Synthesis, biological activity and mechanistic insights of 1-substituted cyclopropylamine derivatives: A novel class of irreversible inhibitors of histone demethylase KDM1A

Article abstract of DOI:10.1016/j.ejmech.2014.08.068

Histone demethylase KDM1A (also known as LSD1) has become an attractive therapeutic target for the treatment of cancer as well as other disorders such as viral infections. We report on the synthesis of compounds derived from the expansion of tranylcypromine as a chemical scaffold for the design of novel demethylase inhibitors. These compounds, which are substituted on the cyclopropyl core moiety, were evaluated for their ability to inhibit KDM1A in vitro as well as to function in cells by modulating the expression of Gfi-1b, a well recognized KDM1A target gene. The molecules were all found to covalently inhibit KDM1A and to become increasingly selective against human monoamine oxidases MAO A and MAO B through the introduction of bulkier substituents on the cyclopropylamine ring. Structural and biochemical analysis of selected trans isomers showed that the two stereoisomers are endowed with similar inhibitory activities against KDM1A, but form different covalent adducts with the FAD co-enzyme.

Full text of DOI:10.1016/j.ejmech.2014.08.068

European Journal of Medicinal Chemistry 86 (2014) 352e363
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Synthesis, biological activity and mechanistic insights of 1-substituted
cyclopropylamine derivatives: A novel class of irreversible inhibitors
of histone demethylase KDM1A
,
Paola Vianello a *, Oronza A. Botrugno a, Anna Cappa a, Giuseppe Ciossani b,
Paola Dessanti a, Antonello Mai c, Andrea Mattevi b *, Giuseppe Meroni a,
,
,
,
*
b
a
c
Saverio Minucci a d, Florian Thaler a , Marcello Tortorici , Paolo Trifiro , Sergio Valente ,
ꢀ
Manuela Villa a, Mario Varasi a, Ciro Mercurio a
a Drug Discovery Unit, European Institute of Oncology, Via Adamello 16, 20139 Milan, Italy
b Department of Biology and Biotechnology, University of Pavia, Via Ferrata 1, 27100 Pavia, Italy
c Pasteur Institute e Cenci Bolognetti Foundation, Department of Drug Chemistry and Technologies, University “La Sapienza”, P.le A. Moro 5, 00185 Roma,
Italy
d Department of Biosciences, University of Milan, Via Celoria, 26, 20133 Milan, Italy
a r t i c l e i n f o
a b s t r a c t
Article history:
Histone demethylase KDM1A (also known as LSD1) has become an attractive therapeutic target for the
treatment of cancer as well as other disorders such as viral infections. We report on the synthesis of
compounds derived from the expansion of tranylcypromine as a chemical scaffold for the design of novel
demethylase inhibitors. These compounds, which are substituted on the cyclopropyl core moiety, were
evaluated for their ability to inhibit KDM1A in vitro as well as to function in cells by modulating the
expression of Gfi-1b, a well recognized KDM1A target gene. The molecules were all found to covalently
inhibit KDM1A and to become increasingly selective against human monoamine oxidases MAO A and
MAO B through the introduction of bulkier substituents on the cyclopropylamine ring. Structural and
biochemical analysis of selected trans isomers showed that the two stereoisomers are endowed with
similar inhibitory activities against KDM1A, but form different covalent adducts with the FAD co-enzyme.
© 2014 Elsevier Masson SAS. All rights reserved.
Received 12 June 2014
Received in revised form
25 August 2014
Accepted 26 August 2014
Available online 27 August 2014
Keywords:
Epigenetics
Histone lysine demethylases
Tranylcypromine
Antiproliferation
X-ray crystallography
1. Introduction
charge of the histone tail, but it affects its basicity, hydrophobicity
and the affinity towards other proteins [11,12]. Histone lysine
In the past decades, it has become evident that an altered
epigenetic control of gene expression is associated to several dis-
eases, including cancer. Posttranslational modifications of the his-
tone tails are among the most important regulatory factors for
structural changes in chromatin, both on the global scale and at
specific genome loci [1e6]. Histone lysine acetylation and deace-
tylation are the best characterized histone modifications and
currently histone deacetylase inhibitors are used in the treatment
of cutaneous and peripheral T-cell lymphoma [7e10]. Contrary to
histone acetylation, methylation does not lead to a change of the
methylation, previously considered to be an irreversible process,
has been shown to be dynamically regulated by the controlled
addition and removal of one, two, or three methyl groups on the
amino group of the amino acid side chain. Histone lysine deme-
thylases (called KDMs) exert their activity through two types of
mechanisms. The Jumonji domain-containing enzymes are iron and
2-oxoglutarate dependent oxygenases, which act on mono-, di- and
tri-methylated lysines [11e14]. On the other hand, the flavin-
dependent (FAD) histone demethylases can only act on mono and
dimethylated lysine residues [15e17]. So far, two human FAD-
dependent demethylases have been identified: LSD1, also known
as KDM1A [18] and LSD2, also known as KDM1B [19,20]. Histone 3
dimethyl-lysine 4 (H3K4me2) is a positive chromatin mark, which
has been localized to the regions of transcriptionally active human
genes [21,22]. Erasure of this mark by KDM1A results in a tran-
scriptional repression [21,23]. KDM1A has been also proposed to be
Abbreviations: LSD, lysine-specific histone demethylase; MAO, monoamine
oxidase; DIPEA, N,N-diisopropylethylamine.
* Corresponding authors.
E-mail addresses: paola.vianello@ieo.eu (P. Vianello), andrea.mattevi@unipv.it
(A. Mattevi), florian.thaler@ieo.eu (F. Thaler).
http://dx.doi.org/10.1016/j.ejmech.2014.08.068
0223-5234/© 2014 Elsevier Masson SAS. All rights reserved.

P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
353
involved in the demethylation of the repressive mono- and di-
methyl H3K9, thus promoting gene activation [24]. In addition it
has been recently found that several non-histone proteins are
substrates of KDM1A, such as p53 [25], DNA methyltransferase 1
[26,27], E2F1 [28] and MYPT1 [29].
position 1 and characterized them, discovering new KDM1A in-
hibitors and broadening our understanding of the selectivity and
stereochemistry of the inhibition mechanism (see Fig. 1).
2. Results and discussion
KDM1A is up-regulated in various cancers [30e33], including
acute myeloid leukaemia [34], prostate cancer [35], ER-negative
breast cancer [36,37], and neuroblastoma [38]. The association of
KDM1A overexpression and tumours as well as the discovery of the
monoamine oxidase (MAO) inhibitor tranylcypromine 1 (see Fig. 1)
as KDM1A inhibitor in 2006 [39] were starting key events, which
have triggered intensive research in the development of new
KDM1A-inhibiting agents [40]. The majority of these activities were
directed towards functionalized tranylcypromine-based com-
pounds by the introduction either of substituents on the amino
and/or phenyl moieties of the inhibitor. A series of patent appli-
cations were disclosed by Oryzon and GSK describing N-substituted
tranylcypromine derivatives [41,42], several of them being highly
selective for KDM1A over MAO A and MAO B. Two compounds from
these series have been reported to have entered clinical studies
[43,44]. Neelamegam et al. found that compound RN-7 (Fig. 1) was
over 300 times more potent against KDM1A over MAO A and B [45].
The authors were able to demonstrate an involvement of KDM1A as
regulator of long-term memory formation implying a key function
in the central nervous system. Also the introduction of different
substituents on the aryl group of tranylcypromine resulted in
highly potent and selective compounds [46,47]. For example,
MC2580 [47] (Fig. 1) was found to be 100 time more active against
KDM1A than compound 1, while being inactive against MAO B.
Contrary to the above described research activities, modifications
on the cyclopropyl moiety have been so far less explored. This
moiety is essential for inhibition because it adds irreversibly to the
FAD cofactor, thus inactivating the enzymes [16,48,49]. A pre-
liminary study of the cyclopropyl ring modifications was described
by Gooden et al., demonstrating that 2-diphenyl-cyclopropylamine
was significantly less potent than 1 [50]. Given the growing
importance of tranylcypromine as lead compound for the devel-
opment of inhibitors of flavin-dependent amine oxidases such as
KDM1A and MAOs, we decided to further investigate the effect of
substituents on the cyclopropyl moiety. Our aim was twofold: (i) to
enhance our knowledge on pharmacological properties of
tranylcypromine-derived compounds, and (ii) to obtain mecha-
nistic insights into the formation of the covalent adduct with the
flavin, which causes the irreversible inhibition. We have synthe-
sized a series of cyclopropylamino derivatives substituted in
The reaction between styrene oxide and the corresponding
phosphonate was carried according to the WadswortheEmmons
cyclopropanation [51e54]. In specific, styrene oxide 6, as well their
2-S (7) and 2-R (8) analogues, were treated with the phosphonates
9aeg in the presence of butyl lithium in dimethoxyethane at 130 ꢀC
under microwave irradiation (Scheme 1). Subsequent hydrolysis of
the ethyl esters with LiOH provided the carboxylic acids 13aec,
13eeg, 14a,b,d,e and 15a,b,d,e which were then converted into the
N-BOC derivatives according to a Curtius rearrangement with
diphenyl phosphorazidate in presence triethylamine and in tert-
butanol at 90 ꢀC. Final hydrolysis of the BOC protecting group with
hydrochloric acid gave the desired amines 19aec, 19eeg, 20a,b,d,e
and 21a,b,d,e. Compound 19d was synthesized as previously re-
ported [55].
The amino group of compound 22 [56] was protected with tert-
butoxycarbonyl-tert-butyl carbonate in the presence of DIPEA and
the trans isomer was then separated from the cis analogue by col-
umn chromatography with a mixture of hexane and EtOAc as
eluent (Scheme 2). Basic hydrolysis of compound 23 with NaOH in
ethanol resulted in the corresponding carboxylic acid 25, while the
hydroxymethyl derivative 27 was obtained by reduction of the ester
23 with LiAlH4 in THF at room temperature. Finally, deprotection of
the tert-butoxycarbonyl moieties of 23, 25 and 27 in HCl provided
the desired cyclopropyl derivatives 24, 26 and 28.
KDM1A inhibitory activity was assessed using human recom-
binant KDM1A/CoREST protein as enzymatic source and a synthetic
mono-methylated H3-K4 peptide containing 21 amino acids as
substrate. The compounds were incubated with the enzymatic
complex and the results are expressed either as IC50 or in case of
poor potency as percentage of inhibition at the highest dose tested.
Initially we prepared a series of analogues of compound 1, all of
them already known for their MAO inhibitory activity. As shown in
Table 1, replacement of the cyclopropylamine by a eCOCH2NH2
group (2), which is present in some highly potent MAO inhibitors
[57,58] resulted in a decreased activity against KDM1A. Introduc-
tion of a CH2 spacer as in example 3 had been described to be
detrimental for any MAO inhibitory activity [59]. Similarly, com-
pound 3 resulted to be inactive against KDM1A when tested in vitro.
The cis phenoxycyclopropyl derivative 4 had been described to be
trans
trans
trans
MC2580
tranylcypromine (1)
RN-7
trans
1-R cyclopropylamines
Fig. 1. Cyclopropylamines derivatives as LSD1 inhibitors.

