Anti-inflammatory terpenes from Schefflera rubriflora C. J. Tseng & G. Hoo with their TNF-α and IL-6 inhibitory activities

Article abstract of DOI:10.1016/j.phytochem.2019.03.021

The 95% ethanol extract and its EtOAc and n-BuOH fractions obtained from the leaves and twigs of Schefflera rubriflora C. J. Tseng & G. Hoo showed significant inhibitory activities (33.6%, 35.7% and 40.6%, respectively) against croton oil-induced ear inflammation in mice. Bioactivity-guided isolation and separation gave eight previously undescribed terpenes or terpene glycosides. Structural elucidation was based on UV, IR, and NMR spectroscopy, MS, experimental and calculated ECD data, and Mosher's method. To identify anti-inflammatory components from the extract, all the compounds were evaluated for tumor necrosis factor-α (TNF-α) and interleukine-6 (IL-6) inhibitory activities. Four undescribed compounds inhibited mRNA expression of TNF-α and IL-6 with IC₅₀ values of 15.3–52.4 μM.

Full text of DOI:10.1016/j.phytochem.2019.03.021

Phytochemistry163(2019)23–32
Contents lists available at ScienceDirect
Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem
Anti-inflammatory terpenes from Schefflera rubriflora C. J. Tseng & G. Hoo
with their TNF-α and IL-6 inhibitory activities
Fenghua Lia, Jian Zhangb, Mingbao Lina, Xianming Sua, Changkang Lia, Hongqing Wanga,
Baoming Lia, Ruoyun Chena, Jie Kanga,∗
a State Key Laboratory of Bioactive Substances and Functions of Natural Medicines, Institute of Materia Medica, Chinese Academy of Medical Sciences & Peking Union
Medical College, No. 1 Xiannongtan Street, Beijing 100050, China
b Department of Bioengineering, Zhuhai Campus of Zunyi Medical University, Zhuhai 519041, China
A R T I C L E I N F O
A B S T R A C T
Keywords:
The 95% ethanol extract and its EtOAc and n-BuOH fractions obtained from the leaves and twigs of Schefflera
rubriflora C. J. Tseng & G. Hoo showed significant inhibitory activities (33.6%, 35.7% and 40.6%, respectively)
against croton oil-induced ear inflammation in mice. Bioactivity-guided isolation and separation gave eight
previously undescribed terpenes or terpene glycosides. Structural elucidation was based on UV, IR, and NMR
spectroscopy, MS, experimental and calculated ECD data, and Mosher's method. To identify anti-inflammatory
components from the extract, all the compounds were evaluated for tumor necrosis factor-α (TNF-α) and in-
terleukine-6 (IL-6) inhibitory activities. Four undescribed compounds inhibited mRNA expression of TNF-α and
IL-6 with IC50 values of 15.3–52.4 μM.
Schefflera rubriflora C. J. Tseng & G. Hoo
Araliaceae
Terpene
Anti-inflammatory activity
TNF-α
IL-6
1. Introduction
responses. Tumor necrosis factor-α (TNF-α) and interleukine-6 (IL-6)
are the most potent mediators of the immune response by macrophages,
The Schefflera genus in the Araliaceae family includes about 1100
species worldwide, of which 35 are distributed in the south of China
(Wang et al., 2014; Wu et al., 2007). Some species have been used as
folk medicines to treat pain, such as that due to rheumatoid arthritis,
traumatic injury, fever, and sprains (Hu et al., 1998; Wu et al., 1990). In
previous studies of the genus, triterpenes, diterpenes, sesquiterpenes,
lignans, and phenolic acids have been identified as bioactive con-
stituents (Nguyen et al., 2015; Wang et al., 2013), some of which re-
portedly possess anti-inflammatory, antifungal, antiviral, and cytotoxic
activities (Cioffi et al., 2003; Li et al., 2007; Muir et al., 1982; Wu et al.,
2014). The leaves and twigs of Schefflera kwangsiensis are used to pre-
pare Campo Peach Twig Tablets, which are recorded in the Chinese
Pharmacopoeia (2010) (Sang et al., 2015) and are currently commer-
cially available as anti-inflammatory and analgesic drugs. Our recent
studies of bioactive triterpenoid saponins from S. kwangsiensis (Wang
et al., 2014, 2016) inspired our further study of another folk medicine
from the same genus, Schefflera rubriflora C. J. Tseng & G. Hoo, for
which the phytochemistry and bioactivity have not been reported.
Inflammatory cytokines are a class of endogenous polypeptides
produced by immune system cells to mediate various immune
and both are known to be involved in pain, stiffness, and swelling re-
sponses (Lai et al., 2018; Liu et al., 2017; Luo et al., 2018). Previous
studies have indicated that exposure to lipopolysaccharide (LPS) can
effectively promote the mRNA expression of TNF-α and IL-6 in RAW
264.7 macrophages (Kong et al., 2019; You et al., 2013). Therefore,
inhibiting TNF-α and IL-6 activation might be clinically effective in
patients with pain and inflammation.
In this study, a 95% ethanol extract of S. rubriflora leaves and twigs
significantly inhibited ear inflammation in mice caused by croton oil
(33.6% inhibition), suggesting potential anti-inflammatory bioactivity.
In the further search for anti-inflammatory compounds, the activity-
guided isolation of the EtOAc and n-BuOH fractions of the 95% ethanol
extract was performed, which demonstrated 35.7% and 40.6% inhibi-
tions of croton oil-induced ear inflammation in mice, respectively. Eight
undescribed terpenes (1–8) were obtained, with compounds 2–5 ex-
hibiting moderate TNF-α and IL-6 inhibition in vitro, consistent with the
anti-inflammatory bioactivities of the 95% ethanol extract and its
EtOAc and n-BuOH fractions in vivo.
This paper describes the isolation, structural elucidation, and eva-
luation of the anti-inflammatory activities of these compounds.
∗ Corresponding author.
E-mail addresses: lifenghua@imm.ac.cn (F. Li), jianzhang@hotmail.com (J. Zhang), mingbaolin@imm.ac.cn (M. Lin), sxmxiaomuchong@163.com (X. Su),
chklee2015@163.com (C. Li), wanghongqing@imm.ac.cn (H. Wang), libaoming@imm.ac.cn (B. Li), rych@imm.ac.cn (R. Chen), jiekang@imm.ac.cn (J. Kang).
https://doi.org/10.1016/j.phytochem.2019.03.021
Received 30 December 2018; Received in revised form 19 March 2019; Accepted 22 March 2019
0031-9422/©2019ElsevierLtd.Allrightsreserved.

F. Li, et al.
Phytochemistry163(2019)23–32
Fig. 1. Structures of compounds 1–8.
2. Results and discussion
NOEs of H-11 (δH 3.87, m)/H3-25 (δH 1.05, s) showed that the 11-OCH3
group had an α-orientation (Fig. 2). Therefore, compound 1 was iden-
tified as 3-oxo-11α-methoxy-olean-12-en-28-oic acid.
The EtOAc fraction of the 95% EtOH extract of S. rubriflora leaves
and twigs yielded two undescribed triterpenes (1 and 2), whereas the n-
BuOH fraction yielded five undescribed compounds: one diterpene
glycoside (3), two megastigmane glycosides (4 and 5), and three ses-
quiterpene esters (6–8). The structures of 1–8 (Fig. 1) were elucidated
by spectroscopic analysis.
According to the HRESIMS spectrum peak at m/z 451.3542 [M +
Na]+ (calcd. for C29H48NaO2, 451.3546), compound 2 had a molecular
formula of C29H48O2 and showed six degrees of unsaturation. The 1H
NMR spectrum (Table 1) contained peaks for seven singlet methyl
groups [δH 1.23 (2), 1.15, 0.98, 0.95, 0.91, 0.88] and one olefinic
proton [δH 5.31 (1H, m, H-12)]. The 13C NMR spectrum (Table 1) re-
vealed 29 carbon signals, which indicated that 2 was a nortriterpenoid.
The 1D and 2D NMR spectra were consistent with the planar structure
of 28-norolean-12-en-3β,17β-diol (Ikuta, 1992). The main difference
between these two compounds was the 13C NMR signal at C-3. The C-3
signal for compound 2 appeared at δC 75.2 and was 3.0 ppm lower than
that of 28-norolean-12-en-3β,17β-diol (δC 78.2) (Ikuta, 1992), but the
same as that of 3α-hydroxy-11α,12α-epoxyoleanan-28,13β-olide (δC
75.1) (Ikuta, 1992). In addition, the NOEs of H-3 (δH 3.62, m)/H3-23
(δH 0.91, s) and H-3 (δH 3.62, m)/H3-24 (δH 1.23, s) further proved H-3
is in the equatorial orientation (Fig. 3). From the above data, we pre-
sumed that 2 contained a 3α-hydroxy group. Therefore, compound 2
was identified as 28-norolean-12-en-3α,17β-diol.
