Synthesis and structure-activity relationship (SAR) of 2-methyl-4-oxo-3- oxetanylcarbamic acid esters, a class of potent N-acylethanolamine acid amidase (NAAA) inhibitors

Article

pubs.acs.org/jmc

Synthesis and Structure−Activity Relationship (SAR) of 2‑Methyl-4-

oxo-3-oxetanylcarbamic Acid Esters, a Class of Potent

N‑Acylethanolamine Acid Amidase (NAAA) Inhibitors

Stefano Ponzano,^†Fabio Bertozzi,^†Luisa Mengatto,^†Mauro Dionisi,^†Andrea Armirotti,^†Elisa Romeo,^†

Anna Berteotti,^†Claudio Fiorelli,^†Glauco Tarozzo,^†Angelo Reggiani,^†Andrea Duranti,^‡Giorgio Tarzia,^‡

Marco Mor,^§Andrea Cavalli,^†,#Daniele Piomelli,*^,†,∥and Tiziano Bandiera*^,†

^†Drug Discovery and Development, Istituto Italiano di Tecnologia, Via Morego 30, I-16163 Genova, Italy

^‡Dipartimento di Scienze Biomolecolari, Universita

^§Dipartimento di Farmacia, Universita

̀

degli Studi di Urbino “Carlo Bo”, Piazza del Rinascimento 6, I-61029 Urbino, Italy

degli Studi di Parma, Viale delle Scienze 27/A, I-43124 Parma, Italy

^#Department of Pharmaceutical Sciences, University of Bologna, Via Belmeloro 6, I-40126, Bologna, Italy

̀

^∥Department of Anatomy and Neurobiology, Pharmacology and Biological Chemistry, University of California, Irvine, California

92697-4625, United States

S

* Supporting Information

ABSTRACT: N-Acylethanolamine acid amidase (NAAA) is a

lysosomal cysteine hydrolase involved in the degradation of

saturated and monounsaturated fatty acid ethanolamides

(FAEs), a family of endogenous lipid agonists of peroxisome

proliferator-activated receptor-α, which include oleoylethano-

lamide (OEA) and palmitoylethanolamide (PEA). The β-

lactone derivatives (S)-N-(2-oxo-3-oxetanyl)-3-phenylpropionamide (2) and (S)-N-(2-oxo-3-oxetanyl)-biphenyl-4-carboxamide

(3) inhibit NAAA, prevent FAE hydrolysis in activated inﬂammatory cells, and reduce tissue reactions to pro-inﬂammatory

stimuli. Recently, our group disclosed ARN077 (4), a potent NAAA inhibitor that is active in vivo by topical administration in

rodent models of hyperalgesia and allodynia. In the present study, we investigated the structure−activity relationship (SAR) of

threonine-derived β-lactone analogues of compound 4. The main results of this work were an enhancement of the inhibitory

potency of β-lactone carbamate derivatives for NAAA and the identiﬁcation of (4-phenylphenyl)-methyl-N-[(2S,3R)-2-methyl-4-

oxo-oxetan-3-yl]carbamate (14q) as the ﬁrst single-digit nanomolar inhibitor of intracellular NAAA activity (IC₅₀= 7 nM on

both rat NAAA and human NAAA).

antagonists.^12,13The possibility that PEA might attenuate skin

INTRODUCTION

■

inﬂammation and neuropathic pain in humans heightens the

The ethanolamides of long-chain fatty acids, or fatty acid

translational value of the results outlined above.^14,15

ethanolamides (FAEs), are a class of bioactive lipids that serve

Tissue levels of bioactive FAEs are regulated at both the

important signaling functions in both plants and animals.¹

synthesis and degradation levels.¹These compounds are

Polyunsaturated FAEs such as arachidonoylethanolamide

generated by the action of a selective phospholipase D, which

(anandamide) are endogenous agonists for G protein-coupled

catalyzes the cleavage of the membrane precursor, N-

cannabinoid receptors and participate in the control of stress-

acylphosphatidylethanolamine (NAPE),¹⁶and are deactivated

coping responses and pain initiation.²On the other hand,

by either of two intracellular lipid amidases: fatty acid amide

monounsaturated and saturated FAEs, such as oleoylethanola-

hydrolase (FAAH) and N-acylethanolamine acid amidase

mide (OEA) and palmitoylethanolamide (PEA), regulate

energy balance, pain, and inﬂammation primarily by engaging

(NAAA).¹⁷⁻¹⁹NAAA preferentially hydrolyzes PEA and OEA

over anandamide, whereas FAAH displays an opposite substrate

peroxisome proliferator-activated receptor-α (PPAR-α), a

selectivity.^18,20Whereas several classes of FAAH inhibitors have

been reported in the literature, only a few NAAA inhibitors

have been identiﬁed so far.²¹⁻²⁸

member of the nuclear receptor superfamily.³⁻⁶

The pharmacology of PEA has been extensively investigated.⁷

The compound inhibits peripheral inﬂammation and mast cell

degranulation^8,9and exerts profound antinociceptive eﬀects in

rat and mouse models of acute and chronic pain.^3,9−11

Moreover, it suppresses pain behaviors induced, in mice, by

tissue injury, nerve damage, or inﬂammation.¹²These proper-

ties are dependent on PPAR-α activation, because they are

absent in PPAR-α-deﬁcient mice and blocked by PPAR-α

NAAA is a cysteine hydrolase that belongs to the N-terminal

nucleophile (Ntn) family of enzymes^18,19and bears a signiﬁcant

degree of sequence homology with the choloylglycine hydro-

Received: May 17, 2013

A

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 1. Noncompetitive β-lactone-based inhibitors of intracellular NAAA activity.

Scheme 1. General Synthetic Pathways for the Preparation of 2-Methyl-4-oxo-3-oxetanylcarbamic Acid Esters

lases, which are characterized by the ability to cleave

nonpeptide amide bonds.²⁹Like other Ntn enzymes, NAAA

is activated by autoproteolysis, which occurs at acidic pH and

generates a catalytically competent form of the enzyme.³⁰Site-

directed mutagenesis experiments have unequivocally identiﬁed

Cys131 (in mice) and Cys126 (in humans) as the catalytic

residues responsible for both autoproteolysis and FAE

hydrolysis.^23,31−33

prevented carrageenan-induced decrease of FAE levels in vivo

with a potency that paralleled its ability to inhibit NAAA in

vitro.²⁵A ﬁrst investigation of threonine-derived β-lactone

derivatives, which have enhanced chemical stability compared

to their serine-derived analogues,^28,35,36led to the discovery of

ARN077 (4, Figure 1), a potent NAAA inhibitor^28,37that is

active in vivo by topical administration in rodent models of

hyperalgesia and allodynia caused by inﬂammation or nerve

damage.

In the present study, we describe a further expansion of the

SAR on threonine-derived β-lactones. We synthesized and

tested a series of 2-methyl-4-oxo-3-oxetanylcarbamic acid esters

to investigate the inﬂuence on NAAA inhibition of the size and

shape of the carbamic acid ester side chain.

Compounds containing chemical groups susceptible to

nucleophilic attack, such as a β-lactone moiety, are known to

inhibit enzymes that contain a catalytic cysteine.³⁴Within this

class of compounds, (S)-2-oxo-3-oxetanyl-carbamic acid benzyl

ester (1, Figure 1), an inhibitor of a viral cysteine hydrolase,³⁵

was found to inhibit NAAA activity with micromolar potency.²⁴

Replacement of the carbamic acid benzyl ester function of 1

with a 3-phenylpropionamide moiety led to (S)-N-(2-oxo-3-

oxetanyl)-3-phenylpropionamide [2, (S)-OOPP, Figure 1], a

CHEMISTRY

■

The synthesis of the 2-methyl-4-oxo-3-oxetanylcarbamic acid

esters 14a−s and 19−22 was carried out following the synthetic

pathways represented in Scheme 1. First, alcohols 5 were

converted into the corresponding chloroformates (6),

imidazole 1-carboxylates (7), or 2-pyridyl carbonates (8) and

2-oxopyridine-1-carboxylates (9). Then, compounds 6−9 were

reacted either with (2S,3R)-2-methyl-4-oxo-3-oxetanylammo-

nium toluene-4-sulfonate (13) to give the desired ﬁnal

compounds (path A) or with the commercially available

threonines 10a−d (path B) to furnish the intermediate α-

substituted-β-hydroxycarboxylic acids 15a−h,j,k,n,o,r and 16−

18, which upon cyclization aﬀorded the corresponding 2-

methyl-4-oxo-3-oxetanylcarbamic acid esters.

relatively potent NAAA inhibitor (IC₅₀= 0.42 μM).²⁴

A

pharmacological characterization of 2 showed that this

compound prevents FAE hydrolysis in activated inﬂammatory

cells and dampens tissue reactions to various pro-inﬂammatory

stimuli.²⁴In addition, compound 2 does not inhibit FAAH or

other lipid hydrolases, such as monoacylglycerol lipase and

diacylglycerol lipase type-α, a selectivity proﬁle that allows its

use as a pharmacological probe. Structure−activity relationship

(SAR) studies of serine-derived 2-oxo-3-oxetanyl amides

conﬁrmed the key role of the β-lactone ring for NAAA

inhibition and identiﬁed lipophilic side chains of the

carboxamide moiety with optimal size and shape for potent

enzyme inhibition. This work led to the identiﬁcation of the

NAAA inhibitor 3 (Figure 1; IC₅₀= 0.115 μM), which

The preparation of compounds 6−9 was accomplished as

reported in Scheme 2. Chloroformate 6b was prepared by

B

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

from di-2-pyridyl carbonate (DPC), to be reacted with

compounds 10a−d or 13. DPC is reported to activate primary,

secondary, and tertiary alcohols as alkyl 2-pyridyl carbonates

and, as described in the literature, the pyridyl moiety makes

these mixed carbonates highly reactive species toward amino

acids.^39,40

Scheme 2. Synthetic Pathways for the Preparation of

Compounds 6−9

a

Alcohols 5a,d,f,g,i−t were therefore reacted with DPC in the

presence of triethylamine to give an isomeric mixture of 2-

pyridyl carbonates 8a,d,f,g,i−t and 2-oxopyridine-1-carboxy-

lates 9a,d,f,g,i−t (Scheme 2, path c).^41,42The mixture of

isomers was used as such in the following synthesis step, as the

limited stability of both compounds to chromatographic

puriﬁcation prevented the isolation of the pure products.

The synthesis of the tosylate salt 13 was carried out with a

minor modiﬁcation of the previously reported procedure

(Scheme 3).^25,35According to path A of Scheme 1, 2-methyl-

4-oxo-3-oxetanylcarbamic acid esters were obtained in moder-

ate yields (17−41%) by coupling the tosylate salt 13 with a

large excess (3 equiv) of the isomeric mixture containing the

suitable 2-pyridyl carbonates 8i,l,m,p,q,s and the 2-oxopyridine-

1-carboxylates 9i,l,m,p,q,s (Scheme 3, step d).

More 2-methyl-4-oxo-3-oxetanylcarbamic acid ester ana-

logues were prepared according to path B of Scheme 1, as

detailed in Scheme 4. ^D-Threonine (10a) was reacted with

chloroformates 6b,e,h (procedure a), imidazole 1-carboxylates

7c (procedure b), or the isomeric mixtures containing the 2-

pyridyl carbonates 8a,d,f,g,j,k,n,o,r and the 2-oxopyridine-1-

carboxylates 9a,d,f,g,j,k,n,o,r (procedure c) to aﬀord the

corresponding α-substituted β-hydroxycarboxylic acids15a−

h,j,k,n,o,r.

When procedure c was applied, a slight excess (1.5 equiv) of

the isomeric mixtures containing 8 and 9 was required, leading

to intermediates 15 in higher yields (36−97%) compared to

that observed in the reaction with 13.

Compounds 15 were submitted to a cyclization reaction

using diﬀerent coupling reagents [2-(1H-benzotriazol-1-yl)-

1,1,3,3-tetramethylaminium hexaﬂuorophosphate (HBTU),

benzotriazol-1-yloxytris(pyrrolidino)phosphonium hexaﬂuoro-

phosphate (PyBOP), or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetra-

methylaminium tetraﬂuoroborate (TBTU)] to aﬀord the

a

Reagents and conditions: (a) 5b, (Cl₃CO)₂CO, pyridine, toluene,

room temperature, 16 h; (b) 5c, CDI, DMF, room temperature, 2 h;

(c) 5a,d,f,g,i−t, Et₃N or DMAP, DPC, CH₂Cl₂, room temperature, 15

h.

reacting 3-phenylpropan-1-ol (5b) with triphosgene in the

presence of pyridine. Imidazole 1-carboxylate 7c was obtained

in a straightforward manner by reaction of the corresponding

alcohol 5c with 1,1′-carbonyldiimidazole (CDI).³⁸Compound

7c was not isolated and used in a one-pot procedure in the

subsequent step of the synthetic pathway.

Synthesis problems encountered during the preparation of

chloroformates 6 and the observed poor reactivity of imidazole

1-carboxylates 7c with either ^D-threonine (10a) or the tosylate

salt 13 (Scheme 1) prompted us to search for alternative

carbonic acid derivatives such as pyridyl carbonates deriving

a

Scheme 3. Synthesis of D-Threonine-Derived β-Lactones 14i,l,m,p,q,s via Tosylate Salt 13

a

Reagents and conditions: (a) Boc₂O, NaHCO₃, H₂O, MeOH, room temperature, 36 h; (b) PyBOP, Et₃N, CH₂Cl₂, room temperature, 15 h; (c)

CF₃COOH, p-TsOH, 0 °C, 15 min; (d) DIPEA, mixture of 8i,l,m,p,q,s and 9i,l,m,p,q,s, CH₂Cl₂, room temperature, 15 h.

C

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Scheme 4. Synthesis of 2-Methyl-4-oxo-3-oxetanylcarbamic Acid Esters via β-Hydroxycarboxylic Acids

a

Reagents and conditions: (a) NaHCO₃, 6b,e,h, (n-Bu)₄NBr, THF/H₂O, room temperature, 18 h; (b) Et₃N, 7c, DMF/H₂O, 50 °C, 16 h; (c)

NaHCO₃, mixture of 8a,d,f,g,j,k,n,o,r and 9a,d,f,g,j,k,n,o,r, H₂O/THF, room temperature, 15 h; (d) 15b,c,h, HBTU, Et₃N, CH₂Cl₂, 0 °C, 3 h then

room temperature, 3.5−16 h; (e) 15 a,d,f,g,j,k,n,o,r, TBTU, Et₃N, CH₂Cl₂, 0 °C, 1 h then room temperature, 15 h; (f) 15e, PyBOP, Et₃N, CH₂Cl₂, 0

°C, 3 h then room temperature, 3.5 h.