354
P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
a
b
10a-c, e-g
11a,b,d,e
12a,b,d,e
6 (trans racemic)
7 (2S)
8 (2R)
9a-c, e-g
d
c
13a-c, e-g
14a,b,d,e
15a,b,d,e
16a-c, e-g
17a,b,d,e
18a,b,d,e
19a-c, e-g
20a,b,d,e
21a,b,d,e
Scheme 1. Reagents and conditions: (a) 1,2-dimethoxyethane, BuLi, room temperature, then MW, 130 ꢀC, 90 min; (b) H2O/THF (1:1), LiOH, MW, 115 ꢀC, 1 h; (c) tert-BuOH, diphenyl
phosphorazidate, TEA, 90 ꢀC, 18 h; (d) Et2O/dioxane, HCl, room temperature, 20 h.
24
22
b
a
d
c
25
26
e
23
f
27
28
Scheme 2. Reagents and conditions: (a) CH2Cl2, (BOC)2O, DIPEA room temperature, 20 h; (b þ d) MeOH, HCl, room temperature, 7 h; (c) EtOH, NaOH, 80 ꢀC, 24 h; (e) THF, LiAlH4,
room temperature, 6 h.
more potent than compound 1 as MAO inhibitor [59]. However, in
our hands compound 4 as well as its trans analogue 5 was
completely inactive against KDM1A. Based on these results, we
directed our efforts towards derivatives substituted on the cyclo-
and 0.36
vided even more potent KDM1A inhibitors: the phenyl derivative
19d exhibited an IC50 value of 0.16 M and the benzyl, the 2-
naphthylmethyl and the 2-phenylethyl derivatives 19eeg had
similar potencies in the submicromolar range. On the other hand,
the eCH2OH analogue 28 exhibited similar potency compared to
parent compound 1. Similarly, other hydrophilic substituents such
as a carboxylic acid and an ethyl ester group proved to be detri-
mental for the KDM1A inhibitory activity: the cyclo-
mM, respectively. Bulkier hydrophobic substituents pro-
m
propylamine ring. According to the literature, substitution of the a-
hydrogen in 1 by a methyl group results in a MAO inhibitor 19a with
a good in vitro potency, which was confirmed by our studies (see
Table 1) [60]. Moreover, we were able to demonstrate a positive
contribution to the KDM1A inhibitory activity by this replacement.
Specifically, inhibitor 19a exhibited an IC50 value of 1.72
mM and
propanecarboxylic acid 26 and the ethyl ester 24 showed at 100 mM
was around 10 times more potent than the unsubstituted analogue
1.
only minimal potency by inhibiting 21% and 11% of the enzyme
activity, respectively.
These results prompted us to investigate whether further sub-
Based on these data, we decided to further characterize the 2-
phenylcyclopropyl derivatives which showed an increased po-
tency compared to the parent compound 1. For this purpose, we
profiled the compounds for their MAO A and MAO B inhibition [61].
stituents on the
effective compounds in inhibiting KDM1A. For this purpose, a set of
trans isomers with hydrophobic and hydrophilic -substituents
a-position are tolerated or may provide even more
a
was prepared and tested. As shown in Table 2, we observed that
increasing the alkyl chain from methyl to ethyl and n-propyl
resulted in increasingly more potent inhibitors. In particular, the
ethyl analogue 19b and the n-propyl derivative 19c were around 2
and 4 times more potent than compound 1, with IC50 values of 0.78
The data summarized in Table 2 show that the
19a was around 10 times more potent against MAO
(IC50 ¼ 0.17 M) and 100 times against MAO B (IC50 ¼ 0.01 M) than
the unsubstituted standard 1. However, larger substituents on the
-position diminished the inhibitory efficiency against MAO B: the
a-methyl derivative
A
m
m
a

P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
355
Table 1
ethyl and the n-propyl derivatives 19b and 19c exhibiting IC50
values of 0.19 and 0.60 M, were around 20 and 60 times less active
than the corresponding methyl analogue 19a. With exception of the
2-phenylethyl analogue 19g, all other compounds with bulkier
substituents were much less active and the IC50 values were higher
than 10 M. The active site of MAO A is shorter in length and wider
Hit identification of tranylcyclopropylamine analogues.
m
KDM1A
a
-
R
IC50 (mM) or percentage of inhibition
trans
m
than the narrower cavity in MAO B and thus allows to accommo-
date larger molecules [62]. Indeed, we found that the phenyl de-
rivative 19d and the 2-phenylethyl analogues 19g were more
potent against MAO A than the methyl derivative 19a, whereas the
IC50 values for the ethyl, benzyl and 2-naphthyl derivatives 19b, 19e
and 19f were in the micromolar range with IC50 values of 1.92, 3.51
1
2
3
4
11.6
30% at 22
0% at 100
0% at 100
m
m
m
M
M
M
and 1.30 mM, respectively. Taken together, these data indicate that
inhibition by the herein presented small tranylcypromine ana-
logues follows similar trends for MAO A and KDM1A, with MAO B
featuring more distinct properties. Similar results were also
observed with other trancylpromine derivatives substituted on
their aryl moiety, such as for MC2580 (Fig. 1) and similar com-
trans
cis
pounds [47]. However, it has become evident that bulky
a-sub-
stituents generally increase selectivity for KDM1A, as exemplified
by the benzyl- and 2-naphthyl-(CH2)-substituted 19e and 19f
compounds (Table 2).
Compounds 19aeg were further characterized for their KDM1A
inhibitory activities in cells. Previous data [47] indicated the bio-
logical relevance in inhibiting KDM1A both in murine primary
promyelocytic blasts and human promyelocytic leukaemia cell lines
(NB4). Based on these results we selected NB4 cells as our privi-
leged cellular model and we incubated them with the inhibitors at a
concentration equal to their respective biochemical IC50 value. After
24 h, Gfi-1b mRNA levels were measured by quantitative RT-PCR.
The choice to follow the effect on Gfi-1b, a gene associated with
haematopoietic differentiation, was based on the observation that
Gf1-b levels are increased following KDM1A deletion and that the
gene is a direct transcriptional target of KDM1A [63]. The selective
MAO-A inhibitor, chlorgyline, which was inactive on KDM1A, in our
hands was used as negative control and as expected it does not lead
trans
5
0% at 100
m
M
trans
19a
1.72
to any Gfi-1b mRNA level variation at doses up to 100 mM. On the
other hand, the known KDM1A inhibitor MC2580 led to an increase
the Gfi-1b levels respect the vehicle treated cells by six times.
As shown in Table 2, all tested compounds were able to increase
the mRNA expression of Gfi-1b by at least 5 times compared to cells
treated with the vehicle and thus demonstrated their ability to
block KDM1A activity in cellular systems.
Table 2
Biological characterization of compounds 1, 19aeg, 24, 26 and 28.a
trans
Next, we investigated the KDM1A inhibitory activity of some
selected stereoisomers. For this scope, we prepared the trans en-
antiomers of the methyl (19a), ethyl (19b), phenyl (19d), and benzyl
(19e) derivatives. As summarized in Table 3, there were no signif-
icant differences in the KDM1A inhibitory activity based on the
chirality of the stereogenic centres. Only in the case of the bulkier
phenyl series the differences were somewhat greater: the 1R,2S
derivative 20d was almost 5 times less potent than the other isomer
21d, whereas the 1S,2R benzyl derivative 21e was less potent than
compound 20e. Consistent with these biochemical data, all tested
compounds inhibited KDM1A in NB4 cells to a rather similar extent
as shown by a ~5e6 fold up-regulation of the Gfi-1b mRNA
expression compared to the vehicle treated control cells.
More relevant differences were instead found for MAO A and
MAO B inhibition. For both enzymes, the 1S,2R isomer 21a resulted
to be the most active compound being 20 and 140 times more
potent against MAO A and MAO B than the corresponding 1R,2S
analogue 20a. High differences in the MAO B inhibitory activity was
also found for the ethyl series: the 1S,2R isomer 21b exhibited an
R
KDM1A MAO A MAO B Target modulation Gfi-1bb
IC50
(m
M) IC50
M)
IC50
M)
(Fold increase vs. vehicle
treated cells)
(
m
(
m
1
H
11.6
1.19
1.05
5.3
19a CH3
19b C2H5
1.72 0.17
0.779 1.92
0.010 6.4
0.190 6.6
19c n-C3H8
19d Phenyl
19e Benzyl
19f 2-Naphthyl-
(CH2)
19g Ph-(CH2)2
24 COOC2H5
26 COOH
28 CH2OH
0.358 0.527 0.600 5.4
0.161 0.0828 10.4
7.9
6.5
6.2
0.617 3.51
0.218 1.30
50.5
12.7
0.202 0.0214 0.941 5.7
>100
>100
nd.
nd.
nd.
nd.
nd.
nd.
nd.
nd.
9.132 nd.
a
Assays done in replicates (n ꢁ 2). Mean values are shown and the standard
deviations are <30% of the mean.
The experiment was carried out at the concentration of the inhibitor equal to
equal to their respective biochemical IC50 value.
IC50 value of 0.088 mM and was almost 400 times more potent than
compound 20b. Weak inhibitory activity against MAO B was
confirmed for the molecules with the larger phenyl or benzyl
b

356
P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
Table 3
both varying
a substituents and chiralities. For five inhibitors (20a,
KDM1A, MAO A and MAO B inhibition as well as gene target modulation of com-
20b, 20e, 21a, and 21d) the quality of the diffraction allowed us to
solve the structures at resolutions sufficient for structural analysis
(Fig. 2; Table 4). A first observation is the ring opening of the
cyclopropylamine moiety in all compounds and the formation of
pounds 19aeb, 19dee, 20aeb, 20dee, 21aeb and 21dee.a
Table 4
Crystallographic statistics.
R
Stereo-
KDM1A MAO MAO B Target modulation Gfi-1bb
chemistry
A
20e
20b
20a
21a
21d
IC50
M)
IC50
M)
IC50
(Fold increase vs. vehicle
PDB code
4uv8
2.8
4uv9
3.0
4uva
2.9
4uvb
2.8
4uvc
3.1
(
m
(m
(mM) treated cells)
Resolution (Å)
Rmerge (%)a,b
7.5 (83.3) 14.3
(106.0)
99.5 (99.8) 99.6
(99.7)
55,688
3.7 (3.6) 3.4 (3.6)
12.5 (1.5) 7.5 (1.3)
6367
22.6
6.7 (56.5) 8.7 (54.4) 19.4
(132.1)
100.0
,c
19a CH3
20a CH3
21a CH3
trans
1R,2S
1S,2R
1.72
1.78
3.26
0.779 1.92
0.975 6.8
0.608 1.43
0.161 0.083 10.4
0.584 0.235
0.131 0.094 11.5
0.17
1.28
0.070
0.010 6.4
0.998 5.0
0.007 4.7
0.190 6.6
33.3
0.088 4.5
7.9
5.55 4.7
Completeness (%)c 99.3
(98.4)
Unique reflections 62,089
99.9
(99.8)
62,197
(99.9)
45,854
19b C2H5 trans
20b C2H5 1R,2S
21b C2H5 1S,2R
19d Phenyl trans
20d Phenyl 1R,2S
21d Phenyl 1S,2R
19e Benzyl trans
20e Benzyl 1S, 2S
21e Benzyl 1R, 2R
49,581
4.9
Redundancyc
I/
4.1 (4.2) 4.0 (4.0) 6.1 (5.6)
13.3 (2.8) 9.3 (2.5) 9.0 (1.2)
6358
22.0
23.2
0.005
s
c
N of atoms
Rfactor (%)d
Rfree (%)d
Rms bond length
(Å)
Rms bond angle (ꢀ) 0.913
6358
22.6
24.6
6357
22.2
23.6
6361
21.0
24.1
5.7
6.5
9.7
9.8
23.7
0.005
0.617 3.51
0.335 2.59
50.5
28.1
74.3
0.005
0.005
0.006
nda
8.31
0.976
0.905
0.888
1.097
a
The IC50 value could not be determined due to a significant dose dependent
interferences with the fluorescent signal of enzymatic assay.
The experiment was carried out at the concentration of the inhibitor equal to
equal to their respective biochemical IC50 value.
a
Space group is I222.
Rmerge ¼ SjIi ꢂ <I>j/SIi, where Ii is the intensity of ith observation and <I> is the
b
b
mean intensity of the reflection.
c
Values in parentheses are for reflections in the highest resolution shell.
Rcryst ¼ SjFobs ꢂ Fcalcj/SFobs where Fobs and Fcalc are the observed and calculated
d
structure factor amplitudes, respectively.
Fig. 2. Crystallographic data on binding of the inhibitors 20a, 20b, 20e, 21a and 21d to human LSD1/CoREST. The weighted 2Fo-FC electron density maps (blue mesh) were
calculated before the inclusion of the inhibitor atoms in the refinement to avoid model bias. The contour level is 1.2e1.3 . Carbon atoms of flavin and inhibitor are in yellow and
green, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
s
substituents. In the case of MAO A, the methyl and phenyl 1S,2R
analogues 21a and 21d were the most potent stereoisomers with
IC50 values of 0.07 and 0.094 mM, respectively. These data indicate
that the two enantiomers exhibit different inhibitory activities,
which are more pronounced for MAOs.
covalent adducts with the FAD by adding to the N5 or C4a atoms of
the flavin or to both. A second indication is that the inhibitors are
hosted in the wide active-site cleft, which forms the binding site for
the N-terminal H3 peptide. As observed for other tranycylpromine
analogues [47,49], the width of the cleft enables the various sub-
These observations prompted us to investigate the three-
dimensional structures of KDM1A/CoREST in complex with the
inhibitors using X-ray crystallography. The compounds used for
these studies were chosen with the goal to investigate the effect of
stituents on the a carbon to remain mostly exposed and accessible
to the solvent, even when bound to the flavin and with no specific
interactions (i.e. H-bonds) between the ligand and protein atoms.
Therefore, the differences in inhibitor potencies appear to be

