 (20 nM), PRMT3 (100 nM), SETD7
(20 nM), SETD8 (50 nM), PRMT5-MEP50 (15 nM), PRC2 (20 nM),
and MLL1 (500 nM). Corresponding biotinylated peptides (H3
(1–25) for G9a, EHMT1, SUV39H2, SETD7 and MLL1 complex;
H3 (21–44) for PRC2 complex; H4 (1–24) for PRMT3 and SETD8)
were used at about five times the Km value for each enzyme (G9a,
Chromatography/Mass Spectrometry (LCMS) using
a Waters
Acquity separations module. Identity was determined via low-res-
olution mass spectra (LRMS) acquired in positive ion mode using a
Waters Acquity SQD mass spectrometer (electrospray ionization
source) fitted with a PDA detector. Mobile phase A consisted of
0.01% formic acid in water, while mobile phase B consisted of
0.01% formic acid in acetonitrile. The gradient ran from 5% to
95% mobile phase B over 5 minutes at 0.7 mL/min. An Acquity
0.8
SETD7, 2
plex, 1
mined using compound concentrations ranging from 100 nM to
100 M. Since all assays were performed at cofactor concentra-
l
M; EHMT1, 0.6
M; SETD8, 40
M; and MLL1 complex, 2
l
M; SUV39H2, 0.5
M; PRMT5-MEP50, 120 nM; PRC2 com-
M). IC50 values were deter-
lM; PRMT3, 0.6 lM;
l
l
l
l
l
tion equal to Km values for SAM, Ki values were calculated as
CSH C18, 1.7
perature maintained at 25 °C. The sample solution injection vol-
ume was 5 L. Analytical thin-layer chromatography (TLC) was
l
m, 2.1 ꢂ 50 mm column was used with column tem-
IC50/2 as described by Cer et al.29 To stop the enzymatic reactions,
20
ll of 7.5 M Guanidine hydrochloride was added, followed by
l
180
l
l of buffer (20 mM Tris, pH 8.0), mixed and then transferred
performed on aluminum sheets, silica gel 60 F254 (0.2 mm, VWR
International, Darmstadt, Germany). Visualization was accom-
plished with UV light and aqueous potassium permanganate
(KMnO4) stain followed by heating.
to a 96-well Flashplate (Cat.# SMP103; Perkin Elmer). After mix-
ing, the reaction mixtures in Flashplate were incubated for 1 h
and the CPM counts were measured using Topcount plate reader

W. Yu et al. / Bioorg. Med. Chem. 21 (2013) 1787–1794
1793
Cl
N
Br
Cl
N
Br
Cl
N
A
BzO
Br
N
OAc
O
N
BSA
MeCN, rt
TMSOTf
BzO
N
+
N
MeCN, 80 °C
O
N
N
63%
OBz OBz
H
Me3Si
OBz OBz
1
NH3/MeOH
120 °C
B
40%
NH2
N
NH2
NH2
Br
Br
Br
D
C
O
N
(DL)-Homocysteine
N
or (L)-Homocysteine
SOCl2
S
Cl
HO
*
HO
N
N
O
N
N
N
N
NaOH/H2O, 80 °C
HMPA, rt
O
O
NH2
61%
OH OH
OH OH
OH OH
4a (DL), 13%
4b (L), 9%
2
3
Steps A and B are adapted from Seela et al.31 Additional infor-
was then cooled to rt, and the solvent evaporated under reduced
pressure to afford the crude nucleoside. Purification by flash column
chromatography (silica gel, 5–15% MeOH/CH2Cl2 gradient) provided
(2) as an off-white solid (179 mg, 40%). TLC (silica gel, CH2Cl2/MeOH
6:1): Rf = 0.35. 1H NMR (500 MHz, DMSO-d6) d: 8.10 (s, 1H, 6-H);
7.66 (s, 1H, 2-H); 6.81 (br s, 2H, 4-NH2); 6.05 (d, J = 6.0 Hz, 1H, 10-
H); 5.32 (d, J = 6.2 Hz, 1H, 20-OH); 5.15 (d, J = 5.4 Hz, 1H, 30-OH);
5.11 (d, J = 4.7 Hz, 1H, 50-OH); 4.35 (m, 1H, 20-H); 4.07 (m, 1H, 30-
H); 3.89 (m, 1H, 40-H); 3.62 (m, 1H, 50-H); 3.54 (m, 1H, 50-H). LRMS
(ESI): 346.2 and 344.4 [M+H]+.
mation relating to the characterization of reported compounds
(1) and (2) can be found therein.
