Full text of DOI:10.1016/S0167-7799(00)01541-9

Review
TRENDS in Biotechnology Vol.19 No.3 March 2001
114
14 Hidalgo, E. and Demple, B. (1994) An iron–sulfur
center essential for transcriptional activation by
the redox-sensing SoxR protein. EMBO J .
13, 138–146
23 Liochev, S.I. and Fridovich, I. (1992) Fumarase
C, the stable fumarase of Escherichia coli, is
controlled by the soxRS regulon. Proc. Natl.
Acad. Sci. U. S. A. 89, 5892–5896
32 Gonzalez-Flecha, B. and Demple, B. (1999) Role
for the oxyS gene in regulation of intracellular
hydrogen peroxide in Escherichia coli.
J . Bacteriol. 181, 3833–3836
15 Ding, H. et al. (1996) The redox state of the
[2Fe–2S] clusters in SoxR protein regulates its
activity as a transcription factor. J . Biol. Chem.
271, 33173–33175
24 Nunoshiba, T. et al. (1995) Roles of nitric oxide in
inducible resistance of Escherichia coli to
activated murine macrophages. Infect. Immun.
63, 794–798
33 Altuvia, S. et al. (1998) The Escherichia coli
OxyS regulatory RNA represses fhlA translation
by blocking ribosome binding. EMBO J . 17,
6069–6075
16 Gaudu, P. and Weiss, B. (1996) SoxR, a [2Fe–2S]
transcription factor, is active only in its oxidized
form. Proc. Natl. Acad. Sci. U. S. A.
25 Nunoshiba, T. et al. (1993) Activation by nitric
oxide of an oxidative-stress response that defends
Escherichia coli against activated macrophages.
Proc. Natl. Acad. Sci. U. S. A. 90, 9993–9997
26 Ding, H. and Demple, B. (2000) Direct nitric
oxide signal transduction via nitrosylation of
iron- sulfur centers in the SoxR transcription
activator. Proc. Natl. Acad. Sci. U. S. A.
97, 5146–5150
27 Demple, B. and Halbrook, J . (1983) Inducible
repair of oxidative DNA damage in Escherichia
coli. Nature 304, 466–468
28 Christman, M.F. et al. (1985) Positive control of a
regulon for defenses against oxidative stress and
some heat-shock proteins in Salmonella
typhimurium. Cell 41, 753–762
29 Christman, M.F. et al. (1989) OxyR, a positive
regulator of hydrogen peroxide-inducible genes in
Escherichia coli and Salmonella typhimurium, is
homologous to a family of bacterial regulatory
proteins. Proc. Natl. Acad. Sci. U. S. A. 86,
3484–3488
30 Hausladen, A. et al. (1996) Nitrosative stress:
activation of the transcription factor OxyR.
Cell 86, 719–729
34 Zhang, A. et al. (1998) The OxyS regulatory RNA
represses rpoS translation and binds the Hfq
(HF-I) protein. EMBO J . 17, 6061–6068
35 Storz, G. et al. (1990) Transcriptional
regulator of oxidative stress-inducible genes:
direct activation by oxidation. Science 248,
189–194
36 Toledano, M.B. et al. (1994) Redox-dependent
shift of OxyR-DNA contacts along an
extended DNA-binding site: a mechanism for
differential promoter selection. Cell
78, 897–909
37 Gonzalez-Flecha, B. and Demple, B. (1997)
Transcriptional regulation of the Escherichia
coli oxyR gene as a function of cell growth.
J . Bacteriol. 179, 6181–6186
38 Gonzalez-Flecha, B. and Demple, B. (1997)
Homeostatic regulation of intracellular
hydrogen peroxide concentration in aerobically
growing Escherichia coli. J . Bacteriol. 179,
382–388
93, 10094–10098
17 Hidalgo, E. and Demple, B. (1997) Spacing of
promoter elements regulates the basal expression
of the soxS gene and converts SoxR from a
transcriptional activator into a repressor.
EMBO J . 16, 1056–1065
18 Outten, C.E. et al. (1999) DNA distortion
mechanism for transcriptional activation by
ZntR, a Zn(II)-responsive MerR homologue in
Escherichia coli. J . Biol. Chem. 274, 37517–37524
19 Ding, H.G. and Demple, B. (1997) In vivo kinetics
of a redox-regulated transcriptional switch. Proc.
Natl. Acad. Sci. U. S. A. 94, 8445–8449
20 Gaudu, P. et al. (1997) Regulation of the soxRS
oxidative stress regulon. Reversible oxidation of
the Fe–S centers of SoxR in vivo. J . Biol. Chem.
272, 5082–5086
21 Hidalgo, E. et al. (1997) Redox signal
transduction: mutations shifting [2Fe–2S] centers
of the SoxR sensor-regulator to the oxidized form.
Cell 88, 121–129
22 Kobayashi, K. and Tagawa, S. (1999) Isolation of
reductase for SoxR that governs an oxidative
response regulon from Escherichia coli. FEBS
Lett. 451, 227–230
39 Zheng, M. et al. (1998) Activation of the OxyR
transcription factor by reversible disulfide bond
formation. Science 279, 1718–1721
40 Åslund, F. et al. (1999) Regulation of the OxyR
transcription factor by hydrogen peroxide and
the cellular thiol-disulfide status. Proc. Natl.