Scheme 5. Synthesis of Isomeric 5-Phenylpentyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]carbamates 19−21 via β-

a

Hydroxycarboxylic Acids

a

Reagents and conditions: (a) NaHCO₃, mixture of 8t and 9t, H₂O/THF, room temperature, 15 h; (b) TBTU, Et₃N, CH₂Cl₂, 0 °C, 1 h then room

temperature, 15 h.

a

Scheme 6. Synthesis of Compound 29

a

Reagents and conditions: (a) NaH, THF, 0 °C, 10 min, then MeI, DMF, 0 °C, 2 h then room temperature, 15 h; (b) H₂, 10% Pd/C (H-Cube,

EtOH, 60 °C, 1.0 bar); (c) CF₃COOH, p-TsOH, 0 °C, 15 min; (d) NaHCO₃, mixture of 8t and 9t, H₂O/THF, room temperature, 15 h; (e) TBTU,

Et₃N, CH₂Cl₂, 0 °C, 1 h, then room temperature, 15 h.

desired 2-methyl-4-oxo-3-oxetanylcarbamic acid esters 14a−

h,j,k,n,o,r in moderate to good yields (37−76%). The

diﬀerence in the cyclization step yields was not dependent on

the coupling reagent but rather on the nature of the α-

substituted β-hydroxycarboxylic acids 15a−h,j,k,n,o,r. The

overall yields of ﬁnal compounds following path B of Scheme

1 were always higher than those obtained with path A.

Compounds 19−21, respectively the enantiomer and the

epimers of compound 4, were synthesized starting from the

commercially available ^L-threonine 10b, L-allo-threonine 10c,

and ^D-allo-threonine 10d. The amino acids were ﬁrst reacted

with the isomeric mixture of 8t and 9t to give the

corresponding α-substituted β-hydroxycarboxylic acids 16−18

and subsequently cyclized to provide the desired analogues

19−21 (Scheme 5).

D

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Scheme 7. Syntheses of Alcohols 5j,l,m,o

a

Reagents and conditions: (a) NaH, DMSO, 60 °C, 10 min, then ClCH₂COOH, 80 °C, 3 h; (b) LiAlH₄, Et₂O, room temperature, 4 h; (c) MeOH-

BF₃, CH₃MgBr, NH₄Cl (aq); (d) (COCl)₂, DMSO, −78 °C, 2 h; (e) CH₃Li, THF, −78 °C, 2 h, then room temperature, 1 h; (f) (CH₃)₂CHMgCl,

Et₂O, −78 °C, 0.5 h, then 0 °C, 2 h.

a

Scheme 8. Synthesis of Alcohols 5p,r

a

Reagents and conditions: (a) Pd(PPh₃)₄, 10% Na₂CO₃, Toluene/EtOH, microwave, 100 °C, 0.5 h; (b) NaBH₄, MeOH, 0 °C, 1 h; (c) NaH,

[PhCH₂P(Ph)₃]Br, DMSO, room temperature, 0.5 h then 50 °C, 0.5 h, then 16 h, 50 °C after addition of 36; (d) 2:1 mixture acetone/HCl (10% v/

v), room temperature, 4 h; (e) NaBH₄, MeOH, 0 °C, 1 h; (f) H₂, 10% Pd/C (H-Cube, EtOAc, 30 °C, 1.0 bar).

The diastereoisomeric mixture 14n was separated by chiral

HPLC to aﬀord the single diastereoisomers 22 and 23 as pure

enantiomers (see Table 2). Compound 22 was also synthesized

following the same procedure applied to compound 14n,

starting from the commercially available optically pure (S)-

nonan-2-ol, and used as a reference to assign the correct

absolute conﬁguration of diastereoisomer 23 after chiral HPLC

puriﬁcation.

commercially available phenethyl alcohol 5a was reacted with

chloroacetic acid, in the presence of sodium hydride, to aﬀord

2-phenylethoxyacetic acid (30), which upon reduction with

lithium aluminum hydride furnished the desired alcohol 5j.⁴³

Alcohol 5l was synthesized by addition of methylmagnesium

bromide to 5-phenylpentanoic acid methyl ester, which was

prepared in situ by treatment of the commercially available

compound 31 with BF₃−methanol complex.⁴⁴

The synthesis of compound 29 (Scheme 6) was carried out

starting from the commercially available product 24, which was

N-methylated using methyl iodide and sodium hydride to

aﬀord intermediate 25. The benzyl group was then removed by

catalytic hydrogenation and the obtained N-methyl-N-Boc-^D-

threonine (26) was converted into the corresponding tosylate

salt 27. Reaction of 27 with the isomeric mixture containing the

2-pyridyl carbonate 8t and the 2-oxopyridine-1-carboxylate 9t

aﬀorded the 5-phenylpentyl derivative 28, which was ﬁnally

cyclized to give the desired compound 29.

Alcohols 5m,o were prepared in a two-step procedure

starting from the commercially available alcohol 5t (Scheme 7).

Swern oxidation to the aldehyde 32 followed by addition of

methyl-lithium or isopropylmagnesium bromide furnished the

desired compounds.

Alcohols 5p,r were prepared as reported in Scheme 8. The

compound 5p was obtained via a Suzuki cross-coupling

reaction between the commercially available 3-formylphenyl-

boronic acid (34) and bromobenzene (33) followed by

reduction of the intermediate 3-phenylbenzaldehyde (35).

Alcohol 5r was prepared via a Wittig reaction between 1,4-

dioxaspiro[4.5]decan-8-one (36) and benzyltriphenylphospho-

The syntheses of alcohols 5j and 5l were accomplished

according to literature procedures as reported in Scheme 7. The

E

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Table 1. Inhibitory Potencies (IC₅₀) of Compounds 4 and 14a−k on Rat NAAA Activity

a

IC₅₀values are reported as mean values of three or more determinations.

nium bromide to aﬀord compound 37.⁴⁵Removal of the acetal

group under acidic conditions and subsequent reduction of

ketone 38 furnished the alcohol 39, which was submitted to

catalytic hydrogenation to aﬀord 5r.

F

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Table 2. Inhibitory Potencies (IC₅₀) of Compounds 14l−s, 22, 23, and 29 on Rat NAAA Activity

a

IC₅₀values are reported as mean values of three or more determinations.

damage, 4 administered by the topical route partially

normalized FAE levels in the skin and sciatic nerve, which

were reduced by inﬂammation and surgical ligation, respec-

tively, and attenuated nociception through a mechanism that

required PPAR-α activation.⁴⁶

We identiﬁed compound 4 starting from the serine-derived

2-oxo-3-oxetanylamide, (S)-OOPP (2), which inhibits NAAA

with a median inhibitory concentration (IC₅₀) of 0.42 μM.²⁴

RESULTS AND DISCUSSION

■

Previous pharmacological studies by our group have identiﬁed

the 2-methyl-4-oxo-3-oxetanylcarbamic acid ester derivative 4

(ARN077) as a potent NAAA inhibitor.⁴⁶In vitro experiments

have shown that compound 4 inhibits rat NAAA through a

mechanism that is rapid, noncompetitive, and fully reversible

after overnight dialysis.⁴⁶Moreover, in rodent models of

hyperalgesia and allodynia caused by inﬂammation or nerve

G

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Table 3. Inhibitory Potencies (IC₅₀) of Compounds 4 and 19−21 on Rat NAAA Activity

a

IC₅₀values are reported as mean values of three or more determinations.

a

b

Table 4. Inhibitory Potencies (IC₅₀) on Rat and Human NAAA and Percent Inhibitory Activity on Rat FAAH and Rat AC of

Compounds 4, 14i,k,q and 22

a

b

IC₅₀values are reported as mean values of three or more determinations. Inhibitory activities are reported as a % value of two determinations at 10

c

μM. n.a.= < 10% inhibition

The (S)-conﬁguration at position 3 in the β-lactone ring of 2 is

essential for inhibitory potency, as indicated by the substantially

lower activity of its enantiomer, (R)-OOPP (IC₅₀= 6.0 μM).²⁴

The benzyl carbamate 1 was less potent than 2 at inhibiting

NAAA (IC₅₀= 2.96 μM),²⁸whereas its enantiomer, (R)-2-oxo-

3-oxetanylbenzyl carbamate, showed potency comparable to

that of 2 (IC₅₀= 0.70 μM).²⁸This indicated an opposite

stereochemical preference of NAAA at position 3 of the β-

lactone ring in the carbamic acid ester series relative to the

amide series. The introduction of a methyl group with (S)-

stereochemistry at the β-position of the β-lactone ring of (R)-2-

oxo-3-oxetanylbenzyl carbamate led to the corresponding

threonine-derived β-lactone analogue that, although slightly

less potent (IC₅₀= 1.0 μM),²⁸showed an increased chemical

H

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Scheme 9. Schematic Representation of a Possible NAAA Inhibition Mechanism by β-Lactones

stability with respect to serine-derived β-lactone ana-

logues.^28,35,36These results prompted us to focus our attention

on carbamic acid ester derivatives bearing a methyl substitution

at the β-position of the β-lactone ring.

diastereomeric mixture, and compound 22, from optically pure

(S)-1-methyloctanol. Compound 14n (IC₅₀= 0.06 μM)

displayed a slightly decreased potency compared to the

unsubstituted derivative 14h (IC₅₀= 0.03 μM). The optically

pure (S)-1-methyloctyl diastereoisomer 22 inhibited NAAA

with IC₅₀= 0.016 μM, a value comparable to that of the

unsubstituted compound 14h, whereas the (R)-diastereoisomer

23 (IC₅₀= 0.27 μM), obtained by chiral HPLC puriﬁcation of

14n, was 10 times less potent than 14h. These results indicate a

stereorecognition among the isomers and, speciﬁcally, a

preference for the (S)-conﬁguration at the carbon atom in

position α to the carbamate function, at least for compounds

bearing a 1-methyloctyl side chain.⁴⁷

The inﬂuence of the ﬂexibility of the aliphatic chain on

NAAA inhibition was studied by preparing the series of

analogues 14p−s (Table 2). Compounds bearing a 4-

benzylcyclohexyl (14r, IC₅₀= 0.31 μM) or a p-benzyloxyphenyl

(14s, IC₅₀= 0.29 μM) moiety were less potent than compound

4, indicating that some ﬂexibility is required in close proximity

to the carbamate function. Of particular interest were the

results obtained with the biphenylmethyl derivatives (14p,q).

The p-biphenylmethyl compound 14q turned out to be a very

potent NAAA inhibitor, showing an IC₅₀= 0.007 μM. On the

contrary, the m-biphenylmethyl analogue 14p did not

eﬀectively inhibit NAAA (IC₅₀= 23 μM). These results show

a clear preference for a linear moiety in the carbamic acid ester

for optimal enzyme recognition.

2-Methyl-4-oxo-3-oxetanylcarbamic acid esters were tested

for their ability to inhibit the hydrolysis of 10-cis-heptadece-

noylethanolamide (an unnatural FAE) by either native NAAA

prepared from rat lungs (r-NAAA) or recombinant human

NAAA heterologously expressed in HEK293 cells (h-NAAA).

IC₅₀values are reported in Tables 1−3 (r-NAAA) and Table 4

(h-NAAA). The pharmacological potencies of several test

compounds slightly varied between r-NAAA and h-NAAA. We

attribute such variations to diﬀerences in primary sequence and

enzyme preparation.

As a ﬁrst step in our study, we synthesized a small series of 2-

methyl-4-oxo-3-oxetanylcarbamic acid esters where the length

of the aliphatic chain of the phenylalkyl alcohol was

progressively increased from two to six methylene units

(14a−c, 4, 14d). Compound 4 emerged as the most potent

NAAA inhibitor (IC₅₀= 0.05 μM) within this small series. The

potency and the promising in vivo eﬃcacy of 4 prompted us to

investigate in greater detail the structural determinants for

activity of this compound.

To test the role of the phenyl ring, this moiety was replaced

either with an unsubstituted aliphatic chain (14e−h) or with a

cyclohexyl residue (14k). Removal of the phenyl ring led to a

>10-fold drop in potency (14e, IC₅₀= 0.76 μM). However,

potency was recovered by increasing the length of the aliphatic

chain, with compounds bearing an n-heptyl (14g, IC₅₀= 0.04

μM) or an n-octyl (14h, IC₅₀= 0.03 μM) residue showing IC₅₀

values comparable to that of compound 4. Replacement of the

phenyl ring with a cyclohexyl moiety, as in compound 14k, led

to a signiﬁcant improvement in NAAA inhibitory potency (IC₅₀

= 0.013 μM). The replacement of a carbon atom with an

oxygen in the aliphatic chain of 4 (14i,j, Table 1) was tolerated

only at a speciﬁc position, as shown by the diﬀerent potencies

of compounds 14i (IC₅₀= 0.05 μM) and 14j (IC₅₀= 0.14 μM).

To evaluate the inﬂuence of the shape of the phenylalkyl chain,

we synthesized compounds 14l−n (Table 2), which derive

from secondary and tertiary alcohols bearing branched aliphatic

chains. Introduction of a gem-dimethyl (14l) moiety close to

the carbamic function was detrimental for potency, indicating a

limited space in the region of the enzyme occupied by the

carbamic function and the adjacent carbon atom. A single

methyl group, however, appeared to be well accommodated in

this region because compound 14m (IC₅₀= 0.029 μM),

although a mixture of diastereoisomers, displayed a slight

increase in potency compared to compound 4. The

introduction of the more sterically demanding isopropyl

group (14o) decreased the inhibitory potency relative to 4.

To determine whether there is any stereochemical preference

for a substituent at the carbon atom in the α-position to the

carbamic function, we synthesized compounds 14n, as a

The role of the carbamic function was also investigated by

preparing compound 29 (Table 2), a derivative in which the

carbamate nitrogen is methylated. Highlighting the importance

of the N−H group, the compound showed no inhibitory

activity on NAAA.

To investigate the eﬀect of the stereochemistry at positions 2

and 3 of the β-lactone ring, we synthesized compound 19, the

enantiomer of compound 4, and the epimers 20 and 21 (Table

3). A marked drop in inhibitory potency (70-fold) was

observed with compound 19, whereas the (2S,3S) epimer 20

(IC₅₀= 0.48 μM) showed a 10-fold decrease in potency

compared to 4. By contrast, the (2R,3R) epimer 21 turned out

to be a potent NAAA inhibitor (IC₅₀= 0.02 μM). These

ﬁndings show that the conﬁguration of the two stereogenic

centers is important for potency. Whereas the relative

importance of the conﬁguration at position 2 versus 3 remains

to be fully explored, our data support a primary role for

position 3.

To search for a rational explanation of the diﬀerent potencies

of compounds 4 and 19−21, we carried out density functional

theory (DFT)-based calculations to mimic the nucleophilic

attack of the sulfur atom onto the carbonyl group of the β-

lactone ring, the ﬁrst step of the covalent inhibition mechanism

hypothesized for the present series of compounds.^33,46In our

simulations, the four compounds were truncated and modeled

as methyl carbamate, and the sulfur atom was provided by

I

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 2. Potential energy surfaces plotted versus the reaction coordinate, which was represented by the distance between the nucleophilic sulfur

atom and the carbonylic carbon of the β-lactone ring.

cysteamine (see Computational Methods under Experimental

Section). Starting from the noncovalent complex, we performed

a scan on the potential energy surface, using as reaction

coordinate the distance between the sulfur atom of the

cysteamine molecule and the carbon atom of the carbonyl

group of the β-lactone ring. These calculations allowed us to

identify the transition state (TS) for all four compounds under

investigation and to determine the activation energy related to

the nucleophilic attack carried by the sulfur atom. In Scheme 9

is reported a possible NAAA inhibition mechanism by β-

lactones. Going from the reactants (R) through the transition

state (TS) to the product (P), the sulfur atom attacks the

carbonyl group of the β-lactone ring, and the protonated amino

terminal group donates the proton to the oxygen atom. The

nucleophilic attack and the protonation steps are concerted.

