Bicyclic 1-hydroxy-2-oxo-1,2-dihydropyridine-3-carboxamide-containing HIV-1 integrase inhibitors having high antiviral potency against cells harboring raltegravir-resistant integrase mutants

Article abstract of DOI:10.1021/jm401902n

Integrase (IN) inhibitors are the newest class of antiretroviral agents developed for the treatment of HIV-1 infections. Merck's Raltegravir (RAL) (October 2007) and Gilead's Elvitegravir (EVG) (August 2012), which act as IN strand transfer inhibitors (INSTIs), were the first anti-IN drugs to be approved by the FDA. However, the virus develops resistance to both RAL and EVG, and there is extensive cross-resistance to these two drugs. New "2nd- generation" INSTIs are needed that will have greater efficacy against RAL- and EVG-resistant strains of IN. The FDA has recently approved the first second generation INSTI, GSK's Dolutegravir (DTG) (August 2013). Our current article describes the design, synthesis, and evaluation of a series of 1,8-dihydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamides, 1,4-dihydroxy-2-oxo-1, 2-dihydro-1,8-naphthyridine-3-carboxamides, and 1-hydroxy-2-oxo-1,2-dihydro-1,8- naphthyridine-3-carboxamides. This resulted in the identification of noncytotoxic inhibitors that exhibited single digit nanomolar EC₅₀ values against HIV-1 vectors harboring wild-type IN in cell-based assays. Importantly, some of these new inhibitors retain greater antiviral efficacy compared to that of RAL when tested against a panel of IN mutants that included Y143R, N155H, G140S/Q148H, G118R, and E138K/Q148K.

Full text of DOI:10.1021/jm401902n

Article
pubs.acs.org/jmc
Bicyclic 1‑Hydroxy-2-oxo-1,2-dihydropyridine-3-carboxamide-
Containing HIV‑1 Integrase Inhibitors Having High Antiviral Potency
against Cells Harboring Raltegravir-Resistant Integrase Mutants
Xue Zhi Zhao,† Steven J. Smith,‡ Mathieu Metifiot,§,∥ Barry C. Johnson,‡ Christophe Marchand,§
́
Yves Pommier,§ Stephen H. Hughes,‡ and Terrence R. Burke, Jr.*,†
†Chemical Biology Laboratory, National Cancer Institute-Frederick, National Institutes of Health, Frederick, Maryland 21702, United
States
‡HIV Drug Resistance Program, National Cancer Institute-Frederick, National Institutes of Health, Frederick, Maryland 21702,
United States
§Laboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer Institute, National Institutes of Health,
Bethesda, Maryland 20892, United States
ABSTRACT: Integrase (IN) inhibitors are the newest class of antiretroviral agents developed for
the treatment of HIV-1 infections. Merck’s Raltegravir (RAL) (October 2007) and Gilead’s
Elvitegravir (EVG) (August 2012), which act as IN strand transfer inhibitors (INSTIs), were the
first anti-IN drugs to be approved by the FDA. However, the virus develops resistance to both RAL
and EVG, and there is extensive cross-resistance to these two drugs. New “2nd-generation” INSTIs
are needed that will have greater efficacy against RAL- and EVG-resistant strains of IN. The FDA
has recently approved the first second generation INSTI, GSK’s Dolutegravir (DTG) (August
2013). Our current article describes the design, synthesis, and evaluation of a series of 1,8-
dihydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamides, 1,4-dihydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides, and
1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides. This resulted in the identification of noncytotoxic inhibitors that
exhibited single digit nanomolar EC50 values against HIV-1 vectors harboring wild-type IN in cell-based assays. Importantly,
some of these new inhibitors retain greater antiviral efficacy compared to that of RAL when tested against a panel of IN mutants
that included Y143R, N155H, G140S/Q148H, G118R, and E138K/Q148K.
generation INSTI that has recently received FDA approval for
the treatment of AIDS.1,12,13 However, the finding that DTG,
like all anti-HIV drugs, selects for resistant viruses,12
emphasizes the continuing need to develop INSTIs that can
effectively inhibit HIV strains that carry the common/extant
resistance mutations.
INTRODUCTION
■
After 30 years of intensive research, approximately 30 drugs
have been approved for the treatment of acquired immunode-
ficiency syndrome (AIDS).1,2 Of these, integrase (IN)
inhibitors are the newest drug class2 with Merck’s Raltegravir
(RAL, 1) (October 2007)3 and Gilead’s Elvitegravir (EVG, 2)
(August 2012)4 being the first IN inhibitors to be approved by
the FDA (Figure 1). These agents selectively block the strand
transfer step (ST) of the integration reaction as compared with
the 3′-processing step (3′-P). For this reason, these drugs are
called IN strand transfer inhibitors (INSTIs).5 INSTIs,
including RAL and EVG, share key structural features. These
include a coplanar arrangement of three heteroatoms, whose
function is to chelate the two catalytically important Mg2+ ions
at the IN active site, which are held in place by a conserved
DDE motif (D64, D116, and E152 in HIV-1 IN).6 Additionally,
a halobenzyl ring is present that interacts with the penultimate
cytosine base near the 3′-end of the viral DNA. This displaces
the dA at the very 3′-end of the viral DNA and in so doing
prevents the insertion of the viral DNA into the host genome.7
Treatment with RAL and EVG can lead to the development of
resistance, and there is extensive shared cross-resistance.8−10
Therefore, “2nd-generation” INSTIs are being developed that
have greater efficacies against RAL and EVG-resistant strains of
IN.11 GSK’s Dolutegravir (DTG, 3, Figure 1) is a second-
An attractive property of DTG is its ability to maintain high
potencies against mutant strains of HIV that are resistant to
RAL and EVG.14 Although DTG contains key structural
features that are found in other INSTIs (outlined above and
highlighted in Figure 1), it differs in having its halobenzyl group
appended via an amide carbonyl that is proximal to but not part
of the triad of metal chelating heteroatoms. This is in contrast
to RAL and several other INSTIs, in which the halobenzyl
amide carbonyl serves as one of the metal-chelating elements in
the heteroatom triad. As a result, the halobenzyl linker moiety
of DTG has greater flexibility than RAL structurally related
INSTIs. This flexibility may contribute to DTG’s ability to bind
tightly to both wild-type (WT) and mutant IN−DNA
complexes.15−18 While differing in their halobenzyl linker
arrangements, both RAL and DTG have a hydroxyl group as
the central component of their metal-chelating triad of
Received: December 11, 2013
Published: January 28, 2014
This article not subject to U.S. Copyright.
Published 2014 by the American Chemical
Society
1573
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
Figure 1. Structures of HIV-1 integrase inhibitors discussed in the text. Mg2+-chelating heteroatoms are shown in red with the halogen-substituted
aromatic functionality shown in blue. The amide linkers are shown in magenta.
a
heteroatoms. We noted that hydroxyl amides can function as
high affinity metal-chelating groups.19 In fact, hydroxylamide-
containing INSTIs (for example 4) have been reported, which
combine a centrally located hydroxylamide metal chelating
functionality with flexible halobenzylamide group like the one
in DTG.20−24 Alternatively, inhibitors such as 5 employ a
hydroxylamide group as the terminal member of the metal-
chelating triad, and the halobenzyl group is appended through a
1H-pyrrole ring (Figure 1).25 Our current report describes new
INSTIs (6−8, Figure 1) that have a hydroxylamide group as the
central component of a triad of metal-chelating heteroatoms,
which originate from within bicyclic frameworks. Importantly,
the halobenzylamide moieties of many of these inhibitors are
appended in a fashion that may not require participation of
their amide carbonyls in metal chelation. These inhibitors
exhibit high potencies against viral vectors that carry WT IN
and the major RAL-resistant IN mutants.
Scheme 1. Synthesis of Analogues 6a−c and 12c
a
Reagents and conditions: (i) HOAc (4 equiv), CH2(CO2Me)2 or
CH2(CO2Et)2 (12 equiv), piperidine (1.2 equiv), microwave, 80 °C;
(ii) H2, PtO2 (0.15 equiv), rt; (iii) 3-Cl-4-F-BnNH2 (a), 3,4-diF-
BnNH2 (b) or 2,4-diF-BnNH2 (c), 60 °C; iv) BBr3, CH2Cl2, rt.
RESULTS AND DISCUSSION
■
Inhibitor Design. In designing the current series of
inhibitors, we examined two classes of bicyclic platforms that
differed in their presentation of the “left” terminal member of
the metal-chelating heteroatom triad. Both of these platforms
utilized a 1-hydroxypyridin-2(1H)-one moiety as the central
and “right” members of the heteroatom triad. However, one
class of inhibitor utilized a phenolic hydroxyl as the “left”
terminal metal-chelating heteroatom [1,8-dihydroxyquinolin-
2(1H)-ones 6], while the second class employed a ring-
embedded nitrogen to give 1-hydroxy-1,8-naphthyridine-
2(1H)-ones (7). The latter class of inhibitors was also varied
by the introduction of a 4-hydroxyl substituent [1,4-dihydroxy-
1,8-naphthyridine-2(1H)-ones 8] (Figure 1). Three different
halogen-substituted benzylamides were examined at the 3-
position of the “right” 1-hydroxypyridin-2(1H)-one ring
because the nature and pattern of halogen phenyl substitution
is known to significantly affect the IN inhibitory potency of
INSTIs.26
diethyl malonate under similar conditions but without the
inclusion of benzene gave the corresponding diethyl 2-(3-
methoxy-2-nitrobenzylidene)malonate 10b in 90% yield. Initial
hydrogenation of 10a (0.15 equiv of platinum(IV) oxide) using
previously reported conditions that did not contain DMSO,27
provided a very low yield of the desired methyl 1-hydroxy-2-
oxo-1,2-dihydroquinoline-3-carboxylate 11a, accompanied by
significant reduction of the C3−C4 double bond and the N-
hydroxyl group. However, when the reduction was performed
on 10b with the inclusion of DMSO (1.6 equiv),29,30 the
desired ethyl 1-hydroxy-8-methoxy-2-oxo-1,2-dihydroquinoline-
3-carboxylate 11b was obtained in 82% yield. In choosing the
composition and pattern of halogen substitution on the benzyl
amide group, we selected 3′-chloro-4′-fluorobenzyl 13a and
3′,4′-difluorobenzyl 13b, respectively, based on our previous
findings that these can provide improved IN inhibitory
potencies.26,31 In addition, we prepared the 2′,4′-difluoroben-
zyl-substituted pattern 12c and 13c found in DTG.