P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
357
mainly due to non-specific van der Waals protein-inhibitor in-
teractions and small changes in the reactivity of the tranylcypro-
mine ring induced by the variations in the bulkiness and chemical
opening of the bond to either the N5 or C4a atoms, depending
(preferentially) on the chirality of the cyclopropyl groups (Fig. 3).
We do not rule out other possibilities such as initial formation of a
“single-linkage” adduct followed by chemical recombination or
migration of the group that initially adds to the flavin. However,
independently from the exact mechanism, these data demonstrate
nature of the
These data are of particular interest in respect to the mechanism
of FAD inactivation by these irreversible inhibitors. Indeed, -sub-
a substituents.
a
stitution prevents that the CeNH2 bonds of the inhibitors are
enzymatically oxidized to an imine product (Fig. 3). Therefore, a
“suicide substrate” mechanism can be ruled out, in which the in-
hibitor amine group has to be first oxidized to an imine before
binding covalently to the flavin. Instead, our studies support the
hypothesis that the ring opening occurs directly, possibly through a
radical mechanism, without prior enzymatic oxidation of the in-
hibitor amino group [64]. Further evidences for such a mechanism
is given by the finding that three types adducts are observed, with a
pattern consistent with the chirality of the investigated inhibitors.
that a-substitution (e.g. absence of an “oxidizable” CeNH bond)
does not prevent covalent inhibition and that both enantiomeric
forms of the inhibitor retain inhibitory reactivity although (pref-
erentially) giving rise to different adducts, which might correlate
with the observed slight differences in potencies.
3. Conclusion
A novel series of tranylcypromine analogues containing a
substituted cyclopropyl core moiety have been described as
demethylase inhibitors. We found that the inhibitory activity was
strongly influenced by the type of the substitution on the cyclo-
propyl group. Introduction of hydrophobic groups, among them
alkyls, phenyl, or benzyl, resulted in compounds with a higher
KDM1A inhibitory potency, compared to the standard tranylcy-
promine (1), while a carboxylic acid and an ethyl ester group
proved to be detrimental. Introduction of a methyl group resulted
also in an increased potency against the MAO enzymes, while the
introduction of larger substituents increased the selectivity for
KDM1A substantially over MAO B and to a minor extent over MAO
The electron density for compound 21a (a-methyl substitution with
1S,2R chirality) is consistent with a cyclic adduct in which the 1 and
2 carbons are respectively attached to the N5 and C4a flavin atoms,
as originally found for tranylcypromine bound to KDM1A [49].
Conversely, 21d (1S,2R; a-phenyl) forms an adduct in which there is
a single linkage between carbon 1 of the ring-opened inhibitor and
the flavin N5, while the three other inhibitors 20a, 20b, and 20e
feature a covalent linkage between flavin C4a and inhibitor carbon
2. Collectively, these data support an inhibition mechanism, in
which a cyclic adduct is initially formed. This can be followed by
4a
5
20a, 20b, 20e
21a
21d
Fig. 3. Proposed mechanism for the formation of different cyclopropylamine adducts to the FAD cofactor.

358
P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
A. These trends can be explained by the overall larger active site of
KDM1A compared to the other two enzymes. This may also explain
why the single trans enantiomers of some selected derivatives
showed major differences in their MAO inhibitory activity and only
minor ones for KDM1A, even though the crystal structure of
KDM1A with the 1R,2S enantiomers 20a, 20b and 20d revealed the
formation of different covalent adducts of the inhibitors to the FAD
cofactor than with the 1S,2R enantiomers 21a and 21d. Taken
together, all these findings highlight the potential of the modifi-
cations on the carbon 1 position on the tranylcypromine scaffold as
a feasible route to achieve highly potent KDM1A inhibitors with an
increased selectivity over MAO enzymes.
7.34e7.27 (m, 2H), 7.26e7.18 (m, 2H), 2.67e2.64 (m, 1H), 1.51e1.48
(m, 1H), 1.32e1.22 (m, 1H), 0.85 (s, 3H). MS (ESI): m/z: 175 [MꢂH]ꢂ.
4.1.1.3. tert-Butyl N-[(1R,2S)-1-methyl-2-phenyl-cyclopropyl]carba-
mate (17a). 2.4 g (8.7 mmol) diphenyl phosphorazidate (Sigma
Aldrich) and 1.0 g (10 mmol) TEA were added to a solution of 1.4 g
(7.9 mmol) carboxylic acid 14a in 25 mL dry tert-Butanol, the
resulting solution was stirred at 90 ꢀC for 18 h. The mixture was
concentrated and the residue partitioned between 10% aqueous
Na2CO3 and Et2O. The combined organic layers were dried
(Na2SO4), filtered, concentrated in vacuo and purified by column
chromatography (eluent: EtOAc/cyclohexane, 1:100e10:100) to
give 1.37 g (69%) of the carbamate intermediate 17a. 1H NMR
4. Experimental section
(CDCl3) d (ppm): 7.28e7.10 (m, 5H), 4.96 (bs,1H), 2.29e2.26 (m,1H),
1.40 (bs, 9H), 1.16e1.05 (m, 1H), 0.98 (s, 3H), 0.96e0.93 (m, 1H). MS
(ESI): m/z: 248 [MþH]þ
4.1. Chemistry
Reagents and solvents used, unless stated otherwise, were of
commercially available reagent grade quality and were used
without further purification. Flash chromatography purifications
were performed on Merck silica gel 60 (0.04e0.063 mm). Nuclear
magnetic resonance spectra (1H NMR) were recorded on a Varian
4.1.1.4. (1R,2S)-1-Methyl-2-phenyl-cyclopropanamine hydrochloride
(20a). A solution of 60 mg (0.24 mmol) of tert-Butyl N-[(1R,2S)-1-
methyl-2-phenyl-cyclopropyl]carbamate 17a, in 2 mL Et2O was
cooled down to 0 ꢀC. 4 M HCl in dioxane (1.2 mL) was added and the
solution stirred at RT for 20 h. The solvent was evaporated and the
resulting residue triturated twice with Et2O giving 32 mg (72%) of
the desired cyclopropanamine hydrochloride 20a as a white solid.
500 MHz spectrometer at 300 K and are referenced in ppm (d)
relative to TMS. Coupling constants (J) are expressed in hertz (Hz).
HPLCeMS experiments were performed on an Acquity UPLC
apparatus, equipped with a diode array and a Micromass SQD single
quadruple (Waters). Purity was monitored at 220 nm and the pu-
rities of the compounds used for biological tests were found to be at
least 95%. Ethyl 1-amino-2-phenyl-cyclopropanecarboxylate was
prepared as described by Wurtz et al. [56]. Triethyl 2-
phosphonopropionate (9a, Sigma Aldrich, Cat No. 174653),
triethyl 2-phosphonobutanoate (9b, Sigma Aldrich, Cat No. 417467),
and triethyl 2-phosphonopentanoate (9c, Alfa Aesar, Cat. No.
30413) are commercially available. Ethyl 2-(diethoxyphosphoryl)-
3-phenylpropanoate (9e) was prepared as described in Eur. J. Org.
Chem. [65], triethyl phosphonophenylacetate (9d) as in J. Org.
Chem [66]. trans-1,2-Diphenylcyclopropanamine hydrochloride
(19d) was prepared as described in Acta Chem. Scand. [55].
1H NMR (DMSO-d6)
d (ppm): 8.45 (s, 3H), 7.36e7.30 (m, 2H),
7.27e7.21 (m, 3H), 2.50e2.46 (m, 1H), 1.41e1.35 (m, 1H), 1.26e1.21
(m, 1H), 1.02 (s, 3H). MS (ESI): m/z: 148 [MþH]þ.
According to the procedure described for example 11a the
following compounds were synthesized starting from the appro-
priate styrene oxides and phosphonoacetates:
4.1.2. Ethyl trans-1-methyl-2-phenyl-cyclopropanecarboxylate
(10a)
Yield: 84%. 1H NMR (CDCl3)
d (ppm): 7.34e7.28 (m, 2H),
7.26e7.22 (m, 1H), 7.22e7.18 (m, 2H), 4.22e4.15 (m, 2H), 2.85e2.77
(m, 1H), 1.72e1.65 (m, 1H), 1.30 (t, J ¼ 7.1 Hz, 3H), 1.19e1.13 (m, 1H),
0.99 (s, 3H).
4.1.1. (1S,2R)-1-Ethyl-2-phenyl-cyclopropanamine hydrochloride
(20a)
4.1.3. Ethyl trans-1-ethyl-2-phenyl-cyclopropanecarboxylate (10b)
Yield: 79%. 1H NMR (CDCl3)
d (ppm): 7.34e7.17 (m, 5H),
4.27e4.14 (m, 2H), 2.86e2.77 (m, 1H), 1.69e1.61 (m, 2H), 1.31 (t,
J ¼ 7.1 Hz, 3H), 1.22e1.14 (m, 1H), 0.94e0.83 (m, 4H).
4.1.1.1. Ethyl
(1R,2S)-1-methyl-2-phenyl-cyclopropanecarboxylate
(11a). 5.6 mL (2.5 mol/L) butyl lithium was added to a solution of
3.4 g (14 mmol) ethyl 2-diethoxyphosphorylbutanoate (Sigma
Aldrich) in 12 mL dry DME under N2 atmosphere at RT. After 5 min,
1.3 g (11 mmol) (2S)-2-phenyloxirane (Sigma Aldrich) was added
dropwise. The mixture was stirred for 20 min at RT and then heated
at 130 ꢀC under MW irradiation for 90 min. Aqueous NH4Cl was
added and the product was extracted with Et2O. The combined
organic layers were dried over Na2SO4 and concentrated. The dry
residue was purified by column chromatography (eluent: EtOAc/
hexane, 0:100e10:100) to give the ethyl cyclopropanecarboxylate
4.1.4. Ethyl trans-2-phenyl-1-propyl-cyclopropanecarboxylate
(10c)
Yield: 89%. 1H NMR (CDCl3)
d (ppm): 7.39e7.07 (m, 5H),
4.30e4.08 (m, 2H), 2.83e2.69 (m, 1H), 1.72e1.67 (m, 1H), 1.66e1.58
(m, 1H), 1.45e1.26 (m, 5H), 1.21e1.16 (m, 1H), 0.83e0.77 (m, 1H),
0.75 (t, J ¼ 1.0 Hz, 3H).
11a (2.9 g, 90%). 1H NMR (CDCl3)
d (ppm): 7.25e7.20 (m, 2H),
4.1.5. Ethyl trans-1-benzyl-2-phenyl-cyclopropanecarboxylate
(10e)
7.19e7.13 (m, 1H), 7.12 (d, J ¼ 7.3 Hz, 2H), 4.13e4.06 (m, 2H),
2.75e2.71 (m, 1H), 1.63e1.59 (m, 1H), 1.24e1.19 (m, 3H), 1.12e1.07
(m, 1H), 0.91 (s, 3H). MS (ESI): m/z: 205 [MþH]þ.
Yield 72%. 1H NMR (CDCl3)
d (ppm): 7.44e7.10 (m, 10H),
4.20e4.03 (m, 2H), 3.23e3.15 (m, 1H), 2.99e2.93 (m, 1H), 2.03e1.98
(m, 1H), 1.92e1.87 (m, 1H), 1.45e1.42 (m, 1H), 1.20 (t, J ¼ 7.1 Hz, 3H).
4.1.1.2. (1R,2S)-1-Methyl-2-phenyl-cyclopropanecarboxylic
acid
(14a). 2.9 g (9.9 mmol) ethyl ester 11a was dissolved in 12 mL of a
water/Ethanol/THF (1:1:1, v:v:v) mixture. The solution was cooled
down to 0 ꢀC, 4 g (40 mmol) of LiOH added and the mixture stirred
under microwave irradiation at 115 ꢀC for 1 h. The solution was
concentrated, quenched with 2 M HCl, and the formed precipitate
filtered off, washed with water and dried, yielding 1.55 g (89%) of
4.1.6. Ethyl trans-1-(2-naphthylmethyl)-2-phenyl-
cyclopropanecarboxylate (10f)
Yield 80%. 1H NMR (CDCl3)
d (ppm) 7.81e7.77 (m, 1H), 7.76e7.69
(m, 2H), 7.56e7.53 (m, 1H), 7.48e7.35 (m, 4H), 7.33e7.28 (m, 4H),
4.23e4.07 (m, 2H), 3.37 (d, J ¼ 15.7 Hz, 1H), 2.95e2.89 (m, 1H),
2.23e2.16 (m, 1H), 1.96e1.91 (m, 1H), 1.53e1.47 (m, 1H), 1.20 (t,
J ¼ 1.0 Hz, 3H).
the cyclopropanecarboxylic acid 14a. 1H NMR (DMSO-d6)
d (ppm):