Acad. Sci. U. S. A. 96, 6161–6165
31 Altuvia, S. et al. (1997) A small, stable RNA
induced by oxidative stress: role as a pleiotropic
regulator and antimutator. Cell 90, 43–53
Telom erase inhibitors
Laura K. White, Woodring E. Wright and J erry W. Shay
There has been a vast increase in telom erase research over the past several
years, w ith m any different pre-clinical approaches being tested for inhibiting
the activity of this enzym e as a novel therapeutic m odality to treat m alignancy.
In this review, we w ill provide som e basic background inform ation about
telom eres and telom erase and then discuss the pros, cons and challenges of
the approaches that are currently under investigation, and w hat we m ight
expect in the future of this em erging field.
replication potential in culture. As first described by
Hayflick1, normal cells in culture replicate until they
reach a discrete point at which population growth
ceases. This is termed the Phase III or M1 stage and is
caused by the shortening of a few telomeres to a size
that leads to a growth arrest called ‘cellular
senescence’. A popular misconception is that cellular
senescence leads to cell death rather than to a stable
non-dividing state. This stage can be bypassed in vitro
by abrogation of the function of the p53 and pRB
human tumor suppressor genes2. The cells can then
replicate until the telomeres have become critically
shortened, which produces the M2 or crisis stage. As
opposed to M1, the net growth arrest in the M2 or
crisis stage is caused by a balance between the cell
proliferation and cell death rate. At this stage, when
most of the telomeres are extremely short, end-to-end
fusions and chromosome breakage-fusion cycles cause
marked chromosomal abnormalities and apoptosis.
Under rare circumstances a cell can escape M2 and
Telomeres are repetitive DNA sequences at the ends
of linear chromosomes that protect the termini from
being recognized as double-strand breaks. Without
Laura K. White
Woodring E. Wright*
J erry W. Shay*
telomeres, the ends of the chromosomes would be
Depts of Internal Medicine
and Cell Biology,
‘repaired’, leading to chromosome fusion and massive
genomic instability. In humans, the telomeres
typically contain 5–15 kb pairs of repeating TTAGGG
The University of Texas
Southwestern Medical
Center at Dallas Dallas,
sequences. With each cell division, telomeres shorten
by 50–200 bp because the lagging strand of DNA
synthesis is unable to replicate the extreme 3′ end of
the chromosome (the ‘end replication problem’;
Texas 75390-9039
*e-m ail:
woodring.wright@
UTSsouthwestern.edu
*e-m ail: Jerry.Shay@
UTSouthwestern.edu
Fig. 1). Normal cultured human cells have a limited
http://tibtech.trends.com 0167-7799/01/$ – see front m atter © 2001 Elsevier Science Ltd. All rights reserved. PII: S0167-7799(00)01541-9

Review
TRENDS in Biotechnology Vol.19 No.3 March 2001
115
Fig . 1. End replication
problem . DNA replication
starts by the unwinding of
double stranded DNA at
the origin of replication.
Synthesis of the new
strands of DNA proceeds
in the 5′ to 3′ direction.
The leading strand is
continuous, but the
telomeres. This makes telomerase a target not only for
cancer diagnosis but also for the development of novel
therapeutic agents. There are several considerations
about telomerase as an anticancer target that need to
be addressed. First, there will be an expected lag
phase between the time telomerase is inhibited and
the time when the telomeres of the cancer cells shorten
sufficiently to produce detrimental effects on cellular
proliferation. This lag phase will vary depending on
the initial telomere length. There is, at least in theory,
the possibility that cancer cells might become
Leading strand
3′
5′
Lagging strand
3′
5′
RNA primers removed and degraded
Unreplicated
DNA
TRENDS in Biotechnology
lagging strand is
synthesized as a series of
short segm ents of DNA
(Okazaki fragm ents) onto
the ends of RNA prim ers.
The RNA prim ers are
rem oved and DNA
become immortal by stabilizing the length of its
telomeres. This almost always occurs through the
activation of the enzyme telomerase3,4
Telomerase is a unique ribonucleoprotein enzyme
that is responsible for adding the telomeric repeats
onto the 3′ ends of chromosomes5 (Fig. 2). It has two
major components as well as many associated proteins
that are critical for proper function. The first major
resistant to telomerase inhibitors or develop
.
alternative mechanisms of telomere maintenance
independent of telomerase, which has been seen in
experimentally immortalized human cell lines7.
Finally, inhibitors of telomerase would potentially
have effects on other human somatic cells that express
telomerase, such as hematopoietic stem cells, germline
polym erase fills in the
gaps, which are then
ligated (not shown). The
extrem e 3′ end is not
replicated leading to DNA
loss and the ‘end
replication problem ’. The
leading strand m ight also
be processed to give a
short overhang to which
end-protecting factors
could bind.
component is a functional or template RNA, the human cells and cells of the basal layer of the epidermis and
telomerase RNA (hTR), which contains an 11 bp
sequence that serves as the template on which
telomeric repeats are added to the chromosome. The
second major component is the human telomerase
reverse transcriptase (hTERT) catalytic subunit. The
ability of cells to express telomerase activity is limited
intestinal crypts8. We believe that these effects might
be minor because stem cells of renewal tissues typically
have much longer telomeres than cancer cells have and
the deepest stem cells only proliferate intermittently.
