Salphen metal complexes as tunable G-quadruplex binders and optical probes

Article abstract of DOI:10.1039/c3ra44793f

A series of seven new metal complexes (metal = Ni^II, Cu ^II, Pt^II and VO²⁺) with substituted salphen ligands have been prepared and their duplex and G-quadruplex DNA affinities determined. The selectivity of the complexes towards a given DNA topology is dictated by several factors including geometry, overall charge and substitution pattern of the complex. We also show that the two platinum(II)-salphen complexes developed as part of this series are emissive. Confocal microscopy studies were carried out with these two complexes using four different cell lines (CHO, HeLa, U2OS and HepG2). These studies showed that the cell permeability and localization are different for the two probes and highly dependent on the cell line used.

Full text of DOI:10.1039/c3ra44793f

RSC Advances
View Article Online
View Journal | View Issue
PAPER
Salphen metal complexes as tunable G-quadruplex
binders and optical probes†
Cite this: RSC Adv., 2014, 4, 3355
Nurul H. Abd Karim,‡a Oscar Mendoza,‡a Arun Shivalingam,‡a
Alexander J. Thompson, Sushobhan Ghosh, Marina K. Kuimova and Ramon Vilar
a
a
a
ab
*
A series of seven new metal complexes (metal ¼ NiII, CuII, PtII and VO2+) with substituted salphen ligands
have been prepared and their duplex and G-quadruplex DNA affinities determined. The selectivity of the
complexes towards a given DNA topology is dictated by several factors including geometry, overall
charge and substitution pattern of the complex. We also show that the two platinum(II)–salphen
complexes developed as part of this series are emissive. Confocal microscopy studies were carried out
with these two complexes using four different cell lines (CHO, HeLa, U2OS and HepG2). These studies
showed that the cell permeability and localization are different for the two probes and highly dependent
on the cell line used.
Received 30th August 2013
Accepted 2nd December 2013
DOI: 10.1039/c3ra44793f
www.rsc.org/advances
phenyl groups of the ligand in this complex are nearly coplanar
yielding a practically at surface (with the potential of display-
Introduction
ing p–p stacking interactions). In contrast, the zinc(II) salphen
complexes20 have a considerably distorted square-based pyra-
midal geometry in which the phenyl rings of the ligand are
clearly not coplanar.
Two square planar metal–salphen complexes (1 and 2 – Fig. 2)
have been previously co-crystalized with quadruplex DNA and
their X-ray crystal structures determined.21 These studies showed
that 1 and 2 bind to the guanine quartet via end-stacking as had
been initially predicted.14 The crystal structures also highlighted
that the substituents on the metal–salphen core play an impor-
tant role in dening the exact binding geometry between the
metal complexes and G-quadruplex DNA. This in turn, is bound
Guanine-rich sequences of DNA can fold into quadruply-
stranded structures known as G-quadruplexes. Recently, these
non-canonical DNA structures have received signicant atten-
tion due to the increasing number of biological roles they have
been associated with.1–5 In addition, they have been proposed to
be alternative and attractive targets for the development of
anticancer drugs.6–8 Therefore, there is continuous interest in
developing small molecules (both organic9,10 and metal–
organic11) that can interact selectively with these structures and
in doing so interfere with biological processes such as gene
regulation6,12 and telomere maintenance.13
We have previously reported that metal–salphen complexes
can be very good G-quadruplex DNA binders.14,15 Their affinity
for a given topology of DNA is highly dependent on the overall
geometry of the complex as well as the nature of the salphens'
substituents. The geometry of these complexes is largely
dened by the metal center as highlighted in Fig. 1 which shows
the molecular structure of several metal–salphen complexes for
which the X-ray crystal structures have been previously deter-
mined. In the case of nickel(II),16 copper(II)17 and platinum(II),18
the coordination geometry around the metal cation is square
planar. On the other hand, with vanadium(IV),19 the resulting
complexes have a square-based pyramidal geometry with an oxo
ligand in the axial position. It is worthwhile noting that the
aDepartment of Chemistry, Imperial College London, South Kensington, London SW7
2AZ, UK. E-mail: r.vilar@imperial.ac.uk
bInstitute of Chemical Biology, Imperial College London, South Kensington, London
SW72AZ, UK
† Electronic supplementary information (ESI) available. See DOI:
10.1039/c3ra44793f
‡ These authors contributed equally to the paper.
Fig. 1 X-ray structures of a series of analogous metal salphens.16–20
RSC Adv., 2014, 4, 3355–3363 | 3355
This journal is © The Royal Society of Chemistry 2014

View Article Online
RSC Advances
Paper
synthesized as shown in Scheme 1 and characterized by spec-
troscopic and analytical techniques (see Experimental section
for details).
A second approach to increase the selectivity of salphen
complexes for quadruplex vs. duplex DNA was investigated. This
was based on the complexes' functionalization with groups that
are negatively charged at physiological pH. The rationale was
that this would in principle reduce non-specic electrostatic
interactions with DNA (which is negatively charged) and direct
the compound to the topology with which other non-covalent
interactions such as p–p stacking were more favorable. Thus,
complexes 7–9 with either one or two sulphonate groups were
prepared as shown in Schemes 2 and 3. In complex 7 two propyl-
sulphonate groups (instead of ethyl piperidine) were attached
yielding
a complex with an overall negative charge. In
complexes 8 and 9 a sulphonic group was introduced in the
ligand's backbone while maintaining two piperidine substitu-
1
ents. These three complexes were characterized by H and 13C
NMR spectroscopies which showed the expected number of
signals with the right chemical shi and integration for each of
the compounds (see Experimental details). The formulations
and purity of the compounds were further conrmed by mass
spectrometry and elemental analyses.
Fig.
2 Structures of metal–salphen complexes under study.
Complexes 1 and 2 have been previously reported and shown by X-ray
crystallography to bind to quadruplex DNA via end-stacking.21
Complexes 3–9 are new compounds that are the focus of the current
study.
Interaction of metal complexes with DNA
to have a bearing on the affinity and selectivity of the molecules
towards a given topology of DNA. Thus, we decided to expand our
investigations to study more systematically the effect of different
substituents as well as the metal center on the quadruplex DNA
binding properties of metal salphen complexes. Herein we report
a series of seven new metal complexes with substituted salphen
ligands and their duplex and G-quadruplex DNA affinities. We
also show that the platinum(II) complexes developed as part of
this series are emissive (as previously reported for other plati-
num(II) salphens22) and cell permeable, which have allowed us to
carry out confocal microscopy studies.
