Deoxyribonucleoside 3'-O-(2-thio- and 2-oxo-'spiro'-4,4-pentamethylene- 1,3,2-oxathiaphospholane)s: Monomers for stereocontrolled synthesis of oligo(deoxyribonucleoside phosphorothioate)s and chimeric PS/PO oligonucleotides

Article abstract of DOI:10.1021/ja973801j

New monomers, 5'-O-DMT-deoxyribonucleoside 3'-O-(2-thio-'spiro'-4,4- pentamethylene-1,3,2-oxathiaphospholane)s, were prepared and used for the stereocontrolled synthesis of PS-Oligos via the oxathiaphospholane approach. These monomers and their 2-oxo anal

Full text of DOI:10.1021/ja973801j

7156
J. Am. Chem. Soc. 1998, 120, 7156-7167
Deoxyribonucleoside 3′-O-(2-Thio- and
2-Oxo-“spiro”-4,4-pentamethylene-1,3,2-oxathiaphospholane)s:
Monomers for Stereocontrolled Synthesis of
Oligo(deoxyribonucleoside phosphorothioate)s and Chimeric PS/PO
Oligonucleotides§
Wojciech J. Stec,*,† Bolesław Karwowski,† Małgorzata Boczkowska,† Piotr Guga,†
Maria Koziołkiewicz,† Marek Sochacki,†,‡ Michał W. Wieczorek, and Jarosław Błaszczyk
Contribution from the Polish Academy of Sciences, Centre of Molecular and Macromolecular Studies,
Department of Bioorganic Chemistry, Mass Spectrometry Laboratory, Sienkiewicza 112, 90-363 Ło´dz´,
Poland, and Technical UniVersity of Ło´dz´, Institute of Technical Biochemistry, Stefanowskiego 4/10,
90-924 Ło´dz´, Poland
ReceiVed NoVember 4, 1997
Abstract: New monomers, 5′-O-DMT-deoxyribonucleoside 3′-O-(2-thio-“spiro”-4,4-pentamethylene-1,3,2-
oxathiaphospholane)s, were prepared and used for the stereocontrolled synthesis of PS-Oligos via the
oxathiaphospholane approach. These monomers and their 2-oxo analogues were used for the synthesis of
“chimeric” constructs (PS/PO-Oligos) possessing phosphate and P-stereodefined phosphorothioate internucleo-
tide linkages. The yield of a single coupling step is approximately 92-95%, and resulting oligomers are free
of nucleobase- and sugar-phosphorothioate backbone modifications. Thermal dissociation studies showed that
for heteroduplexes formed by [RP]-, [SP]-, or [mix]-PS/PO-T10 with dA12, dA30, or poly(dA), for each template,
the melting temperatures, as well as free Gibbs’ energies of dissociation process, are virtually equal.
Stereochemical evidence derived from crystallographic analysis of one of the oxathiaphospholane monomers
strongly supports the participation of pentacoordinate intermediates in the mechanism of the oxathiaphospholane
ring-opening condensation.
Introduction
commenced.6,7 The proposed mechanism of their action
involves specific recognition of selected mRNA (or pre-mRNA)
by administered PS-Oligos followed by regioselective cleavage
of mRNA (involved in a heterodimer mRNA/PS-Oligo) by
Ribonuclease H.8 However, the mechanism of biological
activity of PS-Oligos seems to be more complicated and is
still a matter of controversy.9,10
Considering the biological activities of PS-Oligos, attention
should be paid to their polydiastereoisomerism.11 Replacement
of one of two nonbridging oxygens by sulfur at phosphorus in
an internucleotide linkage generates asymmetry at the phos-
phorus atom. Common synthetic methods used to prepare PS-
Oligos are nonstereospecific12 and give a mixture of 2n
diastereomers (where n is the number of internucleotide phos-
phorothioate functions). However, biological properties of PS-
Oligo diastereomers, including transport through cell membranes
and/or interaction with intracellular biopolymers (e.g., proteins
or nucleic acids), may depend on the chirality13 of PS-Oligos.
To verify this assumption, methods for synthesis of PS-Oligos
Among several analogues of oligonucleotides, which in the
main-stream of the “antisense mRNA” strategy1,2 are tested as
potential therapeutics and inhibitors of biosynthesis of unwanted
proteins, oligo(deoxyribonucleoside phosphorothioate)s, typi-
cally bearing 15-30 nucleobases (PS-Oligos), are widely
recognized as the most promising class of DNA congeners.
Using several model systems, PS-Oligos were thoroughly tested
in vitro3,4 and convincing results were reported showing their
efficacy in vivo.5 In addition, the clinical trials combating
CMV-related retinitis, AIDS, and restenosis in humans have
† Polish Academy of Sciences.
‡ Mass Spectrometry Laboratory.
Technical University of Ło´dz´.
§ Abbreviations: Bz, benzoyl; DBU, 1,4-diazabicyclo[5.4.0]undec-7-ene;
DCA, dichloroacetic acid; DMAP, 4-(dimethylamino)pyridine; DMT,
i
dimethoxytrityl; Bu, isobutyryl; LCA CPG, long-chain alkylamino con-
trolled pore glass; Tris-Cl, tris(hydroxymethyl)aminomethane hydrochloride;
DPC, diphenylcarbamoyl; EI, electron impact; ESI MS, electrospray
ionization mass spectrometry; FAB, fast atom bombardment; MS, mass
spectrometry; PAGE, polyacrylamide gel electrophoresis; RP HPLC,
reverse-phase high-performance liquid chromatography; TLC, thin-layer
chromatography; MALDI-MS, matrix-assisted laser desorption/ionization
mass spectrometry.
(1) Uhlmann, E.; Peyman, A. Chem. ReV. 1990, 90, 543-584.
(2) Oligonucleotides: Antisense Inhibitors of Gene Expression; Cohen,
J. S., Ed.; The Macmillan Press Ltd.: Houndsmill, 1989.
(3) Baserga, R.; Denhardt, D. T. Ann. N.Y. Acad. Sci. 1992, 660.
(4) Antisense Research and Applications; Crooke S. T., Lebleu, B., Eds.;
CRC Press: Ann Arbor, MI, 1993.
(6) Genetic Engineering News, Aug 1995, p 12.
(7) Rawls, R. L. Chem. Eng. News 1997 (June 2), 35-39.
(8) (a) Walder, R. Y.; Walder, J. A. Proc. Natl. Acad. Sci. U.S.A. 1988,
85, 5011-5015. (b) Yang, W.; Hendrickson, W. A.; Crouch, R. J.; Satow,
Y. Science 1996, 249, 1398-1405.
(9) Stein, C. A.; Cheng, Y.-C. Science 1993, 261, 1004-1012.
(10) Stein, C. A. Nature Medicine 1995, 1, 1119-1121.
(11) Stec, W. J.; Wilk, A. Angew. Chem. 1994, 106, 747-761; Angew.