In Figure 2, we report the potential energy plotted versus the

reaction coordinate, whereas in Figure 3, we show the geometry

of the four TSs. The activation energy (E_a) was calculated as

the energy diﬀerence between TS and R. The E_avalues for

compounds 4 and 21 were 13.0 and 13.3 kcal/mol, whereas the

E_avalues for the nucleophilic attack to 19 and 20 were 18.9 and

17.0 kcal/mol. These calculations suggest that compounds 4

and 21 might be more prone to react with NAAA’s nucleophilic

cysteine, and therefore more potent, than compounds 19 and

20. This possibility is supported by the experimental IC₅₀values

obtained with these compounds (Table 3), which show that 4

and 21 are up to 2 orders of magnitude more potent than 19

Figure 3. Transition state structures for the nucleophilic attack to 4

and 19−21. In the case of 4 and 21, the stabilization of the TS might

be due to an intramolecular interaction between the oxygen atom of

the lactone carbonyl and the hydrogen atom of the carbamate. The

mechanism was a concerted asynchronous type, where the

nucleophilic attack and the protonation of the carbonyl oxygen

occur simultaneously. All distances are in Å.

and 20, respectively. The TSs structures (Figure 3)

demonstrated that the presence of the carbamic substituent

on the lactone ring allowed the formation of a transient

intramolecular interactionbetween the carbonylic oxygen of

the β-lactone and the hydrogen atom of the carbamateonly

when the absolute conﬁguration of the carbamate-carrying

carbon was (R). Conversely, such a stabilizing interaction could

not be established when the conﬁguration of the same atom

was (S). Moreover, in the reactants showing (S)-conﬁguration,

we observed an intermolecular stabilizing interaction between

the sulfur atom of the cysteamine and the hydrogen atom of the

carbamate. This interaction lowered the reactant energy, with a

further increase of E_afor 19 and 20 (see the Supporting

Information). We conclude that the diﬀerent potencies

between (R)- and (S)-conﬁgurations of the carbon carrying

the carbamate group may be due to both intra- and

intermolecular interactions, responsible for markedly diﬀerent

J

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

activation energies for the sulfur nucleophilic attack. However,

we cannot exclude that compounds 4 and 19−21 might also

bind to NAAA in diﬀerent ways, and therefore, inhibitor−

NAAA interactions at the Michaelis complex can also modulate

their potency.

Selected 2-methyl-4-oxo-3-oxetanylcarbamic acid esters were

tested in a functional assay using h-NAAA (Table 4). A

common trend between relative potencies at human and rat

NAAA was found. Potencies were usually 2−7-fold greater on

human NAAA than on rat NAAA, with a particularly

pronounced diﬀerence observed with compound 4. Compound

14q, the p-biphenylmethyl carbamate derivative, proved to be

equally active on the two enzyme orthologues, showing very

high potency on both h-NAAA (IC₅₀= 0.007 μM) and r-NAAA

(IC₅₀= 0.007 μM).

The same compounds were also tested for selectivity against

rat brain FAAH (r-FAAH), which can also cleave FAEs,⁴⁸and

rat lung acid ceramidase (r-AC), a cysteine amidase that

exhibits 33% amino acid identity with r-NAAA (Table 4).¹⁸At

the concentration tested (10 μM), the compounds had little or

no eﬀect on the activity of these enzymes, demonstrating a

good selectivity toward NAAA.

relevant structural determinants for NAAA inhibition by

threonine-derived β-lactones. Our new investigations highlight

the importance of the conﬁguration of the stereogenic centers

at positions 2 and 3 of compound 4 for potency. Although the

relative importance of the conﬁguration at position 2 versus 3

remains to be fully explored, our data support a primary role for

position 3.

As previously observed with the serine-derived N-(2-oxo-3-

oxetanyl)amides, a linear lipophilic chain attached to the

carbamic acid was important to achieve high potency. An

unsubstituted carbamate nitrogen turned out to be mandatory

for enzyme inhibition, whereas monosubstitution at the carbon

atom in α-position to the carbamate oxygen with a small

substituent, such as a methyl group, could be beneﬁcial for

potency, depending on the substituent conﬁguration. Finally,

the replacement of the phenylpentyl chain of compound 4 with

a p-biphenylmethyl moiety led to the discovery of compound

14q, the ﬁrst single-digit nanomolar inhibitor of both human

and rat NAAA. This molecule represents a promising probe

that may help characterize the functional roles of NAAA and

assess the therapeutic potential of NAAA inhibitors as novel

anti-inﬂammatory and analgesic agents.

Finally, we used high-resolution liquid chromatography−

mass spectrometry (LC-MS) to probe the mechanism through

which 14q, the most potent among the inhibitors described

here, interacts with h-NAAA. We examined whether 14q might

form a covalent adduct with the N-terminal cysteine of the

active form of h-NAAA (see the Supporting Information), as

previously shown for 4.³⁷Consistent with our hypothesis,

incubation of h-NAAA with 14q, followed by trypsin digestion,

revealed the presence of a covalent adduct of 14q with the N-

terminal peptide of h-NAAA (CTSIVAQDSR) (Figure 4). On

the basis of the high-resolution MS/MS analysis of the

modiﬁed peptide, we conclude that 14q inhibits h-NAAA

through S-acylation of catalytic Cys126.

EXPERIMENTAL SECTION

■

a. Chemistry. Chemicals, Materials, and Methods. All of the

commercially available reagents and solvents were used as purchased

from vendors without further puriﬁcation. Dry solvents (THF, Et₂O,

CH₂Cl₂, DMF, DMSO, MeOH) were purchased from Sigma-Aldrich.

Optical rotations were measured on a Rudolf Research Analytical

Autopol II Automatic polarimeter using a sodium lamp (589 nm) as

the light source; concentrations are expressed in g/100 mL using

CHCl₃as a solvent and a 1 dm cell. Automated column

chromatography puriﬁcations were done using a Teledyne ISCO

apparatus (CombiFlash R_f) with prepacked silica gel columns of

diﬀerent sizes (from 4 to 120 g). Mixtures of increasing polarity of

cyclohexane and ethyl acetate (EtOAc) or cyclohexane and methyl

tert-butyl ether (MTBE) were used as eluents. Hydrogenation

reactions were performed using H-Cube continuous hydrogenation

equipment (SS-reaction line version), employing disposable catalyst

cartridges (CatCart) preloaded with the required heterogeneous

catalyst. Microwave heating was performed using an Explorer-48

positions instrument (CEM). NMR experiments were run on a Bruker

Avance III 400 system (400.13 MHz for ¹H and 100.62 MHz for ¹³C),

equipped with a BBI probe and Z-gradients. Spectra were acquired at

300 K, using deuterated dimethyl sulfoxide (DMSO-d₆) or deuterated

chloroform (CDCl₃) as solvents. UPLC-MS analyses were run on a

Waters ACQUITY UPLC-MS system consisting of a SQD (single-

quadrupole detector) mass spectrometer equipped with an electro-

spray ionization interface and a photodiode array detector. The PDA

range was 210−400 nm. Analyses were performed on an ACQUITY

UPLC HSS T3 C₁₈column (50 × 2.1 mm i.d., particle size = 1.8 μm)

with a VanGuard HSS T3 C₁₈precolumn (5 × 2.1 mm i.d., particle

size = 1.8 μm). Mobile phase was either 10 mM NH₄OAc in H₂O at

pH 5 adjusted with AcOH (A) or 10 mM NH₄OAc in MeCN/H₂O

(95:5) at pH 5. Electrospray ionization in positive and negative mode

was applied. Puriﬁcations by preparative HPLC-MS were run on a

Waters Autopuriﬁcation system consisting of a 3100 single-quadrupole

mass spectrometer equipped with an electrospray ionization interface

and a 2998 photodiode array detector. The HPLC system included a

2747 sample manager, 2545 binary gradient module, system ﬂuidic

organizer, and 515 HPLC pump. PDA range was 210−400 nm.

Puriﬁcations were performed on an XBridge Prep C₁₈OBD column

(100 × 19 mm i.d., particle size = 5 μm) with an XBridge Prep C₁₈(10

× 19 mm i.d., particle size = 5 μm) guard cartridge. The mobile phase

was 10 mM NH₄OAc in MeCN/H₂O (95:5) at pH 5. Electrospray

ionization in positive and negative mode was used. Analyses by chiral

HPLC were run on a Waters Alliance HPLC instrument consisting of

Figure 4. Tandem mass spectrum of peptide CTSIVAQDSR

covalently modiﬁed by 14q. The backbone fragment ion series

perfectly matches the primary sequence of the peptide, clearly

indicating that the mass increase (+311 Da) is carried by the N-

terminal cysteine residue. A very intense tropylium ion (167.08 m/z)

and a side-chain loss of the biphenyl group and CO₂(1180.58 m/z)

are also clearly visible in the spectrum.

CONCLUSIONS

■

The present work expanded our previous SAR studies on

threonine-derived 2-methyl-4-oxo-3-oxetanylcarbamic acid es-

ters as NAAA inhibitors. Those studies had led to the discovery

of 5-phenylpentyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate 4, a potent inhibitor of intracellular NAAA activity.

We modiﬁed compound 4 with the aim of clarifying the

K

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

an e2695 separation module and a 2998 photodiode array detector.

PDA range was 210−400 nm. Analyses were performed isocratically

on a Daicel ChiralPak AD column (250 × 4.6 mm i.d., particle size =

10 μm). Mobile phase was 0.1% TFA heptane/2-propanol (75:25).

Separations by preparative chiral HPLC were run on a Waters Alliance

HPLC instrument consisting of a 1525 binary HPLC pump, Waters

Fraction Collector III, and a 2998 photodiode array detector. UV

detection was at 240 nm. Puriﬁcations were performed isocratically on

a Daicel ChiralPak AD column (250 × 10 mm i.d., particle size = 10

μm). Mobile phase was 0.1% TFA heptane/2-propanol (75:25). All

tested compounds (4, 14a−u, 19−22, and 29) showed ≥95% purity

by NMR and UPLC-MS analysis.

Synthesis of 5-Phenylpentyl-[(2S,3R)-2-methyl-4-oxooxe-

tan-3-yl]carbamate (4). 4 was obtained as an oﬀ-white solid.

Experimental procedure and NMR are according to the literature.^28,37

General Procedure I for the Synthesis of Carbamates

14b,e,h (Scheme 4). Preparation of β-Hydroxycarboxylic Acids

15b,e,h (Step 1). To a suspension of NaHCO₃(2.5 equiv) in THF

and H₂O was added D-threonine (1.0 equiv). The suitable

chloroformate 6b,e,h (1.1 equiv) was slowly added, followed by a

catalytic amount of (n-Bu)₄NBr. After stirring at room temperature for

18 h, the mixture was diluted with H₂O and washed with Et₂O. The

aqueous layer was acidiﬁed with 2 M HCl solution and extracted with

EtOAc. The combined organic layers were dried over Na₂SO₄, ﬁltered,

and concentrated to give 15b,e,h, which were used in the next step

without further puriﬁcation.

δ 0.85 (t, J = 7.0 Hz, 3H), 1.21−1.34 (m, 10 H), 1.34 (d, J = 6.4 Hz,

3H), 1.51−2.01 (m, 2H), 4.95−5.05 (m, 2H), 4.84 (dq, J = 6.1, 6.4

Hz, 1H), 5.40 (dd, J = 6.1, 9.3 Hz, 1H), 8.18 (d, J = 9.3 Hz, 1H); ¹³C

NMR (DMSO-d₆), δ 13.94, 14.43, 22.02, 25.27, 28.46, 28.59, 28.59,

31.18, 59.87, 64.66, 74.63, 155.83, 169.88.

Synthesis of Carbamate 14c (Scheme 4). (2R,3S)-3-Hydroxy-

2-(4-phenylbutoxycarbonylamino)butanoic acid (15c). To a

stirred mixture of 4-phenylbutan-1-ol (5c) (5.0 mL, 32.8 mmol, 1.0

equiv) in dry DMF (70 mL) under argon atmosphere was added CDI

(10.6 g, 65.5 mmol, 2.0 equiv). After the mixture had stirred at room

temperature for 2 h, ^D-threonine (3.90 g, 32.8 mmol, 1.0 equiv)

dissolved in H₂O (70 mL) and Et₃N (6.8 mL, 49.1 mmol, 1.5 equiv)

were added. The mixture was heated at 50 °C for 16 h and then

allowed to cool. Water was added and the mixture washed with Et₂O

(three times). The aqueous phase was acidiﬁed with 2 M HCl solution

and then extracted with EtOAc (three times). The collected organic

phases were dried over Na₂SO₄and ﬁltered and the solvent removed

under vacuum. The crude was puriﬁed through silica gel column

chromatography eluting with cyclohexane/EtOAc (20:80) + 1%

CH₃COOH to aﬀord 15c as a pale yellow oil: yield, 54% (5.2 g);

MS (ESI), m/z 294 [M − H]⁻, 296 [M − H]⁺; FTIR (cm⁻¹), 3332

(br), 3027, 2978, 2938, 2863, 1719 (br), 1525, 1253, 1069, 779, 748,

1

699; H NMR (CDCl₃), δ 1.26 (d, J = 6.4 Hz, 3H), 1.39 (m, 2H),

1.63−1.67 (m, 2H), 2.62 (t, J = 7.7 Hz, 2H), 4.05−4.12 (m, 2H),

4.30−4.38 (m, 1H), 4.39−4.47 (m, 1H), 5.68 (m, 1H), 7.16−7.78 (m,

3H), 7.26−7.28 (m, 2H).

Preparation of Carbamates 14b,e,h (Step 2). To a solution of β-

hydroxycarboxylic acid was added 15b,e,h (1.0 equiv) in dry CH₂Cl₂,

Et₃N (3.0 equiv) under argon. After cooling at 0 °C, HBTU (1.5

equiv) or PyBOP (1.3 equiv) was added, and the mixture was stirred at

0 °C for 3 h and then at room temperature for 16 h. The obtained

solid was ﬁltered oﬀ and the solvent removed under vacuum. The

crude was puriﬁed by typical silica gel column chromatography, eluting

with cyclohexane/EtOAc (from 80:20 to 30:70) to give compounds

14b,e,h.