P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
359
4.1.7. Ethyl trans-1-(2-phenylethyl)-2-phenyl-
4.1.19. trans-1-Ethyl-2-(2-naphthyl)cyclopropanecarboxylic acid
(13f)
Yield 94%. 1H NMR (DMSO-d6)
cyclopropanecarboxylate (10g)
Yield 68%. 1H NMR (CDCl3)
d
(ppm): 7.41e6.84 (m, 10H),
d
(ppm): 12.42 (s, 1H), 7.97e7.04
4.29e4.15 (m, 2H), 2.92e2.82 (m, 1H), 2.68e2.49 (m, 2H), 1.84e1.74
(m, 1H), 1.71e1.65 (m, 1H), 1.42e1.30 (m, 4H), 1.22 (dd, J ¼ 4.9,
7.3 Hz, 1H).
(m, 12H), 3.11 (d, J ¼ 15.7 Hz, 1H), 2.85e2.76 (m, 1H), 2.20 (d,
J ¼ 15.7 Hz, 1H), 1.75e1.69 (m, 1H), 1.67e1.61 (m, 1H). MS (ESI): m/z:
301 [MꢂH]ꢂ.
4.1.20. trans-1-(2-Phenylethyl)-2-phenyl-cyclopropanecarboxylic
4.1.8. Ethyl (1S,2R)-1-methyl-2-phenyl-cyclopropanecarboxylate
acid (13g)
(12a)
Yield 54%. 1H NMR (DMSO-d6)
d (ppm): 13.53e11.44 (m, 1H),
Yield 73%. 1H NMR (CDCl3)
d (ppm): 7.35e7.15 (m, 5H),
7.35e6.78 (m, 10H), 2.76e2.70 (m, 1H), 2.64e2.54 (m, 1H),
4.23e4.13 (m, 2H), 2.86e2.76 (m, 1H), 1.73e1.66 (m, 1H), 1.30 (t,
J ¼ 7.1 Hz, 3H), 1.21e1.14 (m, 1H), 0.99 (s, 3H).
2.43e2.34 (m, 1H), 1.60e1.23 (m, 4H). MS (ESI): m/z: 265 [MꢂH]ꢂ.
4.1.21. (1S,2R)-1-Methyl-2-phenyl-cyclopropanecarboxylic acid
4.1.9. Ethyl (1R,2S)-1-ethyl-2-phenyl-cyclopropanecarboxylic acid
(11b)
(15a)
Yield 94%. 1H NMR (CDCl3)
d (ppm): 7.36e7.30 (m, 2H),
Compound 11b was prepared as described by Bray et al. [54].
7.29e7.24 (m, 1H), 7.23e7.19 (m, 2H), 2.92 (dd, J ¼ 7.3, 9.3 Hz, 1H),
1.80 (dd, J ¼ 4.6, 9.0 Hz,1H),1.30e1.25 (m,1H),1.01 (s, 3H). MS (ESI):
m/z: 175 [MꢂH]ꢂ.
4.1.10. Ethyl (1S,2R)-1-ethyl-2-phenyl-cyclopropanecarboxylate
(12b)
Yield 63%. 1H NMR (CDCl3)
d (ppm): 7.35e7.16 (m, 5H),
4.1.22. (1R,2S)-1-Ethyl-2-phenyl-cyclopropanecarboxylic acid
4.32e4.05 (m, 2H), 2.89e2.75 (m, 1H), 1.73e1.58 (m, 2H), 1.30 (t,
J ¼ 7.1 Hz, 3H), 1.20e1.14 (m, 1H), 1.06e0.79 (m, 4H).
(14b)
Yield 95%. 1H NMR (DMSO-d6)
d (ppm): 12.28 (bs, 1H), 7.37e7.12
(m, 5H), 2.69 (dd, J ¼ 7.3, 8.8 Hz, 1H), 1.53e1.35 (m, 2H), 1.31 (dd,
J ¼ 4.4, 6.8 Hz, 1H), 1.02e0.84 (m, 1H), 0.76 (t, J ¼ 7.3 Hz, 3H). MS
(ESI): m/z: 189 [MꢂH]ꢂ.
4.1.11. Ethyl (1R,2S)-1,2-diphenylcyclopropanecarboxylate (11d)
Yield: quantitative. MS (ESI): m/z: 267 [MþH]þ.
4.1.12. Ethyl (1S,2R)-1,2-diphenylcyclopropanecarboxylate (12d)
Yield: 70% MS (ESI): m/z: 267 [MþH]þ.
4.1.23. (1S,2R)-1-Ethyl-2-phenyl-cyclopropanecarboxylic acid
(15b)
Yield 66%. 1H NMR (DMSO-d6)
d (ppm): 12.25 (s, 1H), 7.34e7.26
4.1.13. Ethyl (1S,2S)-1-benzyl-2-phenyl-cyclopropanecarboxylic
acid (11e)
(m, 2H), 7.25e7.17 (m, 3H), 2.74e2.65 (m, 1H), 1.50e1.35 (m, 2H),
1.34e1.25 (m, 1H), 0.98e0.85 (m, 1H), 0.76 (t, J ¼ 1.0 Hz, 3H). MS
(ESI): m/z: 189 [MꢂH]ꢂ.
Compound 11e was prepared as described by Bray et al. [54].
4.1.14. Ethyl (1R,2R)-1-benzyl-2-phenyl-cyclopropanecarboxylate
4.1.24. (1R,2S)-1,2-Diphenylcyclopropanecarboxylic acid (14d)
(12e)
Yield 67%. 1H NMR (DMSO-d6)
d (ppm): 12.6e12.3 (m, 1H),
Yield 63%. 1H NMR (CDCl3)
d (ppm): 7.42e7.03 (m, 10H),
7.12e6.96 (m, 8H), 6.86e6.81 (m, 2H), 3.05e2.98 (m, 1H), 2.27e2.15
4.21e4.01 (m, 2H), 3.24e3.17 (m, 1H), 2.89e2.84 (m, 1H), 2.04e1.97
(m, 1H), 1.92e1.87 (m, 1H), 1.46e1.40 (m, 1H), 1.20 (t, J ¼ 7.1 Hz, 3H).
MS (ESI): m/z: 281 [MþH]þ.
(m, 1H), 2.05e1.88 (m, 1H). MS (ESI): m/z: 237 [MꢂH]ꢂ.
4.1.25. (1S,2R)-1,2-Diphenylcyclopropanecarboxylic acid (15d)
The following ethyl esters were hydrolysed following the pro-
cedure for the acrylic acid 14a:
Yield 80%.1H NMR (CDCl3)
d (ppm): 11.96e8.25 (m,1H), 7.12e7.17
(m, 3H), 7.02e7.10 (m, 5H), 6.75e6.82 (m, 2H), 3.24e3.10 (m, 1H),
2.27e2.15 (m, 1H), 2.05e1.88 (m, 1H). MS (ESI): m/z: 237 [MꢂH]ꢂ.
4.1.15. trans-1-Methyl-2-phenyl-cyclopropanecarboxylic acid (13a)
Yield 57%. 1H NMR (DMSO-d6)
d (ppm): 12.40 (bs, 1H), 7.33e7.16
4.1.26. (1S,2S)-1-Benzyl-2-phenyl-cyclopropanecarboxylic acid
(m, 5H), 2.70e2.59 (m, 1H), 1.53e1.41 (m, 1H), 1.29e1.21 (m, 1H),
(14e)
0.85 (s, 3H). MS (ESI): m/z: 175 [MꢂH]ꢂ.
Yield 67%. 1H NMR (DMSO-d6)
d (ppm): 12.34 (s, 1H), 7.50e7.49
(m, 1H), 7.54e7.05 (m, 10H), 6.97e6.96 (m, 1H), AB System:
VA ¼ 2.96, VB ¼ 1.97, JAB ¼ 15.4 Hz, 2.81e2.68 (m, 1H), 1.77e1.61
(m, 1H), 1.58e1.47 (m, 1H). MS (ESI): m/z: 251 [MꢂH]ꢂ.
4.1.16. trans-1-Ethyl-2-phenyl-cyclopropanecarboxylic acid (13b)
Yield 96%. 1H NMR (DMSO-d6)
d (ppm): 12.26 (bs, 1H), 7.34e7.16
(m, 5H), 2.69 (m, 1H), 1.51e1.36 (m, 2H), 1.31 (m, 1H), 1.00e0.86 (m,
1H), 0.76 (t, J ¼ 7.1 Hz, 3H). MS (ESI): m/z: 189 [MꢂH]ꢂ.
4.1.27. (1R,2R)-1-Benzyl-2-phenyl-cyclopropanecarboxylic acid
(15e)
Yield 78%. 1H NMR (CDCl3)
d (ppm):12.07e9.85 (m, 1H),
4.1.17. trans-2-Phenyl-1-propyl-cyclopropanecarboxylic acid (13c)
Yield 57%. 1H NMR (DMSO-d6)
d (ppm): 12.23 (s, 1H), 7.34e7.26
7.44e7.09 (m, 10H), 3.30e3.19 (m, 1H), 3.02e2.95 (m, 1H),
2.00e1.91 (m, 2H), 1.55e1.46 (m, 1H). MS (ESI): m/z: 251 [MꢂH]ꢂ.
Curtius rearrangement with diphenyl phosphorazidate was
performed for the following derivatives according to the procedure
for intermediate 17a:
(m, 2H), 7.25e7.17 (m, 3H), 2.68e2.61 (m, 1H), 1.51e1.45 (m, 1H),
1.44e1.36 (m, 1H), 1.32 (dd, J ¼ 4.6, 7.1 Hz, 1H), 1.30e1.18 (m, 2H),
0.86e0.75 (m, 1H), 0.65 (t, J ¼ 7.3 Hz, 3H). MS (ESI): m/z: 203
[MꢂH]ꢂ.
4.1.18. trans-1-Benzyl-2-phenyl-cyclopropanecarboxylic acid (13e)
4.1.28. tert-Butyl-N-[trans-1-methyl-2-phenyl-cyclopropyl]
Yield 70%. 1H NMR (DMSO-d6)
d
(ppm): 12.4e12.2 (m, 1H),
carbamate (16a)
7.35e6.10 (m, 10H), 3.00e2.92 (m, 1H), 2.78e2.71 (m, 1H),
2.00e1.94 (m, 1H), 1.69e1.64 (m, 1H), 1.57e1.52 (m, 1H). MS (ESI):
m/z: 237 [MꢂH]ꢂ.
Yield 60%. 1H NMR (DMSO-d6)
d (ppm): 7.34 (bs, 1H), 7.31e7.15
(m, 5H), 2.22e2.08 (m, 1H), 1.39 (s, 9H), 1.10e0.98 (m, 2H), 0.86 (s,
3H). MS (ESI): m/z: 192 [MH-56]þ.