Chem., Int. Ed. Engl. 1994, 33, 709-722.
(12) Zon, G.; Stec, W. J. In Oligonucleotides and Analogues: A Practical
Approach; Eckstein, F., Ed.; IRL Press: London, 1991, pp 87-108.
(5) Antisense Therapeutics; Agrawal, S., Ed.; Humana Press Inc., Totowa,
NJ, 1996.
S0002-7863(97)03801-8 CCC: $15.00 © 1998 American Chemical Society
Published on Web 07/10/1998

Stereocontrolled Synthesis of PS-Oligos
J. Am. Chem. Soc., Vol. 120, No. 29, 1998 7157
of a predetermined sense of chirality at the phosphorus atoms
were sought.14 In earlier reports15-17 we presented the oxathia-
phospholane method which, for the first time, allowed for
stereocontrolled chemical synthesis of PS-Oligos of either SP
or RP configuration at each preselected phosphorothioate center.
The oxathiaphospholane method surpasses the enzymatic one
which allows for the stereoselective synthesis of only [all-RP]
PS-Oligos.18-20 However, broader applicability of the ox-
athiaphospholane methodology has been hampered by tedious
separation of 5′-O-DMT-deoxyribonucleoside 3′-O-(2-thio-1,3,2-
oxathiaphospholane)s (1, R ) H, X ) S), or their 4,4-dimethyl
substituted analogues (2, R ) Me, X ) S) into pure diastere-
omers.
Scheme 1
Scheme 2
Results and Discussion
Oxathiaphospholane Ring-Substituted 4,4-“spiro”-Pen-
tamethylene Monomers. The oxathiaphospholane method of
stereocontrolled synthesis of PS-Oligos, depicted in Scheme
3 (Z ) 3′-O-deoxyribonucleoside, R′O ) 5′-O-deoxyribo-
nucleoside), was shown to be useful for generation of inter-
nucleotide phosphorothioate linkages under conditions compat-
ible with the requirements of solid-phase synthesis. Separation
of earlier described monomers 1 and 2 requires tedious silica
gel column chromatography16 or costly preparative HPLC to
yield diastereomerically pure substrates. To obtain monomers
that afford easier separation, efforts were undertaken to “enhance
the asymmetry” of the phosphorus atom involved in the
oxathiaphospholane part of the molecule. It was found that
“spiro” monomers 5′-O-DMT-deoxyribonucleoside 3′-O-(2-thio-
“spiro”-4,4-pentamethylene-1,3,2-oxathiaphospholane)s (3), ob-
tained by introducing a pentamethylene substituent in position
4 of the oxathiaphospholane ring, possess a satisfactory
separability of diastereomers. Such modification does not create
any new asymmetry center within the substrate molecule. The
desired phosphitylating reagent 5 was obtained by the reaction
of phosphorus trichloride with mercapto alcohol 6 (Scheme 1).
The synthesis of 6 was based on published methods.26 Our
improved synthesis of the intermediate diol-disulfide 7 resulted
in 98% yield of the desired product when solid dialdehyde 8,
rather than its solution in a mixture of isopropyl alcohol and
benzene, was added to the 2-propanol solution of sodium
borohydride in the reduction step. Appropriate 5′-O-DMT-base-
protected deoxyribonucleosides 9a-d (B ) Thy, AdeBz, CytBz,
GuaiBu) were phosphitylated at room temperature with 5 in
acetonitrile in the presence of diisopropylethylamine to yield
phosphites 10a-d, which were further sulfurized with elemental
sulfur (Scheme 2). Silica gel column chromatography with
chloroform as an eluent afforded 5′-O-DMT-deoxyribonucleo-
side-3′-O-(2-thio-“spiro”-4,4-pentamethylene-1,3,2-oxathiaphos-
pholane)s (3a-c, 11) as diastereomeric mixtures in satisfactory
yield (78-86%). The guanosine derivative 11 was additionally
protected at the O-6 site with diphenylcarbamoyl chloride to
yield 3d. The diastereomers of 3a-d (B ) Thy, AdeBz, CytBz,
In this report we present new nucleotide monomers, modified
within the oxathiaphospholane ring, namely, 5′-O-DMT-deox-
yribonucleoside-3′-O-(2-thio-“spiro”-4,4-pentamethylene-1,3,2-
oxathiaphospholane)s (3, R,R ) -(CH2)5-, X ) S), which like
1 and 2 are prepared in the form of a diastereomeric mixture,
but undergo much easier separation into individual diastereo-
mers. We also present here as yet not described nucleotide
monomers, 5′-O-DMT-deoxyribonucleoside-3′-O-(2-oxo-“spiro”-
4,4-pentamethylene-1,3,2-oxathiaphospholane)s (4, R,R )
-(CH2)5-, X ) O), which allow for the synthesis of unmodified
oligo(deoxyribonucleoside phosphate)s. The use of both types
of oxathiaphospholane monomers 3 and 4 allows for the
preparation of “chimeric” oligonucleotides (PS/PO-Oligos)
possessing both natural phosphate and stereodefined phospho-
rothioate internucleotide linkages at the preselected positions
in the same molecule. In such constructs, the natural phosphate
part is expected to preserve the hybridization properties of
natural oligonucleotides, while P-stereodefined phosphorothioate
segments (located at the 3′- and/or 5′-ends of the oligomer)
would confer significantly higher stability toward nucleases.21-25
(13) Buda, A. B.; Heyde, T. A.; Mislow, K. Angew. Chem., Int. Ed. Engl.
1992, 31, 987-1007.
(14) (a) Stec, W. J.; Les´nikowski, Z. L. In Oligonucleotide Synthesis
Protocols; Agrawal, S., Ed.; (in the series Methods in Molecular Biology);
Humana Press: Totowa, NJ, 1993, pp 285-314. (b) Stec, W. J. In Antisense
Research and Applications; Crooke, S. T., Lebleu, B., Eds.; CRC Press:
Boca Raton, FL, 1993; pp 251-273.
(15) Stec, W. J.; Grajkowski, A.; Koziołkiewicz, M.; Uznan´ski, B.
Nucleic Acids Res. 1991, 19, 5883-5888.
(16) Stec, W. J.; Grajkowski, A.; Karwowski, B.; Kobylan´ska, A.;
Koziołkiewicz, M.; Misiura, K.; Okruszek, A.; Wilk, A.; Guga, P.;
Boczkowska, M. J. Am. Chem. Soc. 1995, 117, 12019-12029.
(17) Uznan´ski, B.; Grajkowski, A.; Krzyz˘anowska, B.; Kaz´mierkowska,
A.; Stec, W. J.; Wieczorek, M. W.; Błaszczyk, J. J. Am. Chem. Soc. 1992,
114, 10197-10202.
(18) Hacia, J. G.; Wold, B. J.; Dervan, P. B. Biochemistry 1994, 33,
5367-5369.