4-Phenylbutyl-[(2S,3R)-2-methyl-4-oxooxetan-3-yl]-

carbamate (14c). To a solution of (2R,3S)-3-hydroxy-2-(4-

phenylbutoxycarbonylamino)butanoic acid (15c) (3.9 g, 13.1 mmol,

1.0 equiv) in dry CH₂Cl₂(170 mL) was added Et₃N (5.5 mL, 39.4

mmol, 3.0 equiv) under argon. After cooling at 0 °C, HBTU (7.5 g,

19.7 mmol, 1.5 equiv) was added and the mixture stirred at 0 °C for 3

h and then at room temperature for 3.5 h. The crude was puriﬁed by

silica gel column chromatography, eluting with cyclohexane/EtOAc

(from 95:5 to 60:40). The resulting pale yellow oil was further

crystallized from cyclohexane to give 14c as a white solid: yield, 6%

(0.23 g); [α]²⁵_D−17.8 (c 0.1, CHCl₃); MS (ESI), m/z 276 [M − H]⁻;

FTIR (cm⁻¹), 3312, 3060, 3026, 2942, 2861, 1826, 1694, 1545, 1337,

3-Phenylpropyl-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (14b). The reaction was carried out following the general

procedure I (step 2) employing Et₃N (1.4 mL, 10.1 mmol), (2R,3S)-3-

hydroxy-2-(3-phenylpropoxycarbonylamino)butanoic acid (15b) (0.95

g, 3.38 mmol), dry CH₂Cl₂(40 mL), and HBTU (1.92 g, 5.07 mmol)

1

1269, 1126, 1023; H NMR (CDCl₃), δ 1.45 (d, 3H), 1.66−1.70 (m,

to give 14b, obtained as a white solid: yield, 31% (0.240 g); [α]²⁵

4H), 2.63−2.66 (m, 2H), 4.09−4.18 (m, 2H), 4.83−4.89 (m, 1H),

5.36 (br d, 1H), 5.45 (m, 1H), 7.16−7.31 (m, 5H).

D

−16.6 (c 0.1, CHCl₃); MS (ESI), m/z 262 [M − H]⁻; FTIR (cm⁻¹),

3328, 3064, 3030, 2972, 2929, 2859, 1851, 1691, 1542, 1333, 1270,

1130, 1083, 1024, 843, 822, 697; ¹H NMR (DMSO-d₆), δ 1.36 (d, J =

6.4 Hz, 3H), 1.83−1.92 (m, 2H), 2.64 (t, J = 7.6 Hz, 2H), 4.00 (m,

2H), 4.86 (dq, J = 6.1, 6.4 Hz), 5.42 (dd, J = 6.1, 9.5 Hz, 1H), 7.10−

7.40 (m, 5H), 8.19 (d, J = 9.5 Hz, 1H); ¹³C NMR (DMSO-d₆), δ

14.52, 30.13, 31.27, 59.91, 64.05, 74.65, 125.89, 128.23, 128.33,

141.15, 155.87, 169.87.

General Procedure II for the Synthesis of Carbamates

14i,l,m,p,q,s (Scheme 3). Synthesis of (3R,4S)-4-Methyl-2-oxo-

1-oxetan-3-ylammonium Toluene-4-sulfonate (13). 13 was

obtained as an oﬀ-white solid. Experimental procedure and NMR

data are according to the literature.²⁴

Preparation of Activated Alcohols as Alkyl-2-pyridyl Carbonates

8i,l,m,p,q,s and Alkyl-2-oxopyridine-1-carboxylates 9i,l,m,p,q,s

(Step 1). To a stirred mixture of the suitable alcohol 5i,l,m,p,q,s

(1.0 equiv) in dry CH₂Cl₂and under nitrogen atmosphere was added

Et₃N (1.5 equiv) or DMAP (0.1 equiv) and DPC (1.1 equiv). The

mixture was reacted at room temperature for 15 h and then diluted

with CH₂Cl₂, washed with a saturated NH₄Cl solution and,

subsequently, with a saturated NaHCO₃solution (three times). The

combined organic layers were dried over Na₂SO₄, ﬁltered, and

concentrated to dryness to give an oil as a mixture (ca. 3:1 ratio if Et₃N

was used and ca. 1.6:1 ratio if DMAP was used) of alkyl-2-pyridyl

carbonate 8i,l,m,p,q,s and alkyl-2-oxopyridine 1-carboxylate

9i,l,m,p,q,s. The mixture of isomers was not separated and used in

the next step without any further puriﬁcation.

Preparation of Carbamates 14i,l,m,p,q,s (Step 2). To a stirred

mixture of 13 (1.0 equiv) in dry CH₂Cl₂(1.0 mL) under nitrogen

atmosphere was added dropwise DIPEA (1.0 equiv). Subsequently, the

isomeric mixture of 8i,l,m,p,q,s and 9i,l,m,p,q,s (3.0 equiv) dissolved

in dry CH₂Cl₂(2.0 mL) was added. The mixture was stirred at room

temperature for 15 h, concentrated to dryness, and puriﬁed by column

chromatography eluting with cyclohexane/MTBE (from 100:0 to

70:30). Compounds 14i,l,m,p,q,s were further puriﬁed by preparative

HPLC-MS.

Pentyl-[(2S,3R)-2-methyl-4-oxooxetan-3-yl]carbamate (14e).

The reaction was carried out following the general procedure I (step

2) employing Et₃N (3.75 mL, 26.9 mmol), (2R,3S)-3-hydroxy-2-

(pentyloxycarbonylamino)butanoic acid (15e) (2.0 g, 8.96 mmol), dry

CH₂Cl₂(100 mL), and PyBOP (6.1 g, 11.6 mmol) to give 14e as a

white solid: yield, 22.5% (0.539 g); [α]²⁵−25.2 (c 0.1, CHCl₃); MS

D

(ESI), m/z 214 [M − H]⁻; FTIR (cm⁻¹), 3323, 3074, 2958, 2931,

2871, 1854, 1692, 1545, 1471, 1391, 1334, 1270, 1150, 1126, 1087,

1025, 982, 844,823; ¹H NMR (DMSO-d₆), δ 0.87 (t, J = 7.0 Hz, 3H),

1.23−1.36 (m, 4H), 1.34 (d, J = 6.4 Hz, 3H), 1.56 (m, 2H), 4.00 (m,

2H), 4.84 (dq, J = 6.2, 6.4 Hz, 1H), 5.40 (dd, J = 6.2, 9.5 Hz, 1H), 8.19

(d, J = 9.5 Hz, 1H); ¹³C NMR (DMSO-d₆), δ 13.87, 14.50, 21.77,

27.5, 28.2, 59.89, 64.67, 74.63, 155.82, 169.90.

Octyl-[(2S,3R)-2-methyl-4-oxooxetan-3-yl]carbamate (14h).

The reaction was carried out following the general procedure I (step

2) employing Et₃N (1.5 mL, 10.9 mmol), (2R,3S)-3-hydroxy-2-

(octyloxycarbonylamino)butanoic acid (15h) (1.0 g, 3.63 mmol), dry

CH₂Cl₂(40 mL), and HBTU (2.07 g, 5.45 mmol) to give 14h as a

white solid: yield, 18% (0.165 g); [α]²⁵−19.3 (c 0.1, CHCl₃); MS

D

(ESI), m/z 256 [M − H]⁻; FTIR (cm⁻¹), 3326, 2958, 2924, 2856,

1857, 1692, 1547, 1333, 1270, 1087, 1025, 845; ¹H NMR (DMSO-d₆),

L

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

3-Benzyloxypropyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (14i). The reaction was carried out following the general

procedure II (step 2) employing 13 (0.10 g, 0.36 mmol), DIPEA (0.06

mL, 0.36 mmol), and the isomeric mixture of 8i and 9i (0.294 g, 1.02

mmol). The crude product was further puriﬁed by preparative HPLC-

g); [α]²⁵−21.6 (c 0.1, CHCl₃); MS (ESI), m/z 326 [M − H]⁻, 328

D

[M − H]⁺; ¹H NMR (DMSO-d₆), δ 1.43 (d, J = 6.4 Hz, 3H) 4.92 (dq,

J = 6.1, 6.4 Hz, 1H), 5.10 (s, 2H), 5.51 (dd, J = 6.1, 9.4, Hz, 1H),

6.94−7.53 (m, 9H), 8.78 (d, J = 9.4 Hz, 1H); ¹³C NMR (DMSO-d₆),

δ 14.57, 59.99, 69.54, 74.61, 99.49, 115.23, 122.55, 127.63, 128.40,

136.98, 144.16, 154.33, 155.71, 169.44.

MS to give 14i as a white solid: yield, 41% (0.045 g); [α]²⁵−9.8 (c

D

0.1, CHCl₃); MS (ESI), m/z 292 [M − H]⁻, 294 [M − H]⁺; ¹H NMR

(DMSO-d₆), δ 1.34 (d, J = 6.3 Hz, 3H), 1.81−1.91 (m, 2H), 3.50 (t, J

= 6.3 Hz, 2H), 4.04−4.16 (m, 2H), 4.47 (s, 2H), 4.85 (dq, J = 6.2, 6.3

Hz, 1H), 5.42 (dd, J = 6.2, 9.4 Hz, 1H), 7.25−7.40 (m, 5H), 8.23 (d, J

= 9.4 Hz, 1H); ¹³C NMR (DMSO-d₆), δ 14.47, 28.89, 59.88, 62.08,

66.13, 71.87, 74.62, 127.36, 128.22, 138.47, 155.72, 169.83.

General Procedure III for the Synthesis of Carbamates

14a,d,f,g,j,k,n,o,r and 19−22 (Schemes 4 and 5). Preparation of

Activated Alcohols as Alkyl-2-pyridyl Carbonates 8a,d,f,g,j,k,n,o,r,t

and Alkyl-2-oxopyridine-1-carboxylates 9a,d,f,g,j,k,n,o,r,t (Step 1).

To a stirred mixture of the suitable alcohol 5a,d,f,g,j,k,n,o,r,t (1.0

equiv) in dry CH₂Cl₂, and under nitrogen atmosphere were added

DMAP (0.1 equiv) and DPC (1.2 equiv). The reaction mixture was

left to react at room temperature for 15 h, then diluted with CH₂Cl₂

and washed with a saturated NH₄Cl solution and, subsequently, with a

saturated NaHCO₃solution (three times). The combined organic

layers were dried over Na₂SO₄, ﬁltered, and concentrated to give a

mixture (ratio 1.6:1) of alkyl-2-pyridyl carbonate 8a,d,f,g,j,k,n,o,r,t and

alkyl-2-oxopyridine 1-carboxylate 9a,d,f,g,j,k,n,o,r,t. The mixture of

isomers was not separated and used in the next step without any

further puriﬁcation.

Preparation of β-Hydroxycarboxylic Acids 15a,d,f,g,j,k,n,o,r and

16−18 (Step 2). To a stirred mixture of ^D- or L- or D-allo- or L-allo-

threonine (1.0 equiv) and NaHCO₃(1.5 equiv) in H₂O (3.5 mL) was

added the isomeric mixture containing the pyridyl carbonate

8a,d,f,g,j,k,n,o,r,t and the 2-oxopyridine-1-carboxylate

9a,d,f,g,j,k,n,o,r,t (1.5 equiv) in THF (3.5 mL). After 15 h at room

temperature, the crude was evaporated and subsequently extracted

with Et₂O (3 × 5 mL). The aqueous layer was acidiﬁed with 2 M HCl

solution to pH 2−3 and subsequently extracted with EtOAc (3 × 10

mL). The combined organic layers were dried over Na₂SO₄, ﬁltered,

and concentrated to give the threonine derivatives 15a,d,f,g,j,k,n,o,r

and 16−18, which were used in the next step without further

puriﬁcation.

(1,1-Dimethyl-5-phenylpentyl)-N-[(2S,3R)-2-methyl-4-oxo-

oxetan-3-yl]carbamate (14l). The reaction was carried out

following the general procedure II (step 2) employing 13 (0.07 g,

0.25 mmol), DIPEA (0.044 mL, 0.25 mmol), and the isomeric mixture

of 8l and 9l (0.321 g, 1.02 mmol). The crude product was further

puriﬁed by preparative HPLC-MS to give 14l as a white solid: yield,

31% (0.025 g); [α]²⁵−17.5 (c 0.1, CHCl₃); MS (ESI), m/z 318 [M

D

− H]⁻, 342 [M − Na]⁺; ¹H NMR (DMSO-d₆), δ 1.32 (d, J = 6.4 Hz,

3H), 1.30−1.39 (m, 2H), 1.36 (s, 3H), 1.37 (s, 3H), 1.50−1.62 (m,

2H), 1.69−1.83 (m, 2H), 2.54−2.62 (m, 2H), 4.82 (dq, J = 6.1, 6.4

Hz, 1H), 5.34 (dd, J = 6.1, 9.3 Hz, 1H), 7.94 (d, J = 9.3 Hz, 1H),

7.10−7.30 (m, 5H); ¹³C NMR (DMSO-d₆), δ 14.38, 22.94, 26.03,

31.32, 35.10, 59.61, 74.57, 81.15, 99.48, 125.57, 128.19, 128.21,

142.10, 154.71, 170.00.

[(1R) and (1S)-1-Methyl-5-phenylpentyl]-N-[(2S,3R)-2-meth-

yl-4-oxo-oxetan-3-yl]carbamate (14m). The reaction was carried

out following the general procedure II (step 2) employing 13 (0.100 g,

0.36 mmol), DIPEA (0.060 mL, 0.36 mmol), and the isomeric mixture

of 8m and 9m (0.31 g, 1.02 mmol). The crude product was further

puriﬁed by preparative HPLC-MS to give 14m as a 1:1

diastereoisomeric mixture as a white solid: yield, 32% (0.035 g); MS

1

(ESI), m/z 304 [M − H]⁻, 306 [M − H]⁺; H NMR (DMSO-d₆), δ

Preparation of Carbamates 14a,d,f,g,j,k,n,o,r and 19−22 (Step

3). To a stirred mixture of threonine derivatives 15a,d,f,g,j,k,n,o,r and

16−18 (1.0 equiv) in dry CH₂Cl₂, at 0 °C, and under nitrogen

atmosphere, were added Et₃N (3.0 equiv) and, subsequently, TBTU

(1.2 equiv). The mixture was stirred at 0 °C for 1 h and at room

temperature for 15 h, then concentrated, and the crude was puriﬁed by

column chromatography, eluting with cyclohexane/EtOAc (from

100:0 to 0:100) to aﬀord 14a,d,f,g,j,k,n,o,r and 19−22.

1.12−1.21 (m, 6H), 1.26−1.38 (m, 10H), 1.46−1.64 (m, 8H), 2.52−

2.61 (m, 4H), 4.64−4.75 (m, 2H), 4.84 (dq, J = 6.2, 6.4 Hz, 2H), 5.39

(dd, J = 6.2, 9.3 Hz, 2H), 7.12−7.31 (m, 10H), 8.12 (d, J = 9.3 Hz,

2H); ¹³C NMR (DMSO-d₆), δ 14.90, 20.52, 24.94, 31.21, 31.25, 35.52,

35.81, 60.36, 71.68, 75.12, 126.08, 128.69, 142.57, 155.92, 170.26.

