Novel indole and triazole based hybrid molecules exhibit potent anti-adipogenic and antidyslipidemic activity by activating Wnt3a/β-catenin pathway

Article abstract of DOI:10.1016/j.ejmech.2017.10.034

Obesity and dyslipidemia is the two facet of metabolic syndrome, which needs further attention. Recent studies indicate triazole and indole derivatives have remarkable anti-obesity/antidyslipidemic activity. To harness the above-mentioned potential, a series of novel triazole clubbed indole derivatives were prepared using click chemistry and evaluated for anti-adipogenic activity. Based on the structure-activity relationship, essential functional groups which potentiate anti-adipogenic activity were identified. The lead compound 13m exhibited potent anti-adipogenic activity compared to its parent compounds with the IC-50 value of 1.67 μM. Further evaluation of anti-adipogenic activity was conducted in different cell lines such as C3H10T1/2 and hMSC with positive result. The anti-adipogenic effect of compound 13m was most prominent in the early phase of adipogenesis, which is driven by the G1 to S phase cell cycle arrest during mitotic clonal expansion. The mechanistic study suggests that compound 13m exhibit anti-adipogenic property by activating Wnt3a/β-catenin pathway, a known suppressor of key adipogenic genes PPARγ and C/EBPα. It is noteworthy that the compound 13m also reduced serum triglyceride, LDL and total cholesterol in Syrian Golden hamster model of dyslipidemia. The anti-adipogenic activity of compound 13m can also be correlated with decreased expression of PPARγ and increased expression of β-catenin in epididymal white adipose tissue (eWAT) in vivo. The compound 13m also increased the expression of genes involved in reverse cholesterol transport (RCT) such as PPARα and LXR1α indicating another mechanism by which compound 13m ameliorates dyslipidemia in Syrian Golden hamster model. Overall this study provides a unique perspective into the anti-adipogenic/antidyslipidemic property of triazole and indole hybrids molecules with further scope to increase the anti-adipogenic potency for therapeutic intervention of obesity and metabolic syndrome.

Full text of DOI:10.1016/j.ejmech.2017.10.034

Accepted Manuscript
Novel indole and triazole based hybrid molecules exhibit potent anti-adipogenic and
antidyslipidemic activity by activating Wnt3a/β-catenin pathway
Sujith Rajan, Surendra Puri, Durgesh Kumar, Madala Hari Babu, Kripa Shankar, Salil
Varshney, Ankita Srivastava, Abhishek Gupta, M. Sridhar Reddy, Anil N. Gaikwad
PII:
S0223-5234(17)30826-7
10.1016/j.ejmech.2017.10.034
EJMECH 9826
DOI:
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 11 July 2017
Revised Date: 5 October 2017
Accepted Date: 11 October 2017
Please cite this article as: S. Rajan, S. Puri, D. Kumar, M.H. Babu, K. Shankar, S. Varshney, A.
Srivastava, A. Gupta, M.S. Reddy, A.N. Gaikwad, Novel indole and triazole based hybrid molecules
exhibit potent anti-adipogenic and antidyslipidemic activity by activating Wnt3a/β-catenin pathway,
European Journal of Medicinal Chemistry (2017), doi: 10.1016/j.ejmech.2017.10.034.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT
Novel Indole And Triazole Based Hybrid Molecules Exhibit Potent Anti-Adipogenic
And Antidyslipidemic Activity By Activating Wnt3a/β-Catenin Pathway
1
,2
3
1,2
3
1
Sujith Rajan , Surendra Puri , Durgesh Kumar , Madala Hari Babu , Kripa Shankar ,
1
,2
1,2
1
3*
Salil Varshney , Ankita Srivastava , Abhishek Gupta , M Sridhar Reddy , Anil N
1
,2#
Gaikwad
.
1
Division of Pharmacology, CSIR-Central Drug Research Institute, Lucknow - 226031, India
Academy of Scientific and Innovative Research, CSIR-CDRI.
Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow
226031, India.
2
3
-
#
Corresponding Authors: Anil NilkanthGaikwad, Division of Pharmacology, CSIR-Central
Drug Research Institute, Lucknow, Uttar Pradesh, India.
Tel.: +91 522 2771940x4876; fax: +91 522 2771941
E-mail:anil_gaikwad@cdri.res.in
M Sridhar Reddy, Division of Medicinal and Process Chemistry, CSIR-Central Drug Research
Institute, Lucknow - 226031, India.
E-mail: msreddy@cdri.res.in
1