Compound 1 was assigned with the molecular formula C31H48O4
from the high-resolution electrospray ionization mass spectrometry
(HRESIMS) peak at m/z 483.3479 [M – H]− (calcd. for C31H47O4,
483.3480) in negative ion mode, which suggested that it had eight
degrees of unsaturation. The IR spectrum of 1 suggested the presence of
carbonyl (1756, 1705 cm−1) and olefinic (1603 cm−1) groups. The 1H
NMR spectrum (Table 1) showed seven singlet methyl groups [δH 1.39,
1.35, 1.18, 1.05 (2), 1.00, and 0.94], one methoxy group [δH 3.25 (3H,
s, 11-OCH3)], and one olefinic proton [δH 5.78 (1H, br s, H-12)]. In the
13C NMR spectrum (Table 1), two typical olefinic carbon signals at δC
122.6 and 148.5, a carboxylic carbon signal at δC 181.1, and a carbonyl
carbon signal at δC 216.8 were observed. According to the NMR and
HRESIMS data, the structure of 1 was similar to that of 3-oxoolean-12-
en-28-acid (Li et al., 2012), except that 1 contained an extra methoxy
group at C-11. The positioning of this methoxy at C-11 was deduced
from the heteronuclear multiple bond correlation (HMBC) cross-peaks
of 11-OCH3 (δH 3.25)/C-11 (δC 76.6). Since H-18 may have an α- or β-
orientation in the skeleton of oleanolic acid (Seebacher et al., 2003),
NOE experiments were performed. The strong NOEs of H-18 (δH 3.38,
m)/H3-30 (δH 1.00, s) confirmed the β-orientation of H-18. And the
The molecular formula of compound 3 was assigned as C26H36O11
by HRESIMS analysis (m/z 523.2184 [M – H]−, calcd. for C26H35O11
,
523.2185). The 13C NMR spectrum showed the presence of a C20-gib-
berellin diterpene as an aglycone, and was characterized by two tertiary
methyl groups at δC 29.3 and 15.5, one olefinic carbon at δC 145.4, one
exocyclic methylene carbon at δC 110.5, two carboxyl carbons at δC
178.6 and 175.5, and one keto carbonyl group at δC 207.8. The NOEs of
24

F. Li, et al.
Phytochemistry163(2019)23–32
Table 1
1H NMR and 13C NMR spectroscopic data of compounds 1−5.
Position
1a
2a
position 3b
4c
5d
δH (J in Hz)
δH (J in Hz) δC
δH (J in Hz) δC
δH (J in Hz)
δC
δH (J in Hz)
δC
δC
1
2
1.75, m
2.23, m
2.45, m
2.62, m
40.8, CH2
1.93, m
1.40, m
1.74, m
33.6, CH2
1
2
2.41, m
0.98, m
1.95, m
0.99, m
3.97, m
43.7, CH2
46.3, CH2
40.2, C
39.3, C
38.6, CH2
34.6, CH2
26.3, CH2
1.99, br d (15.2)
1.50, br d (15.2)
4.12, m
3.88, m
2.40, m
39.5, CH2 2.06, br d (15.2)
1.36, br d (15.2)
69.9, CH
84.3, CH
35.2, CH
82.5, C
3
4
5
6
216.8, C
48.2, C
56.0, CH
20.4, CH2
3.62, m
75.2, CH
37.9, C
48.7, CH
18.7, CH2
3
4
5
6
72.5, CH
43.8, C
55.9, CH
49.8, CH
4.05, m
3.85, m
2.36, m
68.4, CH
82.9, CH
33.3, CH
80.2, C
1.37, m
1.50, m
2.54, m
1.57, m
1.47 (m)
1.47, m
1.40, m
1.87, d (12.6)
3.27, d (12.6)
7
8
9
10
11
175.5, C
48.5, C
5.67, br s
5.67, br s
4.41, m
1.28, d (6.4)
1.10, s
135.0, CH 5.55, d (15.7)
135.6, CH 5.73, dd (15.7,6.0) 135.3, CH
71.0, CH
25.2, CH3 1.24, d (6.4)
29.3, CH3 1.11, s
132.9, CH
7
2.03, m
1.82, m
33.4, CH2
42.9, C
33.5, CH2
1.45, dd (10.2,7.8) 52.0, CH
44.7, C
2.36, m
2.11, m
4.29, m
69.4, CH
24.3, CH3
27.8, CH3
8
9
40.2, C
48.1, CH
37.6, C
24.0, CH2 12
122.7, CH 13
145.7, C
42.1, C
26.4, CH2 15
28.1, CH2
16
1.89, d (8.5) 52.5, CH
38.5, C
3.87, m
2.03, m
35.5, CH2
10
11
12
13
14
15
16
76.6, CH
122.6, CH
148.5, C
43.3, C
28.8, CH2
24.0, CH2
1.26, m
5.31, m
207.8, C
56.4, CH
36.7, CH2
0.88, s
1.01, d (7.2)
27.9, CH3 0.85, s
14.6, CH3 1.04, d (7.2)
26.6, CH3
13.1, CH3
5.78, br s
3.06, br s
14
2.00, d (12.0)
1.84, dd (12.0,4.8)
2.20, d (15.6)
2.13, d (15.6)
2.08, m
2.08, m
1.96, m
2.54, m
2.14, m
1.00, m
45.9, CH2
145.4, C
17
18
19
46.9, C
42.2, CH
46.6, CH2
71.0, C
49.4, CH
48.9, CH2 19
20
31.2, C
37.1, CH2 2′
3′
38.8, CH2 4′
5′
29.4, CH3 6′
22.8, CH3
15.4, CH3
18.0, CH3
25.7, CH3
17
18
4.99, s
1.14, s
110.5, CH2
29.3, CH3
178.6, C
15.5, CH3
102.2, CH
73.6, CH
76.8, CH
70.1, CH
76.7, CH
61.1, CH2
3.38, m
1.79, m
1.35, m
1.74, m
1.73, m
0.76, s
20
21
31.4, C
35.2, CH2
1′
4.18, d (7.8)
2.87, t (8.4)
3.12, t (8.4)
3.01, m
3.05, m
3.63, d (11.4)
3.40, dd (11.4,4.8)
4.44, d (8.0)
3.29, t (8.0)
3.49, t (8.0)
3.40, t (8.0)
3.35, m
103.9, CH 4.27, d (7.8)
102.9, CH
75.1, CH
78.2, CH
71.8, CH
78.3, CH
63.0, CH2
1.42, m
1.21, m
1.36, m
1.20, m
1.18, s
1.05, s
1.05, s
1.39, s
1.35, s
1.37, m
1.27, m
1.99, m
75.6, CH
78.8, CH
72.6, CH
78.5, CH
3.28, t (7.8)
3.33, t (7.8)
3.13, t (7.8)
3.24, m
22
33.5, CH2
23
24
25
26
27
28
29
30
27.0, CH3
22.0, CH3
16.9, CH3
19.3, CH3
25.8, CH3
181.1,C
33.6, CH3
24.1, CH3
54.6, OCH3
0.91, s
1.23, s
0.98, s
1.23, s
1.15, s
3.92, d (12.0)
3.72, dd (12.0,5.2)
63.5, CH2 3.86, d (12.0)
3.67, dd (12.0,6.0)
0.94, s
1.00, s
0.88, s
0.95, s
33.0, CH3
24.1, CH3
11-OCH3 3.25, s
a
Recorded in pyridine-d5.
Recorded in DMSO‑d6.
Recorded in D2O.
b
c
d
Recorded in CD3OD.
H-3 (δH 3.97, m)/H3-20 (δH 0.76, s) and H3-20 (δH 0.76, s)/H-6 (δH
3.27, d, J = 12.6 Hz) confirmed that H-3 was α-oriented (Fig. 2).
Therefore, the structure of the aglycone of 3 was consistent with that of
12-oxo-GA14 (Gaskin et al., 1984). The HMBC correlations of H-1′ (δH
4.18, d, J = 7.8 Hz)/C-3 (δC 72.5) indicated that a glucosyl residue was
connected to the hydroxy group at C-3 (Fig. 2). The absolute config-
uration of the sugar unit was identified as D-glucose by HPLC analysis
after acid hydrolysis and derivatization (Su et al., 2018). Compound 3
was identified as 12-oxo-GA14-3-O-β-D-glucopyranoside.
Compound 4 was assigned the molecular formula C19H34O9 from its
HRESIMS results (m/z 429.2087 [M + Na]+, calcd. for C19H34NaO9,
429.2095) and had three degrees of unsaturation. The IR spectrum of 4
showed absorption bands at 3368, 1452, and 1079 cm−1, which in-
dicated the presence of hydroxy, olefinic, and ether groups, respec-
tively. The peaks in the 1H NMR, 13C NMR, HSQC, and HMBC spectra of
4, except for the six signals of the glucosyl unit, were consistent with
the planar structure of wilsonol B (Shu et al., 2013). According to the
HMBC correlations of H-1′ (δH 4.44, d, J = 8.0 Hz)/C-4 (δC 84.3), the
sugar moiety was attached to the 4-position of the aglycone (Fig. 2). To
further unambiguously confirm the relative and absolute configurations
of 4, its aglycone (4a) was obtained using enzymatic hydrolysis (Gu
et al., 2013). The relative configuration of 4a was determined from the
coupling constants (see 4.5.1) and NOE data (Fig. 3). The NOEs of H-5
(δH 2.23)/H-7 (δH 5.55) and H-5 (δH 2.23)/H3-11 (δH 1.14) determined
the axial-axial relationships between H-5 and H-11, and between H-5
and H-7, the latter of which confirmed the substituting group con-
taining H-7 is equatorially oriented (Fig. 3). It also clarified the same
orientations (β) of H-5, H-7, and H-11. In addition, the JH-5-H-4 (2.8 Hz)
and JH-4-H-3 (3.2 Hz) values confirmed axial-equatorial and equatorial-
equatorial couplings, respectively. The absolute configuration of C-9 in
the side chain of 4a was determined to be R using Mosher's method
(Fig. S98) (Shu et al., 2013). The absolute configuration of the cyclo-
hexane ring in 4a was established by comparing experimental and
calculated electronic circular dichroism (ECD) data (Fig. 4), which gave
only two possible candidate stereoisomers, 4a-1 and 4a-2 (Fig. 4).