In order to establish the affinity of the new metal–salphen
complexes towards HTelo quadruplex DNA, Fluorescence
Resonance Energy Transfer (FRET) melting assays were carried
out using the doubly-labeled oligonucleotide 50-FAM-
d(GGGTTAGGGTTAGGGTTAGGG)-TAMRA-30 (where FAM
¼
uorescein and TAMRA ¼ tetramethylrhodamine).23 The DTm
values (see Table 1) show that the tri-ethylpiperidine square
planar complexes 3–5 are excellent HTelo quadruplex binders;
these are followed by the square planar sulphonate-substituted
complexes 8 and 9 (which also show considerable quadruplex
stabilization). The square pyramidal complex 6 and the nega-
tively charged complex 7 show only a modest DTm, as expected
considering their geometry and charge.
Results and discussion
Synthesis of metal–salphen complexes
FRET competition assays were carried out for complexes 3, 6
The metal–salphen complexes shown in Fig. 2 were synthesized and 8 (as representatives of the series) to investigate their
as outlined in Schemes 1–3. In a rst series of complexes (3–6) selectivity for HTelo quadruplex vs. duplex DNA. Complex 3 was
three ethyl-piperidine substituents were added to nickel(II), selected as an example to probe the square planar tri-ethyl-
copper(II), platinum(II) and vanadyl–salphen cores. This type of piperidine complexes (3–5). Complex 6 (also a tri-ethyl-
substituent is well documented to confer enhanced quadruplex piperidine metal complex) has a square-based pyramidal
DNA binding properties to planar molecules. We have previ- structure and therefore it was of interest to investigate whether
ously synthesized several metal–salphen complexes containing having only one planar ‘face’ would improve its selectivity for
two ethyl-piperidine substituents.15 The interest in adding a quadruplex vs. duplex DNA. The third compound investigated
third substituent to the ligand was to maximize the possible by FRET competition assays was complex 8 which features a
contacts of the resulting complexes with quadruplex DNA's negatively-charged sulfonate group and hence might display a
grooves and loops. In addition, we rationalized that having a different selectivity prole than e.g. complex 3 – the overall
substituent on each of the three phenyl rings of the salphen, charge of complex 8 at physiological pH is 1+ while that of
would reduce the possibility of the resulting metal complexes complex 3 is 3+. In the FRET competition assays the DTm of
intercalating with duplex DNA and therefore enhance their HTelo quadruplex DNA (0.4 mM) was measured for a xed
quadruplex selectivity. The third piperidine substituent was concentration of metal complex (1 mM) in the presence of an
also found to increase considerably the water solubility of the increasing amounts of ct-DNA (from 0 to 120 mM). These studies
salphen complexes. These four complexes (3–6) were (see Fig. 3) show that while the tri-ethylpiperidine complex 3 has
3356 | RSC Adv., 2014, 4, 3355–3363
This journal is © The Royal Society of Chemistry 2014

View Article Online
Paper
RSC Advances
Scheme 1 Synthetic route for the preparation of complexes 3–6.
Table 1 DTm (ꢀC) determined by FRET of F21T-HTelo quadruplex DNA
upon addition of 1 mM complex (3–9). Values are average of three
independent measurements
Comp.
DTm (ꢀC)
3
4
5
6
7
8
9
26.8 ꢁ 1.5
22.9 ꢁ 1.0
25.4 ꢁ 1.0
6.4 ꢁ 0.9
5.2 ꢁ 1.0
17.4 ꢁ 0.2
15.9 ꢁ 0.2
Scheme 2 Synthetic route for the preparation of complex 7.
the highest affinity for quadruplex HTelo DNA, its selectivity is
not as good as that of the other two compounds. The square-
based pyramidal complex 6 shows a relatively low quadruplex
affinity but it is highly selective since the DTm of HTelo quad-
ruplex DNA in the presence of this compound does not change
even if a large excess of ct-DNA is added. As per complex 8, it
shows high affinity and selectivity for HTelo quadruplex DNA.
These results highlight the importance of the compounds'
Scheme 3 Synthetic route for the preparation of complexes 8 and 9.
This journal is © The Royal Society of Chemistry 2014
RSC Adv., 2014, 4, 3355–3363 | 3357

View Article Online
RSC Advances
Paper
To assess more accurately the selectivity of complex 9
towards DNA, we determined the binding constants of this
complex for HTelo and c-myc quadruplex DNA as well as ds26
duplex DNA. This was done by titrating complex 9 with
increasing amounts of the corresponding oligonucleotide (see
ESI† for titration plots) to give the following values: K ¼ 0.99 ꢁ
0.07 ꢂ 105 (c-myc); 1.15 ꢁ 0.23 ꢂ 105 (HTelo); 2.98 ꢁ 0.28 ꢂ 103
(ds26).
Confocal microscopy
Once the spectroscopic properties of complexes 5 and 9 were
established, we were interested in determining via confocal
microscopy whether they are cell permeable and, if so, what
their cellular localization is. For this, complexes 5 and 9 (at
concentrations between 0.5 and 16 mM) were incubated with the
following cell lines: Chinese Hamster Ovary (CHO), human
osteosarcoma (U2OS), human cervical cancer (HeLa) and
human hepatocellular carcinoma (HepG2) for up to 24 hours
and confocal microscopy images recorded. Interestingly, some
differences in uptake and localization were observed depending
on the cell line used. Neither of the two platinum(II) complexes
Fig. 3 Plot of DTm of F21T-HTelo upon addition of 1 mM concentration
of complex 3, 6 or 8 and increasing concentration of CT DNA (0–120
mM). Results shown are average of three independent measurements.
geometry and substitution pattern in dening their selectivity
and affinity for quadruplex DNA.
Emission studies
Several metal complexes have been previously reported to were taken up by U2OS cells under the experimental conditions
change their optical properties upon binding to quadruplex used. For the other three cell lines, we observed that complex 5
nucleic acids.22,24–29 An interesting feature of the platinum(II) was readily taken up while complex 9 was only partially cell
complexes 5 and 9 is that they are luminescent and their permeable aer long incubation times. We have also observed
emission in aqueous solution is greatly enhanced upon addi- variations in the localization of the complexes in the different
tion of DNA. Therefore, these complexes were further investi- cell lines. With HeLa cells, complex 5 was shown to localize
gated by emission spectroscopy in the presence of different mainly in the nucleus, more specically in the nucleoli (see
oligonucleotides. We rst recorded the emission of the Fig. 5(a and b)). Co-staining experiments using the nuclear dye
complexes (in aqueous buffered solution) upon addition of 10 DRAQ5 were carried out which conrmed the cellular local-
equivalents of several quadruplex-forming oligonucleotides isation of the probe (Fig. 5(c and d)).