During the time that these cells are quiescent,
telomere shortening does not occur and telomerase
by the presence or absence of hTERT because all human activity is negligible. The expected effects of telomerase
somatic cells constitutively contain hTR(Ref. 6).
Telomerase activity has been found in ~85–90% of
all human tumors but not in adjacent normal cells4. It
has thus been hypothesized that for a tumor cell to
undergo sustained proliferation beyond the limits of
cellular senescence, it must reactivate telomerase or
an alternative mechanism in order to maintain
inhibition on cancer cells as well as telomerase-positive
normal cells are illustrated in Fig. 3.
There have also been concerns that inhibiting
telomerase might lead to an increase in malignancy
by enhancing the genomic instability of cells. These
concerns have risen from the mTR−/− knockout mice
which, as compared with the mTR+/+ model, has an
increased incidence of malignancies in both early and
late generation cohorts9. There is no evidence to
suggest that this would be true in humans. Mouse
telomeres are much longer than even the longest
human telomeres and do not appear to have a role in
signaling senescence. Human cells that lack cell cycle
checkpoints with some terminally short telomeres
die, whereas similar mouse cells show little evidence
of any significant block to further proliferation10. It is
therefore difficult to interpret any effects on genomic
instability or tumorigenesis that telomerase
inhibition in human cells will have based on previous
mouse experiments.
hTR
5
′
GGTTAGGGTTAGGGTTAG
CAAUCCCAAUC
3′CCAAT
3′
5
′
hTERT
3
′
Addition of telomeric repeats
GTTAG
5
3
′
′
GGTTAGGGTTAGGGTTAGG
CAAUCCCAAUC
CCAAT
5
′
Template repositioning
3
′
3 GGTTAGGGTTAGGGTTAGGGTTAG
CAAUCCCAAUC
′
CCAATCCC
5
′
To confirm that a telomerase inhibitor is acting
specifically through a telomere-dependent
mechanism, certain criteria should almost always be
met: (1) inhibitors should reduce telomerase activity
but initially should not affect cell growth rates;
(2) addition of inhibitors should lead to progressive
telomere shortening with each cell division;
3
′
Addition of telomeric repeats
5
3
′
′
GGTTAGGGTTAGGGTTAGG
CCAATCCC
GTTAGGGTTAG
CAAUCCCAAUC
(3) addition of inhibitors should eventually cause cells
to die or undergo growth arrest; (4) the time necessary
to observe decreased proliferation should vary
depending on initial telomere length; and
(5) chemically related molecules that do not inhibit
telomerase activity should not cause decreased cell
proliferation or telomere shortening.
3
′
TRENDS in Biotechnology
Fig . 2 . The addition of telom eric repeats. Telom erase adds hexam eric TTAGGG repeats by attaching to
the end of the chrom osom e and then utilizing its internal tem plate to specify the sequence of added
nucleotides. As evidenced by telom erase repeat addition processivity, it then is able to reposition
downstream and re-anchor its tem plate for the addition of m ore telom eric repeats.
http://tibtech.trends.com

Review
TRENDS in Biotechnology Vol.19 No.3 March 2001
116
degrade the mRNA once the RNA–ODN
hybridization occurs11. Therapeutic uses of these
molecules are currently under investigation in many
different fields of research including oncology,
cardiovascular disease and infectious diseases, with
one drug currently approved for use in
Germ cells
cytomegalovirus retinitis11.
Telomerase presents itself as an intriguing target
for these drugs because it possesses a functional RNA
component as part of its structure. The template
region of hTR must be exposed to add new telomeric
repeats onto the chromosome, making this an
accessible target for the ODN. Thus, rather than
using ODNs to inhibit translation, ODNs directed
against the hTR template are designed to directly
inhibit telomerase activity. ODNs present several
problems in drug development. The first is cellular
delivery because, without a transfecting agent, these
drugs do not easily enter cells in culture. In vivo, they
have been found to cross the cell membrane by a
poorly understood endocytic mechanism. Once inside
the cell they are subjected to degradation by a variety
of exo- and endonucleases. Chemical modifications to
the ODNs have been implemented that might reduce
their degradation but might also reduce the
Telomerase
inhibition
Cancer cell
Telomerase
activation
Growth arrest
or apoptosis
Growth arrest
or apoptosis
Time
TRENDS in Biotechnology
The telomerase holoenzyme complex presents
multiple potential sites for the development of
inhibitors. These include the functional RNA or
hTR, the catalytic reverse transcriptase subunit
hTERT, the primer anchoring site, holoenzyme
assembly and the factors involved in recruiting
telomerase to the telomere. In the past several years
there have been more than 100 manuscripts
published on telomerase inhibitors. However, only a
handful of these reports fulfill the criteria for
telomerase inhibitors outlined above. In this article,
we will review some of the different approaches to
telomerase inhibition that are currently under
investigation (Box 1).
Fig. 3. Effects of telomerase
inhibition on the telom ere
lengths and proliferative
capacity of both cancer
cells and telom erase-
positive norm al hum an
som atic cells and germ
line cells.
specificity of binding to the target sequence.