(19) Tang, J.; Roskey, A.; Li, Y.; Agrawal, S. Nucleosides Nucleotides
1995, 14, 985-990.
(20) Lackey, D. B.; Patel, J. Biotechnol. Lett. 1997, 19, 475-478.
(21) Eckstein, F. Angew. Chem. 1983, 22, 423-439.
(22) Stein, C. A.; Subasinghe, Ch.; Shinozuka, K.; Cohen, J. S. Nucleic
Acid Res. 1988, 16, 3209-3221.
(23) Gao, W.-Y.; Han, F.-S.; Storm, Ch.; Egan, W.; Cheng, Y.-Ch. Mol.
Pharmacol. 1992, 41, 223-229.
(24) Ghosh, M. K.; Ghosh, K.; Cohen, J. S. Anti-Cancer Drug Des. 1993,
8, 15-23.
(25) Peyman, A.; Uhlmann, E. Biol. Chem. Hoppe-Seyler 1996, 377, 67-
70.
(26) Hayashi, K. Macromolecules 1970, 3, 5-9.

7158 J. Am. Chem. Soc., Vol. 120, No. 29, 1998
Stec et al.
Table 1. Characteristics of the Oxathiaphospholane Monomers 3
and 4e
Table 2. Synthetic Protocol for the 1 µmol Scale Automated
Solid-Phase Synthesis of PS-Oligos Using Monomers 3, or
PO-Oligos Using 4
composition
yield (%) (fast:slow) (ppm, CD3CN)
δ
31P NMR
B′
TLC
volume
time
(s)
step
1
reagent or solvent
(mL)
purpose
3a Thy
84
84
86
78
50:50
49:51
48:52
52:48
105.3 (fast)
105.6 (slow)
104.7 (fast)
105.1 (slow)
105.3 (fast)
105.6 (slow)
106.2 (fast)
0.61a(fast)
0.54a(slow)
0.54b(fast)
0.46b(slow)
0.60b(fast)
0.40b(slow)
0.37a,d (fast)
(a) dichloroacetic acid in CH2Cl2
(b) acetonitrile
2.3
7.0
0.8
3.33
7.0
0.33
7.0
detritylation
50
150
470
200
150
20
3b AdeBz
3c CytBz
2
(a) activated 3a or 4b in CH3CN
(b) methylene chloride
(c) acetonitrile
coupling
wash
wash
capping
wash
3
(a) DMAP/Ac2O/lutidine in THF
(b) acetonitrile
3d
GuaiBu,DPC
4a Thy
106.9 (slow) 0.26a,d (slow)
150
55
41
45
54
nd
nd
nd
nd
44.7, 44.3
45.1, 44.9
44.6, 44.1
45.3, 44.5
0.48c
0.61c
0.57c
0.54c
a A mixture of 270 µL of a solution of a monomer 3 in CH3CN (75
mg/mL) and 530 µL of 1.5 M DBU in CH3CN. b A mixture of 270 µL
of a solution of a monomer 4 in CH3CN (75 mg/mL) and 530 µL of
1.0 M DBU in CH3CN.
4b AdeBz
4c CytBz
4d GuaiBu
a Developing system: butyl acetate/benzene 1:1 v/v. b Developing
system ethyl acetate/butyl acetate 1:2 v/v. c Developing system:
chloroform/methanol 9:1 v/v. d Rf values reported for the monomers
before protection at O-6 site with diphenylcarbamoyl chloride. After
protection the Rf’s are 0.74 and 0.63 (butyl acetate/benzene 1:1 v/v).
e TLC analysis was performed on HP TLC plates (Merck).
The value 20 mg (24-32 mM, 19-26-fold molar excess over
nucleoside attached to the support) was found optimal for each
of four monomers. Use of 27 mg did not result in higher yield
or improved purity of the oligomers. Neither yield nor purity
of products was acceptable when 5 or 10 mg of 3 was used in
each coupling step. In the search for the optimal concentration
of DBU activator, the model phosphorothioate oligomer, PS-
d(ACAGTGATCGCTG) (12), was synthesized using stock
solutions of DBU in acetonitrile at concentrations 0.2, 0.5, 0.75,
1.0 and 1.5 M. Thus, after mixing with a solution of a
monomer, the final concentrations ranged from 0.13 to 1.0 M.
It was found that the stock solution at concentration 1 M gives
significantly better results than 0.5 M solution (the latter was
typically used for monomers 1 or 2), while a 1.5 M concentration
did not improve the quality or yield of product. A set of
syntheses of 12 using different coupling times (ranging from
150 to 600 s) revealed that the coupling time 450 s gives the
best result. There was no improvement when longer reaction
time (600 s) or double delivery of the monomer (the second
delivery after washing and drying of the support) was applied.
The oligomer 12 obtained under all optimized conditions (the
protocol is presented in Table 2), after cleavage from the solid
support and deprotection, without any purification, was subjected
to 31P NMR analysis which showed the absence of detectable
amounts of phosphate linkages. Further treatment of the sample
with formic acid followed by HPLC analysis of the hydrolysate
proved the absence of detectable amounts of modified nucleo-
bases.
Starting from pure diastereomers of 3, several “stereoregular”
[all RP]- and [all-SP]-oligonucleotides (10-28 mers) as PS-
d[CCTATAATCC], PS-d[AACGTTGAGGGGCAT], PS-d[C-
CACACCGACGGCGCCC], PS-d[TTCTTTCCATATTGAATA-
TA], and PS-d[CGCTCTCGCACCCATCTCTCTCCTTCTA]
have been synthesized for physicochemical studies and biologi-
cal evaluation. Typically, repetitive yield (based on DMT+
cation assay) was 94-96% for the [RP] oligomers, and it was
slightly lower (92-94%) for their [SP] counterparts. The
oligonucleotides were purified via two-step RP-HPLC chroma-
tography (DMT-on and DMT-off), and their chain length
integrity was assessed by PAGE (Figure 1). The amounts of
material isolated after one synthesis at 1 µmol scale ranged from
4 to 10 OD units, which was less than expected from DMT+
cation assay. It is necessary to mention that in order to achieve
satisfactory purity of the products only middle parts of eluted
peaks were collected. Six consecutive syntheses at 2 µmol scale
yielded total 120 OD units of [all-RP]-PS-d[CCTATAATCC],
and 140 OD units of [all-SP]-form, allowing for 1H NMR
conformational studies (data not shown). The development of
“spiro” oxathiaphospholanes 3 can be considered as a significant
GuaiBu,DPC) were separated by column chromatography into
“fast”- and “slow”-eluting species. Notably, for these mono-
mers, single passage through a silica gel column gave ca. 70%
recovery of the applied material in diastereomerically pure
forms. Isolated monomers were twice coevaporated with dry
toluene (to remove residual water and pyridine) and stored in
tightly closed vessels. Separated diastereomers were analyzed
by 31P NMR, 1H NMR, MS, and elemental analysis. The
diastereomeric purity of separated isomers was determined by
integration of the corresponding signals in the 31P NMR spectra.