Conformational analysis of 4a-1 showed nine lowest-energy con-
formers. These conformers were further optimized at the B3LYP/6-
31G(d) level. The ECD spectra of the different conformers were simu-
lated with a half-bandwidth of 0.35 eV, and the overall theoretical ECD
spectra were obtained according to the Boltzmann weighting of each
conformer. The experimental ECD spectrum of 4a [λmax (Δε) 200
(−3.63)] was similar to the calculated ECD curve of 4a-1 (3S, 4S, 5R,
6R), but the opposite of that of 4a-2 (3R, 4R, 5S, 6S) (Fig. 4). Therefore,
the relative and absolute configurations of 4a were totally consistent
25

F. Li, et al.
Phytochemistry163(2019)23–32
Fig. 2. Key HMBC correlations (blue arrow) and NOEs (red arrow) of compounds 1–8. (For interpretation of the references to colour in this figure legend, the reader
is referred to the Web version of this article.)
with those of wilsonol B (Shu et al., 2013). The absolute configuration
of the sugar unit was assigned as D-glucose by HPLC analysis of thio-
carbamoyl-thiazolidine derivatives of the acid hydrolysis product (Su
method (Fig. S98) (Shu et al., 2013). Therefore, the aglycone of 5 was
unambiguously identified as wilsonol A (Shu et al., 2013). The absolute
configuration of the sugar residue was determined to be D-glucose by
HPLC analysis after acid hydrolysis and derivatization (Su et al., 2018).
Therefore, compound 5 was named as (3S,4S,5R,6R,7E,9S)-3,6,9-tri-
hydroxy-megastigm-7-en-4-O-β-D-glucopyranoside.
et al., 2018). Therefore, compound
4
was named as
(3S,4S,5R,6R,7E,9R)-3,6,9-trihydroxy-megastigm-7-en-4-O-β-D-gluco-
pyranoside.
Compound 5 gave the same HRESIMS ion at m/z 429.2092 [M +
Na]+ (calcd. for C19H34NaO9, 429.2095) as compound 4, which meant
it had the same molecular formula (C19H34O9). The 1H NMR, 13C NMR,
HSQC, and HMBC spectra showed that compounds 4 and 5 had the
same planar structure. The stereostructure of 5 was determined after
hydrolysis. The hydrolysate of 5 (5a) (Figs. 3 and 5) had the same re-
lative and absolute configurations as 4a (Figs. 3 and 4), except for the
configuration of C-9, which was confirmed to be S using Mosher's
According to the HRESIMS signal at m/z 595.2383 [M – H]− (calcd.
for C29H39O13, 595.2396) in negative ion mode, the molecular formula
of 6 was C29H40O13. The IR spectrum contained absorption bands for
hydroxy (3363 cm−1), carbonyl (1706 cm−1), phenyl (1600,
1508 cm−1), olefinic (1452 cm−1), and ether (1048 cm−1) groups. The
1H and 13C NMR spectra showed 6 contained sesquiterpene, phenyl,
and glycosyl moieties. The sesquiterpene moiety was determined to be a
dihydrophaseic group, featuring three methyl groups {CH3-15″ [δH 2.12
Fig. 3. Key NOEs of 2, 4a and 5a.
26

F. Li, et al.
Phytochemistry163(2019)23–32
Fig. 4. (a) Structures of 4a-1 and 4a-2; (b) experimental ECD spectrum of 4a in
MeOH and calculated ECD spectra of 4a-1 and 4a-2.
Fig. 5. (a) Structures of 5a-1 and 5a-2; (b) experimental ECD spectrum of 5a in
MeOH and calculated ECD spectra of 5a-1 and 5a-2.
(3H, s), δC 21.3], CH3-14″ [δH 1.18 (3H, s), δC 19.7], and CH3-13″ [δH
0.95 (3H, s), δC 16.4]}, three methylenes {CH2-12″ [δH 3.84 (d,
J = 7.2 Hz), 3.74 (d, J = 7.2 Hz); δC 77.3], CH2-3″ [δH 2.08 (dd,
J = 13.6, 6.4 Hz), 1.78 (dd, J = 13.6, 10.4 Hz); δC 46.0], and CH2-5″
[δH 1.89 (dd, J = 13.6, 7.2 Hz), 1.68 (m); δC 44.6]}, two coupled ole-
finic methines {CH-8″ [δH 8.00 (d, J = 15.6 Hz); δC 131.7] and CH-7″
[δH 6.58 (d, J = 15.6 Hz); δC 135.8]}, one olefinic methine {CH-10″ [δH
5.76 (s); δC 118.5]}, one oxygenated methine {CH-4″ [δH 4.13 (m), δC
66.0]}, one carbonyl group C-11″ (δC 167.3), and four quaternary
carbons {[δC 152.1 (C-9″), 87.8 (C-2″), 83.3 (C-1″), and 49.6 (C-6″)]}.
The coupling constant of 15.6 Hz between H-7″ and H-8″ indicated that
the C7″ = C8″ double bond had a trans configuration. Other signals were
calculations. The seven lowest-energy conformers of 6a-1 were ob-
tained after conformational analysis. The conformers were further op-
timized at the APFD/6-31g(d)level. Theoretical ECD spectra were then
obtained according to the Boltzmann weighting of each conformer.
Comparison of the calculated ECD spectrum of 6a-1 with the experi-
mental ECD spectrum of 6a showed good agreement. Therefore, the
absolute configuration of 6a was determined to be 1″S,2″R,4″S,6″R. The
absolute configuration of the glucosyl residue was established as D-
glucose by HPLC analysis after acid hydrolysis and derivatization of 6b
(Su et al., 2018). Therefore, compound 6 was assigned as 2,6-di-
methoxy-p-hydroquinone-1-O-β-D-[6′-O-(1″S,2″R,4″S,6″R,7″E,9″Z)-di-
hydrophaseyl]-glucopyranoside.
attributed to
a 2,6-dimethoxy-p-hydroquinone-1-O-glucopyranosyl
The positive-ion HRESIMS of 7 contained a peak for a sodiated
molecular ion at m/z 629.2558 (calcd. for C31H42NaO12, 629.2568),
which corresponded to a molecular formula of C31H42O12. The 1H NMR
spectrum showed that 7 also contained a dihydrophaseic moiety (7a)
that was the same as that of 6a. The other signals included one ABX
system (δH 7.06, d, J = 1.6 Hz; 7.02, d, J = 8.0 Hz; 6.88, dd, J = 8.0,
1.6 Hz), two olefinic signals (δH 6.53, d, J = 16.0 Hz; 6.28, dt, J = 16.0,
5.6 Hz), one oxygenated methylene (δH 4.22, 2H, dd, J = 5.6, 1.2 Hz),
and six glucosyl signals [δH 4.85 (overlapped), 4.40 (2H, m), 3.65 (m),
3.52 (t, J = 7.8 Hz), 3.47 (t, J = 8.4 Hz), and 3.41 (t, J = 8.4 Hz)],
which were assigned to a 4-(3′-hydroxypropenyl)-2-methoxyphenyl-1-
O-glycopyranosyl moiety (Zhou et al., 2000). The HMBC correlations of
H-6″ (δH 4.40, m)/C-11‴ (δC 167.4) confirmed that these two moieties
were connected (Fig. 2). The absolute configuration of the glucosyl
residue was established as D-glucose by HPLC analysis after acid hy-
drolysis and derivatization of 7b (Su et al., 2018), which was obtained
after basic hydrolysis of 7 (Hong et al., 2017). Compound 7 was
moiety. The HMBC correlations between H-6′ (δH 4.39) and C-11″ (δC
167.3) showed that these two moieties were linked (Fig. 2). Compound
6 was hydrolyzed under alkaline conditions to obtain dihydrophaseic
acid (6a) (Milborrow, 1975; Zhang et al., 2010) and 2,6-dimethoxy-p-
hydroquinone-1-O-β-glucopyranoside (6b) (Otsuka et al., 1989)
(Fig. 6). The relative configuration of 6a was assigned according to the
NOE spectrum. The NOEs of H-4″ (δH 4.08, m)/H-12″ (δH 3.77, d,
J = 7.2 Hz), H3-13″ (δH 0.89, s)/H-7″ (δH 6.48, d, J = 16.2 Hz), and H3-
14″ (δH 1.11, s)/H-7″ (δH 6.48, d, J = 16.2 Hz) indicated that H-4″ and
CH2-12″ had α-orientations, whereas H3-13″, H3-14″, and CH-7″ had β-
orientations (Fig. 6). The NOEs of H3-15″ (δH 2.04, s)/H-7″ (δH 6.48, d,
J = 16.2 Hz) and H-10″ (δH 5.73, s) reflected the Z geometry of the
terminal double bond (C9″ = C10″) in 6a (Fig. 6). ECD calculations were
used to determine the absolute configuration of compound 6a. The
experimental ECD spectrum of dihydrophaseic acid (6a) showed a ne-
gative Cotton effect at 259 nm (Δε = – 0.949) (Fig. 7). Two stereo-
isomers, 6a-1 and 6a-2, were considered as candidates for the ECD
27

F. Li, et al.
Phytochemistry163(2019)23–32
Fig. 6. Structure and key NOEs of 6a; Structure of 6b.
and H-2′ of 8b were in the threo form. Compound 8b was further hy-
drolyzed using snailase to obtain the aglycone (8b-1) (Gu et al., 2013).