(3-Phenylphenyl)methyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-

3-yl]carbamate (14p). The reaction was carried out following the

general procedure II (step 2) employing 13 (0.120 g, 0.44 mmol),

DIPEA (0.072 mL, 0.44 mmol), and the isomeric mixture of 8p and

9p (0.402 g, 1.32 mmol). The crude product was further puriﬁed by

preparative HPLC-MS to give 14p as a white solid: yield, 32% (0.045

Phenethyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (14a). The reaction was carried out following the general

procedure III (step 3) employing (2R,3S)-3-hydroxy-2-(2-

phenethyloxycarbonylamino)butanoic acid (15a) (0.35 g, 1.30

mmol), dry CH₂Cl₂(35 mL), Et₃N (0.54 mL, 3.90 mmol), and

TBTU (0.50 g, 1.56 mmol) to give 14a as a white solid: yield, 57%

1

g); [α]²⁵_D−11.4 (c 0.1, CHCl₃); MS (ESI), m/z 334 [M − Na]⁺; H

NMR (DMSO-d₆), δ 1.36 (d, J = 6.4, 3H), 4.88 (dq, J = 6.2, 6.4, 1H),

5.08−5.29 (m, 2H), 5.47 (dd, J = 6.2, 9.3, 1H), 7.31−7.79 (m, 9H),

8.40 (d, J = 9.3, 1H); ¹³C NMR (DMSO-d₆) δ 14.50, 59.95, 66.14,

74.62, 126.18, 126.31, 126.66, 126.85, 127.58, 128.94, 129.07, 137.21,

139.82, 140.33, 155.60, 169.73.

(0.185 g); [α]²⁵−18.2 (c 0.1, CHCl₃); MS (ESI), m/z 249 [M −

D

H]⁻, 250 [M − H]⁺; ¹H NMR (DMSO-d₆), δ 1.33 (d, J = 6.3 Hz, 3H),

2.89 (t, J = 6.8 Hz, 2H), 4.15−4.29 (m, 2H), 4.84 (dq, J = 6.1, 6.3 Hz,

1H), 5.40 (dd, J = 6.1, 9.4 Hz, 1H), 7.19−7.36 (m, 5H), 8.23 (d, J =

9.4 Hz, 1H); ¹³C NMR (DMSO-d₆), δ 14.46, 34.65, 59.86, 65.15,

74.62, 126.31, 128.31, 128.81, 137.95, 155.61, 169.77.

(4-Phenylphenyl)methyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-

3-yl]carbamate (14q). The reaction was carried out following the

general procedure II (step 2) employing 13 (0.12 g, 0.44 mmol),

DIPEA (0.072 mL, 0.44 mmol), and the isomeric mixture 8q and 9q

(0.40 g, 1.31 mmol). The crude product was further puriﬁed by

preparative HPLC-MS to give 14q as a white solid: yield, 30% (0.04

g); [α]²⁵_D−12.1 (c 0.1, CHCl₃); MS (ESI), m/z 310 [M − H]⁻, 329

[M − NH₄]⁺, 350 [M − K]⁺; ¹H NMR (DMSO-d₆), δ 1.37 (d, J = 6.4

Hz, 3H), 4.88 (dq, J = 6.1, 6.4 Hz, 1H), 5.12 (d, J = 12.5 Hz, 1H), 5.16

(d, J = 12.5 Hz, 1H), 5.47 (dd, J = 6.1, 9.4 Hz, 1H), 7.35−7.41 (m,

1H), 7.45−7.51 (m, 4H), 7.66−7.71 (m, 4H), 8.40 (d, J = 9.4 Hz,

1H); ¹³C NMR (DMSO-d₆), δ 14.51, 59.94, 65.89, 74.61, 126.65,

126.70, 127.52, 128.53, 128.91, 135.65, 139.68, 139.88, 155.59, 169.75.

(4-Benzyloxyphenyl)-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-

yl]carbamate (14s). The reaction was carried out following the

general procedure II (step 2) employing 13 (0.120 g, 0.44 mmol),

DIPEA (0.072 mL, 0.44 mmol), and the isomeric mixture 8s and 9s

(0.423 g, 1.31 mmol). The crude product was further puriﬁed by

preparative HPLC-MS to give 14s as a white solid: yield, 17% (0.025

6-Phenylhexyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (14d). The reaction was carried out following the general

procedure III (step 3) employing (2R,3S)-3-hydroxy-2-(6-

phenylhexoxycarbonylamino)butanoic acid (15d) (0.25 g, 0.78

mmol), dry CH₂Cl₂(25 mL), Et₃N (0.33 mL, 2.35 mmol), and

TBTU (0.30 g, 1.2 mmol) to give 14d as a white solid: yield, 50%

(0.12 g); [α]²⁵_D−12.3 (c 0.1, CHCl₃); MS (ESI), m/z 304 [M − H]⁻,

306 [M − H]⁺; ¹H NMR (DMSO-d₆), δ 1.26−1.39 (m, 4H), 1.34 (d, J

= 6.4 Hz, 3H), 1.48−1.65 (m, 4H), 2.54−2.61 (m, 2H), 3.91−4.06 (m,

2H), 4.84 (dq, J = 6.1, 6.4 Hz, 1H), 5.41 (dd, J = 6.1, 9.4 Hz, 1H),

7.11−7.31 (m, 5H), 8.19 (d, J = 9.4 Hz, 1H); ¹³C NMR (DMSO-d₆),

δ 14.47, 25.07, 28.23, 28.40, 30.88, 35.02, 59.88, 64.64, 74.63, 125.57,

128.19, 128.21, 142.20, 155.80, 169.85.

Hexyl-N-[(2S,3R)-2-methyl-4-oxooxetan-3-yl]carbamate

(14f). The reaction was carried out following the general procedure III

(step 3) employing (2R,3S)-2-(hexyloxycarbonylamino)-3-hydroxybu-

tanoic acid (15f) (0.27g, 1.10 mmol), dry CH₂Cl₂(27 mL), Et₃N

M

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(0.46 mL, 3.31 mmol), and TBTU (0.42 g, 1.32 mmol) to give 14f as a

7.13−7.21 (m, 6H), 7.23−7.30 (m, 4H), 8.13 (d, J = 7.0 Hz, 1H), 8.15

(d, J = 7.0 Hz, 1H); ¹³C NMR (DMSO-d₆), δ 14.38, 17.40, 18.48,

24.68, 30.70, 30.76, 31.31, 35.04, 59.96, 74.64, 78.51, 125.59, 128.18,

128.20, 142.09, 156.06, 156.10, 169.72.

white solid: yield, 73% (0.185 g); [α]²⁵−25.1 (c 0.1, CHCl₃); MS

D

1

(ESI), m/z 228 [M − H]⁻, 230 [M − H]⁺; H NMR (DMSO-d₆), δ

0.86 (t, J = 6.9 Hz, 3H), 1.21−1.38 (m, 6H), 1.34 (d, J = 6.4 Hz, 3H),

1.50−1.62 (m, 2H), 3.934.07 (m, 2H), 4.84 (dq, J = 6.1, 6.4 Hz,

1H), 5.40 (dd, J = 6.1, 9.3 Hz, 1H), 8.19 (d, J = 9.3 Hz, 1H); ¹³C

NMR (DMSO-d₆), δ 13.83, 14.46, 21.98, 24.92, 28.42, 30.84, 59.88,

64.67, 74.62, 155.80, 169.85.

(1S,4S)- and (1r,4R)-(4-Benzylcyclohexyl)-N-[(2S,3R)-2-meth-

yl-4-oxo-oxetan-3-yl]carbamate (14r). The reaction was carried

out following the general procedure III (step 3) employing (2R,3S)-2-

[(1r,4R)-4-benzylcyclohexyloxycarbonylamino]-3-hydroxybutanoic

acid and (2R,3S)-2-[(1s,4S)-4-benzylcyclohexyloxycarbonylamino]-3-

hydroxybutanoic acid (15r) (0.4 g, 1.20 mmol), dry CH₂Cl₂(40 mL),

Et₃N (0.5 mL, 3.6 mmol), and TBTU (0.46 g, 1.44 mmol) to give 14r,

as a 7.3 isomeric mixture white solid: yield, 43% (0.17 g); MS (ESI),

m/z 316 [M − H]⁻, 318 [M − H]⁺; ¹H NMR (DMSO-d₆), δ 1.34 (d,

J = 6.4 Hz, 3H, minor isomer), 1.37 (d, J = 6.4 Hz, 3H, major isomer),

1.00−1.99 (m, 20H), 2.48 (d, J = 7.2 Hz, 2H), 4.40−4.52 (m, 1H,

minor isomer), 4.73−4.80 (m, 1H, major isomer), 4.81−4.92 (m, 2H),

5.36−5.47 (m, 2H), 7.13−7.23 (m, 6H), 7.24−7.34 (m, 4H), 8.12−

8.23 (m, 2H); ¹³C NMR (DMSO-d₆), δ 14.49, 26.79, 28.94, 30.11,

31.31, 31.35, 37.62, 38.04, 42.22, 59.85, 70.27, 73.74, 74.58, 74.64,

125.69, 128.11, 128.89, 140.51, 140.60, 155.23, 155.30, 169.96.

5-Phenylpentyl-N-[(2R,3S)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (19). The reaction was carried out following the general

procedure III (step 3) employing (2S,3R)-3-hydroxy-2-(5-

phenylpentyloxycarbonylamino)butanoic acid (16) (0.3 g, 0.89

mmol), dry CH₂Cl₂(30 mL), Et₃N (0.37 mL, 2.67 mmol), and

TBTU (0.34 g, 1.06 mmol) to give 19 as a white solid: yield, 70%

(0.18 g); [α]²⁵_D+21.3 (c 0.1, CHCl₃); MS (ESI), m/z 290 [M − H]⁻,

292 [M − H]⁺; ¹H NMR (DMSO-d₆), δ 1.28−1.37 (m, 2H), 1.33 (d, J

= 6.4 Hz, 3H), 1.53−1.64 (m, 4H), 2.57 (t, J = 7.7 Hz, 2H), 3.93−4.06

(m, 2H), 4.84 (dq, J = 6.1, 6.4 Hz, 1H), 5.40 (dd, J = 6.1, 9.4 Hz, 1H),

7.13−7.30 (m, 5H), 8.19 (d, J = 9.4 Hz, 1H); ¹³C NMR (DMSO-d₆),

δ 14.46, 24.96, 28.33, 30.58, 35.03, 59.87, 64.63, 74.62, 125.60, 128.20,

128.23, 142.07, 155.78, 169.84.

5-Phenylpentyl-N-[(2S,3S)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (20). The reaction was carried out following the general

procedure III (step 3) employing (2S,3S)-3-hydroxy-2-(5-

phenylpentyloxycarbonylamino)butanoic acid (17) (0.35 g, 1.13

mmol), dry CH₂Cl₂(35 mL), Et₃N (0.47 mL, 3.39 mmol), and

TBTU (0.43 g, 1.35 mmol) to give 20 as a white solid: yield, 76%

(0.22 g); [α]²⁵_D−29.2 (c 0.1, CHCl₃); MS (ESI), m/z 290 [M − H]⁻,

292 [M − H]⁺; ¹H NMR (DMSO-d₆), δ 1.27−1.37 (m, 2H), 1.47 (d, J

= 6.1 Hz, 3H), 1.53−1.64 (m, 4H), 2.57 (t, J = 7.6 Hz, 2H), 3.98 (t, J

= 6.6 Hz, 2H), 4.63−4.77 (m, 2H), 7.12−7.31 (m, 5H), 8.04 (d, J =

8.0 Hz, 1H); ¹³C NMR (DMSO-d₆) δ 18.62, 25.47, 28.80, 31.07,

35.52, 63.82, 65.08, 75.80, 126.09, 128.69, 128.72, 142.57, 156.02,

169.53.

Heptyl-N-[(2S,3R)-2-methyl-4-oxooxetan-3-yl]carbamate

(14g). The reaction was carried out following the general procedure

III (step 3) employing (2R,3S)-2-(heptyloxycarbonylamino)-3-hydrox-

ybutanoic acid (15g) (0.3 g, 1.14 mmol), dry CH₂Cl₂(30 mL), Et₃N

(0.48 mL, 3.44 mmol), and TBTU (0.44 g, 1.37 mmol) to give 14g as

a white solid: yield, 37% (0.103 g); [α]²⁵−23.1 (c 0.1, CHCl₃); MS

D

1

(ESI), m/z 242 [M − H]⁻, 244 [M − H]⁺; H NMR (DMSO-d₆), δ

0.86 (t, J = 6.9 Hz, 3H), 1.20−1.32 (m, 8H), 1.34 (d, J = 6.4 Hz, 3H),

1.49−1.60 (m, 2H), 3.934.07 (m, 2H), 4.84 (dq, J = 6.1, 6.4 Hz,

1H), 5.40 (dd, J = 6.1, 9.4 Hz, 1H), 8.19 (d, J = 9.4 Hz, 1H); ¹³C

NMR (DMSO-d₆), δ 13.90, 14.46, 21.98, 25.22, 28.28, 28.47, 31.16,

59.88, 64.67, 74.63, 155.81, 169.86.

2-Phenethyloxyethyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-

yl]carbamate (14j). The reaction was carried out following the

general procedure III (step 3) employing (2R,3S)-3-hydroxy-2-(2-

phenethyloxyethoxycarbonylamino)butanoic acid (15j) (0.46 g, 1.18

mmol), dry CH₂Cl₂(35 mL), Et₃N (0.49 mL, 3.55 mmol), and TBTU

(0.30 g, 1.42 mmol) to give 14j as a white solid: yield, 60% (0.18 g);

[α]²⁵_D−12.7 (c 0.1, CHCl₃); MS (ESI), m/z 292 [M − H]⁻, 294 [M

− H]⁺; ¹H NMR (DMSO-d₆), δ 1.35 (d, J = 6.4 Hz, 3H), 2.81 (t, J =

7.1 Hz, 2H), 3.57−3.65 (m, 4H), 4.05−4.21 (m, 2H), 4.85 (dq, J =

6.1, 6.4 Hz, 1H), 5.43 (dd, J = 6.1, 9.4 Hz, 1H), 7.15−7.33 (m, 5H),

8.33 (d, J = 9.4 Hz, 1H); ¹³C NMR (DMSO-d₆), δ 14.51, 35.45, 59.89,

64.03, 68.24, 71.16, 74.60, 126.01, 128.19, 128.77, 138.78, 155.65,

169.80.

5-Cyclohexylpentyl-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (14k). The reaction was carried out following the general

procedure III (step 3) employing (2R,3S)-2-(5-cyclohexylpentylox-

ycarbonylamino)-3-hydroxybutanoic acid (15k) (0.32 g, 1.02 mmol),

dry CH₂Cl₂(30 mL), Et₃N (0.43 mL, 3.08 mmol), and TBTU (0.39 g,

1.2 mmol) to give 14k as a white solid: yield, 39% (0.12 g); [α]²⁵

D

−8.9 (c 0.1, CHCl₃); MS (ESI), m/z 296 [M − H]⁻, 298 [M − H]⁺;

¹H NMR (DMSO-d₆), δ 0.78−0.93 (m, 2H), 1.05−1.33 (m, 10H),

1.36 (d, J = 6.4 Hz, 3H), 1.51−1.72 (m, 7H), 3.92−4.09 (m, 2H), 4.86

(dq, J = 6.1, 6.4 Hz, 1H), 5.42 (dd, J = 6.1, 9.4 Hz, 1H), 8.20 (d, J =

9.4 Hz, 1H); ¹³C NMR (DMSO-d₆), 14.45, 25.58, 25.83, 25.87, 26.19,

28.49, 32.85, 36.83, 36.92, 59.88, 64.65, 74.61, 155.79, 169.84.