ACCEPTED MANUSCRIPT
Abstract
Obesity and dyslipidemia is the two facet of metabolic syndrome, which needs further attention.
Recent studies indicate triazole and indole derivatives have remarkable anti-
obesity/antidyslipidemic activity. To harness the above-mentioned potential, a series of novel
triazole clubbed indole derivatives were prepared using click chemistry and evaluated for anti-
adipogenic activity. Based on the structure-activity relationship, essential functional groups
which potentiate anti-adipogenic activity were identified. The lead compound 13m exhibited
potent anti-adipogenic activity compared to its parent compounds with the IC-50 value of 1.67
µM. Further evaluation of anti-adipogenic activity was conducted in different cell lines such as
C3H10T1/2 and hMSC with positive result. The anti-adipogenic effect of compound 13m was
most prominent in the early phase of adipogenesis, which is driven by the G1 to S phase cell
cycle arrest during mitotic clonal expansion. The mechanistic study suggests that compound 13m
exhibit anti-adipogenic property by activating wnt3a/β catenin pathway, a known suppressor of
key adipogenic genes PPARγ and C/EBPα. It is noteworthy that the compound 13m also reduced
serum triglyceride, LDL and total cholesterol in Syrian golden Hamster Model of dyslipidemia.
The anti-adipogenic activity of compound 13m can also be correlated with decreased expression
of PPARγ and increased expression of β-catenin in epididymal white adipose tissue (eWAT) in
vivo. The compound 13m also increased the expression of genes involved in reverse cholesterol
transport (RCT) such as PPARα and LXR1α indicating another mechanism by which compound
1
3m ameliorates dyslipidemia in Syrian golden hamster model. Overall this study provides a
unique perspective into the anti-adipogenic/antidyslipidemic property of triazole and indole
hybrids molecules with further scope to increase the anti-adipogenic potency for therapeutic
intervention of obesity and metabolic syndrome.
2

ACCEPTED MANUSCRIPT
Introduction
Obesity is a major risk factor for insulin resistance, type 2 diabetes mellitus (T2DM),
hypertension and cardiovascular diseases collectively known as metabolic syndrome [1]. There
has been a startling increase in the rate of obesity worldwide. Even though 62% of obese
individual live in the developed nation, the percentage of obese people in developing countries
are also increasing exponentially [2]. Obesity mainly results from excess energy intake than
energy expenditure [3]. and the excess energy is stored in adipose tissue in the form of lipid
droplets [4]. There are many factors contributing to obesity such as lack of physical activities,
sedentary lifestyle etc. Excess storage of lipid in adipocytes leads to hypertrophy (increase in
size) and hyperplasia (increase in number) [5]. The overall gain in adipose tissue mass is
associated with T2DM, metabolic syndrome and cardiovascular diseases [6]. 10% adipocytes are
renewed every year to maintain healthy adipose tissue by a process called adipogenesis [7].
Recent studies in adipocyte biology have given better understanding of molecular mechanism
linking obesity to other disease conditions such as insulin resistance, type 2 diabetes [8]. As
adipocytes play a major role in glucose homeostasis and insulin resistance, they have been
targeted as the therapeutic intervention for treatment of insulin resistance and associated
metabolic syndrome [9]. Inhibiting adipogenesis and thereby limiting overall increase in adipose
tissue mass is seen as a potential mechanism for the treatment and prevention of obesity.
Therefore, chemical agents exhibiting such inhibitory effect on adipogenesis are of great
pharmacological importance.
The process of adipogenesis has been well studied in different murine cell lines such as 3T3-L1,
3
T3-F442A and C3H10T1/2 [10]. Adipogenesis is complex process accompanied with a cascade
of changes in morphology, protein expression, hormonal sensitivity and extracellular matrix. The
3

ACCEPTED MANUSCRIPT
process of adipogenesis can be divided into four stages 1) Growth arrest, 2) Mitotic clonal
expansion, 3) Early differentiation and 4) Late differentiation [11, 12]. After growth arrest cells
upon hormonal stimulation undergo two to three rounds of cell division termed as mitotic clonal
expansion, a process essential for adipogenesis. At the early stage of adipogenesis, genes
involved in lipogenesis and fatty acid metabolism such as fatty acid synthase (FAS), adipocyte-
specific fatty acid binding protein (AP2), and lipoprotein lipase (LPL) etc., get activated. At the
late stage, adipocytes start secreting proteins such as leptin, adiponectin, resistin etc, which are
collectively called as adipokines [13]. Each stage of adipogenesis is governed by different
transcription factors such as CCAAT/enhancer binding protein α and β (C/EBPα and C/EBPβ),
peroxisome proliferator-activator receptor γ (PPARγ) etc [14]. These transcription factors
through a cascade of signaling, activates adipocyte-specific genes resulting in the formation of
fully matured adipocytes. Gene mutation studies conducted on mouse 3T3-L1 show PPARγ as
the master regulator of adipogenesis [15]. PPARγ agonists like thiazolidinedione class of
compound are known for their pro-adipogenic activity [16].
Molecular hybridization approach is a straightforward and emerging approach for the rational
design of new prototypes and structural modifications based on the recognition of
pharmacophoric subunits [17]. Indole derivatives are endowed with diverse pharmacological
properties including anti-tubercular [18], anticancer [19], antioxidant [20] and antiviral [21]
activities. Owing to the broad spectrum of pharmacological profile, eliciting anti-obesity [22]
lipid lowering [23] and anti-adipogenic [24] activity of indole derivatives has been widely
investigated. On the other hand, it is well documented that 1,4-disubstituted 1,2,3-triazoles
display a number of chemotherapeutic properties such as anticancer [25], antifungal [26], anti-
tubercular [27], antimicrobial [28], antiviral [29], anti-HIV [30], anti-inflammatory [31], anti-
4