Demethylation of 13a−c with boron tribromide gave the
desired final products 1,8-dihydroxy-2-oxo-1,2-dihydroquino-
line-3-carboxamides, 6a−c (Scheme 1).
Synthesis. Modification of a previously reported27 low-yield
Knoevenagel condensation of o-nitrobenzaldehyde 9a with
diethyl malonate using microwave radiation and a solvent
mixture that included benzene provided dimethyl 2-(2-
nitrobenzylidene)malonate 10a in quantitative yield (Scheme
1).28 Treatment of 3-methoxy-2-nitrobenzaldehyde 9b with
1574
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
a
Scheme 2. Synthesis of Analogues 7a−c and 8a−c and Over-reduced Products 20a−c
a
Reagents and conditions: (i) BnONH2, DMSO, 140 °C; (ii) ClCOCH2CO2CH3, NEt3, CH2Cl2, rt; (iii) NaOMe, MeOH, rt; (iv) Tf2O, 0 °C; (v)
PdCl2(PPh3)2, TIS, NEt3, 85 °C; (vi) (a) 3-Cl-4-F-BnNH2, (b) 3,4-diF-BnNH2, or (c) 2,4-diF-BnNH2; (vii) H2, Pd·C.
Because DTG is unsubstituted at the position para to its
central metal-chelating hydroxyl group (the 2-position of its 5-
hydroxy-4-oxo-1,3-dihydropyridine-3-carboxamide moiety), we
prepared a series of 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyr-
idine-3-carboxamides (7), which lack a substituent at the
corresponding position. Accordingly, in a fashion similar to
reported methology,32 treatment of commercially available
methyl 2-fluoronicotinate 14 with benzoxylamine in DMSO
followed by acylation of the resulting methyl 2-((benzyloxy)-
amino)nicotinate with methyl 3-chloro-3-oxopropanoate gave
the intermediate methyl 2-(N-(benzyloxy)-3-methoxy-3-
oxopropanamido)nicotinate 15 (Scheme 2). This was treated
with sodium methoxide in methanol to yield the cyclized
product, methyl 1-(benzyloxy)-4-hydroxy-2-oxo-1,2-dihydro-
1,8-naphthyridine-3-carboxylate 16 (66% yield for three steps
from 14) (Scheme 2). Removal of the 4-hydroxy group was
achieved by conversion of 16 to its triflate 17 followed by
reduction, and the resulting methyl 1-(benzyloxy)-2-oxo-1,2-
dihydro-1,8-naphthyridine-3-carboxylate 18 was reacted indi-
vidually with neat 3-chloro-4-fluorobenzylamine (a), 3,4-
difluorobenzylamine (b) and 2,4-difluorobenzylamine (c) to
provide the corresponding amides 19a−c (Scheme 2). Finally,
hydrogenolytic deprotection of the N-hydroxyl group gave the
desired 1-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-car-
boxamides, (7a−c) (Scheme 2). Alternatively, debenzylation
of 16 followed by treatment with halobenzylamines (a, b, and
c) in DMF afforded the desired 1,4-dihydroxy-2-oxo-1,2-
dihydro-1,8-naphthyridine-3-carboxamides 8a−c along with
over-reduced 4-dihydroxy-2-oxo-1,2-dihydro-1,8-naphthyri-
dine-3-carboxamides (20a−c) (Scheme 2).
Evaluation in in Vitro IN Biochemical Assays.
Compounds were evaluated in an IN biochemical assay using
radiolabeled oligonucleotides to measure the ability of the
compounds to inhibit the 3′-P and ST reactions.33 For the 1,8-
dihydroxyquinolin-2(1H)-ones (6), 3′-P reactions were in-
hibited with IC50 values in the micromolar range, with the 3′-
Cl-4′-F and 3′,4′-diF-substituted amides (6a, 3′-P IC50 = 17
μM; and 6b, 3′-P IC50 = 24 μM) being slightly more potent
than the 2′,4′-disubstituted analogue 6c (3′-P IC50 = 43 μM)
(Table 1). These results are consistent with our previous
reports that among the diverse halogen substituent patterns we
tested, 3-chloro-4-fluoro benzylamides show the best potencies
in in vitro assays.26,31 Selectivity for the ST reaction relative to
the 3′-P reaction is a defining characteristic of INSTIs, and in
the case of 6a and 6b, selectivity was approximately 30-fold (ST
Table 1. Inhibitory Potencies of 1,8-Dihydroxy-2-oxo-1,2-
dihydroquinoline-3-carboxamides 6(a−c) and 1-Hydroxy-2-
oxo-1,2-dihydroquinoline-3-carboxamides 12c and 13c
Using an in Vitro IN Assay
IC50 values (μM)
no.
R
Z
3′-processing
strand transfer
6a
OH
OH
OH
H
3′-Cl-4′-F
3′, 4′-diF
2′, 4′-diF
2′, 4′-diF
2′, 4′-diF
17
1
3
5
0.53 0.13
0.78 0.22
6b
24
6c
43
18
7
12c
13c
>333
>333
19.7 2.7
>333
OCH3
IC50 values of 0.53 μM and 0.78 μM, respectively; Table 1). In
contrast, for 6c the ST inhibitory potency (ST IC50 = 18 μM)
was very similar to its 3′-P inhibitory potency. There was
approximately a 20-fold loss of ST inhibitory potency in going
from the 3′,4′-diF to the 2′,4′-diF benzylamide substituent
pattern. With the latter pattern of halogen substituents, removal
of the 8-hydroxy group abrogated 3′-P inhibitory potency (12c,
3′-P IC50 >333 μM) but had little effect on ST inhibitory
potency (12c ST IC50 = 19.7 μM). Insertion of a bulky
methoxyl group at the 8-position (13c) also abrogated both 3′-
P and ST inhibitory potencies (Table 1).
Using the in vitro IN catalytic assay described above, we
showed that compounds 7a and 7b exhibited potent ST
inhibition, with IC50 values (14 nM and 17 nM, respectively,
Table 2). These were approximately 40-fold lower than the IC50
values measured for the corresponding 8-dihydroxyquinolin-
2(1H)-ones (6a and 6b, respectively, Table 1); however, high
selectivity for inhibiting the ST reaction versus the 3′-P reaction
was maintained. Unexpectedly, compound 7c, which contains
the benzyl 2′,4′-diF pattern found with DTG, while being
slightly less potent (2-fold) than either the 3′-Cl-4′-F or 3′,4′-
diF containing compounds (7a and 7b, respectively), exhibited
a greater than 400-fold enhancement of ST inhibitory potency
(IC50 ≈ 40 nM) relative to the corresponding 8-dihydrox-
yquinolin-2(1H)-one (6c).
Given the potentially important role of the carboxamide
linker arrangement in DTG’s ability to maintain efficacy against
1575
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
Evaluation of the Compounds in Cell-Based Antiviral
Assays. A primary objective in developing second-generation
IN inhibitors is to overcome mutations that are associated with
resistance to first-generation inhibitors, such as RAL. To
determine the abilities of our current inhibitors to retain
efficacy against resistant variants, we evaluated the antiviral
potencies in cells infected with one-round HIV-1 vectors that
carry mutations that cause resistance to RAL (Table 4).10,34,35
In these assays, RAL (1) exhibited an EC50 value (effective
concentration resulting in 50% reduction of luciferase reporter
signal) of 4 nM in cells infected with virus containing WT IN.
Cells infected with viruses containing either the Y143R or the
N155H mutant forms of IN, showed significantly elevated EC50
values (162 nM and 154 nM, respectively). An even greater loss
of efficacy (EC50 = 1900 nM) was observed with viruses
containing the G140S/Q148H double mutant form of IN
(Table 4). In similar assays, treatment of WT-infected cells with
inhibitors 7a−c and 8a−c gave EC50 values in the low
nanomolar range, with analogues 7c and 8c having the 2′,4′-diF
substituted benzyl group (EC50 values of 5 nM and 6 nM,
respectively) showing greater efficacy by several fold relative to
analogues having either 3′-Cl-4′-F (7a and 8a) or 3′,4′-diF (7b
and 8b) substituted benzyl groups. This is in contrast to in vitro
assays, where analogues bearing the 2′,4′-diF-substituted benzyl
group were slightly less effective ST inhibition (Tables 2 and
3).
Table 2. Inhibitory Potencies of 1-Hydroxy-2-oxo-1,2-
dihydro-1,8-naphthyridine-3-carboxamides 7(a−c) Using an
in Vitro IN Assay
IC50 values (μM)
no.
Z
3′-processing
strand transfer
7a
7b
7c
3′-Cl-4′-F
3′, 4′-diF
2′, 4′-diF
9.4 1.5
13.6 1.8
6.1 0.8
0.014 0.003
0.017 0.003
0.041 0.012
RAL- and EVG-resistant strains of mutant IN,15−17 we inserted
a hydroxyl group at the 4-position of the 1-hydroxy-1,8-
naphthyridine-2(1H)-one ring system to ask whether this could
potentially influence the inhibitory profiles by hydrogen
bonding with the 3-carboxamide carbonyl. However, this
modification resulted in a slight loss of ST inhibitory potencies
(8a−c, Table 3). We also showed that removing the
Table 3. Inhibitory Potencies of 1,4-Dihydroxy-2-oxo-1,2-
dihydro-1,8-naphthyridine-3-carboxamides 8(a−c) and 4-
Dihydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-
carboxamides 20(a−c) Using an in Vitro IN Assay
An important feature of the new inhibitors is their ability to
maintain high efficacies against RAL-resistant strains. For
example, compound 7c exhibits single digit nanomolar antiviral
potencies against both WT and the Y143R mutant, while
showing a lower potency against the G140S/Q148H mutant
(EC50 = 438 nM). However, it is much improved when
compared to RAL (1) (EC50 = 1900 nM). Compound 8c also
retains good efficacy against the Y143R mutant (EC50 = 11
nM) as well as both the N155H mutant (EC50 = 31 nM; RAL
IC50 values (μM)
no.