360
P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
4.1.29. tert-Butyl-N-[trans-1-ethyl-2-phenyl-cyclopropyl]
4.1.39. tert-Butyl-N-[(1S,2S)-1-benzyl-2-phenyl-cyclopropyl]
carbamate (16b)
carbamate (17e)
Yield 50%. 1H NMR (DMSO-d6)
d
(ppm): 7.41e7.17 (m, 5H), 5.02
Yield 33%. 1H NMR (CDCl3)
d (ppm): 7.62e7.31 (m, 4H), 7.29e7.15
(bs, 1H), 2.51e2.39 (m, 1H), 1.66e1.40 (m, 10H), 1.20e1.09 (m, 1H),
(m, 4H), 7.09e6.95 (m, 2H), 4.82 (s, 1H), AB System: VA ¼ 3.01,
VB ¼ 2.02, JAB ¼ 13.9 Hz, 2.62e2.41 (m, 1H), 1.56 (s, 9H), 1.36e1.25
(m, 1H), 1.20e0.95 (m, 1H).
1.05e0.99 (m,1H), 0.97e0.79 (m, 4H). MS (ESI): m/z: 206 [MH-56]þ.
4.1.30. tert-Butyl-N-[trans-1-propyl-2-phenyl-cyclopropyl]
4.1.40. tert-Butyl-N-[(1R,2R)-1-benzyl-2-phenyl-cyclopropyl]
carbamate (16c)
Yield 60%. 1H NMR (CDCl3)
d (ppm): 7.45e7.06 (m, 5H), 5.01 (s,
carbamate (18e)
Yield 35%. 1H NMR (CDCl3)
d (ppm): 7.62e6.92 (m, 10H), 4.82 (s,
1H), 2.47e2.32 (m, 1H), 1.65e1.26 (m, 12H), 1.19e1.11 (m, 1H),
1.07e1.00 (m, 1H), 0.78 (t, J ¼ 7.3 Hz, 4H). MS (ESI): m/z: 276 [MH]þ.
1H), 3.01 (m, 1H), 2.61e2.47 (m, 1H), 2.16e1.96 (m, 1H), 1.68e1.40
(m, 9H), 1.34e1.28 (m, 1H), 1.18e1.13 (m, 1H). MS (ESI): m/z: 224
[MH-100]þ.
The following cyclopropylamines were deprotected according to
the procedure for the amine 20a:
4.1.31. tert-Butyl-N-[trans-1-benzyl-2-phenyl-cyclopropyl]
carbamate (16e)
Yield 33%. 1H NMR (CDCl3)
d (ppm): 7.50e7.18 (m, 8H),
7.05e7.00 (m, 2H), 4.82 (s, 1H), 3.05e2.95 (m, 1H), 2.56e2.51 (m,
1H), 2.11e1.96 (m, 1H), 1.70e1.40 (m, 9H), 1.33e1.28 (m, 1H),
1.18e1.13 (m, 1H). MS (ESI): m/z: 224 [MH-100]þ.
4.1.41. trans-1-Methyl-2-phenyl-cyclopropanamine hydrochloride
(19a)
Yield 96%. 1H NMR (DMSO-d6)
d (ppm): 8.42 (bs, 3H), 7.40e7.13
(m, 5H), 2.48e2.45 (m, 1H), 1.41e1.34 (m, 1H), 1.28e1.20 (m, 1H),
4.1.32. tert-Butyl-N-[trans-1-(2-naphthylmethyl)-2-phenyl-
1.02 (s, 3H). MS (ESI): m/z: 148 ([MþH]þ). Purity: 96%.
cyclopropyl]carbamate (16f)
Yield 36%. 1H NMR (CDCl3)
d (ppm): 7.83e7.79 (m, 1H),
4.1.42. trans-1-Ethyl-2-phenyl-cyclopropanamine hydrochloride
7.76e7.70 (m, 2H), 7.54e7.36 (m, 7H), 7.32e7.26 (m, 1H), 7.20e7.15
(m, 1H), 4.80 (s, 1H), 3.36e2.96 (m1 H), 2.60e2.52 (m, 1H),
2.31e2.17 (m, 1H), 1.65e1.45 (m, 8H), 1.44e1.38 (m, 1H), 1.24e1.16
(m, 1H), 1.25e1.12 (m, 1H): m/z: 274 [MH-100]þ.
(19b)
Yield 97%. 1H NMR (DMSO-d6)
d (ppm): 8.28 (s, 3H), 7.36e7.29
(m, 2H), 7.28e7.21 (m, 3H), 2.59e2.44 (m, 1H), 1.39e1.27 (m, 3H),
1.27e1.16 (m, 1H), 0.79 (t, J ¼ 7.6 Hz, 3H). MS (ESI): m/z: 162
([MþH]þ). Purity: 100%.
4.1.33. tert-Butyl-N-[trans-1-(2-phenylethyl)-2-phenyl-
cyclopropyl]carbamate (16g)
4.1.43. trans-1-Propyl-2-phenyl-cyclopropanamine hydrochloride
Yield 49%. 1H NMR (CDCl3)
d (ppm): 7.54e6.77 (m, 10H), 4.99 (s,
(19c)
1H), 2.72e2.55 (m, 2H), 2.48e2.40 (m, 1H), 1.89e1.77 (m, 1H),
1.66e1.42 (m, 9H), 1.35e1.24 (m, 1H), 1.19e1.13 (m, 1H), 1.09e1.01
(m, 1H).
Yield 78%. 1H NMR (DMSO-d6)
d (ppm): 8.46 (s, 3H), 7.41e7.28
(m, 2H), 7.28e7.14 (m, 3H), 2.58e2.51 (m, 1H), 1.43e1.18 (m, 5H),
1.12e0.99 (m, 1H), 0.67 (t, J ¼ 1.0 Hz, 3H). MS (ESI): m/z: 176
([MþH]þ). Purity: 99%.
4.1.34. tert-Butyl-N-[(1S,2R)-1-methyl-2-phenyl-cyclopropyl]
carbamate (18a)
4.1.44. trans-1-Benzyl-2-phenyl-cyclopropanamine hydrochloride
Yield 59%. 1H NMR (CDCl3)
d (ppm): 7.51e7.01 (m, 5H), 5.02 (s,
(19e)
1H), 2.49e2.28 (m, 1H), 1.74e1.36 (m, 9H), 1.21e1.15 (m, 1H),
1.11e0.98 (m, 4H).
Yield 78%. 1H NMR (DMSO-d6)
d (ppm): 8.30 (s, 3H), 7.45e7.20
(m, 8H), 7.14e6.99 (m, 2H), 2.82 (d, 1H), 2.69e2.57 (m, 1H), 2.33 (d,
1H), 1.79e1.58 (m, 1H), 1.49e1.32 (m, 1H). MS (ESI): m/z: 224
([MþH]þ). Purity: 99%.
4.1.35. tert-Butyl-N-[(1R,2S)-1-ethyl-2-phenyl-cyclopropyl]
carbamate (17b)
Yield 51%. 1H NMR (CDCl3)
d (ppm): 7.45e7.12 (m, 5H), 5.02 (bs,
4.1.45. trans-1-(2-Naphthylmethyl)-2-phenyl-cyclopropanamine
1H), 2.44 (t, J ¼ 8.1 Hz, 1H), 1.72e1.39 (m, 10H), 1.02 (dd, J ¼ 5.9,
hydrochloride (19f)
6.8 Hz, 1H), 0.96e0.77 (m, 5H).
Yield 91%. 1H NMR (DMSO-d6)
d (ppm): 8.28 (s, 3H), 7.93e7.69
(m, 3H), 7.62e7.12 (m, 9H), AB System: VA ¼ 2.96, VB ¼ 2.53,
JAB ¼ 15.2 Hz, 2.75e2.59 (m, 1H), 1.87e1.72 (m, 1H), 1.51e1.37 (m,
1H). MS (ESI): m/z: 274 ([MþH]þ). Purity: 99%.
4.1.36. tert-Butyl-N-[(1S,2R)-1-ethyl-2-phenyl-cyclopropyl]
carbamate (18b)
Yield 43%. 1H NMR (CDCl3)
d (ppm): 7.45e7.12 (m, 5H), 5.02 (bs,
1H), 2.44 (t, J ¼ 8.1 Hz, 1H), 1.72e1.39 (m, 10H), 1.02 (dd, J ¼ 5.9,
4.1.46. trans-1-(2-Phenylethyl)-2-phenyl-cyclopropanamine
6.8 Hz, 1H), 0.96e0.77 (m, 5H). MS (ESI): m/z: 162 [MH-100]þ.
hydrochloride (19g)
Yield 66%. 1H NMR (DMSO-d6)
d (ppm): 8.33 (s, 3H), 7.40e7.32
4.1.37. tert-Butyl-N-[(1R,2S)-1,2-diphenylcyclopropyl]carbamate
(m, 2H), 7.31e7.23 (m, 3H), 7.22e7.14 (m, 2H), 7.13e7.06 (m, 1H),
6.87e6.76 (m, 2H), 2.66e2.53 (m, 2H), 2.48e2.40 (m,1H),1.58e1.45
(m, 2H), 1.44e1.33 (m, 2H). MS (ESI): m/z: 238 ([MþH]þ). Purity:
99%.
(17d)
Yield 67%. 1H NMR (CDCl3)
d (ppm): 7.57e6.79 (m, 10H),
5.57e5.11 (m, 1H), 2.96e2.59 (m, 1H), 1.93e1.74 (m, 1H), 1.71e1.58
(m, 1H), 1.46 (s, 9H). MS (ESI): m/z: 310 [MH]þ.
4.1.47. (1R,2S)-1-Ethyl-2-phenyl-cyclopropanamine hydrochloride
4.1.38. tert-Butyl-N-[(1S,2R)-1,2-diphenylcyclopropyl]carbamate
(20b)
(18d)
Yield 69%. 1H NMR (DMSO-d6)
d (ppm): 8.28 (s, 3H), 7.36e7.29
Yield 53%. 1H NMR (CDCl3)
d
(ppm): 7.45e6.83 (m, 10H),
(m, 2H), 7.28e7.21 (m, 3H), 2.59e2.44 (m, 1H), 1.39e1.27 (m, 3H),
1.27e1.16 (m, 1H), 0.79 (t, J ¼ 7.6 Hz, 3H). MS (ESI): m/z: 162
([MþH]þ). Purity: 99%.
5.56e5.34 (m, 1H), 2.94e2.68 (m, 1H), 1.90e1.78 (m, 1H), 1.69e1.63
(m, 1H), 1.45 (s, 9H). MS (ESI): m/z: 310 [MH]þ.