A variety of studies have been published on the
inhibition of telomerase using antisense approaches
directed both at the template and at non-template
regions of hTR. The first report was by Feng et al.6
who used a construct expressing an antisense
transcript to the first 185 nucleotides of the RNA and
introduced them into HeLa cells. In this study, 33 out
of 41 clones underwent crisis after 23–26 doublings.
Targeting the RNA com ponent of telom erase
Antisense oligodeoxynucleotides
Antisense oligodeoxynucleotides (ODN) are an area of The clones that entered crisis had reduced telomerase
heightened interest in the field of telomerase
inhibition. These drugs consist of short stretches of
DNA that are complementary to a target RNA. The
mechanism of action for most applications is to
hybridize to their complementary RNA by
activity, as well as shorter telomeres compared with
the clones that contained vector alone. Since that first
study there have been many reports on antisense
ODN inhibitors of telomerase. Many of these have
reported a reduction in telomerase activity in cancer
cells treated in culture, however, most have not
documented reduction in telomere length with
continued treatment12–14. Another concern is that in
some cases the cells underwent slowed growth or
apoptosis without the time lag that would have been
expected if the mechanism of action was specific to
Watson–Crick base pairing and inhibit the
translation of the RNA by a passive and/or active
mechanism. The passive inhibition occurs simply by
the competitive binding of the ODN to the RNA,
whereas the active mechanism recruits RNaseH to
telomerase and telomere erosion15–17
.
Box 1. Approaches for targeting telom erase in
cancer therapy
There have been several studies describing the use
of a 2′,5′-oligoadenylate (2-5A) moiety attached to the
ODN to increase the activity of the ODN against
telomerase16–18. The addition of the 2-5A recruits
RNaseL along with RNaseH to degrade the targeted
RNA once the ODN has hybridized. RNaseL is part of
the mammalian antiviral defense. It is an
•
•
•
Oligonucleotides – antisense hTR tem plate
Ham m erhead ribozym es – hTR tem plate
Sm all m olecules
G-quadruplex stabilizers
Com binatorial libraries
Com pound collections
endoribonuclease that functions in the interferon-
regulated 2-5A system. Upon binding to 2-5A, it is
converted to an active form that cleaves the single-
standed RNA to which it is targeted. Kondo et al.16
used this approach to target malignant glioma cells
and showed that five hours after treating the cells
•
Catalytic (hTERT) com ponent
Reverse transcriptase inhibitors
Dom inant-negative hTERT
Im m unotherapy
http://tibtech.trends.com

Review
TRENDS in Biotechnology Vol.19 No.3 March 2001
117
with a 2-5A antisense moiety directed at a non-
template region, hTR was not detectable by reverse
transcriptase (RT)-PCR. After continuous treatment
with the antisense drug over a 14-day period, 79% of
the cells underwent apoptosis. This striking effect on
cell growth is unlikely to be explained by telomere
erosion because the cells would not have undergone
sufficient cell divisions to significantly shorten their
telomeres. Kushner et al.17 described a similar effect
of a 2-5A antisense ODN directed against hTR in
human ovarian cancer cell lines. They also showed a
profound early cell death after only seven days of
treatment with the antisense ODN as compared with
control ODN. These chemistries have subsequently
been tested in vivo in a nude mouse using a human
prostate cancer xenograft. A 2-5A anti-hTR 19mer
was injected directly into the tumor over a period of
seven days, resulting in an increase in tumor volume
of only 14% as compared with 215% for the control18.
Analyses of the tumors treated with the
epithelial cells in culture, using both match and
mismatch 13mers that were complementary to the
hTR template region over a 120-day period21. Cells
given the match ODNs demonstrated inhibition of
telomerase activity, and after an initial period of
normal growth, shortening of telomeres and eventual
cell death via apoptosis was observed. The control
cells and cells that were given the mismatch ODNs
did not exhibit any significant alterations in telomere
biology or other phenotypic changes. Furthermore,
when the match ODNs were removed from the cells in
culture, the surviving cells regained their baseline
telomerase activity, proliferation rate returned to
normal, and the telomeres grew back to their original
lengths, supporting the conclusion that their
mechanism of action is through a competitive
inhibition of the telomerase enzyme. During this
study, there was no evidence of any emergence of an
alternative pathway for telomere elongation.
2-5A antisense showed many apoptotic cells, and
analyses of the cells in culture showed activation of
the caspase family. The mechanism of action of these
processes and their specificity to telomerase is still
unknown. There has been no long-term follow up on
the cells that did not apoptose to determine whether
they became resistant to the ODN. In addition, there
are no reports on the effects these drugs have on
telomerase-positive normal somatic cells.