Selected data are presented in Table 1. The stereochemistry of
the coupling step utilizing “spiro” oxathiaphospholanes 3a-d
has been checked for each of 32 combinations of diastereomeric
dinucleotides NPSN (N ) dG, dA, dC, or T). It has been found
that all four “fast”-eluting diastereomers of 3, analogous to the
monomers 2,16 were precursors of the dinucleoside 3′,5′-
phosphorothioates of RP configuration. Consequently, “slow”-
eluting isomers of 3 yielded phosphorothioate linkages of SP
configuration. In all cases, the stereoselectivity of condensation
was not lower than 98%. Separated diastereomers of 3 are stable
at room temperature for at least 6 months when stored in a
desiccator.
To elaborate an optimized protocol for automated synthesis
of PS-Oligos using monomers 3, several sets of experiments
were performed. In each set, one parameter (such as the
coupling time, the monomer concentration, or the DBU con-
centration) was changed over a considerably wide range. For
all syntheses the same support (which possessed the N2-
isobutyryldeoxyguanosine 3′-O- attached to LCA CPG via
DBU-resistant sarcosinyl-succinoyl linker27 with loading 29
µmol/g) was used to eliminate any possible effect of support
variability. The optimization of monomer concentration was
investigated by the syntheses of octamers d[(APS)7G], d[(GPS)7G],
d[(CPS)7G], and d[(TPS)7G]. During each synthesis, dimethoxy-
trityl cation absorbance was monitored, and the crude product
was characterized by means of RP HPLC and PAGE to assess
the yield and purity. For a 1 µmol scale of synthesis, the
monomer amounts tested were 5, 10, 20, and 27 mg per single
coupling. Since the total volume of the reacting mixture was
800 µL (530 µL of a DBU solution and 270 µL of a monomer
solution), the final concentration of the monomers 3a-d ranged
from 6 mM (a dose of 5 mg of 3d) to 45 mM (27 mg of 3a).
(27) Brown, T.; Pritchard, C. E.; Turner, G.; Salisbury, S. A. J. Chem.
Soc., Chem. Commun. 1989, 891-893.

Stereocontrolled Synthesis of PS-Oligos
J. Am. Chem. Soc., Vol. 120, No. 29, 1998 7159
Scheme 3
exonucleases,36 it was tempting to apply the oxathiaphospholane
methodology to the synthesis of chimeric PS/PO oligonucleo-
tides of predetermined configuration at P-chiral centers. Un-
fortunately, the oxathiaphospholane method is not compatible
with either the phosphoramidite37 or the H-phosphonate38
methods of DNA synthesis because the assembled internucleo-
tide phosphorothioate linkages are easily oxidized during the
iodine-base-water oxidation33 that is unavoidable in both of
the aforementioned methods. In our laboratory, several methods
for protection of the sulfur atom in PS-Oligos were studied
without satisfactory results (data not shown). Therefore, a
different approach was examined based on modification of the
oxathiaphospholane method. The oxathiaphospholane mono-
mers 1-3 possess sulfur atoms in both exo- and endocyclic
positions, but the sulfur atom present in the resulting phospho-
rothioate internucleotide bond originates from exocyclic sulfur
depicted as X (Scheme 3, Z ) 3′-O-deoxyribonucleoside, R′O
) 5′-O-deoxyribonucleoside). Replacement of that exocyclic
sulfur atom by oxygen in 3 gives rise to 4 (R, R ) -(CH2)5-,
X ) O), which in the condensation reaction should provide
compound 13 possessing a natural phosphodiester bond. Con-
sequently, the whole elongation process would not involve any
oxidation step, and, therefore, phosphorothioate functions present
in the growing oligomer should be preserved. To prove that
assumption, efforts toward the synthesis of 5′-O-DMT-base-
protected nucleoside 3′-O-(2-oxo-“spiro”-4,4-pentamethylene-
1,3,2-oxathiaphospholane)s were undertaken. Chemoselective
oxidation of 5′-O-DMT-thymidine-3′-O-(“spiro”-4,4-penta-
methylene-1,3,2-oxathiaphospholane) (10a, an intermediate in
the synthesis of 3a), to form 5′-O-DMT-thymidine-3′-O-(2-oxo-
“spiro”-4,4-pentamethylene-1,3,2-oxathiaphospholane) (4a, see
Scheme 2) was not a trivial task, since a reagent to be used
Figure 1. An autoradiogram from PAGE analysis (20% polyacrylamide
gel/7 M urea) of phosphorothioate oligonucleotides purified by two-
step RP HPLC: lane A, [mix]-PS-d(CCTATAATCC), oligomer
synthesized via phosphoramidite/sulfurization approach; lanes B and
C, two samples of [all-Rp]-PS-d(CCTATAATCC) synthesized via
oxathiaphospholane method (two consecutive batches).
improvement of the oxathiaphospholane method since the
diastereomeric purity of substrates used for stereospecific
synthesis, especially that involving consecutively repeated
cycles, is a crucial factor for the diastereomeric purity of the
final product.
Synthesis of “Chimeric” PS/PO Oligonucleotides. It is
commonly accepted opinion that PS-Oligos form less stable
duplexes with DNA or RNA templates than natural oligonucle-
otides,22 although some exceptions have been found.16 How-
ever, since their in vivo stability is superior to that of natural
oligonucleotides, several efforts were undertaken aimed at the
synthesis of “chimeric” antisense constructs possessing unmodi-
fied phosphate and modified phosphorothioate internucleotide
linkages in the same molecule (PS/PO-Oligos).22-25,28,29 Two
types of such constructs have been reported. The first one
possesses phosphorothioate linkages in alternate positions,30,31
while the second one contains combined oligophosphate and
oligophosphorothioate clusters.24,28 For the latter type it was
assumed that the flanking phosphorothioate parts would provide
better in vivo stability against nucleases, while the central
unmodified part should enhance the hybridization properties of
“chimeric” product (compared to PS-Oligo) and also facilitate
the action of RNase H toward the duplexes formed with target
RNA. The chimeras prepared via the phosphoramidite method
contain phosphorothioate centers of random configuration, while
those possessing stereodefined phosphorothioate linkages (of
either RP or SP configuration) were synthesized using ap-
propriately protected diastereomerically pure dinucleotide build-
ing blocks31-35 In light of our earlier findings that PS-Oligos
possessing at the 3′-end phosphorothioate linkages of [SP]
configuration are especially resistant to degradation by 3′-
(33) (a) Burgers, P. M. J.; Eckstein, F. Biochemistry 1979, 18, 450-
454. (b) Eckstein, F.; Potter, B. V. L. J. Biol. Chem. 1984, 259, 14243-
14248. (c) Eckstein, F.; Connolly, B. A.; Pingoud, A. J. Biol. Chem. 1984,
259, 10760-10763.