P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
361
4.1.48. (1S,2R)-1-Ethyl-2-phenyl-cyclopropanamine hydrochloride
12 mg (76%) of the desired ethyl ester 24 as yellow solid. MS (ESI):
(21b)
m/z: 206 [MþH]þ. 1H NMR (MeOH-d4)
d (ppm): 7.39e7.23 (m, 5H),
3.87 (dd, J ¼ 3.4, 7.3 Hz, 2H), 3.00 (s, 1H), 2.27 (dd, J ¼ 6.8, 8.8 Hz,
1H), 1.82 (dd, J ¼ 6.8, 10.3 Hz, 1H), 0.78 (t, J ¼ 7.3 Hz, 3H).
Yield 69%. 1H NMR (DMSO-d6)
d
(ppm): 8.35 (s, 3H), 7.36e7.29
(m, 2H), 7.27e7.18 (m, 3H), 2.58e2.50 (m, 1H), 1.43e1.28 (m, 3H),
1.26e1.13 (m, 1H), 0.79 (t, J ¼ 7.6 Hz, 3H). MS (ESI): m/z: 162
([MþH]þ). Purity: 99%.
4.1.55. trans-1-Amino-2-phenyl-cyclopropanecarboxylic acid (26)
4.1.55.1. trans-1-(tert-Butoxycarbonylamino)-2-phenyl-cyclo-
propanecarboxylic acid (25). 0.44 mL of 2 M NaOH was added to a
solution of 0.18 g (0.59 mmol) ethyl ester 23 in 10 mL EtOH. The
mixture was stirred for 24 h at 80 ꢀC. The solution was then
concentrated and the crude mixture was treated with water and
ethyl acetate. The aqueous phase was separated and acidified with
HCl and the obtained suspension was extracted with CH2Cl2. The
combined organic phases were dried over Na2SO4 and evaporated
to give 140 mg (86%) of the desired carboxylic acid 25 as white
4.1.49. (1R,2S)-1,2-Diphenylcyclopropanamine hydrochloride (20d)
Yield 71%. 1H NMR (DMSO-d6)
d (ppm): 8.95 (s, 3H), 7.37e7.31
(m, 2H), 7.26e7.18 (m, 3H), 7.12e7.00 (m, 3H), 6.97e6.93 (m, 2H),
2.87 (dd, J ¼ 7.6, 10.0 Hz, 1H), 2.13e2.06 (m, 1H), 1.85e1.79 (m, 1H).
MS (ESI): m/z: 210 ([MþH]þ). Purity: 99%.
4.1.50. (1S,2R)-1,2-Diphenylcyclopropanamine hydrochloride (21d)
Yield 47%. 1H NMR (DMSO-d6)
d (ppm): 8.96 (s, 3H), 7.43e6.76
(m, 10H), 2.93e2.81 (m, J 1H), 2.15e2.00 (m, 1H), 1.91e1.72 (m, 1H).
solid. MS (ESI): m/z: 300 [MþNa]þ. 1H NMR (CDCl3)
d (ppm):
MS (ESI): m/z: 210 ([MþH]þ). Purity: 99%.
7.39e7.20 (m, 5H), 5.33 (bs, 1H), 2.88e2.75 (m, 1H), 2.27e2.13 (m,
1H), 1.57 (dd, J ¼ 5.6, 9.5 Hz, 1H), 1.51 (s, 9H).
4.1.51. (1S,2S)-1-Benzyl-2-phenyl-cyclopropanamine hydrochloride
(20e)
4.1.55.2. trans-1-Amino-2-phenyl-cyclopropanecarboxylic acid (26).
50 mg (0.18 mmol) of the BOC-protected cyclopropanecarboxylic
acid 25 was dissolved in 1.5 mL HCl 1.25 M in MeOH and the
mixture was stirred at room temperature. for 7 h. After the evap-
oration of the solvent, the solid product was rinsed with Et2O and
evaporated under vacuum to give 30 mg (78%) of the carboxylic
acid 26 as a light brown solid. MS (ESI): m/z: 178 [MþH]þ. 1H NMR
Yield 69%. 1H NMR (DMSO-d6)
d (ppm): 8.30 (s, 3H), 7.45e7.20
(m, 8H), 7.14e6.99 (m, 2H), 2.82 (d, 1H), 2.69e2.57 (m, 1H), 2.33 (d,
1H), 1.79e1.58 (m, 1H), 1.49e1.32 (m, 1H). MS (ESI): m/z: 224
([MþH]þ). Purity: 100%.
4.1.52. (1R,2R)-1-Benzyl-2-phenyl-cyclopropanamine
hydrochloride (21e)
(DMSO-d6) d (ppm): 13.63e13.10 (m, 1H), 9.02e8.67 (m, 2H),
Yield 72%. 1H NMR (DMSO-d6)
d
(ppm): 8.32 (s, 3H), 7.42e7.20
7.40e7.07 (m, 5H), 2.94 (t, J ¼ 9.3 Hz, 1H), 2.03 (dd, J ¼ 6.1, 8.6 Hz,
(m, 8H), 7.14e7.05 (m, 2H), 2.82 (d, 1H), 2.70e2.60 (m, 1H), 2.33 (d,
1H), 1.74e1.65 (m, 1H), 1.47e1.34 (m, 1H). MS (ESI): m/z: 224
([MþH]þ). Purity: 99%.
1H), 1.79 (dd, J ¼ 5.9, 10.3 Hz, 1H).
4.1.56. 1-Amino-(trans)-2-phenyl-cyclopropyl]methanol (28)
4.1.56.1. tert-Butyl-N-[1-(hydroxymethyl)-(trans)-2-phenyl-cyclo-
propyl]carbamate (27). 0.100 g (0.327 mmol) of compound 23 was
dissolved in 1 mL THF and added dropwise to a suspension of
0.017 g (0.46 mmol) LiAlH4 in 2 mL THF at 0 ꢀC. The reaction
mixture was allowed to reach RT and stirred for 6 h. The suspension
was cooled down to 0 ꢀC and quenched with saturated sodium
bisulfate. The suspension was diluted with EtOAc and filtered
through a celite pad. The solution was dried, concentrated, and the
crude mixture was purified by column chromatography (hexane/
EtOAc from 8:2 to 1:1) to give 38 mg (44%) of the tert-butyl-
4.1.53. (1S,2R)-1-Methyl-2-phenyl-cyclopropanamine 2,2,2-
trifluoroacetic acid (21a)
310 mg (1.24 mmol) of the BOC protected compound 18a was
dissolved in 10 mL of a mixture of CH2Cl2/TFA (96:4, v:v) and was
stirred overnight at room temperature. The solution was concen-
trated, and the solid was dissolved twice in hexane and dried in
order to eliminate the residual TFA providing the requisite cyclo-
propylamine 21a as trifluoroacetate salt (322 mg, 99%). 1H NMR
(DMSO-d6)
d (ppm): 8.30 (s, 2H), 7.26e7.14 (m, 3H), 7.13e7.07 (m,
2H), 2.65e2.54 (m, 1H), 1.54e1.40 (m, 1H), 1.14 (s, 3H), 1.11e1.03 (m,
carbamate 27 as a colourless oil. 1H NMR (CDCl3)
d (ppm): 7.44e7.15
1H). MS (ESI): m/z: 148 ([MþH]þ). Purity: 96%.
(m, 5H), 5.28 (bs, 1H), 3.54e3.28 (m, 2H), 2.53 (dd, J ¼ 7.6, 9.0 Hz,
1H), 1.62e1.42 (m, 9H), 1.35 (t, J ¼ 6.4 Hz, 1H), 1.31e1.23 (m, 1H). MS
(ESI): m/z: 286 [MþNa]þ.
4.1.54. trans-Ethyl 1-amino-2-phenyl-cyclopropanecarboxylate
(24)
4.1.54.1. Ethyl-1-(tert-butoxycarbonylamino)-2-phenyl-cyclo-
propanecarboxylate (23). 380 mg (1.85 mmol) Ethyl 1-amino-2-
4.1.56.2. [1-Amino-(trans)-2-phenyl-cyclopropyl]methanol
(28).
0.5 mL 4 M HCl in dioxane was added to a solution of 0.03 g
(0.1 mmol) compound 27 in 0.5 mL dioxane. The reaction mixture
was stirred at RT for 4 h, then the solvent was evaporated under
vacuum and the product was triturated with Et2O. Crystallization
from MeOH/Et2O gave 16 mg (70%, hydrochloride) of the trans-
cyclopropylmethanol 28 as white solid. 1H NMR (DMSO-d6)
phenyl-cyclopropanecarboxylate
[56]
and
0.239
g
(1.85 mmol mmol) DIPEA were added to a solution of 0.404 g
(1.85 mmol) tert-butoxycarbonyl-tert-butyl carbonate in 5 mL
CH2Cl2. The mixture was stirred for 20 h at RT. Water was added
and the product was extracted with CH2Cl2. The combined organic
phases were dried over Na2SO4 and evaporated. The crude mixture
was purified by column chromatography (hexane/EtOAc 9:1) to
give 210 mg of the trans isomer 23 as colourless oil (37%). 1H NMR
d
(ppm): 8.41 (bs, 3H), 7.39e7.16 (m, 5H), 5.16 (bs, 1H), 3.29 (dd,
J ¼ 4.6, 12.0 Hz, 1H), 3.21e3.07 (m, 1H), 2.57 (t, J ¼ 8.6 Hz, 1H), 1.37
(d, J ¼ 7.3 Hz, 2H). MS (ESI): m/z: 164 [MþH]þ.
(DMSO-d6)
d (ppm): 7.79 (s, 1H), 7.36e7.09 (m, 5H), 3.81e3.55 (m,
2H), 2.72 (t, J ¼ 8.8 Hz, 1H), 2.08e1.92 (m, 1H), 1.47e1.20 (m, 10H),
4.2. Biological assays
0.90e0.65 (m, 3H). MS (ESI): m/z: 206 [M-100þH]þ.
4.2.1. KDM1A (LSD1) enzyme inhibition assay
4.1.54.2. trans-Ethyl
1-amino-2-phenyl-cyclopropanecarboxylate
The complex of human recombinant KDM1A/CoREST protein
was produced in Escherichia coli as separate proteins and co-
purified following previously reported procedures [16,67]. The
experiments were performed in 96 well half area white plates (cat.
3693, Corning, Corning, NY) using a mono-methylated H3-K4
(24). 20 mg (0.065 mmol) of the ethyl ester 23 was dissolved in
1.5 mL of HCl 1.25 M in MeOH and the mixture was stirred at room
temperature for 7 h. After the evaporation of the solvent, the solid
product was rinsed with Et2O and evaporated under vacuum to give