Y
Z
3′-processing
strand transfer
8a
OH
OH
OH
H
3′-Cl-4′-F
3′, 4′-diF
2′, 4′-diF
3′-Cl-4′-F
3′, 4′-diF
2′, 4′-diF
4.7 0.7
3.6 0.6
1.2 0.2
125 15
0.027 0.006
0.040 0.010
0.055 0.008
7.8 1.1
has EC50 = 154 nM) and the G140S/Q148H mutant (EC50
308 nM) (Table 4).
=
8b
8c
While showing nanomolar EC50 values against cells infected
with HIV-1 vectors carrying WT and efficacy against some
RAL-resistant mutants, analogues 7a−c exhibited very little
cytotoxicity, with CC50 values (cytotoxic concentrations were
measured as the level of the compound that reduced cellular
ATP levels by 50%) greater than 250 μM. In particular, for the
2′,4′-difluorobenzyl amide 7c with an EC50 value of 5.1 nM
against WT, this gives a selectivity index (SI = CC50/EC50)
greater than 49,000 (Table 4). Analogues 8a−c showed CC50
20a
20b
20c
H
93
8
8.1 1.8
H
>333
7.1 1.8
hydroxylamide group resulted in a more than two-orders of
magnitude loss of ST inhibitory potency (20a−c, Table 3).
This is consistent with the important role this hydroxyl may
play as the central component of the metal-chelating triad.
Table 4. Antiviral Potencies of Compounds 7(a−c) and 8(a−c) in Cells Infected with HIV-1 Vectors Containing Wild-Type
(WT) or Mutant IN
c
EC50 (nM, IN mutants )
a
b
d
no.
CC50 (μM)
EC50 (nM) WT
Y143R
N155H
G140S/Q148H
1900 300
SI
1
>100
4
2
162 16
154 33
>25,000
>6,579
>4,032
>49,020
2,914
e
7a
7b
7c
8a
8b
8c
>250
38 15
62 14
5.1 1.9
35 12
34
6
90
6
N/A
e
>250
40 13
2200 61
134 23
N/A
>250
4.9 0.8
438 121
489 62
507 125
308 125
102 18
192 19
137 20
54
45 12
11
9
148
189 70
31
8
20
6
9,600
6.2 2.9
2
8
22,097
a
b
Cytotoxic concentration resulting in 50% reduction in the level of ATP in human osteosarcoma (HOS) cells. Values obtained from cells infected
c
d
with the lentiviral vector harboring WT IN. Cells were infected with viral vectors carrying IN mutations and indicated values in EC50. Selectivity
index calculated as the ratio of CC50 to EC50. Not available.
e
1576
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
Table 5. Fold Change (FC) of Amides 7c and 8c Compared with That of RAL (1) in Cells Infected with HIV-1 Constructs
Carrying WT or Mutant IN
b
EC50 (FC, IN mutants )
a
no.
EC50 (nM) WT
Y143R
N155H
G140S/Q148H
G118R
E138K/Q148K
1
4
2
41×
1×
2×
38×
26×
5×
475×
86×
50×
9×
N/A
375×
N/A
c
c
7c
8c
5.1 1.9
6.2 2.9
6×
32×
a
b
Values obtained from cells infected with a lentiviral vector harboring WT IN. Cells were infected with viral constructs carrying IN mutations, and
the indicated values correspond to the fold-change (FC) in EC50 relative to WT. Not available.
c
ionization-mass spectra (ESI-MS) were acquired with an Agilent LC/
values between approximately 100 μM (8a) and 200 μM (8b).
In the case of 8c, which showed a WT EC50 value of 6.2 nM, a
SI value greater than 20,000 was achieved.
MSD system equipped with a multimode ion source. Purities of
samples subjected to biological testing were assessed using this system
and shown to be ≥95%. High-resolution mass spectra (HRMS) were
acquired by LC/MS-ESI using an LTQ-Orbitrap-XL at 30K resolution.
General Procedure A for the Synthesis of Diethyl 2-(2-
(Nitrobenzylidene)malonates (10a and 10b). Commercially
available 2-nitrobenzaldehydes (9a and 9b) (5 mmol) were added to
a solution of dimethyl malonate or diethyl malonate (60 mmol), acetic
acid (20 mmol), and piperidine (6 mmol). The mixture was irradiated
with microwave radiation with stirring (80 °C, 15 h). The mixture was
partitioned between EtOAc (60 mL) and aqueous NaHCO3 (30 mL),
and the organic phase was dried (Na2SO4) and filtered, and the filtrate
was concentrated. The resulting residue was purified by Combiflash
silica gel chromatography (hexanes and EtOAc) to yield either
dimethyl (10a) or diethyl 2-(2-nitrobenzylidene)malonate (10b).
Dimethyl 2-(2-Nitrobenzylidene)malonate (10a). Reaction of
commercially available 2-nitrobenzaldehyde (9a) and dimethyl
malonate in benzene (8 mL) as described in general procedure A
with the inclusion of benzene (8.0 mL) provided 10a as a colorless oil
in 100% yield. 1H NMR (500 MHz, CDCl3) δ 8.19 (t, J = 4.1 Hz, 2H),
7.64 (t, J = 7.6 Hz, 1H), 7.56 (t, J = 7.8 Hz, 1H), 7.39 (d, J = 7.6 Hz,
1H), 3.85 (s, 3H), 3.59 (s, 3H). 13C NMR (125 MHz, CDCl3) δ
165.24, 163.68, 147.04, 141.73, 133.88, 130.36, 130.24, 129.92, 128.38,
125.06, 52.83, 52.42. ESI-MS m/z: 266.0 (M+H+).
Because compounds 7c and 8c show antiviral potencies
similar to those of RAL (1) against HIV-1 vectors carrying WT
IN, it is important to compare the relative effectiveness of our
inhibitors against mutant strains of IN in terms of fold-loss
relative to WT. Table 5 contains data showing the efficacy of
compounds against the G118R and E138K/Q148K mutants,
which have recently been identified through in vitro selection
studies with second-generation inhibitors.36 Of particular note
is the ability of 8c to maintain efficacy equivalent to that of RAL
against the G118R mutant while showing approximately one
order of magnitude greater efficacy than RAL against the
remaining mutants in the table.
CONCLUSIONS
■
A series of bicyclic inhibitors were prepared that employed 1-
hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide
(7) and 1,8-dihydroxy-2-oxo-1,2-dihydroquinoline-3-carboxa-
mide (8) ring systems. Key features of these inhibitors include
the use of a hydroxylamide group as a metal-chelating
component and the inclusion of halobenzylamide functionality
that is appended through a linker whose carboxamide carbonyl
is not an obligatory component of the key metal-chelating
heteroatom triad. Among these IN inhibitors, amides 7c and 8c
have single digital nanomolar antiviral EC50 potencies against
HIV-1 vectors carrying WT IN. Several compounds have
selectivity indices of greater than 20,000, and certain of these
inhibitors have greater antiviral efficacies than RAL against a
panel of IN mutants that included Y143R, N155H, G118R, and
the double mutants G140S/Q148H and E138K/Q148K.
Compounds 7c and 8c represent potentially useful platforms
for further structural variations intended to find compounds
that are more broadly effective against additional resistant
strains of the virus.
Diethyl 2-(3-Methoxy-2-nitrobenzylidene)malonate (10b). Reac-
tion of commercially available 3-methoxy-2-nitrobenzaldehyde (9b)
and diethyl malonate as described in general procedure A, provided
1
10b as a colorless oil in 90% yield. H NMR (400 MHz, CDCl3) δ
7.58 (s, 1H), 7.36 (t, J = 8.2 Hz, 1H), 7.05 (d, J = 8.4 Hz, 1H), 6.99 (d,
J = 7.9 Hz, 1H), 4.24 (q, J = 7.2 Hz, 2H), 4.16 (q, J = 7.1 Hz, 2H),
3.87 (s, 3H), 1.27 (t, J = 7.1 Hz, 3H), 1.12 (t, J = 7.1 Hz, 3H). 13C
NMR (100 MHz, CDCl3) δ 164.94, 162.88, 151.25, 140.28, 135.29,
131.38 (2C), 127.75, 120.06, 114.03, 62.00, 61.73, 56.55, 13.98, 13.72.
ESI-MS m/z: 324.1 (M+H+).
General Procedure B for the Synthesis of Methyl and Ethyl
1-Hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxylates (11a
and 11b). Compound 10a or 10b (0.5 mmol) was dissolved in
acetic acid (3 mL) with or without added DMSO (0.8 mmol),
followed by the addition of platinum(IV) oxide (0.075 mmol), and the
mixture was stirred at room temperature under H2 (22 h). The
mixture was filtered and washed by MeOH, and the filtrate was
concentrated and purified by Combiflash silica gel chromatography
(hexanes and EtOAc) to yield products 11a or 11b.
EXPERIMENTAL SECTION
■
1
General Synthesis. H and 13C NMR data were obtained on a
Varian 400 MHz spectrometer or a Varian 500 MHz spectrometer and
are reported in ppm relative to TMS and referenced to the solvent in
which the spectra were collected. The solvent was removed by rotary
evaporation under reduced pressure, and anhydrous solvents were
obtained commercially and used without further drying. Purification by
silica gel chromatography was performed using CombiFlash Rf 200i
with EtOAc−hexanes solvent systems. Preparative high pressure liquid
chromatography (HPLC) was conducted using a Waters Prep LC4000
system having photodiode array detection and Phenomenex C18
columns (Cat. No. 00G-4436-P0-AX, 250 mm × 21.2 mm, 10 μm
particle size, 110 Å pore) at a flow rate of 10 mL/min. Binary solvent
systems consisting of A = 0.1% aqueous TFA and B = 0.1% TFA in
acetonitrile were employed with gradients as indicated. Products were
obtained as amorphous solids following lyophilization. Electrospray
Methyl 1-Hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxylate
(11a). Treatment of 10a as outlined in general procedure B, without
the inclusion of DMSO, afforded 11a as a white solid in 0.7% yield. 1H
NMR (500 MHz, CDCl3) δ 8.63 (s, 1H), 7.80−7.77 (m, 3H), 7.39−
7.36 (m, 1H), 4.01 (s, 3H). ESI-MS m/z: 220.0 (M+H+).