Steps C and D are adapted from Lim et al.32
Cl
Br
N
BzO
N
N
O
OBz OBz
NH2
Br
1
N
Step A: (2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(5-bromo-4-chloro-
7H-pyrrolo[2,3-d]pyrimidin-7-yl)tetra-hydrofuran-3,4-diyl dibenzoate
(1). N,O-Bis(trimethylsilyl)acetamide (BSA, 0.56 mL, 2.27 mmol)
was added to a stirred suspension of 5-bromo-4-chloro-7H-pyrrol-
o[2,3-d]pyrimidine (480 mg, 2.06 mmol) in dry acetonitrile
(15 mL). After stirring at rt for 10 min, 1-O-acetyl-2,3,5-tri-O-ben-
Cl
N
N
O
OH OH
3
zoyl-b-D-ribofuranose (1.16 g, 2.31 mmol) was added, followed by
Step C: (2R,3R,4R,5R)-2-(4-amino-5-bromo-7H-pyrrolo[2,3-d]pyrimi-
din-7-yl)-5-(chloromethyl)tetra-hydrofuran-3,4-diol (3). A solution
of (2R,3R,4R,5R)-2-(4-Amino-5-bromo-7H-pyrrolo[2,3-d]pyrimidin-
7-yl)-5-(hydroxymethyl)tetrahydrofuran-3,4-diol (2) (160 mg,
0.463 mmol) in hexamethylphosphoramide (2 mL) was cooled to
0 °C. Thionyl chloride (0.202 mL, 2.78 mmol) was added dropwise
with stirring, and after 10 min, the solution was warmed to rt and
stirred a further 18 h. Following dilution with water (5 mL) and
adjustment to pH 8 with aqueous NaOH solution (1 M), the aqueous
layer was extracted with EtOAc (3 ꢂ 5 mL). The combined organic
extracts were dried (Na2SO4), filtered, and concentrated under re-
duced pressure to afford the crude nucleoside. This material was
then dissolved in CH2Cl2 and triturated with hexanes to produce a
precipitate. The precipitate was collected by filtration, providing
pure (3) as an off-white solid (102 mg, 61%). TLC (silica gel,
CH2Cl2/MeOH 6:1): Rf = 0.45. LRMS (ESI): 362.1, 364.0 and 365.9
[M+H]+.
the addition of trimethylsilyl trifluoromethanesulfonate (0.41 mL,
2.25 mmol). The reaction mixture was stirred at rt for 15 min, after
which the flask was transferred to a preheated 80 °C oil bath. After
stirring for 1 h at 80 °C, the reaction mixture was cooled to rt and
diluted with EtOAc (75 mL). The organic phase was sequentially
washed with aqueous saturated NaHCO3 solution and brine, dried
(Na2SO4), filtered, and concentrated under reduced pressure to af-
ford the crude nucleoside. Purification by flash column chromatog-
raphy (silica gel, 20–100% EtOAc/hexanes gradient) provided (1) as
a colorless foam (870 mg, 63%). TLC (silica gel, hexanes/ethyl ace-
tate 3:1): Rf = 0.45. LRMS (ESI): 677.3, 675.2 and 673.2 [M+H]+.
NH2
Br
N
HO
N
N
O
NH2
N
NH2
N
Br
OH OH
Br
2
O
O
S
S
HO
N
Step B: (2R,3R,4R,5R)-2-(4-Amino-5-bromo-7H-pyrrolo[2,3-d]pyrimi-
din-7-yl)-5-(hydroxymethyl)tetra-hydrofuran-3,4-diol (2). A solution
of (2R,3R,4R,5R)-2-(benzoyloxymethyl)-5-(5-bromo-4-chloro-7H-
pyrrolo[2,3-d]pyrimidin-7-yl)tetrahydrofuran-3,4-diyl dibenzoate
(1) (870 mg, 1.29 mmol) in methanolic ammonia (7 N, 55 mL) was
heated at 120 °C in a screw-cap pressure flask for 2 h. The mixture
HO
N
N
N
O
O
NH2
NH2
OH OH
4a
OH OH
4

1794
W. Yu et al. / Bioorg. Med. Chem. 21 (2013) 1787–1794
2. Muntean, A. G.; Hess, J. L. Annu. Rev. Pathol. 2012, 7, 283.
Step D: (DL)- and (L)-2-Amino-4-(((2S,3S,4R,5R)-5-(4-amino-5-bromo-
3. Nguyen, A. T.; Taranova, O.; He, J.; Zhang, Y. Blood 2011, 117, 6912.
4. Daigle, S. R.; Olhava, E. J.; Therkelsen, C. A.; Majer, C. R.; Sneeringer, C. J.; Song,
J.; Johnston, L. D.; Scott, M. P.; Smith, J. J.; Xiao, Y.; Jin, L.; Kuntz, K. W.;
Chesworth, R.; Moyer, M. P.; Bernt, K. M.; Tseng, J. C.; Kung, A. L.; Armstrong, S.