(34) (a) Koziołkiewicz, M.; Uznan´ski, B.; Stec, W. J.; Zon, G. Chem.
Scr. 1986 26, 251. (b) Kurpiewski, M. R.; Koziołkiewicz, M.; Wilk, A.;
Stec, W. J.; Jen-Jacobson, L. Biochemistry 1996, 35, 8846-8854. (c) Lesser,
D. R.; Koziołkiewicz, M.; Grajkowski, A.; Kurpiewski, M.; Stec, W. J.;
Jen-Jacobson, L. J. Biol. Chem. 1992, 267, 24810-24818.
(35) Fidanza, J. A.; Ozaki, H.; McLaughlin, L. W. J. Am. Chem. Soc.
1992, 114, 5509-5517.
(36) Koziołkiewicz, M.; Wo´jcik, M.; Kobylan´ska, A.; Karwowski, B.;
Re¸bowska, B.; Guga, P.; Stec, W. J. Antisense Nucleic Acids Drug
DeVelopment 1997, 7, 43-48.
(37) Stec, W. J.; Zon, G.; Egan, W.; Stec, B. J. Am. Chem. Soc. 1984,
106, 6077-6080.
(38) (a) Froehler, B. C. Tetrahedron Lett. 1986, 27, 5575-5578. (b)
Froehler, B. C. In Methods in Molecular Biology. Vol. 20: Protocols for
Oligonucleotides and Analogues; Agrawal, S., Ed.; Humana Press Inc.,
Totowa, NJ, 1993, pp 63-80.
(28) Soreq, H.; Patinkin, D.; Lev-Lehman, E.; Grifman, M.; Ginzberg,
D.; Eckstein, F.; Zakut, H. Proc. Natl. Acad. Sci. U.S.A. 1994, 91, 7907-
7911 and pertinent references therein.
(29) Ojwang, J. O.; Buckheit, R. W.; Pommier, Y.; Mazumder, A.;
DeVreese, K.; Este´, J. A.; Reymen, D.; Pallansch, L. A.; Lackman-Amith,
C.; Wallace, T. L.; DeClercq,; McGrath, M. S.; Rando, R. F. Antimicrob.
Agents Chemother. 1995, 39, 2426-2435.
(30) Monia, B. P.; Johnston, J. F.; Sasmor, H.; Cummins, L. L. J. Biol.
Chem. 1996, 271, 14533-14533.
(31) Patil, S. V.; Mane, R. B.; Salunkhe, M. M. Bioorg. Med. Chem.
Lett. 1994, 4, 2663-2666.
(32) Koizumi, M.; Ohtsuka, E. Biochemistry 1991, 30, 5145-5150.

7160 J. Am. Chem. Soc., Vol. 120, No. 29, 1998
Stec et al.
must oxidize exclusively the trivalent phosphorus atom leaving
untouched the rest of the molecule. Attempts at oxidation using
anhydrous tert-butyl hydroperoxide39 in benzene solution gave
a mixture of products containing the desired 4a (a mixture of
diastereomers, δ 31P NMR 44.3 and 44.9 ppm, 57%) and a
considerable amount of a side-product seen by 31P NMR as a
pair of signals at 106.8 and 106.4 ppm (20%). The identity of
the side product with 3a (a mixture of diastereomers) was
confirmed by MS analysis. The spectrum showed the presence
of the corresponding molecular ion, and a “fingerprint” of the
region m/z 650-800 was virtually identical with that of genuine
material. The origin of this unwanted contamination is obscure
and will be studied separately. Chromatographic isolation of
4a from the reaction mixture was found to be rather difficult.
However, oxidation of 10a with selenium dioxide gave much
more pure product 4a in good yield. Initially the reactants were
used in stoichiometric molar ratio (2:1), but it was found that
20% excess of selenium dioxide prevents formation of 5′-O-
DMT-thymidine-3′-O-(2-selena-“spiro”-4,4-pentamethylene-
1,3,2-oxathiaphospholane).40 The progress of oxidation was
monitored by TLC, and after 2 h the crude product was analyzed
by 31P NMR. The spectrum indicated the presence of two
signals corresponding to both diastereomers of desired product
4a (at 44.3 and 44.7 ppm, 1:1 ratio, 83% of total integral),
accompanied by a pair of signals at 100.2 and 100.3 ppm
(probably phosphoroselenoates, ca. 4%), and other not identified
resonances with a total abundance of 13%. Compound 4a was
isolated in 56% yield using a silica gel column with chloroform
as an eluent. Three other monomers 4b-d (B ) AdeBz, CytBz,
and GuaiBu) were prepared in the same way. Their character-
istics are given in Table 1.
Applicability of the 2-oxo monomers 4 to the synthesis of
natural oligonucleotides was tested by the manual synthesis of
four dimers (AT, CT, GT, and TT), and by the automated
synthesis of four “homooctamers” (NPO)7T (N ) dA, dG, dC,
or T) using a protocol analogous to that elaborated for synthesis
of PS-Oligos. In all syntheses performed on a 1 µmol scale,
the same solid support, LCA CPG-Sar-Thy (23 µmol/g), was
employed. For each coupling step 20 mg of 4 was used together
with 1.0 M DBU in acetonitrile as an activator. The coupling
time was 450 s. The resulting oligomers were cleaved from
the solid support, and RP HPLC analysis confirmed their identity
with genuine samples synthesized via the phosphoramidite
method. These encouraging results prompted us to synthesize
similarly a mixed sequence PO-d(TAGTGATTCT) (0.75 µmol
scale). An RP-HPLC chromatogram recorded for DMT-on
purification showed that the desired product constitutes 56%
of the total integrated peak area (Figure 2), while analysis of
the detritylated product showed its purity to be better than 92%.
MALDI-MS spectrum recorded in the negative mode showed
the presence of molecular ion at m/z 3031.6. PAGE analysis
confirmed satisfactory quality of the product, which was
comparable to that of a genuine sample of oligonucleotide
prepared via the phosphoramidite method.41 Approximately 1
OD unit of the crude product was then treated with formic acid.42
The resulting hydrolysate was dried in a stream of argon and
Figure 2. RP HPLC trace of crude PO-d(TAGTGATTCT) (DMT-
on) synthesized using the monomers 4.
analyzed by means of RP-HPLC. Chromatograms recorded at
255 and 280 nm showed the presence of only four peaks
corresponding to cytosine, guanine, thymine, and adenine,
indicating that the synthesized oligonucleotide was free of base
modification detectable by this method.