(namely G-rich sequences in the promoter regions of proto-
Complex 5 was also taken up by CHO cells where strong
oncogenes c-myc, c-kit1 and c-kit2, telomeric DNA (hTelo) and uorescence was observed from the nuclei (Fig. S4†). The
modied telomeric DNA 21CTA – for the specic sequences, see nuclear uorescence in CHO cells appeared homogeneous
Experimental details) as well as duplex DNA (ds26) and a 25- rather than specically localized in nucleoli as was the case with
base singly-stranded oligonucleotide (poly(dT)25). In all cases, HeLa cells. Interestingly, staining of HepG2 cells with 5 shows
an increase in the emission intensity was observed (see Fig. 4). that, while the compound is also taken up readily by the cells,
While complex 5 is not selective for any given DNA topology its localization is different (see Fig. S5†). The compound accu-
(Fig. 4(a)), complex 9 showed to have some selectivity for mulates in small pockets outside the nucleus and co-staining
quadruplex structures over duplex and singly-stranded DNA experiments with DRAQ5 indicate that the two dyes co-localize
(Fig. 4(b)).
in these pockets.
Fig. 4 Bar chart depicting the enhancement in the emission of complex 5 (a) and 9 (b) (in Tris–KCl buffer) upon addition of 10 equivalents of
several DNA quadruplex (hTelo, c-myc, c-kit1, c-kit2 and 21CTA) duplex (ds26) and ssDNA (polyT) respectively.
3358 | RSC Adv., 2014, 4, 3355–3363
This journal is © The Royal Society of Chemistry 2014

View Article Online
Paper
RSC Advances
Fig.
5 Fluorescence microscopy of live HeLa cells stained with
complex 5 (10 mM, 30 min incubation). (a) shows the transmitted light
image, (b) is the fluorescence intensity image, (c) shows DRAQ5
nuclear staining (5 mM) and (d) represents the merge of the three
channels. Clear fluorescence is seen in the nucleus of all cells indi-
cating that the dye localises to this region and becomes fluorescent in
the presence of DNA. Scale bar 20 microns.
As indicated above, in contrast to 5, complex 9 showed to
have only limited cell permeability with CHO, HeLa and HepG2.
The low levels of 9 that are taken up by these three cell lines
show some nuclear localization (see Fig. 6, S6 and S7† for CHO,
HeLa and HepG2 cells respectively). As can be seen in Fig. 6, two
distinct staining regimes were observed. Fig. 6(a–c) respectively
show transmitted light, uorescence and merged images for the
rst – and most common – staining regime where dim uo-
rescence is observed in discrete regions of the cytoplasm and no
uorescence is seen in the nucleus. This implies that the
compound is taken up by the cells but cannot penetrate the
nuclear membrane. Hence, it does not encounter any oligonu-
cleotides and, as such, does not become uorescent. The
second type of staining observed is documented in Fig. 6(d–f).
In this case the dye has reached the nucleus and uorescence is
observed in the nucleoli, suggesting some selective location in
Fig. 6 Confocal microscopy images of live CHO cells stained with
complex 9, showing transmitted light images (a and d), fluorescence
intensity images (b and e) and merged fluorescence and transmission
images (c and f). (a–c) show two healthy cells with dim fluorescence
mainly emanating from discrete regions within the cytoplasm. Most
cells observed exhibited staining similar to this. (d–f) show images of a
single cell with nuclear staining. In this case the dye has reached the
nucleus. Scale bar for (a–c) 10 microns and for (d–f) 7.5 microns.
and not simply to the entire nucleus equally. Indeed, this was
also the case with complex 5 in HeLa but not in CHO cell line.
Conclusions
these small regions of the nucleus. The uorescence is Seven new salphen-based metal complexes have been prepared,
considerably more intense than in the rst staining regime characterized and their DNA affinities studied. The affinity of
(Fig. 6(a–c)) and we note that the transmission images appear these complexes towards HTelo quadruplex DNA is determined
dimmer in Fig. 6(d–f) solely because the laser power was by the geometry around the metal center with the square planar
reduced in this case due to the increased uorescence intensity. complexes (Ni, Cu and Pt) having the higher affinities. Inter-
This second type of staining was less common than the rst type estingly, the vanadyl complex with a square-based pyramidal
and it is worth noting that the cell shown in Fig. 6(d–f) appears structure, while it has a lower affinity towards quadruplex than
less viable than the cells presented in Fig. 6(a–c). Thus, it may be the analogue square planar complexes, it displays higher
the case that complex 9 can only penetrate the nuclear selectivity for quadruplex over duplex DNA – as we reported
membrane and reach the nucleus when the cells are beginning previously for another vanadyl complex.15 This is likely to be a
to undergo apoptosis (likely due to the cytotoxicity of the consequence of the axial ligand which would prevent easy
compound itself) and the permeability of the nuclear intercalation into duplex DNA but still allow the complex to
membrane is starting to increase. Despite this, it is still inter- interact by end-stacking (using its one planar face) with a
esting to note that complex 9 locates specically to the nucleoli guanine tetrad. Our results also show that the nature and
This journal is © The Royal Society of Chemistry 2014
RSC Adv., 2014, 4, 3355–3363 | 3359

View Article Online
RSC Advances
Paper
number of substituents on the salphen, play an important role cm path-length quartz cuvettes. The emission spectra were
in dening the affinity and selectivity of the resulting recorded on a Varian Cary Eclipse Spectrometer. Spectra were
complexes.
A particularly interesting observation is the smoothed using the Savitzky–Golay algorithm and emission
increased selectivity of complexes 8 and 9 (with a negatively maxima were tted to 1 : 1 binding model using the Levenberg–
charged sulfonate group in the ligand backbone) for quadruplex Marquardt algorithm and equations reported previously by
over duplex DNA as compared to the complexes with no sulfo- Thordarson in Matlab 7.12.0.30
nate and either two or three ethyl-piperidino substituents. An
interesting feature of the platinum(II) complexes is that they are
highly emissive under the right conditions. This was success-
fully used to investigate their DNA binding prole and study
their cellular uptake and localization by confocal microscopy.