ACCEPTED MANUSCRIPT
HSV [32], anticonvulsant [33] along with significant anti-adipogenic activities [34]. The
aforementioned findings led us to explore molecular hybridization approach and synthesize new
functionalized indoles and 1,2,3-triazoles to generate a new prototype for biological evaluation.
The structure activity relationship (SAR) study of functionalized hybrid analogues was done
around the lead compound 13m.
Figure 1. Schematic representation of indole and triazole hybrid prototypes based on reported
antidyslipidemic and anti-obesity candidates.
Results and Discussion
Chemistry: The synthesis of desired hybrid compounds was started from indole carboxaldehyde
derivatives. The 3-subtitued indole-2-carboxaldehyde derivatives 1a-b were prepared by using
5

ACCEPTED MANUSCRIPT
literature procedure [35] and was further treated with TsCl in the presence of DMAP, TEA in
DCM to obtain the sulfonylatedindole derivatives 2a-b. Condensation of compounds 2a-b with
propargyl amine followed by reduction with NaBH afforded the terminal alkyne derivatives 3a-
4
b.
Scheme 1. Synthetic Route To 2-Substituted Indole And Triazole Based Hybrid Molecules
8
a-f.
The azide derivatives 6a-d for click reaction was prepared from readily available benzaldehyde
derivatives 4a-d via reduction followed by nucleophilic substitution reactions with sodium azide.
It involves CuI catalyzed 3+2 cycloaddition reaction of benzylazides 6a-d and terminal alkynes
3
a-b that produced the triazole clubbed indole derivatives 7a-f in good yields. Finally, the
sulfonyl protection of 7a-f with desired sulfonyl chlorides produced the target compounds 8a-f in
good to excellent yields.
6

ACCEPTED MANUSCRIPT
Scheme 2. Synthetic Route To 3-Substituted Indole And Triazole Based Hybrid Molecules
1
3a-o.
To further prepare a library of compounds, readily available indole-3-carboxamide was opted as
a starting material. By using aforementioned synthetic strategy, the considerable number of N-
sulfonyl 3-substituted indole and triazole based hybrid molecules 13a-m were prepared. Based
on the preliminary results obtained from in vitro screening the possible structural modifications
were done around 13m. In this series acetylation and trifluoro acetylation was carried out on 12f
to obtain 13n and 13o respectively.
Scheme 3. Synthetic Routes To 3-Substituted Indole And 2,3-Difluoro Benzaldehyde Based
Hybrid Molecule 18a-l
Further, the role of indole and triazole pharmacophores around the lead compound 13m showing
anti-adipogenic activity was tested. Initially, triazole ring was removed from the hybrid molecule
1
3m to know the structure activity relationship (SAR) as well as the activity of newly
synthesized compounds. The synthesis of the desired prototype started from the reduction of
7

ACCEPTED MANUSCRIPT
sulfonyl protected indole-3-aldehyde derivatives 10a-b followed by the reduction with NaBH
4
afforded compounds 14a-b. Nucleophilic displacement of the hydroxyl group on 14a-b was
achieved by treating with sodium azide and triphenyl phosphine in DMF and CCl (4:1 ratio
4
respectively) as a solvent. Further, the reduction of azide group with PPh in THF:H O (6:1 ratio
3
2
respectively) produced 16a-b. Condensation of 16a-b with 2,3- difluorobenzaldehyde under
refluxing temperature followed by NaBH reduction produced the compound 17a-b. The series
4
of compounds 18a-I were synthesized by further functionalization of secondary nitrogen with
various alkylating and various amide incurring groups.
Scheme 4. Synthetic Routes To Substituted Benzyl amines And 2,3-Difluoro Benzaldehyde
Based Condensed Molecules 21a-f
In continuation to these, we also aimed to prepare set of compounds by removing indole
pharmacophore. In this regard, condensation of benzyl amine and 2,3-difluorobenzaldehyde was
4
achieved in DCE at reflux condition followed by reduction with NaBH in MeOH produced
compounds 20a-b. Further 20a-b were treated with various amidating and sulfonylating agents
for the synthesis of corresponding tert-amine derivatives 21b-f.
8

ACCEPTED MANUSCRIPT
Biological Activity: Screening Of Compounds For Anti-Adipogenic Activity In 3T3-L1
Preadipocytes
A series of compounds were screened for anti-adipogenic activity in 3T3-L1 cell line. The
compound treatment was given along differentiation media and Oil-red O absorbance was taken
at 492nm. The initial triazole/indole hybrid compounds synthesized 8a-f (scheme 1) did not
show any significant anti-adipogenic activity (Fig. 1A) (Supplementary table 1). Delightedly, 3-
substituted indole and triazole molecules 13m-o (Scheme 2) possessing 2,3-difluoro benzyl
substitution on the triazole ring showed significant anti-adipogenic activity with 71, 39 and 31%
of inhibition respectively (Fig. 1B) (Table 1). However, among the series of compounds 18a-l
(Scheme 3) containing indole as a pharmacophore 18a, 18c, 18g and 18i exhibited moderate anti-
adipogneic activity with 45, 57, 21 and 25% of inhibition respectively (Fig. 1C) (Supplementary
table 1). The decrease in anti-adipogenic activity in series of compound (18a-l) might be
representing the pharmacophoric activity of triazole ring. Another series of compounds
synthesized on the basis of SAR confirmed the essential functional groups necessary for the anti-
adipogenic activity. Compounds in the fourth series 21a-f (Scheme 4) showed non-significant
anti-adipogenic activity (Fig. 2D).
9