(1R) and (1S)-1-Methyloctyl-N-[(2S,3R)-2-methyl-4-oxo-oxe-

tan-3-yl]carbamate (14n). The reaction was carried out following

the general procedure III (step 3) employing (2R,3S)-3-hydroxy-2-(1-

methyloctyloxycarbonylamino)butanoic acid (15n) (0.24 g, 0.83

mmol), dry CH₂Cl₂(24 mL), Et₃N (0.35 mL, 2.49 mmol), and

TBTU (0.32 g, 0.99 mmol) to give 14n as a 1:1 diastereoisomeric

mixture white solid: yield, 51%; MS (ESI), m/z 270 [M − H]⁻, 272

5-Phenylpentyl-N-[(2R,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (21). The reaction was carried out following the general

procedure III (step 3) employing (2R,3R)-3-hydroxy-2-(5-

phenylpentyloxycarbonylamino)butanoic acid (18) (0.23 g, 0.74

mmol), dry CH₂Cl₂(23 mL), Et₃N (0.31 mL, 2.22 mmol), and

TBTU (0.28 g, 0.88 mmol) to give 21 as a white solid: yield, 69%

1

[M − H]⁺; H NMR (DMSO-d₆), δ 0.82−0.90 (m, 6H), 1.13−1.19

(0.15 g); [α]²⁵+28.23 (c 0.1, CHCl₃); MS (ESI), m/z 290 [M −

D

(m, 6H), 1.21−1.30 (m, 20H), 1.31−1.37 (m, 6H), 1.40−1.59 (m,

4H), 4.63−4.74 (m, 2H), 4.79−4.88 (m, 2H), 5.35−5.43 (m, 2H),

8.08−8.16 (m, 2H); ¹³C NMR (DMSO-d₆), δ 13.91, 14.40, 14.45,

20.07, 22.04, 24.78, 24.81, 28.60, 28.75, 28.77, 31.16, 35.51, 35.56,

59.87, 71.22, 74.59, 74.63, 155.54, 169.84, 169.91.

1

H]⁻, 292 [M − H]⁺; H NMR (DMSO-d₆), δ 1.27−1.38 (m, 2H),

1.47 (d, J = 6.1 Hz, 3H), 1.53−1.64 (m, 4H), 2.54−2.59 (m, 2H), 3.98

(t, J = 6.6 Hz, 2H), 4.64−4.77 (m, 2H), 7.13−7.21 (m, 3H), 7.24−

7.31 (m, 2H), 8.04 (d, J = 7.9 Hz, 1H); ¹³C NMR (DMSO-d₆), δ

18.62, 25.47, 28.80, 31.07, 35.52, 63.82, 65.08, 75.80, 126.09, 128.69,

128.73, 142.57, 156.02, 169.53.

(1R)- and (1S)-(1-Isopropyl-5-phenylpentyl)-N-[(2S,3R)-2-

methyl-4-oxo-oxetan-3-yl]carbamate (14o). The reaction was

carried out following the general procedure III (step 3) employing

(2R,3S)-3-hydroxy-2-[(1-isopropyl-5-phenylpentyloxy)-

carbonylamino]butanoic acid (15o) (0.16 g, 0.45 mmol), dry CH₂Cl₂

(16 mL), Et₃N (0.19 mL, 1.36 mmol), and TBTU (0.17 g, 0.55 mmol)

to give 14o as a 1:1 diastereoisomeric mixture white solid: yield, 37%

[(S)-1-Methyloctyl]-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (22). Compound 22 was synthesized in the same manner

as compound 14n starting from (S)-nonan-2-ol: yield, 53% (0.1 g);

white solid; [α]²⁵−4.39 (c 0.1, CHCl₃); MS (ESI), m/z 270 [M −

D

H]⁻, 272 [M − H]⁺; ¹H NMR (DMSO-d₆), δ 0.85 (t, J = 6.8 Hz, 3H),

1.15 (d, J = 6.3 Hz, 3H), 1.20−1.31 (m, 10H), 1.34 (d, J = 6.4 Hz,

3H), 1.41−1.56 (m, 2H), 4.63−4.74 (m, 1H), 4.83 (dq, J = 6.3, 6.4

Hz, 1H), 5.39 (dd, J = 6.3, 9.3 Hz, 1H), 8.11 (d, J = 9.3 Hz, 1H); ¹³C

NMR (DMSO-d₆), δ 13.91, 14.44, 20.05, 22.03, 24.80, 28.59, 28.76,

31.16, 35.55, 59.86, 71.23, 74.63, 155.55, 169.92.

1

(0.05 g); MS (ESI), m/z 332 [M − H]⁻, 334 [M − H]⁺; H NMR

(DMSO-d₆), δ 0.84 (d, J = 6.7 Hz, 6H), 0.86 (d, J = 6.7 Hz, 6H),

1.22−1.35 (m, 4H), 1.30 (d, J = 6.2 Hz, 3H), 1.32 (d, J = 6.2 Hz, 3H),

1.42−1.66 (m, 8H), 1.69−1.80 (m, 2H), 2.52−2.61 (m, 4H), 4.46−

4.56 (m, 2H), 4.78−4.90 (dq, J = 6.2 Hz, 2H), 5.33−5.43 (m, 2H),

N

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

[(R)-1-Methyloctyl]-N-[(2S,3R)-2-methyl-4-oxo-oxetan-3-yl]-

carbamate (23). Compound 23 was obtained by chiral HPLC

(m, 4H), 4.16−4.27 (m, 2H), 4.32 (d, J = 5.8 Hz, 1H, minor rotamer),

4.47 (d, J = 5.4 Hz, 1H, major rotamer), 7.13−7.31 (m, 10H).

5-Phenylpentyl-N-methyl-N-[(2S,3R)-2-methyl-4-oxo-oxe-

tan-3-yl]carbamate (29). To a stirred mixture of 28 (0.04 g, 0.14

mmol) in dry CH₂Cl₂(5.0 mL), at 0 °C, and under nitrogen

atmosphere, were added Et₃N (0.06 mL, 0.41 mmol) and subsequently

TBTU (0.05 g, 0.17 mmol). The mixture was stirred at 0 °C for 1 h

and at room temperature for 15 h and concentrated. The crude was

absorbed over silica gel and puriﬁed by column chromatography,

eluting with cyclohexane/EtOAc (from 100:0 to 0:100) to aﬀord 29 as

puriﬁcation of the diastereomeric mixture 14n: white solid; [α]²⁵

D

−28.39 (c 0.1, CHCl₃); ee >99% [chiral HPLC, AD column; ﬂow, 1.0

mL/min; t_s, 26.28 min]; MS (ESI), m/z 270 [M − H]⁻, 272 [M −

H]⁺; ¹H NMR (DMSO-d₆), δ 0.85 (t, J = 6.8 Hz, 3H), 1.17 (d, J = 6.3

Hz, 3H), 1.20−1.31 (m, 10H), 1.34 (d, J = 6.3 Hz, 3H), 1.42−1.56

(m, 2H), 4.63−4.74 (m, 1H), 4.84 (dq, J = 6.1, 6.3 Hz, 1H), 5.39 (dd,

J = 9.4, 6.1 Hz, 1H), 8.13 (d, J = 9.3 Hz, 1H); ¹³C NMR (DMSO-d₆),

δ 14.55, 14.91, 20.58, 22.49, 25.27, 29.20, 31.66, 36.08, 60.40, 71.76,

75.06, 155.54, 169.84.

a 1:1.5 rotameric mixture colorless oil: yield, 23% (0.01 g); [α]²⁵

D

−16.66 (c 0.1, CHCl₃); ¹H NMR (DMSO-d₆), δ 1.29−1.41 (m, 10H),

1.53−1.69 (m, 8H), 2.58 (t, J = 7.6 Hz, 4H), 2.93 (s, 6H), 3.98−4.11

(m, 4H), 4.77−4.89 (m, 2H), 5.24−5.33 (m, 1H, major rotamer),

5.35−5.43 (m, 1H, minor rotamer), 7.13−7.32 (m, 10H); ¹³C NMR

(DMSO-d₆), δ 14.25, 24.84, 28.07, 30.45, 34.95, 65.60, 66.95, 74.70,

125.59, 128.18, 128.23, 142.06, 167.32.

Synthesis of Carbamate 29 (Scheme 6). (2R,3S)-3-Benzyloxy-

2-[tert-butoxycarbonyl(methyl)amino]butanoic Acid (25). To a

solution of (2R,3S)-3-benzyloxy-2-(tert-butoxycarbonylamino)-

butanoic acid (24) in dry THF (15 mL) at 0 °C, and under argon

atmosphere, was added in one portion a 60% NaH dispersion in

mineral oil (0.21 g, 5.33 mmol). The reaction mixture was stirred at 0

°C for 10 min, and then MeI (0.95 mL, 15.22 mmol) followed by

DMF (0.75 mL) were sequentially added. The reaction was stirred at 0

°C for 2 h and at room temperature for 15 h, then quenched with H₂O

(15 mL), diluted with EtOAc (30 mL), and acidiﬁed to pH 2 by

dropwise addition of 2 N HCl aqueous solution. The organic layer was

separated, and the aqueous layer was extracted with EtOAc (2 × 30

mL). The combined organic layers were dried over Na₂SO₄, ﬁltered,

and concentrated. The crude mixture was puriﬁed by column

chromatography using an ISCO apparatus and cyclohexane/MTBE

(60:40) as eluent. A mixture of two rotamers in a 2:1 ratio was

obtained as a colorless oil: yield, 67% (1.1 g); ¹H NMR (DMSO-d₆), δ

1.13−1.20 (m, 6H), 1.36 (s, 9H, minor rotamer), 1.41 (s, 9H, major

rotamer), 2.84 (s, 3H, minor rotamer), 2.87 (s, 3H, major rotamer),

4.13−4.24 (m, 2H), 4.34−4.40 (m, 2H), 4.49 (d, J = 5.5 Hz, 1H,

minor rotamer), 4.57−4.62 (m, 2H), 4.71 (d, J = 5.2 Hz, 1H, major

rotamer), 7.23−7.35 (m, 10H).

b. Pharmacology. NAAA in Vitro Assay. Rat native NAAA was

obtained from lungs of male Sprague−Dawley rats (275−300 g,

Charles River Italia, Calco, Italy). Rats were sacriﬁced by decapitation

and lungs rapidly dissected out, ﬁnely chopped on ice, and transferred

into ice-cold homogenizing buﬀer (20 mM Tris-HCl buﬀer, pH 7.4,

0.32 M sucrose). Samples were then homogenized with an IKA T-18

Ultraturrax for 1 min at 14000 rpm. Recombinant HEK−h-NAAA

pellets were resupended in homogenizing buﬀer and sonicated.

Samples were then spun at 800g for 15 min at 4 °C, and the resultant

supernatants were then ultracentrifuged at 12000g for 30 min at 4 °C.

The pellets were resuspended in PBS, pH 7.4, on ice and subjected to

a freeze/thaw cycle at −80 °C. The suspension was ﬁnally centrifuged

at 105000g for 1 h at 4 °C. Protein concentration was measured and

samples aliquoted and stored at −80 °C until use. NAAA protein

preparation (10 μg) was preincubated with various concentrations of

test compound or vehicle control in 100 mM NaH₂PO₄, 100 mM

trisodium citrate dehydrate, 0.1% Triton-X 100, and 3 mM DTT, pH

4.5, for 30 min at 37 °C. Duplicate samples were then incubated with

50 μM C17:1 10-cis-heptadecenoylethanolamide (Avanti Polar Lipids,

Alabaster, AL, USA) at 37 °C for 30 min. The reaction was terminated

by the addition of 0.2 mL of cold methanol containing 1 nmol of

heptadecanoic acid (NuChek Prep, Elysian, MN, USA) as internal

standard. Samples were then analyzed by UPLC-MS. Heptadecenoic

and heptadecanoic acids were eluted on an ACQUITY UPLC BEH

C18 column (50 mm length, 2.1 mm i.d., 1.7 μm pore size, Waters)

isocratically at 0.5 mL/min for 1.5 min with a solvent mixture of 95%

methanol and 5% water, both containing 0.25% acetic acid and 5 mM

ammonium acetate. The column temperature was 40 °C. Electrospray

ionization was in the negative mode, capillary voltage was 2.7 kV, cone

voltage was 45 V, and extractor voltage was 3 V. The source

temperature was 150 °C with a desolvation temperature of 400 °C. N₂

was used as drying gas at a cone ﬂow of 100 L/h and a desolvation

ﬂow of 800 °C. The [M − H]⁻ion was monitored in the selected ion

monitoring mode (m/z values: heptadecenoic acid, 267.37;

heptadecanoic acid, 269.37). Calibration curves were generated using

commercial heptadecenoic acid (NuCheck Prep). Inhibition of NAAA

activity was calculated as reduction of heptadecenoic acid in the

samples compared to vehicle controls. IC₅₀values were calculated by

nonlinear regression analysis of log[concentration]/inhibition curves

using GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA,

USA) applying a ﬁxed slope curve ﬁtting.

(2R,3S)-2-[tert-Butoxycarbonyl(methyl)amino]-3-hydroxybu-

tanoic Acid (26). Compound 25 (0.5 g, 1.55 mmol) was dissolved in

absolute EtOH (100 mL). The solution was passed through the H-

Cube hydrogenator ﬂow reactor provided with a 10% Pd/C cartridge.

The system was set to full hydrogen mode at 60 °C and 1 bar (1.0

mL/min ﬂow rate). The hydrogenated solution was concentrated to

aﬀord 26 as a 1:1.3 rotameric mixture colorless oil: yield, 96% (0.35 g);

¹H NMR (DMSO-d₆), δ 1.06−1.12 (m, 6H), 1.36 (s, 9H, minor

rotamer), 1.40 (s, 9H, major rotamer), 2.86 (s, 3H, minor rotamer),

2.89 (s, 3H, major rotamer), 4.15−4.27 (m, 2H), 4.33 (m, 1H, minor

rotamer), 4.47 (d, J = 5.3 Hz, 1H, major rotamer).

[(1R,2S)-1-Carboxy-2-hydroxypropyl]methylammonium Tol-

uene-4-sulfonate (27). In a heart-shaped ﬂask, 26 (0.086 g, 0.37

mmol) was mixed with p-TsOH (0.073, 0.39 mmol), and the mixture

was cooled to 0 °C. Subsequently, TFA (2.0 mL) was added over 10

min, and the mixture was reacted at 0 °C for 15 min and then

concentrated, maintaining the bath below 30 °C. The obtained oil was

left under vacuum for 1 h, then dissolved in dry Et₂O to form a white

precipitate. The solution was decanted and the solid washed several

times with Et₂O, providing a white sticky solid: yield, 97% (0.11 g); ¹H

NMR (DMSO-d₆), δ 1.25 (d, J = 6.5 Hz, 3H), 2.29 (s, 3H), 2.60 (s,

3H), 3.73−3.82 (m, 1H), 4.02−4.11 (m, 1H), 7.11 (d, J = 8.1 Hz,

2H), 7.48 (d, J = 8.1 Hz, 2H); ¹³C NMR (DMSO-d₆), δ 21.25, 33.24,

40.01, 65.56, 66.57, 125.96, 128.50, 138.04, 146.24, 169.28.