362
P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
peptide containing 21 amino acids (custom synthesis done by
Thermo Scientific) as substrate and in a in 40 l volume of 50 mM
TRIS-HCl, pH 8.0 and 0.05 mg/ml BSA buffer. The peptide purity was
>95% as checked by analytical high-pressure liquid chromatog-
raphy and mass spectrometry.
(DMSO). After 24 h the cells were collected for RNA analysis. Total
RNA was purified using RNeasy Mini Kit (Qiagen, Valencia, CA),
quantified and reverse transcribed. mRNA levels were measured by
quantitative RT-PCR (Fast SYBR Green Master mix, Applied Bio-
systems Foster City, CA) using specific primers and normalized
against TBP mRNA. Results are presented as fold induction relative
to vehicle treated cells (DMSO). Primers used in this study were:
Gfi1b, TCTGGCCTCATGCCCTTA e TCTGGCCTCATGCCCTTA;
m
The demethylase activity was estimated under aerobic condi-
tions and at RT by measuring the release of H2O2 produced during
the catalytic process by the Amplex® UltraRed detection system
coupled with horseradish peroxidase (HRP). Briefly, 20 nM of
KDM1A/CoREST complex was incubated at RT for 15 min in the
absence and/or the presence of various concentrations of the in-
TBP, GCTGGCCCATAGTGATCTTT e CTTCACACGCCAAGAAACAGT.
Acknowledgement
hibitors, 50 m mM
M Amplex® UltraRed (Life Technologies) and 0.023
HRP (Sigma) in 50 mM TriseHCl pH 8.0 and 0.05 mg/ml BSA. The
inhibitors were tested twice in duplicates at each concentration.
Tranylcypromine (Sigma) was used as control. After preincubation
of the enzyme with the inhibitor, the reaction was initiated by
This work was supported by Fondazione Cariplo (2010.0778),
AIRC (IG-11342), MIUR (Progetto Epigen and RF-2010-2318330),
FIRB RBFR10ZJQT, Sapienza Ateneo Project 2012, IIT-Sapienza
Project, FP7 Project BLUEPRINT/282510, and Regione Lombardia,
Fondo per la Promozione di Accordi Istituzionale, Bando di Invito di
cui al Decreto n. 4779 del 14/05/2009, Progetto DiVA.
addition of 4.5 mМ of mono-methylated H3-K4 peptide. The con-
version of the Amplex® Ultra Red reagent to Amplex® UltroxRed
was monitored by fluorescence (excitation at 510 nm, emission at
595 nm) for 12 min and by using a microplate reader (Infinite 200,
Tecan Group, Switzerland). Arbitrary units were used to measure
the level of H2O2 produced in the absence and/or in the presence of
inhibition. The maximum demethylase activity of KDM1A/CoREST
was obtained in the absence of inhibitors and corrected for back-
ground fluorescence in the absence of KDM1A/CoREST. The IC50
was calculated using GraphPad Prism version 4.0 (GraphPad Soft-
ware, San Diego, CA).
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.ejmech.2014.08.068.
References
[1] T. Jenuwein, C.D. Allis, Translating the histone code, Science 293 (2001)
1074e1080.
[2] S.L. Berger, Histone modifications in transcriptional regulation, Curr. Opin.
Genet. Dev. 12 (2002) 142e148.
[3] S.L. Berger, The complex language of chromatin regulation during transcrip-
tion, Nature 447 (2007) 407e412.
[4] M.R. Hubner, M.A. Eckersley-Maslin, D.L. Spector, Chromatin organization and
transcriptional regulation, Curr. Opin. Genet. Dev. 23 (2013) 89e95.
[5] C. Biancotto, G. Frige, S. Minucci, Histone modification therapy of cancer, Adv.
Genet. 70 (2010) 341e386.
[6] T. Waldmann, R. Schneider, Targeting histone modifications e epigenetics in
cancer, Curr. Opin. Cell Biol. 25 (2013) 184e189.
[7] P.A. Marks, Discovery and development of SAHA as an anticancer agent,
Oncogene 26 (2007) 1351e1356.
[8] P.A. Marks, R. Breslow, Dimethyl sulfoxide to vorinostat: development of this
histone deacetylase inhibitor as an anticancer drug, Nat. Biotechnol. 25 (2007)
84e90.
4.2.2. Structural studies
Crystals of KDM1A/CoREST were obtained as described [47]. For
structure determination of enzyme-inhibitor complexes, crystals
were soaked for 3e8 h in a solution consisting of consisting of 1.3 M
sodium/potassium tartrate, 100 mM N-(2-acetamido)-2-
iminodiacetic acid pH 6.5, 12% (v/v) glycerol, and 0.5e1 mM in-
hibitor. Diffraction data were measured at beamlines of the Euro-
pean Synchrotron Radiation Facility (Grenoble, France) and the
Swiss Light Source (Villigen, Switzerland). Data processing and
coordinate refinement were performed with programs of the CCP4
package [68]. Pictures were produced with CCP4mg [69] (Table 4).
[9] C. Grant, F. Rahman, R. Piekarz, C. Peer, R. Frye, R.W. Robey, E.R. Gardner,
W.D. Figg, S.E. Bates, Romidepsin: a new therapy for cutaneous T-cell lym-
phoma and a potential therapy for solid tumors, Expert Rev. Anticancer Ther.
10 (2010) 997e1008.
[10] S. Jain, J. Zain, Romidepsin in the treatment of cutaneous T-cell lymphoma,
J. Blood Med. 2 (2011) 37e47.
[11] Y. Zhang, D. Reinberg, Transcription regulation by histone methylation:
interplay between different covalent modifications of the core histone tails,
Genes Dev. 15 (2001) 2343e2360.
[12] A. Spannhoff, A.T. Hauser, R. Heinke, W. Sippl, M. Jung, The emerging thera-
peutic potential of histone methyltransferase and demethylase inhibitors,
ChemMedChem 4 (2009) 1568e1582.
4.2.3. Bioluminescent-coupled assay for monoamine oxidases (MAO
Glo Assay)
The MAO Glo Assay from Promega (cat. V1402, Promega, Mad-
ison, WI) was used to measure the effect of inhibitors on MAO A and
MAO B activity. Human recombinant MAO A and MAO B were
expressed in Pichia pastoris and purified as published [70]. The
assay was performed at RT in 50
m
L (25
m
L reaction solution þ 25
mL
detection reagent) in 96 well half area white plates (cat. 3693,
Corning, Corning, NY). Luminescence was measured after 20 min
incubation in the dark using a microplate reader (Infinite F200,
Tecan Group, Switzerland) with an integration time of 0.25 s per
well. 50 nM MAO A or 125 nM MAO B were incubated with five
[13] C. Loenarz, C.J. Schofield, Expanding chemical biology of 2-oxoglutarate oxy-
genases, Nat. Chem. Biol. 4 (2008) 152e156.
[14] S.S. Ng, K.L. Kavanagh, M.A. McDonough, D. Butler, E.S. Pilka, B.M. Lienard,
J.E. Bray, P. Savitsky, O. Gileadi, F. von Delft, N.R. Rose, J. Offer, J.C. Scheinost,
T. Borowski, M. Sundstrom, C.J. Schofield, U. Oppermann, Crystal structures of
histone demethylase JMJD2A reveal basis for substrate specificity, Nature 448
(2007) 87e91.
[15] J.C. Culhane, P.A. Cole, LSD1 and the chemistry of histone demethylation, Curr.
Opin. Chem. Biol. 11 (2007) 561e568.
[16] F. Forneris, C. Binda, E. Battaglioli, A. Mattevi, LSD1: oxidative chemistry for
multifaceted functions in chromatin regulation, Trends Biochem. Sci. 33
(2008) 181e189.
[17] F. Forneris, E. Battaglioli, A. Mattevi, C. Binda, New roles of flavoproteins in
molecular cell biology: histone demethylase LSD1 and chromatin, FEBS J. 276
(2009) 4304e4312.
[18] Y. Shi, F. Lan, C. Matson, P. Mulligan, J.R. Whetstine, P.A. Cole, R.A. Casero,
Histone demethylation mediated by the nuclear amine oxidase homolog
LSD1, Cell 119 (2004) 941e953.
[19] D.N. Ciccone, H. Su, S. Hevi, F. Gay, H. Lei, J. Bajko, G. Xu, E. Li, T. Chen, KDM1B
is a histone H3K4 demethylase required to establish maternal genomic im-
prints, Nature 461 (2009) 415e418.
different inhibitor concentrations (from 0.004 mM to 100 mM) for
15 min at RT in Promega MAO Buffer or Promega MAO B Buffer
(MAO Glo Assay kit, catalogue number V1402, Promega, Madison,
WI). After 30 min of incubation the reaction was stopped with the
Promega detection reagent. All compounds were tested twice and
IC50 values were calculated using GraphPad Prism version 4.0
(GraphPad Software, San Diego, CA).
4.2.4. Cell studies (transcriptional assay)
Human APL NB4 cells were grown in RPMI supplemented with
10% foetal bovine serum, 2 mM L-glutamine, and antibiotics and
maintained in a humidified tissue culture incubator at 37 ꢀC in 5%
CO2. Cells were treated at the biochemical IC50 or with vehicle