Another class of oligonucleotides being studied are
peptide nucleic acids (PNAs). PNAs are analogs of
RNA and DNA, in which the pentose-phosphate
backbone is replaced by an oligomer of
Ham m erhead ribozym es
Hammerhead ribozymes are small RNA molecules
that possess specific endoribonuclease activity. They
consist of a catalytic core flanked by anti-sense
sequences that function in the recognition of the target
site. Yokoyama et al.22 used three different ribozyme
constructs targeting the 3′ end of different sequences in
hTR and introduced them into an endometrial cancer
cell line. The ribozyme targeting the template region
proved to be the most efficacious in reducing
telomerase activity and additionally led to telomere
shortening over a four-week period. No change in
proliferation rate was seen in these cells over this time
period. A similar study using a ribozyme targeting the
hTR template in melanoma cells, showed a reduction
in telomerase activity with a reported slowing in
N-(2-aminoethyl) glycine, making them resistant to
degradation by endo- and exonucleases. This neutral
backbone additionally enhances the affinity and
specificity of hybridization to the RNA targets. Human doubling time. However, after >20 passages, the cells
telomerase can be inhibited in cells in culture by PNA
oligonucleotides complementary to the telomere-
templating region of hTR (Ref. 9). When delivered to
immortalized SV40 human cell lines in culture using
exhibited no reduction in telomere length and were still
proliferating23. This strategy for telomerase inhibition
might prove to be a useful tool if investigators are able
to demonstrate the expected effects on telomere biology
electroporation over 11–16 doublings, the cells showed with specific targeting of the telomerase RNA.
reduced telomerase activity, shortening of telomere
lengths, and growth inhibition after an initial lag
Inhibition of the telom erase catalytic protein subunit
phase20. Although the pharmacokinetics and uptake of (hTERT)
these drugs in vivo is largely unknown, they present
an exciting new class of oligonucleotide agents.
The most extensively studied modified ODNs are
the chimeric 2′-O-methyl RNA and 2′ methoxyethoxy
RNAs. These modifications to the sugar moieties of
the RNA bases flanking the antisense DNA, along
with substituting phosphorothioate linkages for
phosphodiester bonds, confers greater specificity to
the RNA target and also greater resistance to
Dom inant negative hTERT
Dominant negative hTERT constructs (mutants that
are catalytically inactive but still able to bind and
sequester hTR) effectively inhibit telomerase both in
vitro and in vivo. By introducing cDNA that contains
point mutations in the reverse transcriptase motifs of
hTERT into both a human epidermoid tumor cell line
and an immortalized embryonic kidney cell line,
Zhang et al.24 demonstrated an inhibition of telomerase
nucleases. One downside of the chimeric ODNs is that activity as well as a reduction in telomere length. The
with this modification, RNaseH cannot be activated
and the ODN acts only through a passive mechanism
of competitive binding to the target sequence.
In one study, the 2′-O-methyl chemistry was
administered to immortalized human breast
epidermoid tumor cells, which had very short
telomeres (1–4 kb), showed early morphologic changes
and the population underwent growth arrest with all
the plated cells dead at 32 days. By contrast, the
embryonic kidney cells have a significant clone-to-clone
http://tibtech.trends.com

Review
TRENDS in Biotechnology Vol.19 No.3 March 2001
118
variability in telomere length (3–12 kb). Clones
chosen with long telomeres (10–12 kb) continued to
proliferate at the same rate as the control and
wild-type hTERT infected cells until their telomeres
shortened to ~4 kb. At this point, the clones lost the
dominant-negative protein and reactivated
telomerase resulting in a stabilization of telomere
length. Considering data from other reports on
inhibitors that cause progressive telomere
shortening, it is probable that these clones would
have undergone an apoptotic cell death at a point
when their telomeres became critically short if the
dominant-negative mutants remained active.
Hahn et al.25 described the expression of a
catalytically inactive hTERT subunit in a variety of
human immortalized cells and cancer cells using a
retroviral vector. The dominant-negative mutant was
created by substituting the aspartic acid and valine
residues at positions 710 and 711 with alanine and
isoleucine, respectively. Multiple cell clones infected
with the DN-hTERT had undetectable telomerase
activity with gradual telomere shortening and
eventual growth arrest and cell death. The clones
infected with wild-type hTERT and empty vectors
retained telomerase activity and no effects were seen
on telomere length or proliferation when compared
with control clones. In addition, GM847 cells, an
immortal cell line that maintains its telomeres by an
alternative mechanism, were tested with these
They were able to demonstrate telomerase
inhibition and slowed growth of cells in culture;
however, they have not demonstrated telomere
erosion or eventual growth arrest of the cells after
prolonged exposure26–28. Strahl and Blackburn
showed progressive telomere shortening of two
immortalized human lymphoid lines using
dideoxyguanosine inhibitors but no effects on cell
viability after prolonged exposure were observed29.
It is unlikely that these analogs are functioning
through a selective inhibition of telomerase because
their reduced proliferation is occurring in the setting
of sufficiently long telomeres. A plausible explanation
might be that the RTIs have a toxic effect on the cells,
perhaps by inhibiting mitochondrial DNA replication
leading to the observed reduction in telomerase
activity, which is dose dependent. Work in this field is
continuing and might shed some light on their precise
effects on telomere biology.
Im m unotherapy
Recently, there has been exciting work in the field of
antigen-specific immune responses in tumor cells.
Previous studies have focused on expression of
tumor-associated antigens that are restricted to only
a few tumor types, making progress in this field slow
and tedious. The discovery of tumor-associated
antigens that are universal to a broad range of tumor
types would greatly enhance the efforts to target
constructs. The GM847 clones that were infected with these antigens in strategies such as vaccination and
the DN-hTERT remained telomerase negative with
no effects on cell growth or telomere length, whereas
the GM847 clones that were infected with the
wild-type hTERT became positive for telomerase
in generation of effective anti-tumor cytotoxic
T lymphocyte (CTL) responses.