Although the repetitive yield of the synthesis (89.4%, based
on the DMT cation assay) was relatively low as compared with
phosphoramidite or H-phosphonate methods, it was judged to
be satisfactory enough to attempt synthesis of chimeric PS/PO-
Oligos using both types of monomers 3 and 4. As the first
step, [mix]-TsTsTsTsToToToToTsTsTsT ([mix]-PS/PO-T12)
was synthesized, and a MALDI-MS spectrum recorded after
two-step purification confirmed the identity of the product (the
negative ion mode; m/z 3699.2). Repetitive yield, calculated
from the DMT cation assay, was 93%. In this sequence as well
as in other chimeric sequences 14-16 (vide infra), the letters
“s” and “o” stand for phosphorothioate and phosphate inter-
nucleotide linkages, respectively, and the descriptors [mix]-, [all-
RP]-, and [all-SP]- refer to the configuration at phosphorus in
the phosphorothioate linkages. Then two oligonucleotides, [all-
RP]-ToTsToTsToTsToTsToT ([RP]-PS/PO-T10, 14) and [all-SP]-
ToTsToTsToTsToTsToT ([SP]-PS/PO-T10, 15) were synthesized
on 1 µmol scale, and repetitive yield 96-97% was found. The
reference compound, corresponding to [mix]-ToTsToTsToTs-
ToTsToT ([mix]-PS/PO-T10, 16), was synthesized using standard
phosphoramidite method with either oxidation or sulfuration at
selected cycles. Compounds 14-16 were isolated by standard
two-step HPLC (Econosphere, RP-C18, 220 × 4.6 mm; buffer
A, 0.1 M TEAB; buffer B, 40% acetonitrile in 0.1 M TEAB;
gradient 1%/min, flow rate 1 mL/min) (Figure 10 in Supporting
Information). Surprisingly, PAGE analysis showed that result-
ing 15 was approximately 25% contaminated with oligomer(s)
shorter by one nucleotide. This contamination was substantially
removed by rechromatography (Figure 10, panel C) using PTH-
C18 column (Brownlee, 220 × 2.1 mm, gradient 0.7%/min,
buffers as above, flow rate 0.3 mL/min). Purified 14-16 were
labeled at the 5′-end with radioactive [32P]phosphate group and
analyzed by PAGE (Figure 3). Densitometry of autoradiograms
showed that the purity of 14 was almost 100%, and was not
lower than 96% for 15 and 16. ESI MS analysis of 14 and 15
confirmed expected molecular weight (MW 3043), and 31P
NMR analysis showed that each spectrum contained two sets
of resonances corresponding to phosphate and phosphorothioate
linkages in the correct ratio.
(39) (a) Engels, J.; Jager, A. Angew. Chem., Int. Ed. Engl. 1982, 21,
912. (b) Engels, J.; Jager, A. Tetrahedron Lett. 1984, 25, 1437. (c)
Hayakawa, Y.; Uchiyama, M.; Noyori, R. Tetrahedron Lett. 1986, 27,
4191-4194.
(40) Misiura, K.; Stec, W. J. Bioorg. Med. Chem. Lett. 1994, 4, 1037-
1040.
(41) Caruthers, M. H. Science 1985, 230, 281-285.
(42) Fritz, H.-J.; Eick, D.; Werr, W. In Chemical and Enzymatic Synthesis
of Gene Fragments; Gassen, H. G., Lang, A., Eds.; Verlag Chemie GmbH:
Weinheim, 1982; p 199-223.
Enzymatic analysis with RP-specific snake venom phosphodi-
esterase (svPDE) and SP-specific Nuclease P1 was used to
confirm the location and the absolute configuration of phos-

Stereocontrolled Synthesis of PS-Oligos
J. Am. Chem. Soc., Vol. 120, No. 29, 1998 7161
Figure 3. An autoradiogram from PAGE analysis (20% polyacryla-
mide/7 M urea) of HPLC purified “chimeric” oligonucleotides: lane
A, [mix]-PS/PO-T10 (16); lane B, [RP]-PS/PO-T10 (14); lane C, [SP]-
PS/PO-T10 (15); lanes D-F, as A-C, but at doubled concentration.
Figure 5. An autoradiogram from PAGE analysis (20% polyacryla-
mide/7 M urea) after digestion of [RP]-PS/PO-T10 (14) with Nuclease
P1: lane S, the substrate 14. The sets of lanes A-C correspond to the
enzyme amount 0.01, 0.05, and 0.1 µg, respectively. In each set
consecutive lanes correspond to the incubation time 15, 30, and 90
min.
Figure 4. An autoradiogram from PAGE analysis (20% polyacryla-
mide/7 M urea) after digestion of [RP]-PS/PO-T10 (14) with snake venom
phosphodiesterase: lane S, the substrate 14. The sets of lanes A-D
correspond to the enzyme amounts 0.002, 0.005, 0.010, and 0.050 µg,
respectively. In each set consecutive lanes correspond to the incubation
time 5, 10, and 15 min.
Figure 6. An autoradiogram from PAGE analysis (20% polyacryla-
mide/7 M urea) after digestion of [SP]-PS/PO-T10 (15) with Nuclease
P1: lane S, the substrate 15. The sets of lanes A-D correspond to the
enzyme amount 0.001, 0.005, 0.010, and 0.050 µg, respectively. In
each set consecutive lanes correspond to the incubation time 15, 30,
and 60 min.
phorothioate centers within oligonucleotide chains of 14 and
15.16 svPDE exonuclease hydrolyzes oligonucleotides (labeled
at the 5′-end with radioactive [32P]phosphate group) starting
from the 3′-end. In the autoradiogram (Figure 4), the more
abundant bands (n - 1, n - 3, n - 5... nucleotides) correspond
to the fragments of 14 possessing at their 3′-ends internucleotide
phosphorothioate linkages, because their cleavage by svPDE is
relatively slow. The oligomers with natural phosphodiester
linkages at the 3′-ends are hydrolyzed fast, thus the relevant
bands are of low abundance. Analogous degradation of 14 (not
radiolabeled at the 5′-end) with svPDE was followed by
MALDI-MS in the negative ions mode. The spectra (Figure
11 in Supporting Information) showed the presence of ions m/z
3043, 2739, 2418, 2114, 1792, 1489, 1168, 864. This pattern
corresponds to consecutive removal of thymidine phosphate (m/z
304) or thymidine phosphorothioate moieties (m/z 320). The
last recorded ion m/z 864 indicates the presence of a trinucleotide
The above results thus confirmed the configurations of the
phosphorothioate centers in the chimeric oligomers 14 and 15.
Thermodynamic Studies. For the chimeric constructs 14,
15, and 16 the Tm values for duplexes formed with a dA12, dA30,
and poly(dA) were measured. It was found that, contrary to a
literature report,31 both stereoregular oligomers [RP]- and [SP]-
PS/PO-T10, as well as [mix]-PS/PO-T10, form duplexes of
practically the same thermal stability (buffer 10 mM Tris, 10
mM MgCl2, 1 M NaCl) within an oligonucleotide concentration
range of 1.15 to 6.9 µM (Table 3). The melting temperatures,
obtained from the melting curves using first derivative method,
allowed for calculation of thermodynamic parameters from an
-1
equation Tm ) (R/∆H°) ln (CT) + (∆S° - R ln (4))/∆H°
(representative plots of reciprocal melting temperature vs ln
(CT)43 are presented in Supporting Information, Figure 13),
where CT is the total strand concentration.