Ethyl 1-Hydroxy-8-methoxy-2-oxo-1,2-dihydroquinoline-3-car-
boxylate (11b). Treatment of 10b as outlined in general procedure
B with the inclusion of DMSO afforded 11b as a yellow oil in 82%
1
yield. H NMR (400 MHz, CDCl3) δ 8.47 (s, 1H), 7.31−7.29 (m,
1H), 7.23−7.22 (m, 1H), 7.21 (d, J = 1.6 Hz, 1H), 4.41 (q, J = 7.1 Hz,
2H), 3.96 (s, 3H), 1.39 (t, J = 7.1 Hz, 3H). 13C NMR (100 MHz,
CDCl3) δ 163.68, 154.45, 146.70, 141.82, 127.52, 123.81, 122.68,
119.21, 118.55, 116.62, 61.81, 57.64, 14.26. ESI-MS m/z: 264.1 (M
+H+).
1577
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
General Procedure C for the Synthesis of N-(Benzyl)-1-
hydroxy-2-oxo-1,2-dihydroquinoline-3-carboxamides (12c
and 13a−13c). A mixture of 11a or 11b (0.4 mmol) with
benzylamine (3 mL) was heated with stirring (60 °C, 14 h), and
the resulting product mixture was purified by reverse-phase HPLC to
provide 12c or 13a−13c.
(M+H+). HRMS calcd C17H13F2N2O4 [MH+], 347.0838; found,
347.0847.
N-(2,4-Difluorobenzyl)-1,8-dihydroxy-2-oxo-1,2-dihydroquino-
line-3-carboxamide (6c). Treatment of 13c as outlined in general
procedure D with purification by preparative reverse-phase HPLC
(linear gradient of 30% B to 65% B over 30 min; retention time = 24.6
1
N-(2,4-Difluorobenzyl)-1-hydroxy-2-oxo-1,2-dihydroquinoline-3-
carboxamide (12c). Treatment of 11a with 2,4-difluorobenzylamine
as outlined in general procedure C with purification by preparative
reverse-phase HPLC (linear gradient of 30% B to 60% B over 30 min;
min) provided 6c as a white solid in 38% yield. H NMR (400 MHz,
DMSO-d6) δ 9.99 (t, J = 5.6 Hz, 1H), 8.67 (s, 1H), 7.41 (dd, J = 15.7,
8.0 Hz, 2H), 7.23−7.11 (m, 3H), 7.04 (dd, J = 19.0, 8.2 Hz, 2H), 4.54
(d, J = 5.9 Hz, 2H). ESI-MS m/z: 347.1 (M+H+). HRMS calcd for
C17H13F2N2O4 [MH+], 347.0838; found, 347.0835.
1
retention time = 28.1 min) provided 12c as a white solid. H NMR
(500 MHz, DMSO-d6) δ 11.82 (s, 1H), 10.06 (t, J = 6.2 Hz, 1H), 8.84
(s, 1H), 8.05 (d, J = 8.0 Hz, 1H), 7.82−7.76 (m, 2H), 7.49−7.38 (m,
2H), 7.26 (t, J = 10.0 Hz, 1H), 7.08 (t, J = 8.5 Hz, 1H), 4.61 (d, J = 5.8
Hz, 2H). ESI-MS m/z: 331.1 (M+H+). HRMS calcd for
C17H13F2N2O3 [MH+], 331.0889; found, 331.0884.
N-(3-Chloro-4-fluorobenzyl)-1-hydroxy-8-methoxy-2-oxo-1,2-di-
hydroquinoline-3-carboxamide (13a). Reaction of 11b and 3-chloro-
4-fluorobenzylamine as outlined in general procedure C with
purification by preparative reverse-phase HPLC (linear gradient of
30% B to 65% B over 30 min; retention time =27.6 min) provided 13a
as a white solid in 62% yield. 1H NMR (400 MHz, DMSO-d6) δ 11.18
(s, 1H), 10.01 (t, J = 6.0 Hz, 1H), 8.70 (s, 1H), 7.57 (dd, J = 8.0, 1.2
Hz, 1H), 7.53−7.51 (m, 1H), 7.34 (ddd, J = 7.2, 6.8, 1.1 Hz, 3H), 7.26
(t, J = 7.9 Hz, 1H), 4.52 (d, J = 6.0 Hz, 2H), 3.83 (s, 3H). ESI-MS m/
z: 377.0 (M+H+).
Methyl 2-(N-(Benzyloxy)-3-methoxy-3-oxopropanamido)-
nicotinate (15). A solution of commercially available methyl 2-
fluoronicotinate (14) (1 mmol), O-benzylhydroxylamine (3 mmol),
and N-ethyl-N-isopropylpropan-2-amine (3 mmol) in DMSO was
subjected to microwave irradiation with stirring (140 °C, 10 h). The
resulting mixture was extracted (EtOAc), the organic phase was
washed with brine and dried (Na2SO4), the crude product was filtered,
and the filtrate was concentrated. Purification by Combiflash silica gel
chromatography (hexanes and EtOAc) provided intermediate methyl
2-((benzyloxy)amino)nicotinate as a yellow oil in 86% yield. 1H NMR
(400 MHz, CDCl3) δ 10.03 (s, 1H), 8.49 (dd, J = 4.8, 1.9 Hz, 1H),
8.15 (dd, J = 7.8, 1.9 Hz, 1H), 7.50−7.47 (m, 2H), 7.41−7.34 (m,
3H), 6.79 (dd, J = 7.8, 4.8 Hz, 1H), 5.08 (s, 2H), 3.83 (s, 3H). 13C
NMR (100 MHz, CDCl3) δ 166.62, 159.66, 153.68 (2C), 139.85,
136.38, 128.86, 128.44, 128.26, 114.58, 114.55, 107.03, 78.05, 52.15.
ESI-MS m/z: 259.1 (M+H+). To a solution of this material (2 mmol)
and triethylamine (4 mmol) in CH2Cl2 (10 mL) was added methyl 3-
chloro-3-oxopropanoate (4 mmol) dropwise, and the mixture was
stirred at room temperature (2 h). The crude product was filtered, the
filtrate was concentrated, and the residue was purified by Combiflash
silica gel chromatography (hexanes and EtOAc) to provide 15 as a
N-(3,4-Difluorobenzyl)-1-hydroxy-8-methoxy-2-oxo-1,2-dihydro-
quinoline-3-carboxamide (13b). Reaction of 11b and 3,4-difluor-
obenzylamine as outlined in general procedure C with purification by
preparative reverse-phase HPLC (linear gradient of 30% B to 65% B
over 30 min; retention time = 24.8 min) provided 13b as a white solid
1
in 78% yield. H NMR (400 MHz, DMSO-d6) δ 10.08 (t, J = 6.0 Hz,
1
1H), 8.66 (s, 1H), 7.55 (dd, J = 8.0, 1.3 Hz, 1H), 7.38−7.21 (m, 3H),
7.17−7.14 (m, 1H), 7.12−7.08 (m, 1H), 4.51 (d, J = 5.9 Hz, 2H), 3.80
(s, 3H). ESI-MS m/z: 361.1 (M+H+).
yellow oil in 83% yield. H NMR (400 MHz, CDCl3) δ 8.64 (s, 1H),
8.18 (d, J = 7.6 Hz, 1H), 7.39−7.38 (m, 2H), 7.35−7.32 (m, 4H), 5.03
(s, 2H), 3.88 (s, 3H), 3.72 (s, 3H), 3.61 (s, 2H). 13C NMR (100 MHz,
CDCl3) δ 167.09 (2C), 165.37, 151.13, 139.33, 133.89, 129.59 (3C),
128.94, 128.45 (2C), 123.83, 122.73, 78.18, 52.70, 52.32, 41.13. ESI-
MS m/z: 359.1(M+H+).
N-(2,4-Difluorobenzyl)-1-hydroxy-8-methoxy-2-oxo-1,2-dihydro-
quinoline-3-carboxamide (13c). Reaction of 11b and 2,4-difluor-
obenzylamine as outlined in general procedure C with purification by
preparative reverse-phase HPLC (linear gradient of 30% B to 65% B
over 30 min; retention time = 27.0 min) provided 13c as a white solid
Methyl 1-(Benzyloxy)-4-hydroxy-2-oxo-1,2-dihydro-1,8-naph-
thyridine-3-carboxylate (16). To a solution of 15 (1.7 mmol) in
MeOH (30 mL) was added sodium methanolate (4.2 mmol) (25% in
MeOH) at room temperature, and the resulting suspension was stirred
at room temperature (overnight). Acidification to pH 4 by the
addition of aqueous 2 N HCl gave a precipitate, which was collected
1
in 74% yield. H NMR (400 MHz, DMSO-d6) δ 11.24 (s, 1H), 10.04
(t, J = 6.1 Hz, 1H), 8.75 (s, 1H), 7.62 (dd, J = 7.9, 1.3 Hz, 1H), 7.47
(dd, J = 15.3, 8.7 Hz, 1H), 7.42−7.40 (m, 1H), 7.32 (t, J = 7.9 Hz,
1H), 7.29−7.23 (m, 1H), 7.08 (dd, J = 11.1, 8.6 Hz, 1H), 4.59 (d, J =
5.9 Hz, 2H), 3.88 (s, 3H). ESI-MS m/z: 361.1 (M+H+). HRMS calcd
for C18H15F2N2O4 [MH+], 361.0994; found, 361.0990.
General Procedure D for the Synthesis of 1,8-Dihydroxy-2-
oxo-1,2-dihydroquinoline-3-carboxamides (6a−6c). HPLC-pu-
rified compounds 13a−13c (0.1 mmol) were stirred at room
temperature with boron tribromide (0.8 mmol, 2.0 M in CH2Cl2)
(overnight). The reaction was quenched by the addition of MeOH,
and the product mixture was purified by reverse-phase HPLC to
provide 6a−6c.