ACCEPTED MANUSCRIPT
1
0

ACCEPTED MANUSCRIPT
Figure 2. Screening Of Compounds For Anti-Adipogenic Activity In 3T3-L1 Preadipocytes
20µM of compound was given along with differentiation media in 3T3-L1 preadipocytes and stained with
Oil red O. MDI+ was taken as control. The stain was collected and absorbance was taken at 492nm. n=3,
error bars represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001 as tested by students t test. Significance
is indicated in comparison to control (A-D). Log concentration dependent treatment of selected
compounds in 3T3-L1 preadipocytes, n=3, error bars in the graph represent mean ± SD (E-K). The actual
concentrations used for treatment were 0.1, 1, 3, 10, 30, 100 and 300µM respectively which are converted
to log concentration and analyzed in non-liner regression to find IC50 value. The IC50 values of the
compounds are given in the box adjacent to the plot. The data are representative of three independent
experiments.
Among all the triazole/indole hybrids, compounds 13m-o, 18a, 18c, 18g and 18i exhibited
maximum anti-adipogenic activity and were taken up for further study. Compound treatment was
given in log concentration from 1µM to 300µM to calculate IC50 value. IC value of
50
compound13m-o, 18a, 18c, 18g and 18i are given in table 1 (Fig. 2E–K).
Table 1: Molecular Weight And IC50Value Of Selected Compounds Based On Their
Activity.
Compound Name
Molecular Weight
IC50 value (μM)
1
1
1
1
1
1
3m
3n
3o
8a
8c
661.1629 1.7 ± 0.8
549.1646 9.1 ± 0.9
603.1364 19.1 ± 3.4
426.1214 30 ± 5.5
468.1319 17.5 ± 2.2
430.0963 12.4 ± 0.7
8g
1
1

ACCEPTED MANUSCRIPT
1
8i
472.1068 10.6 ± 3.1
The IC50 value calculated from two to three independent experiments is represented as mean ± SEM.
Among the selected compounds, 13m showed most potent anti-adipogenic activity with IC50
value of 1.67µM and was selected for mechanistic study. Oil red O images of 3T3-L1 cells
treated with lead compound 13m at 5, 10 and 20µM concentration were captured in imaging
condition (Supplementary Fig. 1A). Compound 13m did not show any cytotoxicity even at 100
times above the IC50 concentration (Supplementary Fig. 1B). These results made us to choose
the compound 13m a suitable candidate for mechanistic study.
Anti-Adipogenic Activity Of Compound 13m In Different Cell Lines
Similar to above study, the anti-adipogenic activity of compound 13m was checked in
C3H10T1/2 and human mesenchymal stem cells (hMSC). As observed in 3T3-L1, both these
cell lines when differentiated in presence of compound 13m showed less lipid accumulation as
seen in oil red O staining (Fig. 3A & B). The absorbance at 492nm of Oil-red O stain collected
from lipid accumulated in C3H10T1/2 and hMSC indicated that the compound 13m inhibits
adipogenesis at various concentrations (5, 10, 20 µM) as shown in (Fig. 3C & D).
1
2

ACCEPTED MANUSCRIPT
Figure: 3. Anti-Adipogenic Activity Of Compound 13m In Different Cell Lines
Oil red O staining images of C3H10T1/2 and hMSC differentiated adipocytes treated with 5, 10 and
20µM respective concentration of compound 13m along with differentiation media. The images were
captured at 10x and 20x magnification with Leica microscope. The images are representative of three
independent experiments. (A&B). Oil red O stain was collected from the lipid accumulated in C3H10T1/2
and hMSC differentiated adipocytes, absorbance was taken at 492nm, n=3, error bars represents mean ±
SD, ***p<0.001 as tested by student t test. Significance is indicated in comparison to MDI+ group
(
C&D). Oil red O staining images of 3T3-L1 (E), C3H10T1/2 (G) differentiated adipocytes treated with
M of compound 13m along with differentiation media for different time periods as given in figure (E
20µ
and G).The images were captured at 10x magnification with Leica microscope, images are representative
of three independent experiments (E&G). Oil red O stain was collected from the lipid accumulated in
1
3

ACCEPTED MANUSCRIPT
3
T3-L1 (F) and C3H10T1/2 (G) differentiated adipocytes, absorbance was taken at 492nM. n=3, error
bars represents mean ± SD, ***p<0.001 as tested by student t test. Significance is indicated in comparison
to MDI+ group (F&H).
To further check the stage at which, the compound 13m inhibits adipogenesis, day dependent
compound treatment was given along with the differentiation media. The day dependent
treatment of compound 13m in 3T3-L1 cells during the period of differentiation showed
maximum inhibition of adipogenesis at 0 to 7 days of treatment. The treatment of compound
1
3m (20µM) at the early stage of differentiation (0-3days) was sufficient to significantly inhibit
adipogenesis in 3T3-L1 cells (Fig. 3E & F). Similar to 3T3-L1, the compound 13m inhibited
adipogenesis at the early stage of differentiation in C3H10T1/2 cells (Fig. 3G & H). The above
results indicate that the compound acts on the early stage of differentiation thereby inhibiting
adipogenesis. This made us curious to investigate the action of compound 13m in growth arrest
and mitotic clonal expansion, the two early events in the process of adipogenesis.
Suppression of Mitotic Clonal Expansion By Compound 13m Via Activation of
Wnt3a/βcatenin Pathway
To examine the effect of compound 13m during mitotic clonal expansion, 3T3-L1 cells were
incubated with 10 and 20µM of compound 13m along with differentiation media for 16 and 24hr.
After incubation period cell were fixed and cell cycle was analyzed using flow cytometry. Flow
cytometry analysis indicated that MDI treatment leads to increased cell division and majority of
cells are in S phase at 16hr times point, whereas in presence of compound 13m the cells entering
S phase was significantly reduced. At 24hr time point MDI treated cells were significantly less in
1
4