Telomerase is present in the majority of human
tumors and is, therefore, a good candidate as a
activity but maintained their heterogeneous telomere universal tumor-associated antigen. Vonderheide et
length and growth rate. To further test the hypothesis al.30 identified a hTERT-derived peptide, I540, that
that the inhibition of telomerase will decrease
tumorigenicity of cells in vivo, late passage
36M ovarian cancer cells were injected into
immunodeficient nude mice. The cells containing the
wild-type hTERT and control vectors readily
produced tumors whereas the cells with the
DN-hTERT failed to form tumors. These results
validate the targeting of hTERT as a potentially
powerful site for anti-cancer drug design.
binds to human leukocyte antigen (HLA)-A2.1. This
major histocompatibility complex (MHC) class I allele
is expressed by nearly 50% of the population, making
it an attractive target. They generated CTL from
CD8+ T cells from the peripheral blood of normal
HLA-A2.1 donors by priming with the peptide pulsed
autologous dendritic cells. They then showed a
specific CTL response in cells expressing hTERT.
This response was shown in a variety of tumor cells
and was not present in either telomerase negative
cells or in cells negative for the HLA-A2.1 allele.
Similarly, Minev et al.31 identified two hTERT
peptides containing known binding motifs to the
HLA-A2.1 allele, p540 and p865, which were able to
generate a specific CTL response in HLA-A2.1
positive tumor cells of prostate, lung, breast, colon
and melanoma. Neither of these studies found a CTL
effect on telomerase positive CD34+ hematopoietic
cells. This might be because of the relatively low level
of telomerase expression in these cells compared with
tumor cells, and the fact that they do not continuously
express telomerase. Whether other normal somatic
cells that express telomerase will be affected by the
CTL response remains to be determined.
Reverse transcriptase inhibitors
Reverse transcriptase inhibitors (RTIs) are
predominantly used in the treatment of HIV. They
are able to incorporate into the viral DNA and block
chain elongation using the reverse transcriptase
enzyme. Telomerase, because of its RNA-dependent
DNA polymerase activity, has been studied as a
potential use for these agents in cancer therapeutics.
The results of these investigations thus far have been
inconsistent. 3′-azido-3′-deoxythymidine (AZT) has
been the most extensively studied of the RTIs.
Several investigators have tested AZT in
concentrations ranging from 100 µM to 1.75 mM,
according to the IC50 for the cell lines used.
http://tibtech.trends.com

Review
TRENDS in Biotechnology Vol.19 No.3 March 2001
119
Sm all m olecule inhibitors
A rapidly emerging area for discovering potential
candidate telomerase inhibitors is through the rapid
screening of small molecules using NCI-COMPARE
analyses or other large-scale screening models. The
NCI-COMPARE bioinformatics approach
(a) Telomerase inhibitor alone
Tumor size
Telomere length 7 kbp
5 kbp
4 kbp
2 kbp
incorporates a strategy of testing and categorizing
drugs based on their chemical structures relative to a
known ‘seed’ compound37. There are efforts under way
to identify prospective telomerase inhibitors using
this system, with several potentially promising
rhodacyanine derivatives discovered thus far38. The
mechanism of action of these molecules is not known
at this time but could be through disruption of the
anchoring of telomerase to the telomere, disruption of
the telomerase holoenzyme assembly or G-quartet
stabilization. This and other small-molecule
(b) Angiogenesis inhibitor alone
Tumor size
Telomere length 7 kbp
7 kbp
7 kbp
7 kbp
2 kbp
(c) Telomerase inhibitor + angiogenesis inhibitor
Growth
arrest
Tumor size
Telomere length 7 kbp
5 kbp
4 kbp
Time of treatment
screening strategies using combinatorial libraries are
likely to yield new classes of telomerase inhibitors.
TRENDS in Biotechnology
Conclusions and future perspectives
Fig . 4 . Model of telom erase inhibition in conjunction with angiogenesis inhibitors. (a) Treatm ent
with telom erase inhibitor alone. The cells continue to proliferate as telom ere lengths shorten. Once
the telom eres reach a critically short length, the cells will growth arrest or apoptose. This lag phase
of continued cell proliferation and tum or growth will vary depending on initial telom ere length.
(b) Tum or treated with an angiogenesis inhibitor alone. The tum or’s growth is balanced by apoptosis
but telom eres rem ain unchanged from their initial lengths. (c) Treatm ent with a com bination of
telom erase inhibitor and angiogenesis inhibitor. The tum ors do not increase in size as growth is
balanced by apoptosis as in (b) above. However, when telom eres reach a critical length, there is
eventual growth arrest and apoptosis.