The absolute configurations of H-1′ and H-2′ were confirmed according
to the reported optical values. A negative optical value would indicate
the 1′R,2′R form of threo-2-methoxy-4-(1′,2′,3′-trihydroxypropyl)-
phenol and a positive optical value would indicate the 1′S,2′S form of
threo-2-methoxy-4-(1′,2′,3′-trihydroxypropyl)-phenol (Takeshita et al.,
1992; Ishikawa et al., 2002). Therefore, 8b-1 was confirmed to be 2-
methoxy-4-[(1′S,2′S)-1′,2′,3′-trihydroxypropyl]-phenol due to its posi-
tive optical value. The absolute configuration of the glucosyl residue
was established as D-glucose by HPLC analysis after acid hydrolysis and
derivatization of 8b (Su et al., 2018). Therefore, 8 was assigned as 2-
methoxy-4-[(1′S,2′S)-1′,2′,3′-trihydroxypropyl]-phenyl-1-O-β-D-{6″-O-
[(1‴S,2‴R,4‴S,6‴R,7‴E,9‴Z)-dihydrophaseic acyl]}-glucopyranoside.
The 95% ethanol extract and its EtOAc and n-BuOH fractions of S.
rubriflora leaves and twigs significantly inhibited ear inflammation in
mice caused by croton oil, with 33.6%, 35.7%, and 40.6% inhibition
(P < 0.05) compared to the control group.
To identify the anti-inflammatory components of the 95% ethanol
extract of S. rubriflora, the isolated compounds were tested for TNF-α
and IL-6 inhibition. Compounds 2–5 inhibited mRNA expression of
TNF-α and IL-6 in LPS-induced RAW 264.7 macrophages, with IC50
15.3–52.4 μM (Table 3).
3. Conclusion
The present study demonstrated the anti-inflammatory effects of a
95% EtOH extract of S. rubriflora in vivo. Eight previously undescribed
triterpenes and triterpene glycosides (compounds 1–8) were isolated
from the 95% EtOH extract of S. heptaphylla, four of which (2–5)
showed anti-inflammatory activity, with the inhibition of TNF-α and IL-
6 in LPS-induced RAW 264.7 macrophages (IC50 15.3–52.4 μM). The
only structural difference between 4 and 5 is the absolute configuration
at C-9, which may have caused the different anti-inflammatory activity:
the TNF-α and IL-6 inhibition of 9R (4) are both better than that of 9S
(5). Three ester derivatives (6–8) consisting of sesquiterpenes and
phenolic glycosyl moieties were newly determined, and shown not to be
artefacts using HPLC/(+)ESIMS (Fig. S97).
Fig. 7. (a) Structures of 6a-1 and 6a-2; (b) experimental ECD spectrum of 6a in
MeOH and calculated ECD spectra of 6a-1 and 6a-2.
assigned as 4-(3′-hydroxypropenyl)-2-methoxyphenyl-1-O-β-D-{6″-O-
[(1‴S,2‴R,4‴S,6‴R,7‴E,9‴Z)-dihydrophaseic acyl]}-glucopyranoside.
Compound 8 had a molecular formula of C31H44O14, which was
deduced from the HRESIMS ion at m/z 663.2634 (calcd. for
C
31H44NaO14, 663.2623). The 1H and 13C NMR spectra of 8 (Table 2)
4. Experimental
were similar to those of 7. However, two olefinic resonances in the
spectrum of 7 were replaced by two oxygenated methine signals [H-1′
(δH 4.61, d, J = 5.6 Hz), C-1′ (δC 76.4); and H-2′ (δH 3.82, m), C-2′ (δC
78.3)] in the spectrum of 8. To confirm the relative configuration of the
two additional hydroxy groups, basic hydrolysis was performed to ob-
tain 8a and 8b (Hong et al., 2017). The structure of 8a is the same as
those of 6a and 7a. The structure of 8b was determined to be 2-
methoxy-4-(1′,2′,3′-trihydroxypropyl)-phenyl-1-O-glucopyranoside by
comparison of its HRESIMS, 1H NMR, and 13C NMR data with those
reported in the literature (Comet et al., 1997; Ishikawa et al., 2002).
The 13C NMR chemical shifts of the two oxygenated methines (C-1′: δC
74.5; and C-2′: δC 77.6) in 8b were similar to the corresponding 13C
NMR signals in threo-2-methoxy-4-(1′,2′,3′-trihydroxypropyl)-phenol
(C-1′: δC 74.9; C-2′: δC 77.8) (Ishikawa et al., 2002), but different from
those in erythro-2-methoxy-4-(1′,2′,3′-trihydroxypropyl)-phenol (C-1′:
4.1. General experimental procedures
Optical rotation was measured using a Jasco P-2000 digital polari-
meter (Jasco, Tokyo, Japan). UV spectra were collected in methanol
using a Jasco V-650 UV–Vis spectrophotometer. Fourier-transform in-
frared spectroscopy was performed using a Nicolet 5700 ATR-FTIR
spectrometer (Thermo Fisher Scientific, Waltham, MA, USA). 1H and
13C NMR spectra were acquired using a Bruker Avance III 400 MHz (or
500 MHz) NMR spectrometer (Bruker BioSpin GmbH, Rheinstetten,
Germany) or an Agilent VNMRS 600 MHz NMR spectrometer (Palo
Alto, CA, USA). HRESIMS spectra were recorded with an Agilent 1200
SL series LC/6520 QTOF spectrometer (Agilent, Boblingen, Germany)
or a Thermo Fisher Scientific Q Exactive Focus Hybrid Quadrupole-
Orbitrap mass spectrometer (Waltham, MA, USA). Sephadex LH-20 (GE
Healthcare Bio-Sciences AB, Uppsala, Sweden) and C-18 (50 μm; YMC,
δ
C 76.1; C-2′: δC 76.5) (Ishikawa et al., 2002), which suggested that H-1′
28

F. Li, et al.
Phytochemistry163(2019)23–32
Table 2
1H NMR and 13C NMR spectroscopic data of compounds 6−8.
Position
6a
position
7a
8b
δH (J in Hz)
δC
δH (J in Hz)
δC
δH (J in Hz)
δC
1
2
3
4
5
6
1′
2′
3′
4′
5′
6′
129.3, C
154.9, C
94.0, CH
156.1, C
94.0, CH
154.9, C
106.1, CH
75.5, CH
77.8, CH
71.7, CH
75.6, CH
64.1, CH2
1
2
3
4
5
6
1′
2′
3′
147.4, C
150.2, C
111.4, CH
133.7, C
120.6, CH
118.2, CH
131.3, CH
128.9, CH
63.7, CH2
147.8, C
151.4, C
113.7, CH
138.9, C
122.1, CH
118.8, CH
76.4, CH
78.3, CH
65.3, CH2
6.13, s
6.13, s
7.06, d (1.6)
7.05, s
6.88, dd (8.0, 1.6)
7.02, d (8.0)
6.53, d (16.0)
6.28, dt (16.0, 5.6)
4.22, dd, (5.6, 1.2)
6.85, d (8.0)
7.01, d (8.0)
4.61, d (5.6)
3.82, m
3.49, dd (12.0, 3.0)
3.39, dd (12.0, 6.6)
5.00, d (6.4)
3.63, m
4.64, d (7.8)
3.44, m
3.45, m
3.43, m
3.53, m
1″
2″
3″
4″
5″
6″
1‴
2‴
4.85, overlapped
3.52, t, (7.8)
3.47, t, (8.4)
3.41, t, (8.4)
3.65, m
102.7, CH
74.9, CH
77.8, CH
71.8, CH
75.6, CH
64.1, CH2
83.3, C
103.4, CH
75.6, CH
78.3, CH
72.8, CH
76.3, CH
65.4, CH2
85.3, C
4.39, d, (12.0)
4.33, dd (12.0,3.6)
3.85, m
3.57, t (9.0)
3.67, m
1″
2″
3″α
3″β
4″
83.3, C
87.8, C
46.0, CH2
2.08, dd (13.6, 6.4)
1.78, dd (13.6, 10.4)
4.13, m
4.40, m
4.46, m
66.0, CH
87.8, C
89.7, C
5″α
5″β
6″
7″
8″
1.89, dd (13.6, 7.2)
1.68, m
44.6, CH2
3‴α
3‴β
4‴
5‴α
5‴β
6‴
7‴
8‴
9‴
2.02, m
1.73, m
4.10, m
1.85, m
1.66, m
46.1, CH2
1.79, m
1.89, m
4.14, m
1.90, m
1.60, m
46.3, CH2
49.6, C
66.0, CH
44.6, CH2
67.5, CH
44.8, CH2
6.58, d (15.6)
8.00, d (15.6)
135.8, CH
131.7, CH
152.1, C
118.5, CH
167.3, C
77.3, CH2
9″
49.6, C
50.6, C
10″
11″
12″
5.76, s
6.56, d (16.0)
8.00, d (16.0)
135.8, CH
131.7, CH
152.3, C
118.4, CH
167.4, C
77.3, CH2
6.51, d (16.2)
7.76, d (16.2)
136.8, CH
133.2, CH
155.0, C
119.6, CH
170.3, C
78.3, CH2
3.84, d (7.2)
3.74, d (7.2)
0.95, s
1.18, s
2.12, s
10‴
11‴
12‴
5.82, s
5.85, s
13″
14″
15″
2-OCH3
6-OCH3
16.4, CH3
19.7, CH3
21.3, CH3
56.7, OCH3
56.7, OCH3
3.88, d (7.2)
3.72, d (7.2)
0.92, s
1.09, s
2.12, s
3.81, d (7.2)
3.73, d (7.2)
0.88, s
1.06, s
2.10, s
3.78, s
3.78, s
13‴
14‴
15‴
2-OCH3
16.4, CH3
19.7, CH3
21.4, CH3
56.7, OCH3
17.9, CH3
21.0, CH3
23.2, CH3
58.6, OCH3
3.88, s
3.86, s
a
Recorded in CD3OD.