A.; Copeland, R. A.; Richon, V. M.; Pollock, R. M. Cancer Cell 2011, 20, 53.
5. Anglin, J. L.; Deng, L.; Yao, Y.; Cai, G.; Liu, Z.; Jiang, H.; Cheng, G.; Chen, P.; Dong,
S.; Song, Y. J. Med. Chem. 2012, 55, 8066.
7H-pyrrolo[2,3-d]pyrimidin-7-yl)-3,4-dihydroxy-tetrahydrofuran-2-
yl)methylthio)butanoic acid (4a and 4b). To a solution of DL- or
L
-homocysteine (26 mg, 0.19 mmol) in 1 N NaOH/H2O (0.60 mL)
was added (2R,3R,4R,5R)-2-(4-amino-5-bromo-7H-pyrrolo[2,3-
d]pyrimidin-7-yl)-5-(chloromethyl)tetrahydrofuran-3,4-diol (3)
(50 mg, 0.14 mmol) and KI (10 mg). The reaction mixture was stir-
red vigorously at 80 °C for 2 h, cooled to rt, and applied to a column
(1 ꢂ 15 cm) of Amberlite XAD-4 ion exchange resin. The column
was washed [0.2 N NH4OAc (30 mL); H2O (20 mL)] and eluted
[H2O (20 mL); ethanol (30 mL)] to afford 4a or 4b as an off-white
solid (8 mg, 13% for 4a and 6 mg, 9% for 4b). 1H NMR (500 MHz,
D2O) d; 7.89 (s, 1H, 6-H); 7.25 (s, 1H, 2-H); 6.01 (m, 1H, 10-H);
6. Basavapathruni, A.; Jin, L.; Daigle, S. R.; Majer, C. R.; Therkelsen, C. A.; Wigle, T.
J.; Kuntz, K. W.; Chesworth, R.; Pollock, R. M.; Scott, M. P.; Moyer, M. P.; Richon,
V. M.; Copeland, R. A.; Olhava, E. J. Chem. Biol. Drug Des. 2012, 80, 971.
7. Yu, W.; Chory, E. J.; Wernimont, A. K.; Tempel, W.; Scopton, A.; Federation, A.;
Marineau, J. J.; Qi, J.; Barsyte-Lovejoy, D.; Yi, J.; Marcellus, R.; Iacob, R. E.; Engen,
J. R.; Griffin, C.; Aman, A.; Wienholds, E.; Li, F.; Pineda, J.; Estiu, G.; Shatseva, T.;
Hajian, T.; Al-Awar, R.; Dick, J. E.; Vedadi, M.; Brown, P. J.; Arrowsmith, C. H.;
Bradner, J. E.; Schapira, M. Nat. Commun. 2012, 3, 1288.
8. Richon, V. M.; Johnston, D.; Sneeringer, C. J.; Jin, L.; Majer, C. R.; Elliston, K.;
Jerva, L. F.; Scott, M. P.; Copeland, R. A. Chem. Biol. Drug Des. 2011, 78, 199.
9. Yao, Y.; Chen, P.; Diao, J.; Cheng, G.; Deng, L.; Anglin, J. L.; Prasad, B. V.; Song, Y.
J. Am. Chem. Soc. 2011, 133, 16746.
10. Kernstock, S.; Davydova, E.; Jakobsson, M.; Moen, A.; Pettersen, S.;
Maelandsmo, G. M.; Egge-Jacobsen, W.; Falnes, P. O. Nat. Commun. 2012,
1038, 3.
11. Magnani, R.; Dirk, L. M.; Trievel, R. C.; Houtz, R. L. Nat. Commun. 2010, 1, 43.
12. Min, J.; Feng, Q.; Li, Z.; Zhang, Y.; Xu, R. M. Cell 2003, 112, 711.
13. Campagna-Slater, V.; Mok, M. W.; Nguyen, K. T.; Feher, M.; Najmanovich, R.;
Schapira, M. J. Chem. Inf. Model. 2011, 51, 612.
4.75 (m, 1H, 20-H); 4.45 (m, 1H, 30-H); 4.22 (m, 1H,
a
-H); 4.19 (m,
1H, 40-H); 3.70 (m, 2H, 50-H); 2.60 (br t, 2H,
c-H); 2.11 (m, 2H, b-
H). LRMS (ESI): 463.0 and 461.1 [M+H]+.
6. Accession codes
The coordinates and structure factors for human DOT1L in com-
plex with BrSAH have been deposited in the Protein Data Bank
(PDB) with accession number 3sx0.
14. Eswaran, J.; Patnaik, D.; Filippakopoulos, P.; Wang, F.; Stein, R. L.; Murray, J. W.;
Higgins, J. M.; Knapp, S. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 20198.