These studies showed that both 5 and 9 are taken up by cells
(CHO, HeLa and HepG2) and localize in the nucleus (in CHO
and HeLa cell lines); this is more prominent in the case of
complex 5 – with three ethyl-piperidino groups. It is likely that
the negative charge on the sulfonate group of 9 reduces its
ability to cross biological membranes and therefore is not taken
up by cells as readily as complex 5. Further studies are currently
underway to modify this platinum(II) complex (which is selective
for quadruplexes) to increase its affinity as well as cell
permeability.
Determination of quantum yields
Complex 5 and 9 absorption and emission spectra were
measured in 50 mM Tris–HCl (pH 7.4) buffer containing 100
mM KCl. The absorbance at 436 nm was plotted against the
integrated emission intensity from 530 to 800 nm and tted to
the equation y ¼ mx + c (R2 > 0.98) for both complexes and the
reference [Ru(bpy)3]Cl2 (aerated water f ¼ 0.028).31 Absorbance
above the excitation wavelength was kept below 0.1. Quantum
yields were determined by the equation fx ¼ fref(mx/mref). The
absorbance and emission spectra were recorded on Perkin-
Elmer UV-vis and Horiba Jobin Yvon Fluorolog spectrometers. f
(complex 5, lex ¼ 436 nm; lex ¼ 602 nm) ¼ 0.0019 and f
(complex 9, lex ¼ 436 nm; lex ¼ 572 nm) ¼ 0.0007.
FRET assay
Experimental details
General
Labelled DNA F21T-HTelo was dissolved as a 20 mM stock
solution in MilliQ water, then annealed as a 400 nM concen-
tration in 60 mM potassium cacodylate buffer (pH 7.4) at 95 ꢀC
for 5 min, and allowed to cool slowly to room temperature
overnight. Compounds were dissolved from stock solutions (see
above) to nal concentrations in the buffer. Each well of a 96-
well plate (Applied Biosystem) was prepared with 40 mL, with a
nal 200 nM DNA concentration and increasing concentration
of tested compound (0–4 mM). Measurements were performed
on a PCR Stratagene Mx3005P (Agilent Technologies) with
excitation at 450–495 nm and detection at 515–545 nm. Read-
ings were taken from 25 C to 95 ꢀC at interval of 0.7 C main-
taining a constant temperature for 30 seconds before each
reading. Each measurement was done in triplicate. The nor-
malised uorescence signal was plotted against the compound
concentration and the DTm for 1 mM compound concentration
were determined.
The oligonucleotides 21CTA (50-GGGCTAGGGCTAGGGC-
TAGGG-30), c-kit1 (50-GGGAGGGCGCTGGGAGGAGGG-30), c-kit2
(50-GGGCGGGCGCGAGGGAGGGG-30) and calf thymus DNA
were purchased from Sigma Aldrich. H-telo DNA, (50-AGGGT-
TAGGGTTAGGGTTAGGG-30),
GAGGGTGGG-30),
ds26
c-myc
(50-CAATCGGATCGAATTCGATCC
(50-GGGGAGGGTGGG-
GATTG-30) and polyT (50-T25-30) were purchased from Euro-
gentec. The labelled F21T oligo (50-FAM GGGTTAGGGT-
TAGGGTTAGGG-TAMRA-30) was purchased from IBA. Test
compounds were dissolved in a mixture of DMSO (95% by
volume) and 1 mM HCl aqueous solution (5% by volume) to give
10 mM stock solutions. All solutions were stored at ꢃ20 ꢀC and
defrosted and diluted immediately before use. Prior to use, the
compounds were diluted to 1 mM using DMSO. This was then
further diluted using suitable buffer to the appropriate
concentrations.
ꢀ
ꢀ
FRET competition assay
F21T-HTelo (see above) was annealed as a 400 nM concentra-
tion in 60 mM potassium cacodylate buffer (pH 7.4) at 95 ꢀC for
5 min, and allowed to cool slowly to room temperature over-
night. Compounds were dissolved from stock solutions (see
above) to nal concentrations in the buffer. Each well of a 96-
well plate (MJ Research, Waltham, MA) was prepared with a
nal 200 nM oligo concentration, 1 mM compound concentra-
tion, and the ct-DNA concentration to test (0 to 120 mM).
Measurements were performed under the same conditions as
the FRET melting assay.
Emission titrations
The corresponding DNA (i.e. c-myc, HTelo and ds26) was dis-
solved in 50 mM Tris–HCl (pH 7.4) buffer containing 100 mM
KCl and annealed at 95 ꢀC for 5 min before cooling to room
temperature overnight. The concentration of DNA was checked
using the molar extinction coefficients 216 900, 228 500 and
6600 dm3 molꢃ1 cmꢃ1 for c-myc, HTelo and ds26 respectively.
Annealing concentrations were approximately 1 mM for c-myc
and HTelo. For emission titrations, complex 9 (10 mM) in the
same buffer was titrated with the corresponding DNA until
saturation of uorescence. Strand concentration was used for c-
myc and HTelo whilst ds26 was considered in base pair
Cell culture
concentration. The emission spectra were recorded between HeLa, HepG2 and U2OS cells were grown in Dulbecco's modi-
460 and 750 nm with an excitation wavelength of 440 nm in 1 ed Eagle medium (DMEM) containing 10% fetal bovine serum
3360 | RSC Adv., 2014, 4, 3355–3363
This journal is © The Royal Society of Chemistry 2014

View Article Online
Paper
RSC Advances
ꢀ
(FBS) at 37 C with 10% CO2 in the air. For microscopy, cells MHz, CDCl3): d 24.0, 25.8, 55.0, 57.3, 68.0, 111.1, 117.2, 127.5,
were seeded at 2 ꢂ 104 in 200 mL per well (0.8 cm2) in phenol red 134.2, 145.4, 163.1. ESI(+)-MS m/z calcd for C13H17N3O5: 295.29
free media. For 24 h treatments, aer cell adhesion (6 h) the a.m.u.; found 296 a.m.u. corresponding to [M + 1]+.
medium was replaced with complexes 5 or 9 diluted at the
Synthesis of 3,4-diamino-1-(2-(piperidin-1-yl)ethoxy)benzene
specied concentration in phenol red-free medium (200 mL). (11). Compound 10 (0.160 g, 0.50 mmol) was rst dissolved in
For 30 min treatments, the media was replaced 28 h aer 40 mL degassed EtOH under nitrogen. Palladium on carbon
seeding with complexes 5 or 9 diluted at the specied concen- (0.050 g, 0.01 mmol) was added to this solution. NH2NH2$H2O
tration in phenol red-free medium (200 mL). Prior to imaging, (0.18 mL, 3.70 mmol) was slowly added to it and the reaction
the cells were washed with PBS and fresh phenol red free media mixture was stirred at reux for 48 h. The solvent and excess of
was added. Cells were co-stained by aspirating the medium and NH2NH2 were removed under reduced pressure to obtain 11 as
replacing with the DRAQ-5 (5 mM, 200 ml, PBS) for 10 min.