We have discussed the major avenues of targeting
telomerase in human cancer cells; the question,
however, still remains whether telomerase will be a
viable approach to treating cancer. Would inhibition
of the enzyme in the classical sense, which would
require a lag phase before any detrimental effects on
the cells, be a reasonable strategy in patients with a
large tumor burden? Probably not. Most likely, the
use of telomerase inhibitors in this situation would be
as an adjuvant treatment in combination with
surgery, radiation treatment and chemotherapy with
standard agents, as well as new agents such as
angiogenesis inhibitors (Fig. 4). It is also possible that
telomerase inhibitors could be used following
standard therapies in which there is no clinical
evidence of disease to treat possible micrometastases,
and thus prevent cancer relapse. In these situations,
which would probably require prolonged treatment, it
will be imperative that the drugs have a low toxicity
profile and are easily administered.
The other avenue of telomerase inhibition is by
targeting telomerase-expressing cells as a means to
kill the cells. Immunotherapy directed against
telomerase positive cells, as well as strategies using a
suicide gene promoter targeted to hTERT-expressing
cells (unpublished results) are currently under
investigation. These modalities have the advantage of
abolishing the lag phase that is required with the
classic mode of telomerase inhibition. However, these
treatments might also prove to be more toxic to
normal somatic cells expressing telomerase.
Will telomerase inhibitors become a common
weapon in the armory against cancer? Will
The early in vitro work on the immunogenicity of
hTERT peptides provides a novel avenue of
telomerase inhibition because no lag period would be
required before cell death. Much work remains to be
done in this field because the in vivo efficacy of
delivering these vaccines to trigger immunity and
the elicitation of CTL responses gave inconclusive
results in recent clinical trials using melanoma-
associated peptides32.
G-quadruplex stabilization
The 3′ overhang of telomeres are rich in guanine
units and have been shown in vitro to produce
tetra-stranded DNA structures termed
G-quadruplexes. These G-quadruplex
conformations inhibit telomerase activity and,
therefore, drugs that stabilize these tetraplexes
could conceivably be effective chemotherapeutic
agents. There have been many reports of
compounds that inhibit telomerase through the
stabilization of the G-quadruplexes in cell extracts
and cell culture. Some of these potential compounds
include porphyrin derivatives, acridine derivatives,
2,6-diamidoanthraquinones and fluorenone-based
compounds33–36. Although this might be a viable
approach for telomerase inhibition, none of the
published work to date provides data regarding
telomere shortening with these agents. Until more
is known about the effects of these small molecules
on telomere biology, it remains to be determined
whether they will be a reasonable strategy for
telomerase inhibition.
there be emergence of alternative mechanisms of
telomere maintenance? What will the effects of
telomerase inhibition be on normal hematopoietic
and germline cells? These and other questions will
only be answered when these drugs are moved
into clinical trials.
http://tibtech.trends.com

Review
TRENDS in Biotechnology Vol.19 No.3 March 2001
120
References
15 Mata, J .E. et al. (1997) A hexameric
phosphorothioate oligonucleotide telomerase
inhibitor arrests growth of Burkitt’s lymphoma
cells in vitro and in vivo. Toxicol. Appl.
Pharmacol. 144, 189–197
16 Kondo, S. et al. (1998) Targeted therapy of human
malignant glioma in a mouse model by 2-5A
antisense directed against telomerase RNA.
Oncogene 16, 3323–3330
17 Kushner, D.M. et al. (2000) 2-5A antisense
directed against telomerase RNA produces
apoptosis in ovarian cancer cells. Gynecol. Oncol.
76, 183–192
18 Kondo, Y. et al. (2000) Treatment of prostate cancer
in vitro and in vivo with 2-5A-anti-telomerase RNA
component. Oncogene 19, 2205–2211
19 Norton, J .C. et al. (1996) Inhibition of human
telomerase activity by peptide nucleic acids. Nat.
Biotechnol. 14, 615–619
20 Shammas, M.A. et al. (1999) Telomerase
inhibition by peptide nucleic acids reverses
‘immortality’ of transformed human cells.
Oncogene 18, 6191–6200
21 Herbert, B.S. et al. (1999) Inhibition of human
telomerase in immortal human cells leads to
progressive telomere shortening and cell death.
Proc. Natl. Acad. Sci. U. S. A. 96, 14276–14281
22 Yokoyama, Y. et al. (1998) Attenuation of
telomerase activity by a hammerhead ribozyme
targeting the template region of telomerase RNA
in endometrial carcinoma cells. Cancer Res.
58, 5406–5410
23 Folini, M. et al. (2000) Inhibition of telomerase
activity by a hammerhead ribozyme targeting the
RNA component of telomerase in human
melanoma cells. J . Invest. Dermatol. 114, 259–267
24 Zhang, X. et al. (1999) Telomere shortening and
apoptosis in telomerase-inhibited human tumor
cells. Genes Dev. 13, 2388–2399
27 Melana, S.M. et al. (1997) Inhibition of cell
growth and telomerase activity of breast cancer
cells in vitro by 3′-azido-3′-deoxythymidine. Clin.
Cancer Res. 4, 693–696
28 Murakami, J . et al. (1998) Inhibition of
telomerase activity and cell proliferation by a
reverse transcriptase inhibitor in gynaecological
cancer cell lines. Eur. J . Cancer 35, 1027–1034
29 Gomez, D.E. et al. (1998) Irreversible telomere
shortening by 3′-azido-2′,3′-dideoxythymidine
(AZT) treatment. Biochem. Biophys. Res.