15. Ugarkar, B. G.; DaRe, J. M.; Kopcho, J. J.; Browne, C. E.; Schanzer, J. M.; Wiesner,
J. B.; Erion, M. D. J. Med. Chem. 2000, 43, 2883.
Acknowledgements
16. Schapira, M. Curr. Chem. Genomics 2011, 5, 85.
17. Martin, J. L.; McMillan, F. M. Curr. Opin. Struct. Biol. 2002, 12, 783.
18. Troffer-Charlier, N.; Cura, V.; Hassenboehler, P.; Moras, D.; Cavarelli, J. EMBO J.
2007, 26, 4391.
19. Dowden, J.; Hong, W.; Parry, R. V.; Pike, R. A.; Ward, S. G. Bioorg. Med. Chem.
Lett. 2010, 20, 2103.
20. Niesen, F. H.; Berglund, H.; Vedadi, M. Nat. Protoc. 2007, 2, 2212.
21. Otwinowski, Z.; Minor, W. Macromol. Crystallogr. 1997, 276, 307.
22. French, S.; Wilson, K. Acta Crystallogr., Sect. A 1978, 34, 517.
23. Brunger, A. T. Nature 1992, 355, 472.
24. Schuttelkopf, A. W.; van Aalten, D. M. F. Acta Crystallogr., Sect. D: Biol.
Crystallogr. 2004, 60, 1355.
25. Chen, V. B.; Arendall, W. B.; Headd, J. J.; Keedy, D. A.; Immormino, R. M.; Kapral,
G. J.; Murray, L. W.; Richardson, J. S.; Richardson, D. C. Acta Crystallogr., Sect. D:
Biol. Crystallogr. 2010, 66, 12.
26. Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K. Acta Crystallogr., Sect. D: Biol.
Crystallogr. 2010, 66, 486.
27. Murshudov, G. N.; Skubak, P.; Lebedev, A. A.; Pannu, N. S.; Steiner, R. A.;
Nicholls, R. A.; Winn, M. D.; Long, F.; Vagin, A. A. Acta Crystallogr., Sect. D: Biol.
Crystallogr. 2011, 67, 355.
28. Siarheyeva, A.; Senisterra, G.; Allali-Hassani, A.; Dong, A.; Dobrovetsky, E.;
Wasney, G. A.; Chau, I.; Marcellus, R.; Hajian, T.; Liu, F.; Korboukh, I.; Smil, D.;
Bolshan, Y.; Min, J.; Wu, H.; Zeng, H.; Loppnau, P.; Poda, G.; Griffin, C.; Aman,
A.; Brown, P. J.; Jin, J.; Al-Awar, R.; Arrowsmith, C. H.; Schapira, M.; Vedadi, M.
Structure 2012, 20, 1425.
We thank Dr. Amy K. Wernimont for her review of the crystal
structure and Dr. Ekaterina Kuznetsova for providing chicken
nucleosome and NNMT assay. The Structural Genomics Consor-
tium is a registered charity (number 1097737) that receives funds
from Canadian Institutes of Health Research, Eli Lilly Canada, Gen-
ome Canada, GlaxoSmithKline, the Ontario Ministry of Economic
Development and Innovation, the Novartis Research Foundation,
Pfizer, AbbVie, Takeda and the Wellcome Trust. C.H.A. holds a Can-
ada Research Chair in Structural Genomics. GM/CA CAT has been
funded in whole or in part with Federal funds from the National
Cancer Institute (Y1-CO-1020) and the National Institute of Gen-
eral Medical Sciences (Y1-GM-1104). The Ontario Institute for Can-
cer Research is funded by the Government of Ontario through the
Ministry of Economic Development and Innovation. Use of the Ad-
vanced Photon Source was supported by the U. S. Department of
Energy, Office of Science, Office of Basic Energy Sciences, under
Contract No. DE-AC02-06CH11357.
Supplementary data
29. Cer, R. Z.; Mudunuri, U.; Stephens, R.; Lebeda, F. J. Nucleic Acids Res. 2009, 37,
W441.
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2013.01.049.
30. Allali-Hassani, A.; Wasney, G. A.; Siarheyeva, A.; Hajian, T.; Arrowsmith, C. H.;
Vedadi, M. J. Biomol. Screen. 2011, 17, 71.
31. Seela, F.; Ming, X. Tetrahedron 2007, 63, 9850.
32. Lim, J.; Winkler, W. C.; Nakamura, S.; Scott, V.; Breaker, R. R. Angew. Chem., Int.
Ed. 2006, 45, 964.
References and notes
1. Bernt, K. M.; Zhu, N.; Sinha, A. U.; Vempati, S.; Faber, J.; Krivtsov, A. V.; Feng, Z.;
Punt, N.; Daigle, A.; Bullinger, L.; Pollock, R. M.; Richon, V. M.; Kung, A. L.;
Armstrong, S. A. Cancer Cell 2011, 20, 66.