(2R,3S)-3-Hydroxy-2-[methyl(5-phenylpentoxycarbonyl)-

amino]butanoic Acid (28). To a stirred mixture of 27 (0.1 g, 0.33

mmol) and NaHCO₃(0.05 g, 0.65 mmol) in H₂O (1.0 mL) was added

the isomeric mixture containing the pyridyl-carbonate 8t and the 2-

oxopyridine-1-carboxylate 9t (0.14 g, 0.49 mmol) in THF (1.0 mL).

After 15 h at room temperature, the mixture was concentrated and

extracted with Et₂O (3 × 5 mL). The aqueous layer was acidiﬁed with

2 M HCl solution to pH 2−3 and extracted with EtOAc (3 × 10 mL).

The combined organic layers were dried over Na₂SO₄, ﬁltered, and

concentrated to give 28 as a 1.5:1 rotameric mixture colorless sticky

Human Recombinant NAAA. The coding sequence of human

NAAA (NM_014435.3) was ampliﬁed by PCR (HotStar HiFidelity

kit, Qiagen) from a human spleen cDNA library (catalog no. 639124,

Clontech, Mountain View, CA, USA). To generate the construct h-

NAAA(6× His)-pCDNA3.1 a sequence of h-NAAA fused with a C-

terminal 6× histidine tag was ampliﬁed [forward primer, 5′-

AAGCTTGAGCCCGAGCCATGCGGACCG−HindIII; reverse pri-

mer, 5′-CTCGAGTTAGTGGTGGTGGTGGTGGTGCTTTCT-

ACTCGGGTTTC−XhoI] and cloned into HindIII/XhoI digested

pCDNA 3.1 vector (Invitrogen, Carlsbad, CA, USA). HEK293 wild-

type cells (American Type Culture Collection, Manassas, VA, USA)

were cultured at 37 °C in a humidiﬁed incubator (5% CO₂) using

1

oil: yield, 45% (0.05 g); H NMR (DMSO-d₆), δ 1.07 (d, J = 6.3 Hz,

6H), 1.27−1.40 (m, 4H), 1.51−1.66 (m, 8H), 2.53−2.60 (m, 4H),

2.90 (s, 3H, minor rotamer), 2.91 (s, 3H, major rotamer), 3.92−4.02

O

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Dulbecco’s modiﬁed Eagle’s medium (DMEM) containing 10% fetal

bovine serum and 1% penicillin−streptomycin and transfected with h-

NAAA(6× His)-pCDNA3.1 construct using JetPEI transfection

reagent (Polyplus, Illkirch, France) following the manufacturer’s

instructions. Stably transfected cells were selected by addition of

G418 1 mg/mL to the cell culture media, and cell clones were then

generated by limiting dilution plating. Growing clones were analyzed

by Western blot (mAb anti-hASAHL, R&D Systems) for their capacity

to produce h-NAAA and further characterized by the activity assay

described below.

acetone, vortexed, and centrifuged at 14000 rpm for 10 min. The

supernatant was removed, and pelletted h-NAAA was resuspended

with Rapigest 0.5% (Waters, Milford, MA, USA) and digested with

trypsin (DigestTip Trypsin, ProteoGen Bio, Italy). Prior to digestion, a

small aliquot was run on SDS-PAGE to verify h-NAAA activation.

High-Resolution NanoLC-MS/MS Analysis. Tryptic peptides were

loaded in a NanoAcquity LC system coupled with a Synapt G2 qTOF

mass spectrometer (Waters) equipped with a nanospray ion source.

The analytical column was a Waters BEH C18 75 μm × 10 cm

working at 300 nL/min. Eluents were A, H₂O + 0.1% HCOOH, and

B, CH₃CN + 0.1% HCOOH. A linear gradient from 3 to 55% of B in

30 min was applied to the column followed by a ramp to 90% in 10

min, an isocratic step at 90% for 10 min, and a reconditioning to 3% of

B. Mass spectrometry parameters were as follows: spray, 1.8 kV; cone,

25 V. Data-dependent acquisition of tandem mass spectra was

activated for doubly charged ions in the m/z 300−800 range. A linear

ramp of the collision energy from 15 to 35 eV was applied to the

precursor ion to collect tandem mass spectra. Glucoﬁbrinopeptide

(500 nM) infused at 500 nL/min was used as lockspray mass. MS/MS

data were analyzed using the Biolynx software embedded in the

MassLynx software suite. MassLynx and Protein Lynx softwares

(Waters) were used for the interpretation of LC-MS data.

Rat Fatty Acid Amide Hydrolase (r-FAAH). Compounds were

preincubated for 10 min with 50 μg of proteins from rat brain

homogenates, followed by 30 min of incubation at 37 °C with

[³H]anandamide (1 μM cold AEA/0.6 nM [³H]AEA (arachidonyl-

[

¹⁻³H]ethanolamine, 60 Ci/mmol, 1 mCi/mL; American Radiolabel

Chemicals, Inc., St. Louis, MO, USA) in assay buﬀer (50 mM TRIS,

pH 7.4, 0.05% fatty acid free BSA). The reaction was stopped with

cold CHCl₃/CH₃OH 1:1, and the aqueous phase was counted by

liquid scintillation (Microbeta2 Lumijet, Perkin-Elmer Inc., Boston,

MA, USA).⁴⁹

Rat Acid Ceramidase (r-AC). Compounds were preincubated for 30

min at 37 °C with 25 μg of enzyme derived from rat AC-

overexpressing HEK293 cells in assay buﬀer (100 mM NaH₂PO₄,

100 mM trisodium citrate dehydrate, 0.1% Triton-X 100, 3 mM DTT,

pH 4.5).²⁴N-Lauroyl ceramide 100 μM (Nu-Chek Prep) was added as

substrate and analyzed by LC-MS in the negative-ion mode using

heptadecanoic acid (HDA, NuChek Prep) as internal standard (m/z

199 for lauric acid, m/z 269 for HDA).

ASSOCIATED CONTENT

■

S

* Supporting Information

Detailed experimental procedures, analytical and spectroscop-

ical data of intermediate and ﬁnal compounds, and ¹H and ¹³

C

NMR spectra of compounds 4, 14i,k,q, and 22; additional

computational details on the reaction mechanism and

proteomic data of S-acylated h-NAAA tryptic peptide with

14q. This material is available free of charge via the Internet at

http://pubs.acs.org.

c. Computational Methods. Quantum chemical calculations were

performed by means of the Gaussian 09 (G09) program suite.⁵⁰For all

stationary points, both geometry and analytical frequency calculations

were carried out at the DFT level, using the B3LYP functional.⁵¹The

employed basis set was Pople’s 6-311G++(d,p). All calculations were

performed in implicit water using the C-PCM solvent model.⁵²To

mimic the nucleophilic attack of the reactive cysteine, we built four

model systems composed of a cysteamine molecule, in its zwitterionic

form, and each of the compounds 4 and 19−21. The molecules were

truncated at the ﬁrst carbon atom linked to the carbamate moiety and

therefore modeled as O-methyl carbamate. Each Michaelis complex

was built as reported by Lodola et al.⁵³Then, we performed a scan on

the potential energy surface using as reaction coordinate the distance

between the sulfur atom of the cysteamine molecule and the carbon

atom of the carbonyl group of the β-lactone ring. These calculations

allowed us to identify the TS structures, which were further

characterized by analyzing the Hessian matrix. In particular, at the

TS, the diagonalized mass-weighted Hessian matrix showed only one

negative eigenvalue, revealing in all of the reactions a ﬁrst-order saddle

point. Moreover, for each identiﬁed saddle point, the corresponding

normal mode (related to the negative eigenvalue) involved nuclear

displacements along the investigated reaction coordinate. Finally, to

conﬁrm the reaction path, we performed intrinsic reaction coordinate

(IRC) calculations.

d. Proteomics. h-NAAA Expression and Puriﬁcation. The best

producing h-NAAA−HEK clone was adapted to serum-free growing

condition (free style medium, Invitrogen) and cultivated in spinning

culture at 37 °C in a humidiﬁed incubator (8% CO₂). The cell medium

was harvested every 48 h and stored at −20 °C until use. For

puriﬁcation, 400 mL of clariﬁed cell supernatant was incubated

overnight with 3 mL of NiNTA (Qiagen) at 4 °C under stirring. The

collected aﬃnity resin was washed with a buﬀer of 20 mM Hepes, pH

7.0, 300 mM NaCl, and 20 mM imidazole. Proteins were eluted with

the same buﬀer containing 500 mM imidazole and then dialyzed

overnight with a buﬀer without imidazole.

AUTHOR INFORMATION

Corresponding Author

■

*(D.P.) E-mail: piomelli@uci.edu. (T.B.) Phone: +39-010-

71781533. Fax: +39-010-71781228. E-mail: tiziano.bandiera@

iit.it.

Notes

The authors declare the following competing ﬁnancial

interest(s): Piomelli, D.; Bandiera, T.; Mor, M.; Tarzia, G.;

Bertozzi, F.; Ponzano, S. are inventors in the patent application

WO 2013078430 protecting the class of compounds disclosed

in this paper.

ACKNOWLEDGMENTS

■

We thank Sine Mandrup Bertozzi for reverse phase and chiral

HPLC puriﬁcations, Luca Goldoni for NMR technical support,

Silvia Venzano for compounds handling, and Dr. Natalia

Realini and Clara Albani for r-AC and r-FAAH screenings,

respectively.

ABBREVIATIONS USED

■

FAEs, fatty acid ethanolamides; OEA, oleoylethanolamide;

PEA, palmitoylethanolamide; NAAA, N-acylethanolamine acid

amidase; FAAH, fatty acid amide hydrolase; AC, acid

ceramidase; PPAR-α, peroxisome proliferator-activated recep-

tor-α; HMGS, 3-hydroxy-3-methylglutaryl-CoA synthase; (S)-

OOPP and (R)-OOPP, (S)- and (R)-N-(2-oxo-3-oxetanyl)-3-

phenylpropionamide; CDI, 1,1′-carbonyldiimidazole; DPC, di-

2-pyridyl carbonate; DMAP, 4-dimethylaminopyridine; TS,

transition state; E_a, activation energy; DFT, density functional

theory; LHMDS, lithium bis(trimethylsilyl)amide; PyBOP,

benzotriazol-1-yloxytris(pyrrolidino)phosphonium hexaﬂuoro-

Sample Preparation. A 5.0 μM solution of puriﬁed h-NAAA was

incubated in 100 mM sodium phosphate buﬀer, 100 mM sodium

citrate, 3 mM TCEP, and 0.1% Triton X-100, pH 4.5, for 90 min at 37

°C. 14q was then added to a ﬁnal 5.0 μM concentration, and the

solution was incubated for a further 90 min (0.5% ﬁnal DMSO). A

control sample with 0.5% DMSO only was also prepared. At the end of

the incubation, samples were precipitated with 10 volumes of ice-cold

P

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(17) Ueda, N.; Yamanaka, K.; Yamamoto, S. Purification and

characterization of an acid amidase selective for N-palmitoylethanol-

amine, a putative endogenous anti-inflammatory substance. J. Biol.

Chem. 2001, 276, 35552−35557.

phosphate; HBTU, [2-(1H-benzotriazol-1-yl)-1,1,3,3-tetrame-

thylaminium hexaﬂuorophosphate; TBTU, 2-(1H-benzotriazol-

1-yl)-1,1,3,3-tetramethylaminium tetraﬂuoroborate.

(18) Tsuboi, K.; Sun, Y. X.; Okamoto, Y.; Araki, N.; Tonai, T.; Ueda,

N. Molecular characterization of N-acylethanolamine-hydrolyzing acid

amidase, a novel member of the choloylglycine hydrolase family with

structural and functional similarity to acid ceramidase. J. Biol. Chem.

2005, 280, 11082−11092.

REFERENCES

■

(1) Piomelli, D. A fatty gut feeling. Trends Endocrinol. Metab. 2013,

24, 332−341.

(2) Piomelli, D.; Giuffrida, A.; Calignano, A.; Rodríguez de Fonseca,

F. The endocannabinoid system as a target for therapeutic drugs.

Trends Pharmacol. Sci. 2000, 21, 218−224.

(19) Tsuboi, K.; Takezaki, N.; Ueda, N. The N-acylethanolamine

hydrolyzing acid amidase (NAAA). Chem. Biodivers. 2007, 4, 1914−

1925.

(3) Calignano, A.; La Rana, G.; Giuffrida, A.; Piomelli, D. Control of

pain initiation by endogenous cannabinoids. Nature 1998, 394, 277−

281.

́

(20) Desarnaud, F.; Cadas, H.; Piomelli, D. Anandamide

amidohydrolase activity in rat brain microsomes. Identification and

partial characterization. J. Biol. Chem. 1995, 11, 6030−6035.

(21) Vandevoorde, S.; Tsuboi, K.; Ueda, N.; Jonsson, K.-O.; Fowler,

C. J.; Lambert, D. M. Esters, retroesters, and a retroamide of palmitic

acid: pool for the first selective inhibitors of N-palmitoylethanolamine-

selective acid amidase. J. Med. Chem. 2003, 46, 4373−4376.

(22) Tsuboi, K.; Hilligsmann, C.; Vandevoorde, S.; Lambert, D. M.;

Ueda, N. N-Cyclohexanecarbonylpentadecylamine: a selective inhib-

itor of the acid amidase hydrolysing N-acylethanolamines, as a tool to

distinguish acid amidase from fatty acid amide hydrolase. Biochem. J.

2004, 379, 99−106.

(4) Fu, J.; Gaetani, S.; Oveisi, F.; Lo Verme, J.; Serrano, A.;

Rodriguez de Fonseca, F.; Rosengarth, A.; Luecke, H.; Di Giacomo, B.;

Tarzia, G.; Piomelli, D. Oleylethanolamide regulates feeding and body

weight through activation of the nuclear receptor PPAR-α. Nature

2003, 425, 90−93.

(5) LoVerme, J.; Russo, R.; La Rana, G.; Fu, J.; Farthing, J.; Mattace-

Raso, G.; Meli, R.; Hohmann, A.; Calignano, A.; Piomelli, D. Rapid

broad-spectrum analgesia through activation of peroxisome prolifer-

ator-activated receptor-α. J. Pharmacol. Exp. Ther. 2006, 319, 1051−

1061.

(23) Saturnino, C.; Petrosino, S.; Ligresti, A.; Palladino, C.;

DeMartino, G.; Bisogno, T.; Di Marzo, V. Synthesis and biological

evaluation of new potential inhibitors of N-acylethanolamine hydro-

lyzing acid amidase. Bioorg. Med. Chem. Lett. 2010, 20, 1210−1213.