N-(3-Chloro-4-fluorobenzyl)-1,8-dihydroxy-2-oxo-1,2-dihydroqui-
noline-3-carboxamide (6a). Treatment of 13a as outlined in general
procedure D with purification by preparative reverse-phase HPLC
(linear gradient of 30% B to 65% B over 30 min; retention time =27.5
min) provided 6a as a white solid in 36% yield.1H NMR (400 MHz,
DMSO-d6) δ 10.14 (t, J = 6.0 Hz, 1H), 8.63 (s, 1H), 7.42 (dd, J = 7.4,
1.7 Hz, 1H), 7.39 (dd, J = 8.1, 1.0 Hz, 1H), 7.25−7.22 (m, 3H), 7.17
(t, J = 7.9 Hz, 1H), 7.06 (dd, J = 7.8, 1.1 Hz, 1H), 4.41 (dd, J = 17.7,
6.0 Hz, 2H). ESI-MS m/z: 363.0 (M+H+). HRMS calcd
C17H13FClN2O4 [MH+], 363.0542; found, 363.0551.
1
and dried to provide 16 as a white solid in 93% yield. H NMR (400
MHz, CDCl3) δ 8.79 (dd, J = 4.7, 1.8 Hz, 1H), 8.46 (dd, J = 7.9, 1.8
Hz, 1H), 7.73−7.71 (m, 2H), 7.41−7.36 (m, 3H), 7.28−7.25 (m, 1H),
5.28 (s, 2H), 4.08 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 172.35,
170.14, 156.40, 154.73, 149.54, 134.67, 134.08, 130.00 (2C), 128.94,
128.34 (2C), 118.70, 109.53, 98.85, 78.12, 53.29. ESI-MS m/z: 327.1
(M+H+).
General Procedure E for the Synthesis of 1,4-Dihydroxy-2-
oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamides (8a−c)
and 4-Hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-car-
boxamides (20a−20c). To a degassed solution of 16 (0.2 mmol)
and MeOH (15 mL) with EtOAc (5 mL) was added Pd·C (10%, 0.2
mmol), and the mixture was stirred at room temperature under H2 (1
h). The mixture was filtered, and the filtrate was concentrated and
dissolved in DMF (1.0 mL). To this was added the appropriate
halobenzylamine (2.0 mmol), and the solution was subjected to
microwave irradiation with stirring (140 °C, 2 h). Purification of the
reaction mixture by reverse-phase HPLC provided the desired final
products 8a−c as well as the over-reduced products 20a−20c.
N-(3-Chloro-4-fluorobenzyl)-1,4-dihydroxy-2-oxo-1,2-dihydro-
1,8-naphthyridine-3-carboxamide (8a) and N-(3-Chloro-4-fluoro-
benzyl)-4-hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxa-
mide (20a). Treatment of 16 as outlined in general procedure E using
3-chloro-4-fluorobenzylamine with purification by preparative reverse-
phase HPLC (linear gradient of 20% B to 80% B over 30 min)
provided a 43% yield of 8a and 20a as white solids in a 2:1 ratio. For
N-(3,4-Difluorobenzyl)-1,8-dihydroxy-2-oxo-1,2-dihydroquino-
line-3-carboxamide (6b). Treatment of 13b as outlined in general
procedure D with purification by preparative reverse-phase HPLC
(linear gradient of 30% B to 65% B over 30 min; retention time = 24.9
1
min) provided 6b as a white solid in 42% yield. H NMR (400 MHz,
DMSO-d6) δ 10.14 (t, J = 6.1 Hz, 1H), 8.63 (s, 1H), 7.39 (t, J = 6.4
Hz, 1H), 7.29−7.23 (m, 2H), 7.16 (t, J = 7.9 Hz, 2H), 7.06 (dd, J =
7.8, 1.2 Hz, 2H), 4.42 (dd, J = 24.5, 5.8 Hz, 2H). ESI-MS m/z: 347.1
1
8a: retention time = 26.4 min. H NMR (400 MHz, DMSO-d6) δ
1578
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
11.01 (bs, 1H), 10.52 (bs, 1H), 8.84 (dd, J = 4.6, 1.7 Hz, 1H), 8.47
(dd, J = 7.9, 1.7 Hz, 1H), 7.60 (d, J = 7.6 Hz, 1H), 7.48−7.42 (m, 1H),
7.42 (d, J = 7.7 Hz, 2H), 4.61 (d, J = 6.2 Hz, 2H). ESI-MS m/z: 364.0
(M+H+). HRMS calcd C16H12ClFN3O4 [MH+], 364.0495; found,
General Procedure F for the Synthesis of 1-(Benzyloxy)-N-
(halobenzyl)-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxa-
mides (19a−19c). A solution of 18 (0.6 mmol) and halobenzylamine
(1 mL) was heated with stirring (60 °C, 14 h). The mixture was then
extracted (CHCl3) and washed sequentially with aqueous 1 N HCl
and brine and dried (Na2SO4). The organic phase was filtered and
concentrated, and the crude residue was purified by Combiflash silica
gel chromatograpy (hexanes and EtOAc) to provide amides 19(a−c).
1-(Benzyloxy)-N-(3-chloro-4-fluorobenzyl)-2-oxo-1,2-dihydro-1,8-
naphthyridine-3-carboxamide (19a). Treatment of 18 with 3-chloro-
4-difluorobenzylamine as outlined in general procedure F provided
19a as a white solid in 31% yield. 1H NMR (400 MHz, CDCl3) δ 9.90
(t, J = 5.7 Hz, 1H), 8.81 (s, 1H), 8.75 (dd, J = 4.7, 1.8 Hz, 1H), 8.06
(dd, J = 7.8, 1.8 Hz, 1H), 7.61−7.60 (m, 1H), 7.59 (d, J = 1.7 Hz, 1H),
7.36−7.32 (m, 2H), 7.31−7.27 (m, 3H), 7.19−7.15 (m, 1H), 7.03 (t, J
= 8.7 Hz, 1H), 5.27 (s, 2H), 4.56 (d, J = 6.0 Hz, 2H). 13C NMR (100
MHz, CDCl3) δ 162.45, 159.38, 157.35 (d, J = 248.3 Hz), 153.33,
148.97, 141.41, 138.72, 135.31 (d, J = 3.9 Hz), 133.56, 129.94 (2C),
129.87, 129.24, 128.49 (2C), 128.38 (d, J = 15.3 Hz), 127.43 (d, J =
7.3 Hz), 123.36, 120.00, 116.61 (d, J = 21.2 Hz), 114.12, 78.57, 42.58.
ESI-MS m/z: 438.1 (M+H+).
1-(Benzyloxy)-N-(3,4-difluorobenzyl)-2-oxo-1,2-dihydro-1,8-
naphthyridine-3-carboxamide (19b). Treatment of 18 with 3,4-
difluorobenzylamine as outlined in general procedure F provided 19b
as a white solid in 51% yield. 1H NMR (400 MHz, CDCl3) δ 9.95 (t, J
= 5.8 Hz, 1H), 8.85 (s, 1H), 8.78 (dd, J = 4.7, 1.8 Hz, 1H), 8.09 (dd, J
= 7.8, 1.7 Hz, 1H), 7.65−7.64 (m, 1H), 7.62 (d, J = 1.7 Hz, 1H),
7.37−7.30 (m, 4H), 7.20−7.13 (m, 1H), 7.09−7.03 (m, 1H), 6.98−
6.94 (m, 1H), 5.29 (s, 2H), 4.59 (d, J = 6.0 Hz, 2H). ESI-MS m/z:
422.1 (M+H+).
1-(Benzyloxy)-N-(2,4-difluorobenzyl)-2-oxo-1,2-dihydro-1,8-
naphthyridine-3-carboxamide (19c). Treatment of 18 with 2,4-
difluorobenzylamine as outlined in general procedure F provided 19c
as a white solid in 22% yield. 1H NMR (400 MHz, CDCl3) δ 9.92 (d, J
= 5.4 Hz, 1H), 8.87 (s, 1H), 8.82 (ddd, J = 4.7, 1.7, 0.6 Hz, 1H), 8.13
(dd, J = 7.8, 1.7 Hz, 1H), 7.69 (d, J = 2.4 Hz, 1H), 7.68 (dd, J = 3.3,
1.3 Hz, 1H), 7.42−7.34 (m, 5H), 6.88−6.76 (m, 2H), 5.34 (s, 2H),
4.69 (d, J = 5.9 Hz, 2H). ESI-MS m/z: 422.1 (M+H+).
General Procedure G for the Synthesis of 1-(Benzyloxy)-N-
(halobenzyl)-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxa-
mides 7(a−c). To a solution of amide (19a−19c) (0.2 mmol) in a
solution of MeOH (10 mL) and EtOAc (3 mL) was added Pd·C
(10%, 20 mg), and the mixture was degassed and stirred at room
temperature under H2 (1 h). The mixture was then filtered through a
small pad of silica gel, the filtrate was concentrated, and the residue
was purified by preparative reverse-phase HPLC to provide the target
amides 7a−c.
N-(3-Chloro-4-fluorobenzyl)-1-hydroxy-2-oxo-1,2-dihydro-1,8-
naphthyridine-3-carboxamide (7a). Treatment of 19a as outlined in
general procedure G and purification by preparative reverse-phase
HPLC (linear gradient of 30% B to 50% B over 30 min; retention time
= 22.5 min) provided 7a as a white solid in 41% yield. 1H NMR (400
MHz, DMSO-d6) δ 11.42 (bs, 1H), 9.96 (t, J = 5.9 Hz, 1H), 8.85 (s,
1H), 8.82 (dd, J = 4.7, 1.8 Hz, 1H), 8.51 (dd, J = 7.9, 1.8 Hz, 1H), 7.58
(d, J = 7.8 Hz, 1H), 7.47 (dd, J = 7.8, 4.7 Hz, 1H), 7.40−7.37 (m, 2H),
4.58 (d, J = 6.0 Hz, 2H). ESI-MS m/z: 348.0 (M+H+). HRMS calcd
C16H12ClFN3O3 [MH+], 348.0546; found, 348.0542.