ACCEPTED MANUSCRIPT
+
S phase compared to cell treated with compound 13m. The right panel besides the cell cycle
1
5

ACCEPTED MANUSCRIPT
Figure: 4. Suppression of Mitotic Clonal Expansion By Compound 13m Via Activation of
Wnt3a/
βcatenin Pathway
3
T3L1 adipocytes were exposed to compound 13m (10 and 20µM) for 16 and 24hrs along differentiation
media. Cells were fixed and stained with PI followed by cell cycle analysis using flow cytometry. 10,000
counts were taken in each reading. The data are representative of three independent experiments (A).
3
T3-L1 cells were given MDI treatment with or without compound 13m (20µM) and proteins were
isolated at 16 and 24hrs. The isolated proteins were subjected to western blot analysis for proteins CDK2,
CDK4, CDK6, CyclinD1 and CyclinD3. Actin was taken as loading control. Densitometry graphs
normalized with actin are shown besides the blots. n=3, error bars represent mean ± SD, *P<0.05,
*
*P<0.01 and ***P<0.001 as tested by student t test (B). Western blot analysis of adipocyte specific
proteins PPAR , C/EBP , AP2 and FAS in MDI alone and with compound 13m treated 3T3-L1 cells at
different time points as given figure, n=3 (C). Real-Time PCR analysis of genes related to adipogenesis in
T3-L1 cells treated with differentiation media with or without compound 13m (20 M) during the period
γ
α
3
µ
of differentiation. n=3, error bars represent SD,*P<0.05, **P<0.01, ***P<0.001 as tested by one way
ANOVA and Bonferroni post-test analysis (D). 3T3L1 cells were given MDI treatment with or without
compound 13m (20
isolated proteins were subjected to western blot analysis for following proteins Wnt3a, pLRP6,
pGSK3 , TCF1 and LEF1. The densitometry analysis of above mentions proteins normalized with either
Actin or their respective proteins is given besides the blot. n=3, error bars represent SD, *P<0.05,
*P<0.01 and ***P<0.001 as tested by one way ANOVA and Bonferroni post-test analysis (E). All
µ
M) and protein were isolated at different time points as given in the figure. The
βcatenin,
β
*
results are representative of three independent experiments.
analysis graph shows the percentage of cells in different phase of cell cycle (Fig. 4A). Further
study of proteins involved in cell cycle show that compound 13m particularly blocks G1 to S
phase transition as commitment to enter S phase occurs through sequential phosphorylation of
1
6

ACCEPTED MANUSCRIPT
Rb by CyclinD CDK4/CDK6 and CyclinE/CDK2 proteins[36] which were found to be down
regulated at 16hr and 24hr time point in compound 13m treated cells (Fig.4B). The above result
together with cell cycle analysis study confirms the G1 to S phase cell cycle arrest by compound
1
3m. The mRNA expression profile of 3T3L1 cells treated with compound 13m showed
decreased expression of adipogenic transcription factors PPARγ, C/EBPα and AP2 gene as well
as increased expression of Wnt3a, BMP2 (Bone morphogenetic protein 2), SIRT1 (sirtuin-1),
CREB (cAMP response building proteins) compared to control cells (Fig. 4C). We did not find
increased expression of other Wnt family members such as Wnt5a, Wnt5b,Wnt10a which are
known to inhibit adipogenesis (Supplementary Fig. 2A) Among the aforementioned genes,
PPARγ, C/EBPα, AP2 and FAS were validated at protein level and were found to be decreased
in compound 13m treated 3T3L1 cells at different time intervals (Fig. 4D). The clues obtained
from above results suggest the involvement of proteins associated with Wnt3a pathway at 16 and
2
4 hr time point.
The compound 13m showed increased expression of Wnt3a at the protein level as well. As
expected the downstream proteins of Wnt3a pathway, LRP6 and β-Catenine were found to be
activated (increased phosphorylation) in compound 13m treated cells. The treatment of
compound 13m on 3T3L1 adipocytes also led to increased expression of TCF1 and LEF1 at 16
and 24 hr time point (Fig. 4E). TCF1 and LEF1 are known to suppress PPARγ, C/EBPα and
other pro-adipogenic genes [37] [38]. From the above results, it can be concluded that the one of
the possible mechanisms by which compound 13m inhibit adipogenesis is by arresting cell cycle,
which might be in turn due to activation of Wnt3a/β-catenin pathway.
1
7