green oil. Yield: 0.10 g, 85.0%. 1H NMR (400 MHz, CDCl3): d
CHO cells were grown in serum-free Ham's F-12 Nutrient Mix 1.43–1.49 (br, 2H, piperidine-H), 1.60–1.65 (br, 4H, piperidine-
(Invitrogen) at 37 ꢀC with 10% CO2 in the air. Cells were H), 2.52 (br, 4H, piperidine-H), 2.76 (t, 3J ¼ 6 Hz, 2H, –CH2N–),
transferred to the chambers of an 8-well plate (Lab-Tek 4.04 (t, 3JHH ¼ 6 Hz, 2H, –CH2O–), 6.27 (dd, 3JHH ¼ 8.4 Hz, 4JHH
Chamber Slide System, Nunc, Denmark) in a density of 10 000 2.4 Hz, 1H, ArH), 6.35 (d, 4JHH ¼ 2.4 Hz 1H, ArH), 6.64 (d, 4JHH
¼
¼
cells per well. Aer 6 h incubation for adhesion, the media was 8.4 Hz, 1H, ArH). 13C NMR (400 MHz, CDCl3): d 23.7, 25.2, 54.8,
replaced with complexes 5 and 9 diluted at the specied 57.7, 65.5, 103.7, 105.0, 118.2, 127.7, 137.0, 153.3. ESI(+)-MS m/z
concentration in Ham's F-12 media (200 mL) and then, cells were calcd for C10H10O3: 235.3 a.m.u.; found 236 a.m.u. corre-
incubated for 24 h.
sponding to [M + 1]+.
Synthesis of N,N0-bis[4-[[1-(2-ethyl)piperidine]oxy]salicyli-
dene]-4-(2-(piperidin-1-yl)ethoxy)-1,2-phenylenediamine-nick-
el(II) (3). Compound 12 (0.479 g, 1.9 mmol) and 11 (0.226 g, 1.0
mmol) were dissolved in ethanol and heated at reux for 1 h.
Ni(OAc)2$4H2O (0.239 g, 1.0 mmol) was then added to this
solution and the reaction mixture was reuxed for another 3 h.
The solvent was removed under reduced pressure yielding a red
solid. The solid was then recrystallised from CH2Cl2–pentane to
Cellular imaging
Cells were imaged using a confocal uorescence microscope
(TCS SP5 Confocal, Leica Microsystems GmbH, Germany). A
variety of complex concentrations were tested in every well in
order to ascertain the optimal conditions for cell imaging (0,
0.5, 4, 8 and 16 mM). Aer incubation, the cells were washed
with PBS and 8-well plate then mounted on the microscope.
1
yield 3 as a dark red solid. Yield: 0.74 g, 98.0%. H NMR (400
MHz, CDCl3): d 1.52 (br, 6H, piperidine-H), 1.70 (br, 12H,
Using
a
63ꢂ magnication microscope objective (water
immersion, NA ¼ 1.2) and an excitation wavelength of 458 nm,
images of the cells were recorded in both transmission and
uorescence modes. For the uorescence images, the detection
band was 525–700 nm, which covered the entire emission range
of these metal complexes.
piperidine-H), 2.67 (br, 12H, piperidine-H), 2.93 (br, 6H,
3
–CH2N–), 4.18 (br, 6H, –CH2O–), 6.28 (d, JHH ¼ 9.2 Hz, 1H,
ArH), 6.30 (d, 3JHH ¼ 8.4 Hz, 1H, ArH), 6.56 (s, 2H, ArH), 6.74 (d,
3JHH ¼ 8 Hz, 1H, ArH), 7.13 (d, 3JHH ¼ 9.2 Hz 1H, ArH), 7.15 (s,
3
3
1H, ArH), 7.21 (d, JHH ¼ 8.8, 1H, ArH), 7.56 (d, JHH ¼ 9.2 Hz,
1H, ArH), 7.90 (s, 1H, –CH]N–), 8.01 (s, 1H, –CH]N–). 13C
NMR (400 MHz, CDCl3): d 54.4, 54.6, 57.0, 57.1, 65.1, 65.2, 65.7,
General procedures for characterization of compounds
1H NMR and 13C NMR spectra were recorded on either a Bruker 99.54, 103.12, 108.2, 108.8, 113.5, 114.6, 114.8, 114.9, 134.0,
Avance 400 MHz Ultrashield NMR spectrometer or a Bruker 134.4, 136.6, 143.6, 151.2, 152.5, 157.6, 157.8, 164.2, 164.7,
Avance 500 MHz NMR spectrometer. Mass spectrometric anal- 167.3, 168.3. IR (cmꢃ1): 1581 (C]N), 1182 (C–O), 2924 (CH2–),
ysis was performed under either ESI+ or ESIꢃ condition on a 2850 (CH–O), 1431 (C]C), 1121 (C]C), 1371 (C]C). ESI(+)-MS
LCT Premier mass spectrometer. IR spectra were recorded on a m/z calcd for C41H53N5O5Ni: 754.58. Found: 754.44. Anal. calcd
Perkin-Elmer Spectrum 100 FT-IR spectrometer. Compounds for C41H53N5O5Ni$CH2Cl2: C, 60.09 H, 6.60 N, 8.34. Found: C,
12, 13 and 3,4-diaminophenyl sulfonic acid were prepared 60.50 H, 6.81 N, 8.55%.
following previously reported procedures.14,15,32
Synthesis of N,N0-bis[4-[[1-(2-ethyl)piperidine]oxy]salicyli-
Synthesis of 1-(2-(piperidin-1-yl)ethoxy)-3,4-dinitrobenzene dene]-4-(2-(piperidin-1-yl)ethoxy)-1,2-phenylenediamine-cop-
(10). 3,4-Dinitrophenol (1.250 g, 6.8 mmol), 1-(2-chloroethyl) per(II) (4). Compounds 12 (0.439 g, 1.8 mmol) and 11 (0.207 g,
piperidine hydrochloride (1.499 g, 8.2 mmol) and K2CO3 (1.576 0.9 mmol) were dissolved in ethanol and heated to reux for 1 h.