N-(3,4-Difluorobenzyl)-1-hydroxy-2-oxo-1,2-dihydro-1,8-naph-
thyridine-3-carboxamide (7b). Treatment of 19b as outlined in
general procedure G and purification by preparative reverse-phase
HPLC (linear gradient of 20% B to 50% B over 30 min; retention time
= 26.1 min) provided 7b as a white solid in 22% yield. 1H NMR (400
MHz, DMSO-d6) δ 11.42 (bs, 1H), 9.96 (t, J = 6.0 Hz, 1H), 8.85 (s,
1H), 8.82 (dd, J = 4.7, 1.8 Hz, 1H), 8.52 (dd, J = 7.8, 1.8 Hz, 1H), 7.47
(dd, J = 7.8, 4.7 Hz, 1H), 7.45−7.37 (m, 2H), 7.23−7.22 (m, 1H),
4.58 (d, J = 6.1 Hz, 2H). ESI-MS m/z: 332.1 (M+H+). HRMS calcd
C18H12F2N3O3 [MH+], 332.0841; found, 332.0828.
1
364.0490. For 20a: retention time = 30.7 min. H NMR (400 MHz,
DMSO-d6) δ 12.31 (s, 1H), 10.59 (t, J = 5.8 Hz, 1H), 8.70 (d, J = 4.6
Hz, 1H), 8.36 (d, J = 7.6 Hz, 1H), 7.60 (d, J = 7.0 Hz, 1H), 7.41 (dd, J
= 9.8, 7.0 Hz, 2H), 7.36 (dd, J = 7.9, 4.9 Hz, 1H), 4.59 (d, J = 6.3 Hz,
2H). ESI-MS m/z: 348.0 (M+H+). HRMS calcd C16H12ClFN3O3
[MH+], 348.0546; found, 348.0541.
N-(3,4-Difluorobenzyl)-1,4-dihydroxy-2-oxo-1,2-dihydro-1,8-
naphthyridine-3-carboxamide (8b) and N-(3,4-Difluorobenzyl)-4-
hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide
(20b). Treatment of 16 as outlined in general procedure E using 3,4-
difluorobenzylamine with purification by preparative reverse-phase
HPLC (linear gradient of 20% B to 80% B over 30 min) provided a
54% yield of 8b and 20b as white solids in a 1:1 ratio. For 8b:
1
retention time = 22.2 min. H NMR (400 MHz, DMSO-d6) δ 11.02
(s, 1H), 10.52 (s, 1H), 8.84 (dd, J = 4.6, 1.8 Hz, 1H), 8.47 (dd, J = 7.9,
1.8 Hz, 1H), 7.51−7.37 (m, 3H), 7.24 (s, 1H), 4.60 (d, J = 6.2 Hz,
2H). ESI-MS m/z: 348.0 (M+H+). HRMS calcd C16H12F2N3O4
[MH+], 348.0790; found, 348.0784. For 20b: retention time = 27.4
min. 1H NMR (400 MHz, DMSO-d6) δ 12.33 (s, 1H), 10.59 (s, 1H),
8.70 (d, J = 3.1 Hz, 1H), 8.37 (d, J = 7.8 Hz, 1H), 7.43 (dd, J = 14.0,
5.4 Hz, 2H), 7.42−7.34 (m, 1H), 7.23 (bs, 1H), 4.59 (d, J = 6.1 Hz,
2H). ESI-MS m/z: 332.1 (M+H+). HRMS calcd C16H12F2N3O3
[MH+], 332.0841; found, 332.0835.
N-(2,4-Difluorobenzyl)-1,4-dihydroxy-2-oxo-1,2-dihydro-1,8-
naphthyridine-3-carboxamide (8c) and N-(2,4-Difluorobenzyl)-4-
hydroxy-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide
(20c). Treatment of 16 as outlined in general procedure E using 2,4-
difluorobenzylamine with purification by preparative reverse-phase
HPLC (linear gradient of 20% B to 80% B over 30 min) provided a
45% yield of 8c and 20c as white solids in a 1:1 ratio. For 8c: retention
1
time = 24.7 min. H NMR (500 MHz, DMSO-d6) δ 10.95 (s, 1H),
10.42 (s, 1H), 8.77 (d, J = 4.6 Hz, 1H), 8.40 (d, J = 7.9 Hz, 1H), 7.49−
7.41 (m, 1H), 7.41−7.34 (m, 1H), 7.21 (t, J = 10.1 Hz, 1H), 7.03 (t, J
= 8.2 Hz, 1H), 4.57 (d, J = 5.9 Hz, 2H). ESI-MS m/z: 348.0 (M+H+).
HRMS calcd C16H12F2N3O4 [MH+], 348.0790; found, 348.0787. For
1
20c: retention time = 29.0 min. H NMR (500 MHz, DMSO-d6) δ
12.32 (s, 1H), 10.57 (s, 1H), 8.70 (s, 1H), 8.36 (d, J = 7.4 Hz, 1H),
7.48 (d, J = 7.5 Hz, 1H), 7.36 (s, 1H), 7.28 (t, J = 9.6 Hz, 1H), 7.10 (s,
1H), 4.62 (d, J = 5.9 Hz, 2H). ESI-MS m/z: 332.1 (M+H+). HRMS
calcd C16H12F2N3O3 [MH+], 332.0841; found, 332.0839.
Methyl 1-(Benzyloxy)-2-oxo-4-(((trifluoromethyl)sulfonyl)oxy)-
1,2-dihydro-1,8-naphthyridine-3-carboxylate (17). To a solution of
16 (268 mg, 0.82 mmol) and triethylamine (0.27 mL, 1.97 mmol) in
CH2Cl2 (15 mL) was added trifluoromethanesulfonic anhydride (0.17
mL, 0.98 mmol) at 0 °C, and the solution was stirred at 0 °C (0.5 h).
The mixture was concentrated and purified by Combiflash silica gel
chromatography to provide 17 as a white solid (301 mg, 80% yield).
1H NMR (400 MHz, CDCl3) δ 8.86 (dd, J = 4.7, 1.7 Hz, 1H), 8.21
(dd, J = 8.1, 1.7 Hz, 1H), 7.70−7.67 (m, 2H), 7.43−7.38 (m, 4H),
5.34 (s, 2H), 4.01 (s, 3H). 13C NMR (100 MHz, CDCl3) δ 160.87,
155.20, 154.02, 153.98, 148.70, 148.09, 133.32, 133.23, 130.12, 129.33,
128.48, 120.84, 119.91, 119.86, 116.67, 109.73, 78.72, 53.50. ESI-MS
m/z: 459.0 (M+H+).
Methyl 1-(Benzyloxy)-2-oxo-1,2-dihydro-1,8-naphthyridine-3-
carboxylate (18). To a mixture of 17 (34 mg, 0.074 mmol) and
PdCl2(PPh3)2 (5 mg, 7.37 μmol) in DMF (1 mL), triethylamine
(0.030 mL, 0.22 mmol) and triisopropylsilane (17 mg, 0.15 mmol)
were added. The mixture was heated to 85 °C (24 h). The resulting
crude mixture was purified by Combiflash silica gel chromatography
(hexanes and EtOAc) to provide 18 as a white solid (12 mg, 52%
yield). 1H NMR (400 MHz, CDCl3) δ 8.74 (dd, J = 4.7, 1.8 Hz, 1H),
8.41 (s, 1H), 7.99 (dd, J = 7.8, 1.7 Hz, 1H), 7.69 (dd, J = 7.6, 1.8 Hz,
2H), 7.38−7.30 (m, 3H), 7.26−7.23 (m, 1H), 5.29 (s, 2H), 3.96 (s,
3H). 13C NMR (100 MHz, CDCl3) δ 164.47, 153.41, 141.78, 138.27,
133.86, 132.08, 131.99, 130.10 (2C), 129.05, 128.50, 128.37 (2C),
119.32, 113.30, 78.21, 52.90. ESI-MS m/z: 311.1 (M+H+).
N-(2,4-Difluorobenzyl)-1-hydroxy-2-oxo-1,2-dihydro-1,8-naph-
thyridine-3-carboxamide (7c). Treatment of 19c as outlined in
general procedure G and purification by preparative reverse-phase
HPLC (linear gradient of 20% B to 80% B over 30 min; retention time
1579
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
= 19.2 min) provided 7c as a white solid in 52% yield. 1H NMR (400
MHz, DMSO-d6) δ 9.88 (t, J = 5.9 Hz, 1H), 8.78 (s, 1H), 8.75 (dd, J =
4.7, 1.8 Hz, 1H), 8.45 (dd, J = 7.9, 1.8 Hz, 1H), 7.46−7.34 (m, 2H),
7.19 (ddd, J = 10.6, 9.4, 2.6 Hz, 1H), 7.03−6.98 (m, 1H), 4.54 (d, J =
5.9 Hz, 2H). ESI-MS m/z: 332.1 (M+H+). HRMS calcd
C16H12F2N3O3 [MH+], 332.0841; found, 332.0834.
between 0.2 and 1.5 RLUs was added to each well, and the plates were
incubated at 37 °C (48 h). Infectivity was measured by using the
Steady-lite plus luminescence reporter gene assay system (PerkinElm-
er, Waltham, MA). Luciferase activity was measured by adding 100 μL
of Steady-lite plus buffer (PerkinElmer) to the cells, incubating at
room temperature (20 min), and measuring luminescence using a
microplate reader. Activity was normalized to infectivity in the absence
of target compounds. KaleidaGraph (Synergy Software, Reading, PA)
was used to perform regression analysis on the data. EC50 values were
determined from the fit model.
Integrase Assays. IN reactions were performed as previously
described.35 Briefly, reactions were carried out by adding compounds
or an equivalent volume of 100% DMSO (used as solvent for the
compounds) to a mixture of 20 nM [γ-32P]-labeled DNA and 400 nM
IN in a buffer containing 50 mM morpholinepropanesulfonic acid (pH
7.2), 7.5 mM MgCl2, and 14 mM 2-mercaptoethanol. [γ-32P]-labeled
full length oligonucleotide 21T (GTGTGGAAAATCTCTAGCAGT)
or precleaved oligonucleotide 19T (GTGTGGAAAATCTCTAGCA),
both annealed to the complementary oligonucleotide 21B (ACTGCT-
AGAGATTTTCCACAC), were used to measure both 3′-processing
and strand transfer, respectively.35 Reactions were performed at 37 °C
for 2 h and quenched by the addition of an equal volume of loading
buffer (formamide containing 1% sodium dodecyl sulfate, 0.25%
bromophenol blue, and xylene cyanol). Reaction products were
separated in 16% polyacrylamide-denaturing sequencing gels. Dried
gels were visualized using Typhoon 8600 (GE Healthcare, Piscataway,
NJ). Densitometric analyses were performed using ImageQuant 5.1
software from GE Healthcare. The data analyses (linear regression,
50% inhibitory concentration [IC50] determination, and standard
deviation [SD]) were performed from at least 3 independent
determinations using Prism 5.0c software from GraphPad.