ACCEPTED MANUSCRIPT
Inhibition Of β-Catenin/TCF Pathway By FH353 Abolishes Anti-Adipogenic Activity Of
The Compound 13m
To validate that anti-adipogenic activity of the compound 13m is mediated by Wnt3a/β-catenin
pathway, We used FH353 which is an inhibitor of β-catenin/TCF complex [39]. 3T3L1 pre
adipocytes on treatment with the compound 13m in presence of FH353 (10µM) differentiated to
adipocytes on MDI treatment, similar to control cells (Fig. 5A and B). Cell cycle analysis
showed that the compound 13m failed to arrest G1/S phase transition in presence of FH353 at
2
4hr time point on treatment with MDI (Fig. 5C). Further analysis of proteins involved in cell
cycle regulation at 16 and 24 hr time point showed that in presence of FH353 the compound 13m
treated cell showed increased expression of CDK2, CDK4, CDK6, cyclinD1 and cyclinD3
similar to control cells and failed to activate β-catenin/TCF proteins (Fig. 5D and E). Moreover,
in presence of FH353 3T3L1 cell showed increased expression of PPARγ, C/EBPα, FAS and
AP2 similar to control cells on treatment with compound 13m. The above results confirm that
the compound 13m inhibits adipogenesis by wnt3a/β-catenin pathway.
1
8

ACCEPTED MANUSCRIPT
Figure 5: Inhibition Of
The Compound 13m
β-Catenin/TCF Pathway By FH353 Abolishes Anti-Adipogenic Activity Of
Oil red O staining images of 3T3L1 adipocytes treated with the compound 13m (20
µM) with or without
FH353 (10 M ) along with differentiation media. The images were captured at 20x and 40x magnification
µ
with Leica microscope. The images are representative of three independent experiments. (A). Oil red O
stain was collected from the lipid accumulated in C3H10T1/2 and hMSC differentiated adipocytes,
absorbance was taken at 492nm. n=3, error bars represents mean ± SD, ***p<0.001 as tested by student t
1
9

ACCEPTED MANUSCRIPT
test (B). 3T3L1 adipocytes were exposed to compound 13m (20µM) for 16 and 24 hrs along
differentiation media with or without FH353 (10µM). Cells were fixed and stained with PI followed by
cell cycle analysis using flow cytometry. 10,000 counts were taken in each reading. The data are
representative of three independent experiments (C). 3T3-L1 cells were treated with compound 13m (20
µ
M) with or without FH353 (10
were subjected to western blot analysis for proteins involved in cell cycle regulation,
and LEF1 (D and E). Actin was taken as loading control. n=3. 3T3L1 cells were differentiated in
µ
M) and proteins were isolated at 16 and 24hrs. The isolated proteins
β
-catenin, TCF-1
presence of compound 13m (20µM) or FH353 (10 µM) using MDI as shown in Figure (F). Proteins were
th
isolated at 2, 4 and 6 day and subjected to western blot analysis for PPAR
γ, C/EBPα, FAS and AP2.
Actin was used as loading control. n=3 (F).
Compound 13m Ameliorates Dyslipidemia in Syrian Golden Hamster Model
Many naturally occurring anti-adipogenic compound such as curcumin and berberine are also
,
known to improve dyslipidemia [40] [41]. Moreover our own previous studies indicate that anti-
,
,
adipogenic compounds also exhibits antidyslipidemic activity [42] [6] [43]. On this basis, the
anti-dyslipidemic potential of compound 13m was investigated in Syrian Golden hamster model
for dyslipidemia, which serves as a standard in vivo model [44]. In the course of study, 7 days
compound 13m treatment ameliorated serum lipid profile evaluated by significant reduction of
serum TG, TC LDL and NEFA levels compared to dyslipidemic group (Fig. 6A-D). We did not
found significance HDL level alterations in the treatment group (Fig. 6E). However, we find a
significant attenuated atherogenic index (TG/HDLc ratio) in the compound treated group (Fig.
6
F). In addition, compound 13m treatment significantly attenuated serum ALT (Figure5G) level
and relatively decreased AST level (Fig. 6H) as compared to HFD fed group indicating that the
compound is not hepatotoxic and has beneficial effect. Western blot analysis showed increased
2
0

ACCEPTED MANUSCRIPT
β-catenin and decreased PPARγ protein level in the eWAT of compound treated group (Fig. 6I)
which further support the anti-adipogenic potential of the compound observed in in vitro studies.
2
1