g, 11.4 mmol) were heated at 100 ꢀC under N2 in acetonitrile for Cu(OAc)2$H2O (0.176 g, 0.9 mmol) was then added to this
4 h. Aer that time, the solvent was removed under reduced solution and the reaction mixture was reuxed for another 3 h.
pressure. The crude was then puried through column chro- The solvent was removed under reduced pressure to yield a dark
matography using mixture of CHCl3 : ethanol 9 : 1 on silica to green solid. The solid was then recrystallised from CHCl3–
1
obtain 10 as an orange oil. Yield: 1.04 g, 51.9%. H NMR (400 hexane to give 4 as dark green solid. 0.379 g, 56%. ESI(+)-(MS)
MHz, CDCl3): d 1.48–1.51 (br, 2H, piperidine-H), 1.60–1.66 (br, m/z calcd for C41H53N5O5Cu: 759.4; found: 759.4 a.m.u. IR
4H, piperidine-H), 2.52–2.53 (br, 4H, piperidine-H), 2.81 (t, 3JHH (cmꢃ1): 1581 (C]N), 1187 (C–O), 2928 (CH2–), 2854 (CH–O),
3
¼ 6 Hz, 2H, –CH2N–), 4.24 (t, JHH ¼ 6 Hz, 2H, –CH2O–), 7.16 1430 (C]C), 1121 (C]C), 1372 (C]C). Anal. calcd for
3
4
4
(dd, JHH ¼ 8.8 Hz, JHH ¼ 2.4 Hz 1H, ArH), 7.81 (d, JHH ¼ 2.4
C41H53N5O5Cu$CHCl3: C, 57.40 H, 6.19 N, 7.97. Found: C, 57.22
Hz, 1H, ArH), 8.05 (d, JHH ¼ 8.8 Hz, 1H, ArH). 13C NMR (400 H, 6.62 N, 7.59%.
3
This journal is © The Royal Society of Chemistry 2014
RSC Adv., 2014, 4, 3355–3363 | 3361

View Article Online
RSC Advances
Paper
Synthesis of N,N0-bis[4-[[1-(2-ethyl)piperidine]oxy]salicyli-
dene]-4-(2-(piperidin-1-yl)ethoxy)-1,2-phenylenediamine-plati-
num(II) (5). Compounds 12 (0.200 g, 0.8 mmol) and 11 (0.095 g,
0.4 mmol) were dissolved in ethanol and heated at 60 ꢀC for 4 h.
Aerward, the solvent was removed under reduced pressure.
Acetonitrile (40 mL) was added to this solid and the resulting
reaction mixture was stirred for 5 min. Sodium acetate as a solid
and K2PtCl4 (0.168 g, 0.4 mmol) in DMSO (2 mL) were added to
the solution. The reaction mixture was heated to 40 ꢀC for 24 h.
The solvent was removed under reduced pressure to and the
resulting solid was recrystallised from CH2Cl2–pentane to give 5
108.0, 115.2, 116.0, 127.1, 135.6, 142.7, 154.7, 165.21, 167.8.
ESI(+)-MS m/z calcd ESI(+)-MS m/z calcd for C26H24K2N2NiO10S2:
724.0; found 763.0 a.m.u. corresponding to [M + K]+. Anal. calcd
for C26H24K2N2NiO10S2$2.5H2O: C, 40.53; H, 3.79; N, 3.64.
Found: C, 40.35; H, 3.71; N, 3.87%.
Synthesis of N,N0-bis[4-[[1-(2-ethyl)piperidine]oxy]salicylidene]-
4-sulfonic-1,2-phenylenediamine-nickel(II) (8). Compound 12
(0.381 g, 1.5 mmol) and 3,4-diaminophenyl sulfonic acid (0.130 g,
0.7 mmol) were dissolved in ethanol and heated at reux for 1 h.
Ni(OAc)2$4H2O (0.378 g, 1.5 mmol) was then added to the solution
and the reaction mixture was reuxed for another 3 h. The solvent
was removed under reduced pressure to yield a red solid. The solid
was then washed with ethanol, CH2Cl2 and diethyl ether to give 8
as an orange solid. Yield: 0.42 g, 85.0%. 1H NMR (400 MHz,
DMSO-d6): d 1.48 (br, 4H, piperidine-H), 1.65 (br, 8H, piperidine-
H), 2.52 (br, 12H, piperidine-H), 4.24 (br, 4H, –CH2O–), 6.32–6.39
(m, 4H, ArH), 7.48–7.52 (m, 2H, ArH), 7.68 (d, 3JHH ¼ 8.6 Hz, 1H,
ArH), 7.98 (d, 3JHH ¼ 8.7 Hz, 1H, ArH), 8.23 (s, 1H, ArH), 8.68 (s, 1H,
–CH]N–), 8.74 (s, 1H, –CH]N–). 13C NMR (400 MHz, DMSO-d6):
d 22.5, 23.8, 53.5, 101.7, 107.4, 112.6, 114.8, 115.2, 124.2, 135.3,
135.7, 141.7, 142.2, 154.8, 167.2. ESI(ꢃ)-MS m/z calcd for
C34H39N4NiO7S: 705.19. Found: 705.0 a.m.u. Anal. calcd for
C34H40N4NiO7S$1.5H2O: C, 55.60; H, 5.90; N, 7.63. Found C, 55.55;
H, 5.81; N, 7.52%.
1
as a dark red solid. Yield: 0.055 g, 17.0%. H NMR (400 MHz,
DMSO-d6): d 1.4 (m, 6H, piperidine-H), 1.50–1.54 (m, 12H,
piperidine-H), 2.50–2.52 (m, 12H, piperidine-H), 2.73 (br, 6H,
–CH2N–), 4.14–4.18 (m, 4H, –CH2O–), 4.22 (t, 3JHH ¼ 5.6 Hz, 2H,
4
–CH2O–), 6.43–6.48 (m, 2H, ArH), 6.56 (d, JHH ¼ 2.4 Hz, 1H,
ArH), 6.57 (d, 4JHH ¼ 2.4 Hz, 1H, ArH), 7.55 (d, 3JHH ¼ 9.2 Hz, 1H,
ArH), 7.67 (d, 3JHH ¼ 8.8 Hz, 1H, ArH), 7.73 (d, 3JHH ¼ 9.2 Hz, 1H,
ArH), 7.88 (s, 1H, ArH), 8.23 (d, 3JHH ¼ 9.2 Hz, 1H, ArH), 9.12 (s,
1H, –CH]N–), 9.28 (s, 1H, –CH]N–). IR (cmꢃ1): 1580 (C]N),
1179 (C–O), 2928 (CH2–), 2831 (CH–O), 1421 (C]C), 1125 (C]
C), 1373 (C]C). ESI(+)-MS m/z calcd for C41H53N5O5Pt: 890.97;
found: 891.0 a.m.u. Anal. calcd for: C41H53N5O5Pt$2CH2Cl2: C,
48.68; H, 5.42; N, 6.60; found: C, 48.91; H, 5.75; N, 6.14%.