Recorded in D2O.
b
4.3. Extraction and isolation
Table 3
The inhibitory effects of compounds 2–5 against LPS-induced mRNA expression
of TNF-α and IL-6 in RAW 264.7 macrophages.
Air-dried, powdered leaves and twigs from S. rubriflora (20.1 kg)
were extracted with 95% EtOH (3 × 50 L) under reflux conditions for
1.5 h. The combined extracts were concentrated under reduced pressure
to afford the crude extract (1.5 kg), which was then suspended in H2O
and successively partitioned with petroleum ether, EtOAc, and n-BuOH.
The EtOAc extract (109 g) was subjected to chromatography over
silica gel (160–200 mesh) with a gradient elution of petroleum
ether–acetone (10:0 → 3:7) to give 12 fractions (1–12). Fraction 2
(23 g) was subjected to chromatography on a C-18 column with a
gradient elution of MeOHeH2O (6:4 → 10:0), followed by a Sephadex
LH-20 column (MeOHeH2O, 8:2), and then further purified by semi-
preparative HPLC to afford compounds 1 (25 mg; eluent: CH3CNeH2O,
7:3) and 2 (30 mg; CH3CNeH2O, 8:2).
Compounds
IC50 (μM)
TNF-α
IL-6
2
3
4
5
52.4
44.2
24.9
39.8
15.3
0.10
32.4
29.8
30.1
42.3
18.8
0.03
0.04
0.05
0.08
0.03
0.02
0.01
0.03
0.01
Positive control (kaempferol)
Kyoto, Japan) columns were used to fractionate the samples. Column
chromatography fractions were analyzed by HPLC (Agilent, Boblingen,
Germany).
The n-BuOH fraction (510 g) was subjected to chromatography on a
Diaion HP-20 macroporous resin column, and eluted with H2O followed
by 10%, 30%, 50%, 70%, and 95% aq. EtOH. The 30% EtOH fraction
(80 g) was subjected to chromatography on a C-18 column, eluting with
a gradient of MeOHeH2O (5:95 → 100:0) to yield 14 fractions (1–14).
Fraction 2 (3.4 g) was subjected to chromatography on a Sephadex LH-
20 column and further purified by preparative HPLC to yield com-
pounds 3 (36 mg; eluent: MeOHeH2O, 3:7), 4 (100 mg; MeOHeH2O,
2:8), and 5 (40 mg; MeOHeH2O, 2:8). Fraction 6 (4.0 g) was subjected
to chromatography on a Sephadex LH-20 column (MeOHeH2O, 3:7)
and then purified by semi-preparative HPLC by isocratic elution with
MeOHeH2O (3:7) to obtain compounds 6 (70 mg), 7 (60 mg), and 8
(88 mg).
4.2. Plant material
Leaves and twigs of Schefflera rubriflora C. J. Tseng & G. Hoo
(Araliaceae) were collected in Xishuangbanna District (GPS co-
ordinates:
N 21°56′-22°17′, E 100°51′-101°04′), Yunnan Province,
China, in June 2013 (summer, wet season) and were identified by
Professor Lin Ma of the Institute of Materia Medica, Chinese Academy
of Medical Science and Peking Union Medical College, China. A voucher
specimen (ID-S-2478) was deposited in the Institute of Materia Medica,
Chinese Academy of Medical Science and Peking Union Medical
College, China.
29

F. Li, et al.
Phytochemistry163(2019)23–32
4.3.1. 3-Oxo-11α-methoxy-olean-12-en-28-oic acid (1)
reported method (Hong et al., 2017), by individually mixing them with
MeOH (2.0 mL), N,N-dimethylformamide (2.0 mL), and 1 N LiOH
(2.0 mL), and stirring overnight at room temperature, respectively.
Each mixture was then neutralized with 1 N HCl and extracted with n-
BuOH three times. The n-BuOH extract was separated by preparative
HPLC (MeOH–1% formic acid in H2O; 30:70) to give purified hydro-
lysates 6a (12 mg) and 6b (11 mg); 7a (10 mg) and 7b (9 mg); and 8a
(11 mg) and 8b (10 mg), respectively.
White powder; [α]2D0 + 10.9 (c 0.1, MeOH); UV (MeOH) λmax (log ε)
205 (1.16), 250 (0.71), 255 (0.73) nm; IR νmax 2935, 1756, 1705,
1603 cm−1. For 1H (500 MHz) and 13C NMR (100 MHz) spectroscopic
data, see Table 1. HRESIMS (negative ion) m/z 483.3479 [M − H]−
(calcd. for C31H47O4, 483.3480).
4.3.2. 28-Norolean-12-en-3α,17β-diol (2)
White powder; [α]2D0 + 51.9 (c 0.1, MeOH); UV (MeOH) λmax (log ε)
204 (0.86) nm; IR νmax 3360, 2920, 1631, 1385, 1121, 1071 cm−1. For
1H (500 MHz) and 13C NMR (125 MHz) spectroscopic data, see Table 1.
4.4.1. Hydrolysate of 6 (6a)
HRESIMS (positive ion) m/z 305.1349 [M + Na]+ (calcd. for
C15H22NaO5, 305.1359). 1H NMR (CD3OD, 600 MHz) δH 7.95 (1H, d,
J = 16.2 Hz, H-8″), 6.48 (1H, d, J = 16.2 Hz, H-7″), 5.73 (1H, s, H-10″),
4.08 (1H, m, H-4″), 3.77 (1H, d, J = 7.2 Hz, H-12″a), 3.68 (1H, d,
J = 7.2 Hz, H-12″b), 2.04 (3H, s, H-15″), 2.03 (1H, m, H-3″α), 1.83 (1H,
m, H-5″α), 1.69 (1H, m, H-3″β), 1.62 (1H, m, H-5″β), 1.11 (3H, s, H-
14″), 0.89 (3H, s, H-13″). 13C NMR (CD3OD, 150 MHz) δC 170.3 (C-
11″), 150.8 (C-9″), 134.9 (C-7″), 132.0 (C-8″), 120.1 (C-10″), 87.9 (C-
2″), 83.4 (C-1″), 77.4 (C-12″), 66.1 (C-4″), 49.3 (C-6″), 46.1 (C-3″), 44.6
(C-5″), 21.3 (C-15″), 19.8 (C-14″), 16.5 (C-13″). ECD (c,
1.31 × 10−3 M, MeOH) λmax (Δε) 259 nm (−0.95). The structures of 7a
and 8a were the same as that of 6a.
HRESIMS (positive ion) m/z 451.3542 [M
29H48NaO2, 451.3546).
+
Na]+ (calcd. for
C
4.3.3. 12-Oxo-GA14-3-O-β-D-glucopyranoside (3)
White powder; [α]2D0 − 50.4 (c 0.1, MeOH); UV (MeOH) λmax (log ε)
206 (0.94), 255 (0.17) nm; IR νmax 3392, 2945, 1701, 1562, 1104,
1080 cm−1. For 1H (600 MHz) and 13C NMR (150 MHz) spectroscopic
data, see Table 1. HRESIMS (negative ion) m/z 523.2184 [M − H]−
(calcd. for C26H35O11, 523.2185).
4.3.4. (3S,4S,5R,6R,7E,9R)-3,6,9-trihydroxy-megastigm-7-en-4-O-β-D-
Glucopyranoside (4)
White powder; [α]2D0 − 47.9 (c 0.1, MeOH); UV (MeOH) λmax (log ε)
4.4.2. Hydrolysate of 6 (6b)
203 (0.65) nm; IR νmax 3368, 2925, 1452, 1079 cm−1
.
For 1H
ESIMS (positive ion) m/z 355 [M + Na]+ 1H NMR (CD3OD,
.
(400 MHz) and 13C NMR (100 MHz) spectroscopic data, see Table 1.
HRESIMS (positive ion) m/z 429.2087 [M
Na]+ (calcd. for
19H34NaO9, 429.2095).
500 MHz) δH 6.06 (2H, d, J = 1.5 Hz, H-3, 5), 4.61 (1H, d, J = 7.5 Hz,
H-1′), 3.73 (6H, s, 2, 6-OCH3), 3.61 (1H, dd, J = 12.0, 5.0 Hz, H-6′a),
3.40 (1H, m, H-6′b), 3.36 (1H, m, H-3′), 3.33 (1H, m, H-2′), 3.25 (1H,
m, H-5′), 3.13 (1H, m, H-4′). 13C NMR (CD3OD, 125 MHz) δC 156.3 (C-
4), 155.0 (C-2, 6), 129.9 (C-1), 106.5 (C-1′), 94.8 (C-3, 5), 78.5 (C-5′),
78.1 (C-3′), 76.0 (C-2′), 71.6 (C-4′), 62.9 (C-6′), 57.1 (2, 6-OCH3).