P. Vianello et al. / European Journal of Medicinal Chemistry 86 (2014) 352e363
363
[20] A. Karytinos, F. Forneris, A. Profumo, G. Ciossani, E. Battaglioli, C. Binda,
A. Mattevi, A novel mammalian flavin-dependent histone demethylase, J. Biol.
Chem. 284 (2009) 17775e17782.
[21] R. Schneider, A.J. Bannister, F.A. Myers, A.W. Thorne, C. Crane-Robinson,
T. Kouzarides, Histone H3 lysine 4 methylation patterns in higher eukaryotic
genes, Nat. Cell Biol. 6 (2004) 73e77.
[22] G. Liang, J.C. Lin, V. Wei, C. Yoo, J.C. Cheng, C.T. Nguyen, D.J. Weisenberger,
G. Egger, D. Takai, F.A. Gonzales, P.A. Jones, Distinct localization of histone H3
acetylation and H3-K4 methylation to the transcription start sites in the hu-
man genome, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 7357e7362.
[23] Y. Huang, E. Greene, T. Murray Stewart, A.C. Goodwin, S.B. Baylin, P.M. Woster,
R.A. Casero Jr., Inhibition of lysine-specific demethylase 1 by polyamine an-
alogues results in reexpression of aberrantly silenced genes, Proc. Natl. Acad.
Sci. U. S. A. 104 (2007) 8023e8028.
[24] E. Metzger, M. Wissmann, N. Yin, J.M. Muller, R. Schneider, A.H. Peters,
T. Gunther, R. Buettner, R. Schule, LSD1 demethylates repressive histone
marks to promote androgen-receptor-dependent transcription, Nature 437
(2005) 436e439.
inhibitors can block memory consolidation, ACS Chem. Neurosci. 3 (2012)
120e128.
[46] R. Ueda, T. Suzuki, K. Mino, H. Tsumoto, H. Nakagawa, M. Hasegawa, R. Sasaki,
T. Mizukami, N. Miyata, Identification of cell-active lysine specific demethy-
lase 1-selective inhibitors, J. Am. Chem. Soc. 131 (2009) 17536e17537.
[47] C. Binda, S. Valente, M. Romanenghi, S. Pilotto, R. Cirilli, A. Karytinos,
G. Ciossani, O.A. Botrugno, F. Forneris, M. Tardugno, D.E. Edmondson,
S. Minucci, A. Mattevi, A. Mai, Biochemical, structural, and biological evalua-
tion of tranylcypromine derivatives as inhibitors of histone demethylases
LSD1 and LSD2, J. Am. Chem. Soc. 132 (2010) 6827e6833.
[48] D.M. Schmidt, D.G. McCafferty, trans-2-Phenylcyclopropylamine is
a
mechanism-based inactivator of the histone demethylase LSD1, Biochemistry
46 (2007) 4408e4416.
[49] M. Yang, J.C. Culhane, L.M. Szewczuk, P. Jalili, H.L. Ball, M. Machius, P.A. Cole,
H. Yu, Structural basis for the inhibition of the LSD1 histone demethylase by
the antidepressant trans-2-phenylcyclopropylamine, Biochemistry 46 (2007)
8058e8065.
[50] D.M. Gooden, D.M. Schmidt, J.A. Pollock, A.M. Kabadi, D.G. McCafferty, Facile
synthesis of substituted trans-2-arylcyclopropylamine inhibitors of the hu-
man histone demethylase LSD1 and monoamine oxidases A and B, Bioorg.
Med. Chem. Lett. 18 (2008) 3047e3051.
[25] J. Huang, R. Sengupta, A.B. Espejo, M.G. Lee, J.A. Dorsey, M. Richter, S. Opravil,
R. Shiekhattar, M.T. Bedford, T. Jenuwein, S.L. Berger, p53 is regulated by the
lysine demethylase LSD1, Nature 449 (2007) 105e108.
[26] J. Wang, S. Hevi, J.K. Kurash, H. Lei, F. Gay, J. Bajko, H. Su, W. Sun, H. Chang,
G. Xu, F. Gaudet, E. Li, T. Chen, The lysine demethylase LSD1 (KDM1) is
required for maintenance of global DNA methylation, Nat. Genet. 41 (2009)
125e129.
[51] D.B. Denney, M.J. Boskin, Formation of cyclopropanes from phosphoranes and
epoxides, J. Am. Chem. Soc. 81 (1959) 6330e6331.
[52] W.S.J. Wadsworth, W.D. Emmons, The utility of phosphonate carbanions in
olefin synthesis, J. Am. Chem. Soc. 83 (1961) 1733.
[27] T.B. Nicholson, T. Chen, LSD1 demethylates histone and non-histone proteins,
Epigenetics 4 (2009) 129e132.
[28] H. Kontaki, I. Talianidis, Lysine methylation regulates E2F1-induced cell death,
Mol. Cell 39 (2010) 152e160.
[53] A. Armstrong, J.N. Scutt, Stereocontrolled synthesis of 3-(trans-2-
aminocyclopropyl)alanine, a key component of belactosin A, Org. Lett. 5
(2003) 2331e2334.
[54] C.D. Bray, F. Minicone, Stereocontrolled synthesis of quaternary cyclopropyl
esters, Chem. Commun. Camb. 46 (2010) 5867e5869.
[55] A.R. Patel, 1,2-Diarylcyclopropane derivatives, Acta Chem. Scand. 20 (1966)
1424e1426.
[56] R.P. Wurz, A.B. Charette, An expedient and practical method for the synthesis
of a diverse series of cyclopropane alpha-amino acids and amines, J. Org.
Chem. 69 (2004) 1262e1269.
[57] R.R. Vunnam, D. Bond, R.A. Schatz, N.S. Radin, N. Narasimhachari, A new class
of monoamine oxidase inhibitors, J. Neurochem. 34 (1980) 410e416.
[58] A.J. Christmas, C.J. Coulson, D.R. Maxwell, D. Riddell, A comparison of the
pharmacological and biochemical properties of substrate-selective mono-
amine oxidase inhibitors, Br. J. Pharmacol. 45 (1972) 490e503.
[59] C.L. Zirkle, C. Kaiser, D.H. Tedeschi, R.E. Tedeschi, A. Burger, 2-Substituted
cyclopropylamines. Ii. Effect of structure upon monoamine oxidase-
inhibitory activity as measured in vivo by potentiation of tryptamine con-
vulsions, J. Med. Pharm. Chem. 91 (1962) 1265e1284.
[60] A. Burger, C.S. Davis, H. Green, D.H. Tedeschi, C.L. Zirkle, 1-Methyl-2-
phenylcyclopropylamine, J. Med. Pharm. Chem. 4 (1961) 571e574.
[61] M.P. Valley, W. Zhou, E.M. Hawkins, J. Shultz, J.J. Cali, T. Worzella, L. Bernad,
T. Good, D. Good, T.L. Riss, D.H. Klaubert, K.V. Wood, A bioluminescent assay
for monoamine oxidase activity, Anal. Biochem. 359 (2006) 238e246.
[62] L. De Colibus, M. Li, C. Binda, A. Lustig, D.E. Edmondson, A. Mattevi, Three-
dimensional structure of human monoamine oxidase A (MAO A): relation to
the structures of rat MAO A and human MAO B, Proc. Natl. Acad. Sci. U. S. A.
102 (2005) 12684e12689.
[29] H.S. Cho, T. Suzuki, N. Dohmae, S. Hayami, M. Unoki, M. Yoshimatsu,
G. Toyokawa, M. Takawa, T. Chen, J.K. Kurash, H.I. Field, B.A. Ponder,
Y. Nakamura, R. Hamamoto, Demethylation of RB regulator MYPT1 by histone
demethylase LSD1 promotes cell cycle progression in cancer cells, Cancer Res.
71 (2011) 655e660.
[30] J.T. Lynch, W.J. Harris, T.C. Somervaille, LSD1 inhibition: a therapeutic strategy
in cancer? Expert Opin. Ther. Targets 16 (2012) 1239e1249.
[31] S. Hayami, J.D. Kelly, H.S. Cho, M. Yoshimatsu, M. Unoki, T. Tsunoda, H.I. Field,
D.E. Neal, H. Yamaue, B.A. Ponder, Y. Nakamura, R. Hamamoto, Over-
expression of LSD1 contributes to human carcinogenesis through chromatin
regulation in various cancers, Int. J. Cancer 128 (2011) 574e586.
[32] I. Hoffmann, M. Roatsch, M.L. Schmitt, L. Carlino, M. Pippel, W. Sippl, M. Jung,
The role of histone demethylases in cancer therapy, Mol. Oncol. 6 (2012)
683e703.
[33] D. Rotili, A. Mai, Targeting histone demethylases: a new avenue for the fight
against cancer, Genes Cancer 2 (2011) 663e679.
[34] T. Schenk, W.C. Chen, S. Gollner, L. Howell, L. Jin, K. Hebestreit, H.U. Klein,
A.C. Popescu, A. Burnett, K. Mills, R.A. Casero Jr., L. Marton, P. Woster,
M.D. Minden, M. Dugas, J.C. Wang, J.E. Dick, C. Muller-Tidow, K. Petrie,
A. Zelent, Inhibition of the LSD1 (KDM1A) demethylase reactivates the all-
trans-retinoic acid differentiation pathway in acute myeloid leukemia, Nat.
Med. 18 (2012) 605e611.
[35] F. Crea, L. Sun, A. Mai, Y.T. Chiang, W.L. Farrar, R. Danesi, C.D. Helgason, The
emerging role of histone lysine demethylases in prostate cancer, Mol. Cancer
11 (2012) 52.
[63] S. Saleque, J. Kim, H.M. Rooke, S.H. Orkin, Epigenetic regulation of hemato-
poietic differentiation by Gfi-1 and Gfi-1b is mediated by the cofactors CoREST
and LSD1, Mol. Cell 27 (2007) 562e572.
[36] S. Lim, A. Janzer, A. Becker, A. Zimmer, R. Schule, R. Buettner, J. Kirfel, Lysine-
specific demethylase
1 (LSD1) is highly expressed in ER-negative breast
cancers and a biomarker predicting aggressive biology, Carcinogenesis 31
(2010) 512e520.
[37] M.M. Singh, C.A. Manton, K.P. Bhat, W.W. Tsai, K. Aldape, M.C. Barton,
J. Chandra, Inhibition of LSD1 sensitizes glioblastoma cells to histone deace-
tylase inhibitors, Neuro Oncol. 13 (2011) 894e903.
[64] R.B. Silverman, P.A. Zieske, Mechanism of inactivation of monoamine oxidase
by 1-phenylcyclopropylamine, Biochemistry 24 (1985) 2128e2138.
[65] K. Hackeloer, G. Schnakenburg, S.R. Waldvogel, Oxidative coupling reaction of
1,3-diarylpropene derivatives to dibenzo[a,c]cycloheptene by PIFA, Eur. J. Org.
Chem. (2011) 6314e6319.
[38] J.H. Schulte, S. Lim, A. Schramm, N. Friedrichs, J. Koster, R. Versteeg, I. Ora,
K. Pajtler, L. Klein-Hitpass, S. Kuhfittig-Kulle, E. Metzger, R. Schule, A. Eggert,
R. Buettner, J. Kirfel, Lysine-specific demethylase 1 is strongly expressed in
poorly differentiated neuroblastoma: implications for therapy, Cancer Res. 69
(2009) 2065e2071.
[39] M.G. Lee, C. Wynder, D.M. Schmidt, D.G. McCafferty, R. Shiekhattar, Histone
H3 lysine 4 demethylation is a target of nonselective antidepressive medi-
cations, Chem. Biol. 13 (2006) 563e567.
[66] G. Ozer, N. Saracoglu, M. Balci, Synthesis and chemistry of unusual bicyclic
endoperoxides containing the pyridazine ring, J. Org. Chem. 68 (2003)
7009e7015.
[67] F. Forneris, C. Binda, A. Adamo, E. Battaglioli, A. Mattevi, Structural basis of
LSD1-CoREST selectivity in histone H3 recognition, J. Biol. Chem. 282 (2007)
20070e20074.
[68] M.D. Winn, C.C. Ballard, K.D. Cowtan, E.J. Dodson, P. Emsley, P.R. Evans,
R.M. Keegan, E.B. Krissinel, A.G. Leslie, A. McCoy, S.J. McNicholas,
G.N. Murshudov, N.S. Pannu, E.A. Potterton, H.R. Powell, R.J. Read, A. Vagin,
K.S. Wilson, Overview of the CCP4 suite and current developments, Acta
Crystallogr. D Biol. Crystallogr. 67 (2011) 235e242.
[40] B. Lohse, J.L. Kristensen, L.H. Kristensen, K. Agger, K. Helin, M. Gajhede,
R.P. Clausen, Inhibitors of histone demethylases, Bioorg. Med. Chem. 19
(2011) 3625e3636.
[41] A. Ortega Munoz, M.C.T. Fyfe, M. Martinell Pedemonte, M. Estiarte Martinez,
N. Valls Vidal, G. Kurz, J.C. Castro Palomino Laria, (Hetero)aryl Cyclopropyl-
amine Compounds as LSD1 Inhibitors, 2013. WO2013/057320.
[42] N.W. Johnson, J. Kasparec, W.H. Miller, M.B. Rouse, D. Suarez, X. Tian, Cyclo-
propylamines as LSD1 Inhibitors, 2012. WO2012/135113.
[43] http://www.clinicaltrials.gov/ct2/show/NCT02034123?term¼lsd1&rank¼3.
[44] www.clinicaltrialsregister.eu/ctr-search/trial/2013-002447-29/ES.
[45] R. Neelamegam, E.L. Ricq, M. Malvaez, D. Patnaik, S. Norton, S.M. Carlin,
I.T. Hill, M.A. Wood, S.J. Haggarty, J.M. Hooker, Brain-penetrant LSD1
[69] S. McNicholas, E. Potterton, K.S. Wilson, M.E. Noble, Presenting your struc-
tures: the CCP4mg molecular-graphics software, Acta Crystallogr. D Biol.
Crystallogr. 67 (2011) 386e394.
[70] C. Binda, M. Li, F. Hubalek, N. Restelli, D.E. Edmondson, A. Mattevi, Insights
into the mode of inhibition of human mitochondrial monoamine oxidase B
from high-resolution crystal structures, Proc. Natl. Acad. Sci. U. S. A. 100
(2003) 9750e9755.