ACCEPTED MANUSCRIPT
Figure 6. Compound 13m Ameliorates HFD Induced Dyslipidemia In The Syrian Golden Hamster
Model
HFD fed hamsters showed dysregulated serum lipid profile. 7days treatment of compound 13m
significantly attenuated serum triglycerides (TGs) (A), total cholesterol (TC) (B), LDL (C) and NEFA (D)
levels as compared to HFD fed group. Compound 13m treatment did not alter serum HDL-c levels
significantly (E); while the compound 13m significantly attenuates TG/HDL-c ratio (F), a marker for
artherogenic index. Compound 13m significantly attenuates serum ALT (Alanine Transaminase) as
compared HFD fed group (G), AST (Aspartate Transaminase) level was non-significant among all groups
(
H). All data are expressed in mean ± SEM (n=4 hamster per group). Statistical significance was
measured by one way ANOVA followed by Bonferroni posttest analysis. Statistical significance denoted
by *p<0.05, **p<0.01, ***p<0.001. n.s. means non-significant difference between groups. Proteins
isolated from epididymal white adipose tissue (eWAT) were subjected to western blots of denoted
proteins in different groups (I), error bars represent mean ± SD of three independent experiments.
*P<0.05, **P<0.01, ***P<0.001 as tested by one way ANOVA followed by Bonferroni posttest analysis.
All results are representative of three independent experiments.
Compound 13m Regulates Lipid Metabolism by Promoting Reverse Cholesterol Transport
(RCT)
As high-fat diet-induced dyslipidemia is known to impair RCT[45], hepatic genes associated
with lipid metabolism were analyzed to understand the mode of action of compound 13m.
Comparative gene expression analysis showed significant increase in the expression of genes
such as PPARα (peroxisome proliferator-activated receptor α), LXR1α (Liver X receptor 1α),
HNF1α (Hepatocyte nuclear factor 1α) and ApoA (Apolipoprotein A) in liver of the compound
1
3m treated group (Fig. 7A). Among them, PPARα and LXR1α are the two major genes elevated
following compound 13m treatment and both play a key role in RCT.[46] Therefore, further
studies on adipose and hepatic genes associated with RCT were performed.
2
2

ACCEPTED MANUSCRIPT
2
3

ACCEPTED MANUSCRIPT
Figure: 7. Compound 13m Regulates Lipid Metabolism by Promoting Reverse Cholesterol
Transport (RCT).
Comparative gene expression analysis of denoted key genes involved in hepatic lipid metabolism was up-
regulated in liver after compound 13m treatment, n=3, error bars represent mean ± SD, (A). RCT related
genes in eWAT showed similar results in 13m treated group compared to positive control fenofibrate (B).
RCT related genes in liver showed similar results in 13m treated group compared to positive control
fenofibrate (C). Compound 13m treatment group showed less weight gain as compared to all groups (D).
Compound 13m treatment did not show significant change in energy intake from HFD feeding (E).
Compound 13m significantly attenuated liver weight/total body weight as compared to HFD fed group
(
F). Compound 13m attenuated eWAT/body weight as compared to HFD fed group (G). H&E staining
showed decreased adipocyte hypertrophy and hepatic lipid vacuoles in compound 13m treatment group
H). All data were expressed in mean ± SEM except hepatic mRNA expression (mean ± SD). Statistical
(
significance denoted by *p<0.05, **p<0.01, ***p<0.001. All results are representative of three
independent experiments.
In this cohort, compound treatment showed increased expression of reverse cholesterol transport
genes ABCA1, ABCG8 and ABCG5 in adipose tissue similar to fenofibrate (Fig. 7B).
In addition, compound 13m showed decreased expression of CETP, CYP7a1, NPCL1 and
increased expression of SCARB1 and LCAT genes in liver similar to standard compound
fenofibrate (Fig. 7C). The comparative gene expression studies indicated that compound 13m
improves dyslipidemia by promoting RCT. The compound 13m treated animals gained
significantly lesser weight compared to the dyslipidemic group (Fig. 7D). However non-
significant patterns in energy intake were observed among all groups (Fig. 7E). Interestingly,
compound treated animals had significantly lower liver and eWAT/body weight (Fig. 7F & G).
H&E staining showed decreased adipocyte hypertrophy and hepatic lipid vacuoles in compound
2
4

ACCEPTED MANUSCRIPT
1
3m treated group (Fig. 7H). The in vivo study validates the in vitro findings and shows that
apart from inhibiting adipogenesis, the compound 13m also improves dyslipidemia by activating
RCT in FHD fed Syrian Golden hamster.
Table: 2 Primer sequences of genes analyzed by qRT-PCR in 3T3L1 preadipocytes.
Gene
Primer sequence
GCAGTGTTTCTGTGGCTGACAC
GCCATGCACAGGGTCCA
Fabp4 Forward
Fabp4 Reverse
PPARγ Forward
PPARγ Reverse
C/EBPα Forward
C/EBPα Reverse
Wnt3a Forward
Wnt3a Reverse
Gsk3β Forward
Gsk3β Reverse
LPL Forward
GATTCACTTTTCTGGGACTGA
GCCACTGTGCCGTACAGAGA
GGCCAATGGCATCCAAAATA
CCTTGGCGAATTCTGTGAGC
TGCTGTCCCTGTATGCCTCTG
AGGGAGAGCGTAGCCCTCAT
TCATCAGGACAACGCGATTTAAGAA
GCAGTCGGACTATGTTACAGTGG
TCAGCATCTTCTCTGCAGACCGG
TCATTAGCATCCGTGGGAACA
GGCCTCTACGACTCAGTCCA
TAAGCCGGCTGAGATCTTGT
CCTCCATGCCTGACTAAAGG
TGAAATTCCAGCACTTTGGA
GAGGCGAAGAAAAGCAACAG
CTCCACATGGAAAAAGCTCTG
LPL Reverse
Ucp 1 Forward
Ucp 1 Reverse
SIRT1 Forward
SIRT1 Reverse
BMP2 Forward
BMP2 Reverse
2
5