+
C
4.3.5. (3S,4S,5R,6R,7E,9S)-3,6,9-trihydroxy-megastigm-7-en-4-O-β-D-
Glucopyranoside (5)
White powder; [α]2D0 − 43.8 (c 0.1, MeOH); UV (MeOH) λmax (log ε)
203 (0.55) nm; IR νmax 3379, 2925, 1452, 1078 cm−1
.
For 1H
4.4.3. Hydrolysate of 7 (7b)
(400 MHz) and 13C NMR (100 MHz) spectroscopic data, see Table 1.
HRESIMS (positive ion) m/z 429.2092 [M
Na]+ (calcd. for
19H34NaO9, 429.2095).
HRESIMS (positive ion) m/z 365.1206 [M + Na]+ (calcd. for
+
C
16H22NaO8, 365.1207). 1H NMR (CD3OD, 400 MHz) δH 7.12 (1H, d,
C
J = 8.0 Hz, H-6), 7.09 (1H, br s, H-3), 6.96 (1H, br d, J = 8.0 Hz, H-5),
6.57 (1H, d, J = 15.6 Hz, H-1′), 6.25 (1H, dt, J = 15.6, 6.0 Hz, H-2′),
4.91 (1H, d, J = 7.8 Hz, H-1″), 4.11 (2H, d, J = 6.0 Hz, H-3′), 3.88 (3H,
s, 2-OCH3), 3.87 (1H, m, H-6″a), 3.71 (1H, m, H-6″b), 3.52 (1H, m, H-
3″), 3.50 (1H, m, H-5″), 3.49 (1H, m, H-2″), 3.41 (1H, m, H-4″). 13C
NMR (CD3OD, 150 MHz) δC 151.0 (C-2), 147.9 (C-1), 133.3 (C-4), 131.0
(C-1′, 2′), 121.0 (C-5), 118.0 (C-6), 111.6 (C-3), 102.9 (C-1″), 78.4 (C-
3″), 78.0 (C-5″), 75.0 (C-2″), 71.3 (C-4″), 63.8 (C-3′), 62.6 (C-6″), 56.9
(2-OCH3).
2,6-Dimethoxy-p-hydroquinone-1-O-β-D-[6′-O-
(1″S,2″R,4″S,6″R,7″E,9″Z)-dihydrophaseyl]-glucopyranoside (6)
White powder; [α]2D0 − 42.0 (c 0.1, MeOH); UV (MeOH) λmax (log ε)
204 (1.82), 268 (1.37) nm; IR νmax 3363, 1706, 1600, 1508, 1452,
1048 cm−1. For 1H (600 MHz) and 13C NMR (150 MHz) spectroscopic
data, see Table 2. HRESIMS (negative ion) m/z 595.2383 [M − H]−
(calcd. for C29H39O13, 595.2396).
4.3.7. 4-(3′-hydroxypropenyl)-2-methoxyphenyl-1-O-β-D-{6″-O-
[(1‴S,2‴R,4‴S, 6‴R,7‴E,9‴Z)-dihydrophaseic acyl]}-glucopyranoside
(7)
4.4.4. Hydrolysate of 8 (8b)
HRESIMS (positive ion) m/z 399.1266 [M + Na]+ (calcd. for
C
16H24NaO10, 399.1262). 1H NMR (CD3OD, 600 MHz) δH 7.14 (1H, d,
White powder; [α]2D0 − 40.0 (c 0.1, MeOH); UV (MeOH) λmax (log ε)
203 (0.71), 266 (0.40) nm; IR νmax 3404, 1706, 1600, 1508, 1452,
1074 cm−1. For 1H (400 MHz) and 13C NMR (100 MHz) spectroscopic
data, see Table 2. HRESIMS (positive ion) m/z 629.2558 [M + Na]+
(calcd. for C31H42NaO12, 629.2568).
J = 8.4 Hz, H-6), 7.09 (1H, d, J = 1.2 Hz, H-3), 6.93 (1H, dd, J = 8.4,
1.2 Hz, H-5), 4.89 (1H, d, J = 7.8 Hz, H-1″), 4.60 (1H, d, J = 6.0 Hz, H-
1′), 3.88 (3H, s, 2-OCH3), 3.87 (1H, d, J = 12.6 Hz, H-6″a), 3.71 (1H,
dd, J = 12.6, 4.2 Hz, H-6″b), 3.68 (1H, m, H-2′), 3.65 (1H, m, H-5″),
3.53 (1H, m, H-3″), 3.48 (1H, m, H-2″), 3.45 (1H, m, H-4″), 3.41 (2H,
m, H-3′). 13C NMR (pyridine-d5, 150 MHz) δC 149.8 (C-2), 147.1 (C-1),
138.6 (C-4), 119.9 (C-5), 115.9 (C-6), 112.1 (C-3), 102.4 (C-1″), 78.7
(C-5″), 78.6 (C-3″), 77.6 (C-2′), 74.9 (C-2″), 74.5 (C-1′), 71.2 (C-4″),
64.3 (C-3′), 62.3 (C-6″), 55.8 (2-OCH3).
4.3.8. 2-Methoxy-4-[(1′S,2′S)-1′,2′,3′-trihydroxypropyl]-phenyl-1-O-β-D-
{6″-O-[(1‴S,
2‴R,4‴S,6‴R,7‴E,9‴Z)-dihydrophaseic
acyl]}-
glucopyranoside (8)
White powder; [α]2D0 − 35.0 (c 0.1, MeOH); UV (MeOH) λmax (log ε)
203 (1.60), 233 (1.21), 270 (1.24) nm; IR νmax 3374, 1702, 1597, 1512,
1453, 1077 cm−1. For 1H (400 MHz) and 13C NMR (100 MHz) spec-
troscopic data, see Table 2. HRESIMS (positive ion) m/z 663.2634 [M
+ Na]+ (calcd. for C31H44NaO14, 663.2623).
4.5. Enzymatic hydrolysis of 4, 5, and 8b
Compound 4 (10 mg), 5 (10 mg), or 8b (10 mg) was hydrolyzed
using a previously reported method (Gu et al., 2013), by their separate
incubation with snailase in sodium acetate buffer (pH 4.5) at 37 °C for
48 h. To end the enzymatic reaction, the mixture was put in a water
bath at 90 °C. Thereafter, each mixture was extracted with n-BuOH
three times to obtain a fraction containing the aglycone of 4, 5, or 8b,
4.4. Alkaline hydrolysis of 6–8
Compounds 6–8 (30 mg each) were hydrolyzed according to a
30

F. Li, et al.
Phytochemistry163(2019)23–32
which was further separated by preparative HPLC (MeOH–1% formic
acid in H2O; 40:60) to give the purified hydrolysate of 4a (3.5 mg), 5a
(3.8 mg), or 8b-1 (4.5 mg).
J = 6.0 Hz, H-10), 1.29 (1H, m, H-2β), 1.04 (3H, s, H-11), 0.95 (3H, d,
J = 7.2 Hz, H-13), 0.76 (3H, s, H-12).
4.6.3. (R)-MTPA derivative of 5a (5a-a)
4.5.1. Hydrolysate of 4 (4a)
1H NMR (CD3OD, 400 MHz) δH 5.71 (1H, d, J = 15.2 Hz, H-7), 5.66
(1H, dd, J = 15.2, 6.8 Hz, H-8), 5.61 (1H, m, H-9), 3.91 (1H, m, H-3),
3.64 (1H, m, H-4), 2.21 (1H, m, H-5), 2.00 (1H, dd, J = 15.0, 3.2 Hz, H-
2α), 1.41 (3H, d, J = 6.0 Hz, H-10), 1.31 (1H, m, H-2β), 1.07 (3H, s, H-
11), 0.92 (3H, d, J = 7.2 Hz, H-13), 0.78 (3H, s, H-12).
HRESIMS (positive ion) m/z 267.1568 [M + Na]+ (calcd. for
C
13H24NaO4, 267.1567). 1H NMR (CD3OD, 400 MHz) δH 5.68 (1H, dd,
J = 15.7, 5.9 Hz, H-8), 5.55 (1H, d, J = 15.7 Hz, H-7), 4.29 (1H, dq,
J = 6.4, 5.9 Hz, H-9), 3.91 (1H, dd, J = 3.2, 2.8 Hz, H-3), 3.64 (1H, br
s, H-4), 2.23 (1H, qd, J = 7.2, 2.8 Hz, H-5), 2.00 (1H, dd, J = 15.0,
3.2 Hz, H-2α), 1.37 (1H, br d, J = 15.0 Hz, H-2β), 1.24 (3H, d,
J = 6.4 Hz, H-10), 1.14 (3H, s, H-11), 1.00 (3H, d, J = 7.2 Hz, H-13),
0.86 (3H, s, H-12). 13C NMR (CD3OD, 100 MHz) δC 135.2 (C-8), 132.7
(C-7), 81.6 (C-6), 77.1 (C-4), 72.4 (C-3), 69.3 (C-9), 39.3 (C-1), 38.4 (C-
2), 32.7 (C-5), 27.6 (C-11), 26.7 (C-12), 24.3 (C-10), 13.3 (C-13). ECD
(c, 2.04 × 10−3 M, MeOH) λmax (Δε) 200 (– 3.63).