Cellular Cytotoxicity Assays. The human osteosarcoma cell line,
HOS, was obtained from Dr. Richard Schwartz (Michigan State
University, East Lansing, MI) and grown in Dulbecco’s modified
Eagle’s medium (Invitrogen, Carlsbad, CA) supplemented with 5% (v/
v) fetal bovine serum, 5% newborn calf serum, and penicillin (50
units/mL) plus streptomycin (50 μg/mL; Quality Biological,
Gaithersburg, MD). On the day prior to the screen, HOS cells were
seeded in a 96-well luminescence cell culture plate at a density of 4000
cells in 100 μL per well. On the day of the screen, cells were treated
with compounds in the appropriate concentration range chosen and
incubated at 37 °C for 48 h. Cytotoxicity was measured by monitoring
ATP levels via a luciferase reporter assay. Cells were lysed in 50 μL of
cell lysis buffer (PerkinElmer, Waltham, MA) and shaken at 700 rpm
at room temperature for 5 min. After the addition of 50 μL of ATPlite
buffer (PerkinElmer) directly onto the lysed cells and shaking at 700
rpm at room temperature (5 min), ATP levels were monitored by
measuring luciferase activity using a microplate reader. Activity was
normalized to cytotoxicity in the absence of target compounds.
KaleidaGraph (Synergy Software, Reading, PA) was used to perform
regression analysis on the data. CC50 values were determined from the
fit model.
Single-Round HIV-1 Infectivity Assays. Human embryonic
kidney cell line 293T was transfected with the pNLNgoMIVR-ΔLUC
vector, which was made from pNLNgoMIVR-ΔEnv·HSA by removing
the HSA reporter gene and replacing it with a luciferase reporter gene
between the NotI and XhoI restriction sites.37 VSV-g-pseudotyped
HIV was produced by transfections of 293T cells as described
previously.38 On the day prior to transfection, 293T cells were plated
on 100-mm-diameter dishes at a density of 1.5 × 106 cells per plate.
293T cells were transfected with 16 μg of pNLNgoMIVR-ΔLUC and
4 μg of pHCMV-g (obtained from Dr. Jane Burns, University of
California, San Diego) using the calcium phosphate method. At
approximately 6 h after the calcium phosphate precipitate was added,
the 293T cells were washed twice with phosphate-buffered saline
(PBS) and incubated with fresh media (48 h). The virus-containing
supernatants were then harvested, clarified by low-speed centrifuga-
tion, filtered, and diluted for preparation in infection assays. On the
day prior to the screen, HOS cells were seeded in a 96-well
luminescence cell culture plate at a density of 4000 cells in 100 μL per
well. On the day of the screen, cells were treated with the compounds
from a concentration range of 10 μM to 0.0005 μM using 11 serial
dilutions and then incubated at 37 °C (3 h). After this incubation, 100
μL of virus-stock diluted to achieve a maximum luciferase signal
Vector Constructs. pNLNgoMIVR-ΔEnv·LUC has been de-
scribed previously.37 The IN coding region was removed from
pNLNgoMIVR-ΔEnv·LUC (between KpnI and SalI sites) and
inserted between the KpnI and SalI sites of pBluescript II KS+.
Using that construct as the wild-type template, we prepared the
following IN-resistant mutants via the QuikChange II XL (Stratagene,
La Jolla, CA) site-directed mutagenesis protocol: G118R, Y143R,
Q148H, Q148K, N155H, G140S + Q148H, G140A + Q148K, and
E138K + Q148K. The following sense with cognate antisense (not
shown) oligonucleotides (Integrated DNA Technologies, Coralville,
IA) was used in the mutagenesis: G118R, 5′-GTACATACAGA-
CAATCGCAGCAATTTCACCAGTAC-3′; E138K, 5′-GGCGG-
GGATCAAGCAGAAATTTGGCATTCCCTA-3′; G140A, 5′-
GGGGATCAAGCAGGAATTTGCCATTCCCTACAATC-3′;
G140S, 5′-GGGGATCAAGCAGGAATTTAGCATTCCC-
TACAATC-3′; Y143R, 5′-GCAGGAATTTGGCATTCCCCGC-
AATCCCCAAAGTCAAGGA-3′; Q148H, 5′-CATTCCCTACAA-
TCCCCAAAGTCATGGAGTAATAGAATCTA-3′; Q148K, 5′-
CATTCCCTACAATCCCCAAAGTAAAGGAGTAATAGAATC-
TATGAA-3′; and N155H, 5′-CCAAAGTCAAGGAGTAATAGAAT-
CTATGCATAAAGAATTAAAGAAAATTATAGGACA-3′. The dou-
ble mutant G140S + Q148H was constructed by using the previously
generated Q148H mutant and the appropriate oligonucleotide to
introduce the second mutation, G140S. The double mutant G140A +
Q148K was made by using the Q148K mutant and the appropriate
oligonucleotide to introduce the second mutation, G140A. The double
mutant E138K + Q148K was made by using the Q148K mutant and
the appropriate oligonucleotide to introduce the second mutation,
E138K. The DNA sequence of each construct was verified
independently by DNA sequencing. The mutant IN coding sequences
from pBluescript II KS+ were then subcloned into pNLNgoMIVR-
ΔEnv·LUC (between the KpnI and SalI sites) to produce the full-
length mutant HIV-1 IN constructs. These DNA sequences were
additionally checked independently by DNA sequencing.
AUTHOR INFORMATION
■
Corresponding Author
*Tel: 301-846-5906. Fax: 301-846-6033. E-mail: burkete@
helix.nih.gov.
Present Address
∥Laboratoire MFP, CNRS - UMR 5234, Universite
Bordeaux, Bordeaux Cedex 33076, France
́
de
Notes
The content of this publication does not necessarily reflect the
views or policies of the Department of Health and Human
Services, nor does mention of trade names, commercial
products, or organizations imply endorsement by the U.S.
Government.
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
This work was supported in part by the Intramural Research
Program of the NIH, Center for Cancer Research, Frederick
National Laboratory for Cancer Research and the National
Cancer Institute, National Institutes of Health and the Joint
Science and Technology Office of the Department of Defense,
1580
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
(17) Johns, B. A.; Kawasuji, T.; Weatherhead, J. G.; Taishi, T.;
Temelkoff, D. P.; Yoshida, H.; Akiyama, T.; Taoda, Y.; Murai, H.;
Kiyama, R.; Fuji, M.; Tanimoto, N.; Jeffrey, J.; Foster, S. A.; Yoshinaga,
T.; Seki, T.; Kobayashi, M.; Sato, A.; Johnson, M. N.; Garvey, E. P.;
Fujiwara, T. Carbamoyl pyridone HIV-1 integrase inhibitors 3. A
diastereomeric approach to chiral nonracemic tricyclic ring systems
and the discovery of dolutegravir (S/GSK1349572) and (S/
GSK1265744). J. Med. Chem. 2013, 56, 5901−5916.
(18) Metifiot, M.; Maddali, K.; Johnson, B. C.; Hare, S.; Smith, S. J.;
Zhao, X. Z.; Marchand, C.; Burke, T. R., Jr.; Hughes, S. H.;
Cherepanov, P.; Pommier, Y. Activities, crystal structures and
molecular dynamics of dihydro-1H-isoindole derivatives, inhibitors of
HIV-1 integrase. ACS Chem. Biol. 2013, 8, 209−217.
(19) Sangeetha, B.; Muthukumaran, R.; Amutha, R. Pharmacophore
modelling and electronic feature analysis of hydroxamic acid
derivatives, the HIV integrase inhibitors. SAR QSAR Environ. Res.
2013, 24, 753−771.
(20) Plewe, M. B.; Butler, S. L.; R, D. K.; Hu, Q.; Johnson, T. W.;
Kuehler, J. E.; Kuki, A.; Lam, H.; Liu, W.; Nowlin, D.; Peng, Q.;
Rahavendran, S. V.; Tanis, S. P.; Tran, K. T.; Wang, H.; Yang, A.;
Zhang, J. Azaindole hydroxamic acids are potent HIV-1 integrase
inhibitors. J. Med. Chem. 2009, 52, 7211−7219.
(21) Tang, J.; Maddali, K.; Metifiot, M.; Sham Yuk, Y.; Vince, R.;
Pommier, Y.; Wang, Z. 3-Hydroxypyrimidine-2,4-diones as an
inhibitor scaffold of HIV integrase. J. Med. Chem. 2011, 54, 2282−
2292.
(22) Johnson, T. W.; Tanis, S. P.; Butler, S. L.; Dalvie, D.; DeLisle, D.
M.; Dress, K. R.; Flahive, E. J.; Hu, Q.; Kuehler, J. E.; Kuki, A.; Liu, W.;
McClellan, G. A.; Peng, Q.; Plewe, M. B.; Richardson, P. F.; Smith, G.
L.; Solowiej, J.; Tran, K. T.; Wang, H.; Yu, X.; Zhang, J.; Zhu, H.
Design and synthesis of novel N-hydroxy-dihydronaphthyridinones as
potent and orally bioavailable HIV-1 integrase inhibitors. J. Med. Chem.
2011, 54, 3393−3417.
(23) Desimmie, B. A.; Demeulemeester, J.; Suchaud, V.; Taltynov,
O.; Billamboz, M.; Lion, C.; Bailly, F.; Strelkov, S.; Debyser, Z.;
Cotelle, P.; Christ, F. 2-Hydroxyisoquinoline-1,3(2H,4H)-diones
(HIDs), novel inhibitors of HIV integrase with a high barrier to
resistance. ACS Chem. Biol. 2013, 8, 1187−1194.
(24) Billamboz, M.; Suchaud, V.; Bailly, F.; Lion, C.;
Demeulemeester, J.; Calmels, C.; Andreola, M.-L.; Christ, F.;
Debyser, Z.; Cotelle, P. 4-Substituted 2-hydroxyisoquinoline-1,3-
(2H,4H)-diones as a novel class of HIV-1 integrase inhibitors. ACS
Med. Chem. Lett. 2013, 4, 606−611.