Synthesis of N,N0-bis[4-[[1-(2-ethyl)piperidine]oxy]salicyli-
dene]-4-(2-(piperidin-1-yl)ethoxy)-1,2-phenylenediamine-vana-
dium(II) (6). To a mixture of 12 (0.500 g, 2 mmol) and 11 (0.235 g,
1 mmol) methanol (10 mL) was added and the resulting mixture
was reuxed for 1 h. When the solution became yellow a solu-
tion of vanadium sulphate (0.163 g, 1 mmol) in water and
triethyl amine (0.3 mL) were added to the reaction mixture. The
resulting mixture was kept for reux for another 3 h. Aer this
time, the green precipitate formed was ltered and washed with
water to give 6 as a yellow-green solid. Yield: 0.609 g, 80%. IR
(cmꢃ1): 1606 (C]N); 1575 (Ar); 960 (V]O). ESI MS calcd for
Synthesis of N,N0-bis[4-[[1-(2-ethyl)piperidine]oxy]salicyli-
dene]-4-sulfonic-1,2-phenylenediamine-platinum(II) (9). 3,4-
Diaminophenyl sulfonic acid (0.096 g, 0.5 mmol) and 2,4-
dihydroxybenzaldehyde (0.140 g, 1 mmol) were suspended in
ethanol–methanol (1 : 1, 10 mL) and heated to reux for 3 h.
Aer cooling to room temperature, a yellow solid formed which
was recovered by ltration and washed with MeCN (mass of
crude product: 0.178 g). A portion of these solid (0.080 g) was
then added to a suspension of K2PtCl4 (0.095 g, 0.2 mmol) and
sodium acetate (0.075 g, 0.9 mmol) in DMSO–MeCN (1 : 10, 11
mL) and heated to 76 ꢀC for 24 h. Aer cooling to room
temperature, an orange solid was recovered by ltration and
washed with MeCN. The crude product (0.118 g), 1-(3-chlor-
oethyl)piperidine hydrochloride (0.070 g, 0.4 mmol) and Cs2CO3
(0.154 g, 0.5 mmol) were placed under an inert atmosphere
before the addition of dry DMF (15 mL). The reaction was stirred
C
41H53N5O6V: 762.34. Found: 763.0 a.m.u. Analysis calculated
for C41H53N5O6V: C, 64.55; H, 7.00; N, 9.18; found: C, 64.91; H,
7.03; N, 9.36%.
Synthesis of N,N0-bis[4-[[1-(2-propyl)sulfonic]oxy]salicyli-
dene]-1,2-phenylenediamine-nickel(II) (7).
A suspension of
ꢀ
for 72 h at 30 C. The solution was ltered and the ltrate was
complex 13 (0.483 g, 1.2 mmol), 3-bromopropanesulfonic acid
evaporated to dryness. The resultant solid was washed with
dichloromethane, acetone, acetonitrile and hexane to give 9 as a
red solid. Yield: 0.031 g, 18% (overall yield calculated with
respect to 3,4-diaminophenyl sulfonic acid). IR (neat) 1181 and
1035 (st asymmetric and symmetric, Ar-SO3ꢃ), 1598 and 1571
(st, C]N), 2792 (br st, N–H+), 3432 (br st, HO–H) cmꢃ1. 1H NMR
(400 MHz, DMSO-d6): d 1.24 (s, 1H, piperidine-H), 1.33–1.44 (m,
4H, piperidine-H), 1.46–1.58 (m, 7H, piperidine-H), 2.36–2.50
(br, 8H, piperidine-H), 2.69 (t, J = 5.7 Hz, 4H, –CH2N–), 4.17 (t,
J ¼ 5.7 Hz, 4H, –CH2O–), 6.43 (dd, J ¼ 9.1, 2.2 Hz, 1H, ArH), 6.47
(dd, J ¼ 9.1, 2.2 Hz, 1H, ArH), 6.59 (d, J ¼ 2.2 Hz, 1H, ArH), 6.60
(d, J ¼ 2.2 Hz, 1H, ArH), 7.61 (d, J ¼ 8.8 Hz, 1H, ArH), 7.74 (d,
J ¼ 9.1 Hz, 1H, ArH), 7.93 (d, J ¼ 9.1 Hz, 1H, ArH), 8.31 (d, J ¼ 8.8
Hz, 1H, ArH), 8.53 (s, 1H, ArH), 9.31 (s, 1H, –CH]N–), 9.38 (s,
1H, –CH]N–). 13C NMR (500 MHz, DMSO-d6): d 24.2, 25.8, 54.6,
57.4, 66.1, 102.8, 102.9, 108.3, 108.6, 11.4, 115.7, 116.9, 117.0,
sodium salt (1.080 g, 4.8 mmol) and K2CO3 (0.828 g, 6.0 mmol)
in dry DMF (35 mL) was stirred for 12 h at 90 C temperature.
ꢀ
Aer this period of time the reaction mixture was ltered to
remove all solid material and the DMF from the ltrate was
evaporated under reduced pressure. The resulting solid was
dissolved in water a puried by reversed phase ash chroma-
tography using a water–methanol mixture (gradient from 1 : 0
to 0 : 1) as eluent affording a red solid which was characterised
1
as the di-potassium salt of 7. Yield: 0.34 g, 45%. H NMR (400
MHz, DMSO-d6): d 2.00 (t, 3JHH ¼ 7.3 Hz, 4H, CH2), 2.56 (dd, 3JHH
8.4, 6.4 Hz, 4H, CH2), 4.04 (t, 3JHH ¼ 6.6 Hz, 4H, CH2), 6.26 (dd,
3JHH ¼ 8.9, 4JHH ¼ 2.3 Hz, 2H, ArH), 6.40 (d, 4JHH ¼ 2.3 Hz, 2H,
ArH), 7.26 (dd, 3JHH ¼ 6.3, 4JHH ¼ 3.2 Hz, 2H, ArH), 7.48 (d, 3JHH
¼ 8.9 Hz, 2H, ArH), 8.05 (dd, 3JHH 6.1, 4JHH ¼ 3.3 Hz, 2H), 8.67 (s,
2H). 13C NMR (400 MHz, DMSO-d6): d 26.5, 48.2, 67.3, 102.3,
3362 | RSC Adv., 2014, 4, 3355–3363
This journal is © The Royal Society of Chemistry 2014

View Article Online
Paper
RSC Advances
124.7, 137.0, 137.5, 144.0, 144.5, 147.6, 150.0, 150.2, 165.0, 15 A. Arola-Arnal, J. Benet-Buchholz, S. Neidle and R. Vilar,