(24) Solorzano, C.; Zhu, C.; Battista, N.; Astarita, G.; Lodola, A.;

Rivara, S.; Mor, M.; Russo, R.; Maccarrone, M.; Antonietti, F.; Duranti,

A.; Tontini, A.; Cuzzocrea, S.; Tarzia, G.; Piomelli, D. Selective N-

acylethanolamine-hydrolyzing acid amidase inhibition reveals a key

role for endogenous palmitoylethanolamide in inflammation. Proc.

Natl. Acad. Sci. U.S.A. 2009, 106, 20966−20971.

(25) Solorzano, C.; Antonietti, F.; Duranti, A.; Tontini, A.; Rivara, S.;

Lodola, A.; Vacondio, F.; Tarzia, G.; Piomelli, D.; Mor, M. Synthesis

and structure−activity relationships of N-(2-oxo-3-oxetanyl)amides as

N-acylethanolamine-hydrolyzing acid amidase inhibitors. J. Med. Chem.

2010, 53, 5770−5781.

(26) Yamano, Y.; Tsuboi, K.; Hozaki, Y.; Takahashi, K.; Jin, X-H;

Ueda, N.; Wada, A. Lipophilic amines as potent inhibitors of N-

acylethanolamine-hydrolyzing acid amidase. Bioorg. Med. Chem. 2012,

20, 3658−3665.

(27) Li, Y.; Yang, L.; Chen, L.; Zhu, C.; Huang, R.; Zheng, X.; Qiu, X.

Y.; Fu, J. Design and synthesis of potent N-acylethanolamine-

hydrolyzing acid amidase (NAAA) inhibitor as anti-inflammatory

compounds. PLoS One 2012, 7, e43023.

(28) Duranti, A.; Tontini, A.; Antonietti, F.; Vacondio, F.; Fioni, A.;

Silva, C.; Lodola, A.; Rivara, S.; Solorzano, C.; Piomelli, D.; Tarzia, G.;

Mor, M. N-(2-Oxo-3-oxetanyl)-carbamic acid esters as N-acylethanol-

amine acid amidase inhibitors: synthesis and structure-activity and

structure-property relationships. J. Med. Chem. 2012, 55, 4824−4836.

(29) Rossocha, M.; Schultz-Heienbrok, R.; von Moeller, H.;

Coleman, J. P.; Saenger, W. Conjugated bile acid hydrolase is a

tetrameric N-terminal thiol hydrolase with specific recognition of its

cholyl but not of its tauryl product. Biochemistry 2005, 44, 5739−5748.

(30) Zhao, L.-Y.; Tsuboi, K.; Okamoto, Y.; Nagahata, S.; Ueda, N.

Proteolytic activation and glycosylation of N-acylethanolamine hydro-

lyzing acid amidase, a lysosomal enzyme involved in the

endocannabinoid metabolism. Biochim. Biophys. Acta 2007, 1771,

1397−1405.

(31) Wang, J.; Zhao, L.-Y.; Uyama, T.; Tsuboi, K.; Tonai, T.; Ueda,

N. Amino acid residues crucial in pH regulation and proteolytic

activation of N-acylethanolamine-hydrolyzing acid amidase. Biochim.

Biophys. Acta 2008, 1781, 710−717.

(32) West, J. M.; Zvonok, N.; Whitten, K. M.; Wood, J. T.;

Makriyannis, A. Mass spectrometric characterization of human N-

acylethanolamine-hydrolyzing acid amidase. J. Proteome Res. 2012, 11,

972−981.

(6) Schwartz, G. J.; Fu, J.; Astarita, G.; Li, X.; Gaetani, S.;

Campolongo, P.; Cuomo, V.; Piomelli, D. The lipid messenger OEA

links dietary fat intake to satiety. Cell Metab. 2008, 8, 281−288.

(7) LoVerme, J.; La Rana, G.; Russo, R.; Calignano, A.; Piomelli, D.

The search for the palmitoylethanolamide receptor. Life Sci. 2005, 14,

1685−1698.

(8) Berdyshev, E.; Boichot, E.; Corbel, M.; Germain, N.; Lagente, V.

Effects of cannabinoid receptor ligands on LPS-induced pulmonary

inflammation in mice. Life Sci. 1998, 63, PL125−PL129.

(9) D’Agostino, G.; La Rana, G.; Russo, R.; Sasso, O.; Iacono, A.;

Esposito, E.; Raso, G. M.; Cuzzocrea, S.; Lo Verme, J.; Piomelli, D.;

Meli, R.; Calignano, A. Acute intracerebroventricular administration of

palmitoylethanolamide, an endogenous peroxisome proliferator-

activated receptor-α agonist, modulates carrageenan-induced paw

edema in mice. J. Pharmacol. Exp. Ther. 2007, 322, 1137−1143.

(10) Mazzari, S.; Canella, R.; Petrelli, L.; Marcolongo, G.; Leon, A.

N-(2-Hydroxyethyl)-hexadecanamide is orally active in reducing

edema formation and inflammatory hyperalgesia by down-modulating

mast cell activation. Eur. J. Pharmacol. 1996, 300, 227−236.

(11) Calignano, A.; La Rana, G.; Piomelli, D. Antinociceptive activity

of the endogenous fatty acid amide, palmitylethanolamide. Eur. J.

Pharmacol. 2001, 419, 191−198.

(12) LoVerme, J.; Russo, R.; La Rana, G.; Fu, J.; Farthing, J.; Mattace-

Raso, G.; Meli, R.; Hohmann, A.; Calignano, A.; Piomelli, D. Rapid

broad-spectrum analgesia through activation of peroxisome prolifer-

ator-activated receptor-α. J. Pharmacol. Exp. Ther. 2006, 319, 1051−

1061.

(13) Khasabova, I. A.; Xiong, Y.; Coicou, L. G.; Piomelli, D.; Seybold,

V. Peroxisome proliferator-activated receptor α mediates acute effects

of palmitoylethanolamide on sensory neurons. J. Neurosci. 2012, 37,

12735−12743.

(14) Kemeny, L.; Koreck, A.; Kis, K.; Kenderessy-Szabo, A.; Bodai,

L.; Cimpean, A.; Paunescu, V.; Raica, M.; Ghyczy, M. Endogenous

phospholipid metabolite containing topical product inhibits ultraviolet

light-induced inflammation and DNA damage in human skin. Skin

Pharmacol. Physiol. 2007, 20, 155−161.

(15) Keppel Hesselink, J. M.; Hekker, T. A. M. Therapeutic utility of

palmitoylethanolamide in the treatment of neuropathic pain associated

with various pathological conditions: a case series. J. Pain Res. 2012, 5,

437−442.

(16) Leung, D.; Saghatelian, A.; Simon, G. M.; Cravatt, B. F.

Inactivation of N-acyl phosphatidylethanolamine phospholipase D

reveals multiple mechanisms for the biosynthesis of endocannabinoids.

Biochemistry 2006, 45, 4720−4726.

Q

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(33) West, J. M.; Zvonok, N.; Whitten, K. M.; Vadivel, S. K.;

Bowman, A. L.; Makriyannis, A. Biochemical and mass spectrometric

characterization of human N-acylethanolamine-hydrolyzing acid

amidase inhibition. PLoS One 2012, 7, e43877.

(34) Mayer, R. J.; Louis-Flamberg, P.; Elliott, J. D.; Fisher, M.; Leber,

J. Inhibition of 3-hydroxy-3-methylglutaryl coenzyme A synthase by

antibiotic 1233A and other β-lactones. Biochem. Biophys. Res. Commun.

1990, 169, 610−616.

(35) Lall, M. S.; Ramtohul, Y. K.; James, M. N. G.; Vederas, J. C.

Serine and threonine β-lactones: a new class of hepatitis A virus 3C

cysteine proteinase inhibitors. J. Org. Chem. 2002, 67, 1536−1547.

(36) Pu, Y.; Lowe, C.; Sailer, M.; Vederas, J. C. Synthesis, stability,

and antimicrobial activity of (+)-obafluorin and related β-lactone

antibiotics. J. Org. Chem. 1994, 59, 3642−3655.

Ehara, M.; Toyota, K.; Fukuda, R.; Hasegawa, J.; Ishida, M.; Nakajima,

T.; Honda, Y.; Kitao, O.; Nakai, H.; Vreven, T.; Montgomery, J. A., Jr.;

Peralta, J. E.; Ogliaro, F.; Bearpark, M.; Heyd, J. J.; Brothers, E.; Kudin,

K. N.; Staroverov, V. N.; Kobayashi, R.; Normand, J.; Raghavachari, K.;

Rendell, A.; Burant, J. C.; Iyengar, S. S.; Tomasi, J.; Cossi, M.; Rega,

N.; Millam, N. J.; Klene, M.; Knox, J. E.; Cross, J. B.; Bakken, V.;

Adamo, C.; Jaramillo, J.; Gomperts, R.; Stratmann, R. E.; Yazyev, O.;

Austin, A. J.; Cammi, R.; Pomelli, C.; Ochterski, J. W.; Martin, R. L.;

Morokuma, K.; Zakrzewski, V. G.; Voth, G. A.; Salvador, P.;

̈

Dannenberg, J. J.; Dapprich, S.; Daniels, A. D.; Farkas, O.;

Foresman, J. B.; Ortiz, J. V.; Cioslowski, J.; Fox, D. J. Gaussian 09,

revision A.2; Gaussian, Inc., Wallingford CT, 2009.

(51) Becke, A. D. A new mixing of Hartree-Fock and local density-

functional theories. J. Chem. Phys. 1993, 98, 1372−1377.

(52) Cossi, M.; Rega, N.; Scalmani, G.; Barone, V. Energies,

structures, and electronic properties of molecules in solution with the

C-PCM solvation model. J. Comput. Chem. 2003, 24, 669−681.

(53) Lodola, A.; Branduardi, D.; De Vivo, M.; Capoferri, L.; Mor, M.;

Piomelli, D.; Cavalli, A. A catalytic mechanism for cysteine N-terminal

nucleophile hydrolases, as revealed by free energy simulations. PLoS

One 2012, 7, e32397.

(37) Armirotti, A.; Romeo, E.; Ponzano, S.; Mengatto, L.; Dionisi,

M.; Karacsonyi, C.; Bertozzi, F.; Garau, G.; Tarozzo, G.; Reggiani, A.;

Bandiera, T.; Tarzia, G.; Mor, M.; Piomelli, D. β-Lactones inhibit N-

acylethanolamine acid amidase by S-acylation of the catalytic N-

terminal cysteine. ACS Med. Chem. Lett. 2012, 3, 422−426.

(38) D’Addona, D.; Bochet, C. G. Preparation of carbamates from

amines and alcohols under mild conditions. Tetrahedron Lett. 2001, 42,

5227−5229.

(39) Kim, S.; Lee, J. I. tert-Butyl 2-pyridyl carbonate. A useful reagent

for tert-butoxycarbonylation of amino acids. Chem. Lett. 1984, 2, 237−

238.

(40) Kim, S.; Lee, J. I.; Yi, K. Y. New amino-protective reagents for

tert-butoxycarbonylation and benzyloxycarbonylation of amines and

amino acids. Bull. Chem. Soc. Jpn. 1985, 58, 3570−3575.

(41) Ghosh, A. K.; Duong, T. T.; McKee, S. P. Di-(2-pyridyl)

carbonate promoted alkoxycarbonylation of amines: a convenient

synthesis of functionalized carbamates. Tetrahedron Lett. 1991, 32,

4251−4254.

(42) Shiina, I.; Suenaga, Y.; Nakano, M.; Mukaiyama, T. A

convenient method for the preparations of carboxamides and peptides

by using di-(2-pyridyl)-carbonate and o,o′-di-(2-pyridyl)-thiocarbonate

as dehydrating reagents. Bull. Chem. Soc. Jpn. 2000, 73, 2811−2818.

(43) Machin, P. J.; Hurst, D. N.; Bradshaw, R. M.; Blaber, L. C.;

Burden, D. T.; Fryer, A. D.; Melarange, R. A.; Shivdasanit, C. β₁-

Selective adrenoceptor antagonists. 4-Ether-linked phenoxy-propanol-

amines. J. Med. Chem. 1983, 26, 1570−1576.

(44) Khalaf, A. A.; Roberts, R. Friedel-Crafts cyclialkylations of

certain mono- and diphenyl-substituted alcohols and alkyl chlorides. J.

Org. Chem. 1972, 37, 4227−4235.

(45) Ellis, G. L.; Amewu, R.; Hall, C.; Rimmer, K.; Ward, S. A.;

O’Neil, P. M. An efficient route into synthetically challenging bridged

achiral 1,2,4,5-tetraoxanes with antimalarial activity. Bioorg. Med. Chem.

Lett. 2008, 18, 1720−1724.

(46) Sasso, O.; Moreno-Sanz, G.; Martucci, C.; Realini, N.; Dionisi,

M.; Mengatto, L.; Duranti, A.; Tarozzo, G.; Tarzia, G.; Mor, M.;

Bertorelli, R.; Reggiani, A.; Piomelli, D. Antinociceptive effects of the

N-acylethanolamine acid amidase inhibitor ARN077 in rodent pain

models. Pain 2013, 154, 350−360.

(47) Chiral HPLC puriﬁcation of diastereomeric mixtures 14m and

14o aﬀorded the corresponding pure diastereoisomers. No absolute

conﬁguration of the newly formed stereocenter was assigned. The

activities of single diastereoisomers were the following, for 14m: isomer

1 IC₅₀= 0.018 0.009 μM, isomer 2 IC₅₀= 5.1 1.7 μM, and for 14o:

isomer 1 IC₅₀= 0.08 0.03 μM, isomer 2 IC₅₀= 12.2 4.32 μM.

(48) McKinney, M. K.; Cravatt, B. F. Structure and function of fatty

acid amide hydrolase. Annu. Rev. Biochem. 2005, 74, 411−432.

(49) Kathuria, S.; Gaetani, S.; Fegley, D.; Valino, F.; Duranti, A.;

Tontini, A.; Mor, M.; Tarzia, G.; La Rana, G.; Calignano, A.; Giustino,

A.; Tattoli, M.; Palmery, M.; Cuomo, V.; Piomelli, D. Modulation of

anxiety through blockade of anandamide hydrolysis. Nat. Med. 2003, 9,

76−81.

(50) Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.;

Robb, M. A.; Cheeseman, J. R.; Scalmani, G.; Barone, V.; Mennucci,

B.; Petersson, G. A.; Nakatsuji, H.; Caricato, M.; Li, X.; Hratchian, H.

P.; Izmaylov, A. F.; Bloino, J.; Zheng, G.; Sonnenberg, J. L.; Hada, M.;

R

dx.doi.org/10.1021/jm400739u | J. Med. Chem. XXXX, XXX, XXX−XXX

Article Doi

Synthesis and structure-activity relationship (SAR) of 2-methyl-4-oxo-3- oxetanylcarbamic acid esters, a class of potent N-acylethanolamine acid amidase (NAAA) inhibitors

DOI: 10.1021/jm400739u

Source and publish data:

Authors:

Article abstract of DOI:10.1021/jm400739u

Full text of DOI:10.1021/jm400739u

Products guided by the article

R&D Labs maybe for 1439366-81-0

Relevant to this article

Hot Product