4.6.4. (S)-MTPA derivative of 5a (5a-b)
1H NMR (CD3OD, 400 MHz) δH 5.81 (1H, d, J = 15.2 Hz, H-7), 5.74
(1H, dd, J = 15.2, 6.8 Hz, H-8), 5.61 (1H, m, H-9), 3.92 (1H, m, H-3),
3.65 (1H, m, H-4), 2.24 (1H, m, H-5), 2.01 (1H, dd, J = 15.0, 3.2 Hz, H-
2α), 1.34 (3H, d, J = 6.0 Hz, H-10), 1.32 (1H, m, H-2β), 1.11 (3H, s, H-
11), 0.97 (3H, d, J = 7.2 Hz, H-13), 0.81 (3H, s, H-12).
4.5.2. Hydrolysate of 5 (5a)
4.7. Determination of the absolute configurations of sugar groups
HRESIMS (positive ion) m/z 267.1564 [M + Na]+ (calcd. for
C13H24NaO4, 267.1567). 1H NMR (CD3OD, 400 MHz) δH 5.68 (1H, dd,
J = 15.7, 5.9 Hz, H-8), 5.55 (1H, d, J = 15.7 Hz, H-7), 4.29 (1H, dq,
J = 6.4, 5.9 Hz, H-9), 3.91 (1H, m, H-3), 3.64 (1H, br s, H-4), 2.23 (1H,
qd, J = 7.2, 2.8 Hz, H-5), 2.00 (1H, dd, J = 15.0, 3.2 Hz, H-2α), 1.37
(1H, br d, J = 15.0 Hz, H-2β), 1.24 (3H, d, J = 6.4 Hz, H-10), 1.13 (3H,
s, H-11), 1.03 (3H, d, J = 7.2 Hz, H-13), 0.83 (3H, s, H-12). 13C NMR
(CD3OD, 100 MHz) δC 135.2 (C-8), 132.7 (C-7), 81.6 (C-6), 77.1 (C-4),
72.4 (C-3), 69.4 (C-9), 39.3 (C-1), 38.4 (C-2), 32.7 (C-5), 27.6 (C-11),
26.7 (C-12), 24.3 (C-10), 13.4 (C-13). ECD (c, 1.87 × 10−3 M, MeOH)
λmax (Δε) 200 (−3.63).
The absolute configurations of the sugar groups were assigned ac-
cording to a previously reported procedure (Su et al., 2018). The
compounds (2.0 mg each) were hydrolyzed with 1 M HCl (1 mL) at
100 °C for 2 h, and then extracted with EtOAc (5.0 mL) three times. The
H2O layer was dried, and the residue or sugar standard was dissolved in
pyridine (0.5 mL). L-Cysteine methyl ester hydrochloride (2.0 mg) was
then added and heated at 60 °C for 2 h. Next, o-tolyl isothiocyanate
(2.0 μL) was added and further heated at 60 °C for 2 h. Finally, the
mixture was directly analyzed by HPLC (Agilent 1200) at 250 nm. A
Cosmosil 5C18-AR-II HPLC column (150 mm × 4.6 mm i.d., 5 μm par-
ticle size; Nacalai Tesque Inc., Kyoto, Japan) at 35 °C was used to
analyze each sample by isocratic elution with CH3CNeH2O (25:75) at a
flow rate of 0.8 mL/min. The retention time of D-glucopyranose
(10.4 min) was measured and compared with those of the reaction
mixtures. As the sugar derivatives from the compounds showed very
similar retention times to the sugar standard, the types and absolute
configurations of the sugars were confirmed to be D-glucopyranose.
4.5.3. Hydrolysate of 8b (8b-1)
[α]2D0 + 42.0 (c 0.5, MeOH) HRESIMS (positive ion) m/z 237.0731
[M + Na]+ (calcd. for C10H14NaO5, 237.0733). 1H NMR (pyridine-d5,
400 MHz) δH 7.51 (1H, br s, H-3), 7.35 (1H, br d, J = 8.0 Hz, H-5), 7.26
(1H, d, J = 8.0 Hz, H-6), 5.32 (1H, d, J = 5.6 Hz, H-1′), 4.44 (1H, m, H-
2′), 4.26 (1H, dd, J = 3.6, 11.0 Hz, H-3′a), 4.12 (1H, dd, J = 6.4,
11.0 Hz, H-3′b), 3.68 (3H, s, 2-OCH3). 13C NMR (pyridine-d5, 100 MHz)
δ
C 148.8 (C-2), 147.7 (C-1), 135.7 (C-4), 120.9 (C-5), 116.5 (C-6), 112.0
(C-3), 78.3 (C-2′), 75.3 (C-1′), 64.8 (C-3′), 56.1 (2-OCH3).
4.8. Croton oil-induced mouse ear edema
Kunming male mice were purchased from the Animal Center of
Military Medical Science (Beijing, China). The animal experiments
complied with the Institutional Guidelines for Animal Care and Use of
the Chinese Academy of Medical Sciences and Peking Union Medical
College. The croton oil-induced mice ear edema assay was conducted
according to established methods (Tang et al., 2014). The mice were
randomized and injected subcutaneously with different extracts of S.
rubriflora leaves and twigs (1 mg/g) 1 h before croton oil application.
Topical inflammation was induced on the right ear of the adult mice by
injecting croton oil (0.4 mg/15 μL). The left ear received the same vo-
lume of acetone as a blank control. To evaluate the anti-inflammatory
activity of S. rubriflora, the mice were euthanized 4 h after injection of
the croton oil, and tissue punches of the treated (right) and untreated
(left) ears were weighed.
4.6. Preparation of (S)- and (R)-MTPA ester derivatives of 4a and 5a
A solution of 4a (2.0 mg) in anhydrous pyridine (2 mL) was reacted
with (R)-α-methoxy-α-trifluoromethylphenylacetyl chloride (MTPA
chloride; 10 mg) in the presence of dimethylaminopyridine (30 mg) and
allowed to stand at 37 °C for 10 h H2O (1 mL) was then added and the
solution was dried under vacuum. The residue was redissolved in MeOH
and purified by preparative HPLC (MeOH–1% formic acid in H2O;
65:35) to obtain the (R)-MTPA ester derivative of 4a (4a-a) (1.8 mg)
(Shu et al., 2013). (S)-MTPA chloride and 4a were mixed and separated
in the same manner to obtain the (S)-MTPA derivative of 4a (4a-b)
(2.3 mg). The (R) and (S)-MTPA esters of 5a (5a-a and 5a-b) were
obtained from 5a using the same procedure.
4.6.1. (R)-MTPA derivative of 4a (4a-a)
4.9. Cell culture
1H NMR (CD3OD, 400 MHz) δH 5.79 (1H, d, J = 15.2 Hz, H-7), 5.72
(1H, dd, J = 15.2, 7.2 Hz, H-8), 5.60 (1H, m, H-9), 3.92 (1H, br d,
J = 2.8 Hz, H-3), 3.65 (1H, br s, H-4), 2.24 (1H, qd, J = 7.2, 2.5 Hz, H-
5), 2.02 (1H, dd, J = 15.0, 3.2 Hz, H-2α), 1.37 (3H, d, J = 6.0 Hz, H-
10), 1.30 (1H, m, H-2β), 1.12 (3H, s, H-11), 0.99 (3H, d, J = 7.2 Hz, H-
13), 0.81 (3H, s, H-12).
The RAW264.7 cell line was purchased from the cell bank of the
Chinese Academy of Science. Cells were cultured in RPMI-1640
(Invitrogen, Carlsbad, CA, USA) with fetal bovine serum (10%;
Hyclone, Logan, UT, USA), penicillin (100 U/mL; Sigma-Aldrich),
streptomycin (100 mg/mL; Sigma-Aldrich), and glutamine (4 mM;
Sigma-Aldrich). Cells were seeded in plates at appropriate cell densities
per well. At 80% confluency, cells were pretreated with DMSO (nega-
tive control), kaempferol (positive control) (Wall et al., 2013; Kowalski
et al., 2005) or various concentrations of compounds with LPS (100 ng/
mL) (Invitrogen) for 18 h, followed by RNA collection for real-time
4.6.2. (S)-MTPA derivative of 4a (4a-b)
1H NMR (CD3OD, 400 MHz) δH 5.60 (3H, br s, H-7, 8, 9), 3.90 (1H,
br d, J = 2.8 Hz, H-3), 3.63 (1H, br s, H-4), 2.19 (1H, qd, J = 7.2,
2.5 Hz, H-5), 1.99 (1H, dd, J = 15.0, 3.2 Hz, H-2α), 1.42 (3H, d,
31

F. Li, et al.
Phytochemistry163(2019)23–32
PCR.
kaempferol and resveratrol on the expression of interleukin-1β and tumor necrosis
factor-α genes in J774.2 macrophages. Pharmacol. Rep. 57, 390–394.
Kong, F., Lee, B., Wei, K., 2019. 5-Hydroxymethylfurfural mitigates lipopolysaccharide-
stimulated inflammation via suppression of MAPK, NF-κB and mTOR activation in
RAW 264.7 cells. Molecules 24, 275.
4.10. RNA isolation and evaluation of gene expression
Lai, H.C., Lu, C.H., Wong, C.S., Lin, B.F., Chan, S.M., Kuo, C.Y., Wu, Z.F., 2018. Baicalein
attenuates neuropathic pain and improves sciatic nerve function recovery in rats with
partial sciatic nerve transection. J. Chin. Med. Assoc. 81, 955–963.
Li, Y., Jiang, R., Ooi, L.S., But, P.P., Ooi, V.E., 2007. Antiviral triterpenoids from the
medicinal plant Schefflera heptaphylla. Phytother Res. 21, 466–470.