(25) Pryde, D. C.; Webster, R.; Butler, S. L.; Murray, E. J.; Whitby,
K.; Pickford, C.; Westby, M.; Palmer, M. J.; Bull, D. J.; Vuong, H.;
Blakemore, D. C.; Stead, D.; Ashcroft, C.; Gardner, I.; Bru, C.;
Cheung, W.-Y.; Roberts, I. O.; Morton, J.; Bissell, R. A. Discovery of
an HIV integrase inhibitor with an excellent resistance profile.
MedChemComm 2013, 4, 709−719.
(26) Zhao, X. Z.; Maddali, K.; Vu, B. C.; Marchand, C.; Hughes
Stephen, H.; Pommier, Y.; Burke Terrence, R., Jr. Examination of
halogen substituent effects on HIV-1 integrase inhibitors derived from
2,3-dihydro-6,7-dihydroxy-1H-isoindol-1-ones and 4,5-dihydroxy-1H-
isoindole-1,3(2H)-diones. Bioorg. Med. Chem. Lett. 2009, 19, 2714−
2717.
(27) Flipo, M.; Beghyn, T.; Leroux, V.; Florent, I.; Deprez, B. P.;
Deprez-Poulain, R. F. Novel selective inhibitors of the zinc plasmodial
aminopeptidase PfA-M1 as potential antimalarial agents. J. Med. Chem.
2007, 50, 1322−1334.
(28) Nicolaou, K. C.; Xu, J. Y.; Kim, S.; Ohshima, T.; Hosokawa, S.;
Pfefferkorn, J. Synthesis of the tricyclic core of eleutherobin and
sarcodictyins and total synthesis of sarcodictyin A. J. Am. Chem. Soc.
1997, 119, 11353−11354.
and by funds from the Intramural AIDS Targeted Antiviral
Program.
ABBREVIATIONS USED
■
HIV-1, human immunodeficiency virus type 1; AIDS, acquired
immune deficiency syndrome; FDA, Food and Drug Admin-
istration; IN, integrase; RAL, Raltegravir; EVG, Elvitegravir;
DTG, Dolutegravir; 3′-P, 3′-processing; ST, strand transfer;
INSTIs, integrase strand transfer inhibitors; DNA, deoxyribo-
nucleic acid; IC50, half-maximum inhibitory concentration;
EC50, half maximal effective concentration; WT, wild type;
DMSO, dimethyl sulfoxide; DMF, dimethylformamide; HPLC,
high-pressure liquid chromatography; HRMS, high-resolution
mass spectrometry
REFERENCES
■
(1) Metifiot, M.; Marchand, C.; Pommier, Y. HIV integrase
inhibitors: 20-Year landmark and challenges. Adv. Pharmacol. 2013,
67, 75−105.
(2) Di Santo, R. Inhibiting the HIV integration process: past, present,
and the future. J. Med. Chem. 2013, DOI: 10.1021/jm400674a.
(3) Croxtall, J. D.; Scott, L. J. Raltegravir: In treatment-naive patients
with HIV-1 infection. Drugs 2010, 70, 631−642.
(4) Wills, T.; Vega, V. Elvitegravir: A once-daily inhibitor of HIV-1
integrase. Expert Opin. Invest. Drugs 2012, 21, 395−401.
(5) Marchand, C.; Maddali, K.; Metifiot, M.; Pommier, Y. HIV-1 IN
inhibitors: 2010 Update and perspectives. Curr. Top. Med. Chem. 2009,
9, 1016−1037.
(6) Metifiot, M.; Marchand, C.; Maddali, K.; Pommier, Y. Resistance
to integrase inhibitors. Viruses 2010, 2, 1347−1366.
(7) Cherepanov, P.; Maertens, G. N.; Hare, S. Structural insights into
the retroviral DNA integration apparatus. Curr. Opin. Struct. Biol. 2011,
21, 249−256.
(8) Perryman, A. L.; Forli, S.; Morris, G. M.; Burt, C.; Cheng, Y.;
Palmer, M. J.; Whitby, K.; McCammon, J. A.; Phillips, C.; Olson, A. J.
A dynamic model of HIV integrase inhibition and drug resistance. J.
Mol. Biol. 2010, 397, 600−615.
(9) Geretti, A. M.; Armenia, D.; Ceccherini-Silberstein, F. Emerging
patterns and implications of HIV-1 integrase inhibitor resistance. Curr.
Opin. Infect. Dis. 2012, 25, 677−686.
(10) Delelis, O.; Thierry, S.; Subra, F.; Simon, F.; Malet, I.; Alloui, C.;
Sayon, S.; Calvez, V.; Deprez, E.; Marcelin, A.-G.; Tchertanov, L.;
Mouscadet, J.-F. Impact of Y143 HIV-1 integrase mutations on
resistance to raltegravir in vitro and in vivo. Antimicrob. Agents
Chemother. 2009, 54, 491−501.
(11) Quashie, P. K.; Sloan, R. D.; Wainberg, M. A. Novel therapeutic
strategies targeting HIV integrase. BMC Med. 2012, 10 (34), DOI:
10.1186/1741-7015-10-34.
(12) Katlama, C.; Murphy, R. Dolutegravir for the treatment of HIV.
Expert Opin. Invest. Drugs 2012, 21, 523−530.
(13) Ballantyne, A. D.; Perry, C. M. Dolutegravir: first global
approval. Drugs 2013, 73, 1627−1637.
(14) Vandeckerckhove, L. GSK-1349572, a novel integrase inhibitor
for the treatment of HIV infection. Curr. Opin. Invest. Drugs 2010, 11,
203−212.
(15) Kawasuji, T.; Johns, B. A.; Yoshida, H.; Taishi, T.; Taoda, Y.;
Murai, H.; Kiyama, R.; Fuji, M.; Yoshinaga, T.; Seki, T.; Kobayashi,
M.; Sato, A.; Fujiwara, T. Carbamoyl pyridone HIV-1 integrase
inhibitors. 1. Molecular design and establishment of an advanced two-
metal binding pharmacophore. J. Med. Chem. 2012, 55, 8735−8744.
(16) Kawasuji, T.; Johns, B. A.; Yoshida, H.; Weatherhead, J. G.;
Akiyama, T.; Taishi, T.; Taoda, Y.; Mikamiyama-Iwata, M.; Murai, H.;
Kiyama, R.; Fuji, M.; Tanimoto, N.; Yoshinaga, T.; Seki, T.; Kobayashi,
M.; Sato, A.; Garvey, E. P.; Fujiwara, T. Carbamoyl pyridone HIV-1
integrase inhibitors. 2. Bi- and tricyclic derivatives result in superior
antiviral and pharmacokinetic profiles. J. Med. Chem. 2013, 56, 1124−
1135.
(29) Rylander, P. N.; Karpenko, I. M.; Pond, G. R. Selectivity of
hydrogenation over platinum metal catalysts: nitroaromatics. Ann. N.Y.
Acad. Sci. 1970, 172, 266−275.
(30) Takenaka, Y.; Kiyosu, T.; Choi, J.-C.; Sakakura, T.; Yasuda, H.
Selective synthesis of N-aryl hydroxylamines by the hydrogenation of
1581
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582

Journal of Medicinal Chemistry
Article
nitroaromatics using supported platinum catalysts. Green Chem. 2009,
11, 1385−1390.
(31) Zhao, X. Z.; Maddali, K.; Smith, S. J.; Metifiot, M.; Johnson, B.;
Hughes, S. H.; Pommier, Y.; Burke, T. R., Jr. 6,7-Dihydroxy-1-
oxoisoindoline-4-sulfonamide-containing HIV-1 Integrase Inhibitors.
Bioorg. Med. Chem. Lett. 2012, 22, 7309−7313.
(32) Williams, P. D.; Venkatraman, S.; Langford, H. M.; Kim, B.;
Booth, T. M.; Grobler, J. A.; Staas, D.; Ruzek, R. D.; Embrey, M. W.;
Wiscount, C. M.; Lyle, T. A. Preparation of 1-Hydroxynaphthyridin-
2(1H)-one Derivatives as Anti-HIV Agents. Patent
WO2008010964(A1).
(33) Zhao, X. Z.; Semenova, E. A.; Vu, B. C.; Maddali, K.; Marchand,
C.; Hughes, S. H.; Pommier, Y.; Burke, T. R., Jr. 2,3-Dihydro-6,7-
dihydroxy-1H-isoindol-1-one-based HIV-1 integrase inhibitors. J. Med.
Chem. 2008, 51, 251−259.
(34) Malet, I.; Delelis, O.; Valantin, M.-A.; Montes, B.; Soulie, C.;
Wirden, M.; Tchertanov, L.; Peytavin, G.; Reynes, J.; Mouscadet, J.-F.;
Katlama, C.; Calvez, V.; Marcelin, A.-G. Mutations associated with
failure of raltegravir treatment affect integrase sensitivity to the
inhibitor in vitro. Antimicrob. Agents Chemother. 2008, 52, 1351−1358.
(35) Metifiot, M.; Maddali, K.; Naumova, A.; Zhang, X.; Marchand,
C.; Pommier, Y. Biochemical and pharmacological analyses of HIV-1
integrase flexible loop mutants resistant to raltegravir. Biochemistry
2010, 49, 3715−3722.
(36) Mesplede, T.; Quashie, P. K.; Wainberg, M. A. Resistance to
HIV integrase inhibitors. Curr. Opin. HIV AIDS 2012, 7, 401−408.
(37) Zhao, X. Z.; Maddali, K.; Metifiot, M.; Smith, S. J.; Vu, B. C.;
Marchand, C.; Hughes, S. H.; Pommier, Y.; Burke, T. R., Jr. Bicyclic
hydroxy-1H-pyrrolopyridine-trione containing HIV-1 integrase inhib-
itors. Chem. Biol. Drug Des. 2012, 79, 157−165.
(38) Brachmann, A.; Koenig, J.; Julius, C.; Feldbruegge, M. A reverse
genetic approach for generating gene replacement mutants in Ustilago
maydis. Mol. Genet. Genomics 2004, 272, 216−226.
1582
dx.doi.org/10.1021/jm401902n | J. Med. Chem. 2014, 57, 1573−1582