ACCEPTED MANUSCRIPT
CREB Forward
CREB Reverse
CAGGCAGGTGTTTCACAGG
GCATGTTCAGAGGGTTAGGG
GCCGCTAGAGGTGAAATTCTT
CGTCTTCGAACCTCCGACT
1
1
8s RNA Forward
8s RNA Reverse
Adipogenesis is driven by a complex cascade of transcriptional factors leading to the sequential
development of preadipocyte into mature adipocyte.[47] At the molecular level, PPARγ
activation is sufficient enough to trigger the process of adipogenesis and arrest the growth of
preadipocytes compelling them to enter mitotic clonal expansion.[48, 49] PPARγ is in turn
activated by C/EBPα and is necessary for the continuous maintenance of PPARγ expression. The
compound 13m decreases the expression of both C/EBPα and PPARγ after differentiation media
induction (MDI-Media containing 3-Isobutyl-1-methylxanthine (500µM), insulin (5µg/ml) and
dexamethasone (250nM). During the early stage of adipogenesis, cells retract from their normal
growth and undergo MCE (mitotic clonal expansion), which is composed of at least two rounds
of cell division [50]. MCE is considered to be a necessary step in the event leading to
adipogenesis and the cells which do not undergo MCE do not differentiate into adipocytes [50].
Compound 13m inhibits mitotic clonal expansion as evident from the cell cycle experiment. The
doubling time of 3T3-L1 adipocytes is around 24hr and they undergo MCE within first 2 days of
MDI treatment [41]. As observed in flow cytometry experiment, the compound 13m treated 3T3-
L1 cells were significantly less in S phase compared to control after 16hr of MDI induction. This
indicates that control cell after 16hrs of MDI induction undergoes mitotic clonal expansion.
Similar to compound 13m, many anti-adipogenic compounds such as resveratrol have shown to
inhibit G1 to S phase transition [51]. Resveratrol is also known to activate β-catenin pathway
2
6

ACCEPTED MANUSCRIPT
hence we used resveratrol as positive control in cell cycle regulation experiment [52-54]. One of
the key observations was the increased expression of Wnt3a, which is known to regulate cell
proliferation and differentiation [55]. Different cell lines are available to study adipogenesis, but
each of these capture only specific mechanistic aspect of adipogenesis. Recently, the necessity of
MCE for adipogenesis has been a matter of debate as human mesenchymal stem cells have been
shown to differentiate into adipocytes without undergoing MCE [56]. To check whether the
compound 13m shows similar anti-adipogenic potency in different adipogenesis model and to
rule out species specificity, we tested the compound in C3H10T1/2 and hMSC cell lines. The
compound showed similar anti-adipogenic potency in all cell lines irrespective of their origin.
Wnt family members are glycoproteins, which act on the frizzled receptors responsible for the
maintenance of β-catenin. Although the Wnt pathway is known to inhibit adipogenesis by both
β-catenin dependent and independent pathway, more emphasis has been recently given to
canonical pathway[57, 58]
Table: 3 Prime sequences of genes analyzed by qRT-PCR in hamster
Gene
Lxrα Forward
Lxrα Reverse
Primer sequence
TCAGCATCTTCTCTGCAGACCGG
TCATTAGCATCCGTGGGAACA
HMGCR Forward GAGCTACATTTGTGCTTGGCG
HMGCR Reverse
LPL Forward
TTCATTAGGCCGAGGGCTCAC
GATTCACTTTTCTGGGACTGA
GCCAACTGTGCCGTACAGAGA
GGCCAATGGCATCCAAAATA
CCTTGGCGAATTCTGTTGAGC
LPL Reverse
PPARα Forward
PPARα Reverse
2
7

ACCEPTED MANUSCRIPT
β-Actin Forward
β-Actin Reverse
ApoA1 Forward
ApoA1 Reverse
LCAT Forward
LCAT Reverse
TGCTGTCCTGTATGCCTCTG
AGGGAGAGCCTAGCCCTCAT
ACCGTTCAGGATGAAAACTGTAG
GTGACTCAGGAGTTGCTGGGATAAC
CACACAAGGCCTGTCATCCT
AGCACAACCAGTTCACCACA
SREBP1c Forward GCAAGGTGTTCCTGCATGAA
SREBP1c Reverse TGGTGTTCTGACTGGTACGCC
ABCA1 Forward
ABCA1 Reverse
ABCG1 Forward
ABCG1 Reverse
ABCG5 Forward
ABCG5 Reverse
ABCG8 Forward
ABCG8 Reverse
CETP Forward
CETP Reverse
ATAGCAGGCTCCAACCCTGAC
GGTACTGAAGCATGTTTCGATGTT
GCCTGGTGACACAGACTCTC
CAAACAGTTCCAACCCGGTG
TGATTGGCAGCTATAATTTTGGG
GTTGGGCTGCGATGGAAA
TGCTGGCCATCATAGGGAG
TCCTGATTTCATCTTGCCACC
AAGGGTGTCGTGGTCAGTTCT
ACTGATGATCTCGGGGTTGAT
CYP7A1 Forward CACTCTGCACCTTGAGGATGG
CYP7A1 Reverse GGGTCTGGGTAGATTGCAGG
NPC1L1 Forward CCTGACCTTTATAGAACTCACCACAGA
NPC1L1 Reverse GGGCCAAAATGCTCGTCAT
2
8