166.7. ESI(+)-MS m/z calcd for C34H40N4O7PtS: 843.2. Found Inorg. Chem., 2008, 47, 11910.
844.2 a.m.u corresponding to [M + H]+. Anal. calcd for 16 H.-K. Fun, R. Kia, V. Mirkhani and H. Zargoshi, Acta
C
34H39CsN4O7PtS$1HCl$2H2O: C, 38.96; H, 4.23; N, 5.34.
Crystallogr., Sect. E: Struct. Rep. Online, 2008, 64, m1181.
17 M. Niu, S. Fan, K. Liu, Z. Cao and D. Wang, Acta Crystallogr.,
Sect. E: Struct. Rep. Online, 2010, 66, m77.
Found: C, 38.81; H, 3.91; N, 5.21%.
18 C.-M. Che, C.-C. Kwok, S.-W. Lai, A. F. Rausch,
W. J. Finkenzeller, N. Zhu and H. Yersin, Chem.–Eur. J.,
2010, 16, 233.
Acknowledgements
The UK's Engineering and Physical Sciences Research Council
(EPSRC) is thanked for nancial support including Fellowships to 19 M. J. Xie, S. P. Yan, D. Z. Liao, Z. H. Jian and P. Chen, Acta
M. K. K. (grant number: EP/E038980/1) and to R. V. (grant number: Crystallogr., Sect. E: Struct. Rep. Online, 2004, 60, m1530.
EP/H005285/1). We are also grateful to EC for a Marie Curie 20 N. E. Eltayeb, S. G. Teoh, S. Chantrapromma, H.-K. Fun and
Fellowship (O. M.), to the Royal Society–Newton Fellowship (S. G.)
and to the Malaysian Government for a PhD studentship (N. H. A.
K.). Johnson Matthey is thanked for a lone of platinum.
K. Ibrahim, Acta Crystallogr., Sect. E: Struct. Rep. Online, 2007,
63, m2838.
21 N. H. Campbell, N. H. A. Karim, G. N. Parkinson,
M. Gunaratnam, V. Petrucci, A. K. Todd, R. Vilar and
S. Neidle, J. Med. Chem., 2012, 55, 209.
22 P. Wu, D.-L. Ma, C.-H. Leung, S.-C. Yan, N. Zhu, R. Abagyan
and C.-M. Che, Chem.–Eur. J., 2009, 15, 13008.
23 A. De Cian, L. Guittat, M. Kaiser, B. Sacca, S. Amrane,
A. Bourdoncle, P. Alberti, M.-P. Teulade-Fichou, L. Lacroix
and J.-L. Mergny, Methods, 2007, 42, 183.
References
1 N. Maizels, Nat. Struct. Mol. Biol., 2006, 13, 1055.
2 N. Maizels and L. T. Gray, PLoS Genet., 2013, 9, e1003468.
3 G. Biffi, D. Tannahill, J. McCafferty and S. Balasubramanian,
Nat. Chem., 2013, 5, 182.
4 A. Bugaut and S. Balasubramanian, Nucleic Acids Res., 2012, 24 J. Alzeer, B. R. Vummidi, P. J. C. Roth and N. W. Luedtke,
40, 4727.
Angew. Chem., Int. Ed., 2009, 48, 9362.
25 B. R. Vummidi, J. Alzeer and N. W. Luedtke, ChemBioChem,
2013, 14, 540.
26 K. Suntharalingam, A. Leczkowska, M. A. Furrer, Y. Wu,
M. K. Kuimova, B. Therrien, A. J. P. White and R. Vilar,
Chem.–Eur. J., 2012, 18, 16277.
5 H. J. Lipps and D. Rhodes, Trends Cell Biol., 2009, 19, 414.
6 S. Balasubramanian, L. H. Hurley and S. Neidle, Nat. Rev.
Drug Discovery, 2011, 10, 261.
7 G. W. Collie and G. N. Parkinson, Chem. Soc. Rev., 2011, 40,
5867.
8 S. Balasubramanian and S. Neidle, Curr. Opin. Chem. Biol., 27 D.-L. Ma, C.-M. Che and S.-C. Yan, J. Am. Chem. Soc., 2009,
2009, 13, 345.
131, 1835.
9 A. Arola and R. Vilar, Curr. Top. Med. Chem., 2008, 8, 1405.
10 D. Monchaud and M.-P. Teulade-Fichou, Org. Biomol. Chem.,
2008, 6, 627.
11 S. N. Georgiades, N. H. Abd Karim, K. Suntharalingam and
R. Vilar, Angew. Chem., Int. Ed., 2010, 49, 4020.
28 A. Granzhan, N. Saettel, F. Hamon, E. Largy, C. Guetta and
M.-P. Teulade-Fichou, Collect. Symp. Ser., 2011, 12, 77.
29 T. Wilson, M. P. Williamson and J. A. Thomas, Org. Biomol.
Chem., 2010, 8, 2617.
30 P. Thordarson, Chem. Soc. Rev., 2011, 40, 1305.
12 T.A.Brooks, S.KendrickandL.Hurley, FEBS J., 2010, 277, 3459. 31 K. Nakamaru, Bull. Chem. Soc. Jpn., 1982, 55, 2697.
13 S. Neidle, FEBS J., 2010, 277, 1118.
14 J. E. Reed, A. A. Arnal, S. Neidle and R. Vilar, J. Am. Chem.
Soc., 2006, 128, 5992.
32 F. da Silva Miranda, A. M. Signori, J. Vicente, B. de Souza,
J. P. Priebe, B. Szpoganicz, N. S. Goncalves and A. Neves,
Tetrahedron, 2008, 64, 5410.
This journal is © The Royal Society of Chemistry 2014
RSC Adv., 2014, 4, 3355–3363 | 3363