T
POTPST, which was independently confirmed by enzymatic
degradation from the 5′-end with spleen phosphodiesterase, as
the molecular ion m/z 3042 was accompanied by the ion m/z
2738 (the mass difference of 304 daltons; Figure 12 in
Supporting Information).
On the other hand, a nonlinear least-squares program
(calculating routines developed for the program SigmaPlot, ver.
5.01, Jandel Corp.), based on a model for two-state association
process,44 was used to fit the data from melting curves with a
formula A(T) ) Ah(T) + (Ac(T) - Ah(T))θ, where Ah(T) ) bh-
(1 + mhT) and Ac(T) ) bc(1 + mcT) represent the absorbance
of the pure helical (double strand) and coil (single strand) form,
respectively, as the extinction coefficients are assumed to be
linear functions of temperature. The parameter θ ) ((1 +
Nuclease P1 is an endonucleolytic enzyme and the pattern
of degradation is different from that observed for svPDE. PAGE
analysis revealed (Figure 5), as expected, that 14 is hydrolyzed
only at the phosphate sites, because nuclease P1 does not
hydrolyze phosphorothioate linkages of RP configuration. On
the other hand, the oligomer 15 is hydrolyzed by Nuclease P1
at each internucleotide bond (either phosphodiester or SP-
phosphorothioate), although the bands corresponding to the
truncated oligomers possessing 3′-terminal phosphorothioate
internucleotide linkage are slightly more intensive (Figure 6).
(43) Breslauer, K. J. In Methods in Molecular Biology. Vol. 26: Protocols
for Oligonucleotide Conjugates; Agrawal, S., Ed.; Humana Press Inc.,
Totowa, NJ, 1994; pp 347-372.
(44) Evertsz, E. M.; Rippe, K.; Jovin, M. Nucleic Acids Res. 1994, 22
(16), 3293-3303.

7162 J. Am. Chem. Soc., Vol. 120, No. 29, 1998
Stec et al.
Table 3. Melting Temperatures and Standard Thermodynamic Parameters of Duplex Formation in 10 mM Tris-Cl (pH 7.5), 10 mM MgCl2
and 1 M NaCl
Tm-1 vs ln cT
∆H°, ∆S°,
1.15 3.45 4.6 5.75 6.9 Tm°, °C kcal/mol cal/molK kcal/mol Tm°, °C kcal/mol cal/molK kcal/mol
A(T) vs T
∆H°, ∆S°,
T
m (°C) at concentrations (µM)a
∆G°37
∆G°37,
duplex
[SP]-PS/PO-T10/dA12
27.4 30.4 30.8 31.3 31.5
26.9 29.8 30.8 31.4 31.8
32.8 35.7 36.1 36.2 36.5
32.9 35.5 36.3 36.5 37.5
26
25
32
31
31
34
35
35
-77.8
(5.5
-228.9
(18
-6.8
(0.5
-6.7
(0.2
-8.0
(1.0
-8.0
(0.9
-8.0
(0.2
-8.7
(0.4
-8.8
(0.2
-8.9
(0.2
23
22
31
31
32
35
35
35
-63.0 -182.7
(0.9 (3.2
-57.1 -163.4
(1.7 (5.6
-85.7 -251.7
(5.2 (16.8
-81.1 -236.5
(3.5 (11.4
-84.9 -248.4
(2.2 (6.8
-114.1 -340.4
(2.6 (8.0
-109.7 -327.4
(3.2 (11.5
-107.9 -320.1
(4.2 (14.3
-6.4
(0.1
-6.5
(0.1
-7.6
(0.1
-7.8
(0.1
-7.9
(0.1
-8.5
(0.1
-8.6
(0.1
-8.7
(0.4
[RP]-PS/PO-T10/dA12
[SP]-PS/PO-T10/dA30
[RP]-PS/PO-T10/dA30
[mix]-PS/PO-T10/dA30
[SP]-PS/PO-T10/poly(dA)
[RP]-PS/PO-T10/poly(dA)
-65.6
(1.6
-190.1
(5.3
-89.6
(10.1
-73.1
(7.3
-263.3
(32.7
-209.9
(23.7
-198.4
(4.5
33.3 36.2 nd
nd
38.2
-69.5
(1.4
34.5 37.6 38.3 38.7 39.1
35.1 37.7 38.3 38.7 39.3
-73.5
(3.2
-209
(10.3
-241
-83.2
(2.2
(7.1
[mix]-PS/PO-T10/poly(dA) 35.4 38.3 nd
nd
40.3
-70.0
(1.4
-198.6
(4.5
a Error in melting temperatures is estimated as (1 °C. Concentrations of chimeric PS/PO oligonucleotides are given.
8ET)1/2 - 1)/4ET is the fraction of strands in the coil form, while
ET is given by formula exp((∆H°/R)(Tm - T-1)). The
-1
molecularity of the association process (a parameter hidden in
the formula for θ) was set to 2 independently of the template
used. One can argue that for the poly(dA) template a multistate
model for association would be more adequate, but we believe
that the two-state model is sufficient for comparison of
thermodynamic parameters for closely related diastereoisomeric
species. The program fits data from melting curves (absorbance
versus temperature) with the parameters ∆H°, Tm, mh, bh, mc,
and bc. For each sample the ∆H°’s fitted for consecutive
concentrations, and corresponding calculated standard melting
temperatures Tm° (i.e., the melting temperature for total strand
concentration CT ) 1 µM), were used for calculation of standard
entropies from the formula ∆S° ) ∆H°/Tm° + R ln (4/CT). Then,
standard free Gibbs’ energies at 37 °C were derived from the
formula ∆G° )∆H° - T∆S°. The values ∆G°, ∆H°, ∆S°, and
Tm° calculated for consecutive concentrations were averaged
for each duplex, followed by calculation of standard deviations.
Figure 7. CD spectra (region 255-320 nm) recorded at 5 °C for the
duplexes formed by stereoregular [all-RP]- and [all-SP]-PS-T12, chimeric
[RP]- and [SP]-PS/PO-T10, and unmodified PO-T12 with dA12 matrix.
Buffer 10 mM Tris-Cl, pH 7.5, 10 mM MgCl2, 1 M NaCl. Optical
path length 5 mm; nine smoothing steps were applied to each spectrum.