Commun. 246, 107–110
30 Vonderheide, R.H. et al. (1999) The telomerase
catalytic subunit is a widely expressed tumor-
associated antigen recognized by cytotoxic T
lymphocytes. Immunity 10, 673–679
31 Minev, B. et al. (2000) Cytotoxic T cell immunity
against telomerase reverse transcriptase in
humans. Proc. Natl. Acad. Sci. U. S. A.
1 Shay, J .W. and Wright, W.E. (2000) Haylick, his
limit, and cellular aging. Nature Review: Mol. Cell
Biol. 1, 72–76
2 Shay, J .W. et al. (1991) A role for both RB and p53
in the regulation of human cellular senescence.
Exp. Cell Res. 196, 33–39
3 Wright, W.E. and Shay, J .W. (1992) The two-stage
mechanism controlling cellular senescence and
immortalization. Exp. Gerontol. 27, 383–389
4 Kim, N.W. et al. (1994) Specific association of
human telomerase activity with immortal cells
and cancer. Science 266, 2011–2015
5 Greider, C.W. and Blackburn, E.H. (1985)
Identification of a specific telomere terminal
transferase activity in Tetrahymena extracts.
Cell 43, 405–413
6 Feng, J . et al. (1995) The RNA component of
human telomerase. Science 269, 1236–1241
7 Bryan, T.M. et al. (1995) Telomere elongation in
immortal human cells without detectable
telomerase activity. EMBO J . 14, 4240–4248
8 Wright, W.E. et al. (1996) Telomerase activity in
human germline and embryonic tissues and cells.
Dev. Genet. 18, 173–179
9 Artandi, S.E. and DePinho, R.A. (2000) Mice
without telomerase: what can they teach us about
human cancer? Nat. Med. 6, 852–855
10 Wright, W.E. and Shay, J .W. (2000) Telomere
dynamics in cancer progression and prevention:
fundamental differences in human and mouse
telomere biology. Nat.Med. 6, 849–851
97, 4796–4801
32 Rosenberg, S.A. et al. (1998) Immunologic and
therapeutic evaluation of a synthetic peptide
vaccine for the treatment of patients with
metastatic melanoma. Nat. Med. 4, 321–327
33 Harrison, R.J. et al. (1999) Human telomerase
inhibition by substituted acridine derivatives.
Bioorg. Med. Chem. Lett. 9, 2463–2468
34 Sun, D. et al. (1997) Inhibition of human
telomerase by a G-quadruplex-interactive
compound. J . Med. Chem. 40, 2113–2116
35 Perry, P.J . et al. (1999) 2,7-Disubstituted
amidofluorenone derivatives as inhibitors of
human telomerase. J . Med. Chem. 42, 2679–2684
36 Read, M.A. et al. (1999) Molecular modeling
studies on G-quadruplex complexes of telomerase
inhibitors: structure-activity relationships.
J . Med. Chem. 42, 4538–4546
37 Paull, K.D. et al. (1989) Display and analysis of
patterns of differential activity of drugs against
human tumor cell lines: development of mean
graph and COMPARE algorithm. J . Natl. Cancer
Inst. 81, 1088–1092
38 Naasani, I. et al. (1999) FJ 5002: A potent
telomerase inhibitor identified by exploiting the
disease-oriented screening program with
COMPARE analysis. Cancer Res. 59, 4004–4011
11 Galderisi, U. et al. (1999) Antisense
oligonucleotides as therapeutic agents.
J . Cell Physiol. 181, 251–257
12 Ohnuma, T. et al. (1997) Inhibitory effects of
telomere-mimic phosphorothioate
oligonucleotides on various human tumor cells in
vitro. Anticancer Res. 17, 2455–2458
13 Glukhov, A.I. et al. (1998) Inhibition of telomerase
activity of melanoma cells in vitro by antisense
oligonucleotide. Biochem. Biophys. Res.
Commun. 248, 368–371
25 Hahn, W.C. et al. (1999) Inhibition of telomerase
limits the growth of human cancer cells. Nat. Med.
5, 1164–1170
26 Strahl, C. and Blackburn, E.H. (1996) Effects of
reverse transcriptase inhibitors on telomere
length and telomerase activity in two immortal
human cell lines. Mol. Cell. Biol. 16, 53–56
14 Bisoffi, M. et al. (1998) Inhibition of human
telomerase by a retrovirus expressing telomeric
antisense RNA. Eur. J . Cancer 34,1242–1249
Trends Guides and supplem ents questionnaire
Trends Guides and supplem ents are supplem entary publications produced in association with the
Trends journals. The aim of these Guides and supplem ents is to provide our readers with em erging
inform ation on a topical area of research, in a single focused issue.
Trends Guides and supplem ents can be found at www.journals.bm n.com and are distributed FREE
to subscribers of relevant Trends journals.
We want to know what you think of these Guides and supplem ents. Enclosed in the April issue of
Tibtech you will find a loose-leaf questionnaire. We would be extrem ely grateful if you could spare a
few m inutes to fill in this questionnaire and return it to us using the reply-paid envelope also provided.
Alternatively, you will also find this questionnaire online at
http:/ / w w w.bm n.com / questionnaire?questionnaire=trendsguides
We hope you will be able to help us by filling in this questionnaire when it appears next m onth.
Thank you for your help.
http://tibtech.trends.com