Li, J., Yang, J., Lu, F., Qi, Y., Liu, Y., Sun, Y., Wang, Q., 2012. Chemical constituents from
the stems of Celastrus orbiculatus. Chin. J. Nat. Med. 10, 279–283.
Liu, Y., Li, F., Zhang, L., Wu, J., Wang, Y., Yu, H., 2017. Taurine alleviates lipopoly-
saccharide-induced liver injury by anti-inflammation and antioxidants in ats. Mol.
Med. Rep. 16, 6512–6517.
Total RNAs were extracted using TRIzol reagent (MRC Inc.,
Cincinnati, OH, USA), followed by DNase digestion and column cleanup
with Qiagen mini-columns (Valencia, CA, USA). Reverse transcription
was performed with an iScript cDNA synthesis kit (Bio-Rad, Hercules,
CA, USA). The following real-time PCR primers (Integrated DNA
Technologies, Coralville, IA, USA) were used: GAPDHR sense (GGCCT
CCAAGGAGTAAGAAA) and anti-GAPDHR sense (GCCCCTCCTGTTAT
TATGG); TNF-α sense (CCCCAGTCTGTATCCTTCTAA), and TNF-α an-
tisense (TCGAGGCTCCAGTGAATT); IL-6 sense (CCCCAATTTCCAATG
CTCTCC) and IL-6 antisense (CGCACTAGGTTTGCCGAGTA). Real-time
PCR was performed with SYBR Green and the 7500 Fast Sequence
Detection System (Applied Biosystems, Foster City, CA, USA). All pri-
mers for real-time PCR analysis were designed using Primer Express
software 2.0.0 (Applied Biosystems), and GAPDHR was used as the
normalization reference.
Luo, Q., Yang, A., Cao, Q., Guan, H., 2018. 3,3′-Diindolylmethane protects cardiomyo-
cytes from LPS-induced inflammatory response and apoptosis. BMC Pharmacol
Toxicol 19, 71–79.
Milborrow, B.V., 1975. The absolute configuration of phaseic and dihydrophaseic acids.
Phytochemistry 14, 1045–1053.
Muir, A.D., Cole, A.L.J., Walker, J.R.L., 1982. Antibiotic compounds from New Zealand
plants. I. Falcarindiol, an anti-dermatophyte agent from Schefflera digitata. Planta
Med. 44, 129–133.
Nguyen, T.P., Tran, T.T.V., Mai, D.T., Le, T.D., Phan, N.M., Bui, T.D., 2015. New C20
-
gibberellin diterpene from the leaves of Schefflera sessiliflora De P. V. Nat. Prod. Res.
29, 1432–1436.
Otsuka, H., Takeuchi, M., Inoshiri, S., Sato, T., Yamasaki, K., 1989. Phenolic compounds
from Coix lachrymal-jobi var. Ma-yuen. Phytochemistry 28, 883–886.
Sang, G., Chen, Z., Shao, M., 2015. Chinese Pharmacopeia (Part 1). Beijing Xinhua Press,
Beijing, pp. 812.
Conflicts of interest
The authors declare no competing financial interest.
Acknowledgments
Seebacher, W., Simic, N., Weis, R., Saf, R., Kunert, O., 2003. Complete assignments of 1
H
and 13C NMR resonances of oleanolic acid, 18α-oleanolic acid, ursolic acid and their
11-oxo derivatives. Magn. Reson. Chem. 41, 636–638.
Shu, P., Wei, X., Xue, Y., Li, W., Zhang, J., Xiang, M., Zhang, M., Luo, Z., Li, Y., Yao, G.,
Zhang, Y., 2013. Wilsonols A-L, mesgastigmane sesquiterpenoids from the leaves of
Cinnamomum wilsonii. J. Nat. Prod. 76, 1303–1312.
Su, X., Zhang, J., Li, C., Li, F., Wang, H., Gu, H., Li, B., Chen, Kang, J., 2018. Glycosides of
naphthohydroquinones and anthraquinones isolated from the aerial parts of, Morinda
parvifolia, Bartl. ex DC (Rubiaceae) increase p53 mRNA expression in A2780 cells.
Phytochemistry 152, 97–104.
This study was supported by the CAMS Innovation Fund for Medical
Sciences (CIFMS) (2016-I2M-1-010), the Fund of Jiansheng Fresh Herb
Medicine
Research
and
Drug
Innovation
Major
Project
(2018ZX09711001-008-009).
Takeshita, M., Yaguchi, R., Akutsu, N., 1992. Enzymatic preparation of chiral 1-phe-
nylglycidols and 1-phenyl-1,2-propanediols. Tetrahedron Asymmetry 3, 1369–1372.
Tang, W., Xie, J., Xu, S., Lv, H., Lin, M., Yuan, S., Bai, J., Hou, Q., Yu, S., 2014. New nitric
oxide-releasing derivatives of brusatol as anti-inflammatory agents: design, synthesis,
biological evaluation, and nitric oxide release studies. J. Med. Chem. 57, 7600–7612.
Wall, C., Lim, R., Poljak, M., Lappas, M., 2013. Dietary flavonoids as therapeutics for
preterm birth: luteolin and kaempferol suppress inflammation in human gestational
tissues in vitro. Oxid. Med. Cell. Longev. 2013 485201.
Wang, Y., Chen, R., Yu, D., 2013. Advances of chemical constituents and pharmacological
activities of Schefflera genus. Zhongguo Zhongyao Zazhi 38, 2254–2263.
Wang, Y., Zhang, C., Liu, Y., Liang, D., Luo, H., Hao, Z., Chen, R., Yu, D., 2014.
Hepatoprotective triterpenoids and saponins of Schefflera kwangsiensis. Planta Med.
80, 215–222.
Wang, Y., Liu, Y., Zhang, C., Liang, D., Luo, H., Hao, Z., Chen, R., Yu, D., 2016. Four new
triterpenoid saponins isolated from Schefflera kwangsiensis and their inhibitory ac-
tivities against FBPase1. Phytochem. Lett. 15, 204–209.
Wu, C., Duan, Y., Tang, W., Li, M., Wu, X., Wang, G., Ye, W., Zhou, G., Li, Y., 2014. New
ursane-type triterpenoid saponins from the stem bark of Schefflera heptaphylla.
Fitoterapia 92, 127–132.
Appendix. ASupplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.phytochem.2019.03.021.
References
Cioffi, G., Braca, A., Autore, G., Morelli, I., Pinto, A., Venturella, F., De Tommasi, N.,
2003. Cytotoxic saponins from Schefflera fagueti. N. Planta Med. 69, 750–756.
Comte, G., Joseph Vercauteren, G., Chulia, A.J., Allais, D.P., Delage, C., 1997.
Phenylpropanoids from leaves of Juniperus phoenicea. Phytochemistry 45,
1679–1682.
Gaskin, P., Hutchison, M., Lewis, N., Macmillan, J., Phinney, B., 1984. Microbiological
conversion of 12-oxygena and other derivatives of ent-kaur-16-en-19-oic acid by
gibberella fujikuroi, mutant B1-41a. Phytochemistry 23, 559–564.
Gu, J., Li, W., Xiao, D., Wei, S., Cui, W., Chen, W., Hu, Y., Bi, X., Kim, Y., Li, J., Du, H.,
Zhang, M., Chen, L., 2013. Compound K, a final intestinal metabolite of ginsenosides,
enhances insulin secretion in MIN6 pancreatic β-cells by upregulation of GLUT2.
Fitoterapia 87, 84–88.
Wu, Z., Zhou, T., Xiao, P., 1990. Xinhua Herb (Part 3). Shanghai Science and Technology
Press, Shanghai, pp. 232.
Wu, Z., Peter, R., 2007. Flora of China (Part 13). Science Press, Beijing, pp. 454.
You, R., Long, W., Lai, Z., Sha, L., Wu, K., Yu, X., Lai, Y., Ji, H., Huang, Z., Zhang, Y.,
2013. Discovery of a potential anti-inflammatory agent: 3-Oxo-29-noroleana-
1,9(11),12-trien-2,20-dicarbonitrile. J. Med. Chem. 56, 1984–1995.
Zhang, Z., Zhang, W., Ji, Y., Zhao, Y., Wang, C., Hu, J., 2010. Gynostemosides A-E,
megastigmane glycosides from Gynostemma pentaphyllum. Phytochemistry 71,
693–700.
Hong, M., Kim, J., 2017. Determination of the absolute configuration of khellactone esters
from Peucedanun japonicum roots. J. Nat. Prod. 80, 1354–1360.
Hu, X., Zhang, W., Zhu, Q., 1998. Zhonghua Herb (Part 15). Shanghai Science and
Technology Press, Shanghai, pp. 867.
Ikuta, A., 1992. Triterpenes from Stauntonia hexaphylla callus tissues. J. Nat. Prod. 55,
1230–1233.
Ishikawa, T., Fujimatu, E., Kitajima, J., 2002. Water-soluble constituents of anise: new
glucosides of anethole glycol and its related compounds. Chem. Pharm. Bull. 50,
1460–1466.
Zhou, Z., Yang, C., 2000. Chemical constituents of crude green tea, the material of Pu-er
Tea in Yunnan. Yunnan Zhiwu Yanjiu 22, 343–350.
Kowalski, J., Samojedny, A., Paul, M., Pietsz, G., Wilczok, T., 2005. Effect of apigenin,
32