Measured and calculated parameters, obtained from both
-1
methods (Tm versus ln (CT) and A(T) vs T), are collected in
Table 3. One has to notice that, because of limited range of
DNA strands concentrations suitable for UV measurements,
standard errors for ∆H° and ∆S° parameters calculated from
Supporting Information). It should be pointed out that CD
spectra recorded for the duplexes [all-RP]-(TPS)11T/dA12 and [all-
SP]-(TPS)11T/dA12 differ much more, especially in the region
265-300 nm (Figure 7), and are arranged in the order (from
the top to the bottom) [all-RP]-PS-T12/-, [all-RP]-PS/PO-T10/-,
unmodified-T12/-, [all-SP]-PS/PO-T10/-, and finally [all-SP]-PS-
T12/dA12. Since we observed 4 °C difference in thermal stability
of duplexes [all-RP]-(TPS)11T/dA12 and [all-SP]-(TPS)11T/dA12 (18
°C vs 14 °C),16 discussed above, arrangement of CD spectra
suggests that natural phosphate internucleotide linkages present
in chimeric compounds in alternate positions allow for effective
“relaxation” of tensions or distortions caused by phosphorothio-
ates.
Stereochemistry of 1,3,2-Oxathiaphospholane Ring Open-
ing Condensation - Mechanistic Considerations. Earlier
model studies indicated that DBU-assisted methanolysis of 2-N-
(R-naphthylethyl)amino-2-thio-1,3,2-oxathiaphospholane (17)
yields O-methyl-N-(R-naphthylethyl)-phosphoramidothioate (18)
with net retention of configuration.17 The mechanistic proposal
(Scheme 3, Z ) N-R-naphthylethyl, R′O ) MeO) involved an
attack of a methoxide anion on the phosphorus atom collinearly
with the endocyclic P-O bond to form a pentacoordinate
-1
the plots Tm versus ln (CT) are relatively high, thus corre-
sponding data obtained by numeric fitting seem to be more
reliable. Nonetheless, both methods gave virtually the same
values of free Gibbs’ energy for both stereodefined oligomers
14 and 15, as well as for the corresponding [mix] compound
(-6.4/-6.8 kcal/mol for dA12 template, -7.6/-8.0 kcal/mol
for dA30, -8.4/-8.8 kcal/mol for poly(dA)). In most cases
standard enthalpies and entropies are slightly more negative for
duplexes formed by [SP]-PS/PO-T10, but these trends compensate
each other and do not result in differences of free Gibbs’ energy.
This similarity in thermal stability and thermodynamic param-
eters is also reflected in CD spectra recorded for duplexes
formed by [mix]-, [RP]-, or [SP]-PS/PO-T10 with all three
templates. The spectra possess bands characteristic for natural
dAn/Tn duplexes (the B family)45 and show very little difference
between intensities of corresponding bands (Figure 14 in
(45) Gray, D. M.; Ratlif, R. L.; Vaughan, M. R. In Methods in
Enzymology. Vol. 211: Circular Dichroism Spectroscopy of DNA; Lilley,
D. M. J., Dahlberg, J. E., Eds.; Academic Press: San Diego, 1992; p 401.

Stereocontrolled Synthesis of PS-Oligos
J. Am. Chem. Soc., Vol. 120, No. 29, 1998 7163
For the mechanistic considerations the most important finding
was the assignment of the absolute configuration at the P atom
in 21 as RP (see Figure 8). Since “fast”-2c (B ) CytBz), a
precursor of 21, when condensed with 5′-OH nucleoside gives
phosphorothioate dinucleotides 22 of RP configuration (as
determined by HPLC and enzymatic analysis), the result of
crystallographic analysis supports the earlier suggestion17 that
the coupling reaction proceeds via an “adjacent”-type mecha-
nism depicted in Scheme 3 (Z ) 3′-O-deoxyribonucleoside, R′O
) 5′-O-deoxyribonucleoside), although recent ab initio calcula-
tions suggest that 19b is not an intermediate product, and the
bypiramid 19a collapses to 20 via tetragonal square pyramid
transition state.48. Nonetheless, within this mechanistic proposal,
a DBU molecule acts only as a base and not as a nucleophile.49
Since we observed that other bases, such as N-methylimidazole,
4-(dimethylamino)pyridine, and 2-tert-butylimino-2-diethylamino-
1,3-dimethylperhydro-1,3,2-diazaphosphorine, promote the con-
densation far less effectively than DBU, an attack of DBU on
phosphorus atom might be considered50 as the route to the
phosphorane, which upon addition of the hydroxy compound
would lead to the hexacoordinate phosphorus intermediate.
Departure of the protonated DBU ligand, followed by pseu-
dorotation, cleavage of the P-S bond, and elimination of the
episulfide, would give the expected phosphorothioate product,
although we must admit that there is limited knowledge about
stereochemistry of formation and collapse of such hexacoordi-
nate intermediates. Therefore, to get better insight into the
function of DBU in the oxathiaphospholane ring opening
condensation, a mixture of the thymidine oxathiaphospholane
monomer 3a and DBU (20-fold molar excess) in acetonitrile
was monitored by 31P NMR. The consecutive spectra recorded
over the following 30 min showed the formation of only one
product (up to 30%) absorbing at 48 ppm, which by means of
FAB MS was identified as 5′-O-DMT-thymidine 3′-O-phos-
phorothioate, most likely formed by hydrolysis utilizing traces
of water acting as a nucleophile. When 5 µL of water (5-fold
molar excess over the monomer 3a) was added to the reaction
mixture, the hydrolysis was complete in less than 2 min. Fast
formation of dinucleoside phosphorothioate was observed when,
instead of water, an equimolar amount of 3′-O-acetylated
thymidine was added to the mixture containing the monomer
3a and DBU. If no nucleophile was added, no other resonances
were found in the recorded 31P NMR spectrum indicating that,
if any intermediate is formed with participation of the oxathia-
phospholane monomer and DBU, its lifetime must be relatively
short as compared to the NMR time-scale.
Figure 8. The crystal structure of 5′-OH-N4-Bz-deoxycytidine-3′-O-
(2-thio-4,4-dimethyl-1,3,2-oxathiaphospholane) (21), aligned with di-
ethyl ether molecule (a molecule of cosolvent present in the lattice),
derived from X-ray analysis.
intermediate 19a. Such a phosphorane, before collapse to 20,
according to Westheimer’s pseudorotation theory must undergo
a permutational isomerization (marked as Ψ) into 19b, which
places the endocyclic P-S bond in an apical position, thus
allowing for its cleavage.46 The elimination of an episulfide
molecule from 20 leads to the final product 18. This mechanism
explained the observed stereochemistry of methanolysis of 17,
but its validity for the oxathiaphospholane method of synthesis
of oligonucleotides, where Z is 3′-O-deoxyribonucleoside,
awaited further confirmation. Such a verification was achieved
within the present studies based upon the results of X-ray
analysis of N4-Bz-deoxycytidine-3′-O-(2-thio-4,4-dimethyl-
1,3,2-oxathiaphospholane) (21), which was obtained from the
“fast”-eluted diastereomer 2c (X ) S, R ) Me, B ) CytBz),
after detritylation with p-toluenesulfonic acid in methylene
chloride. Compound 21 was isolated chromatographically on
silica gel and dissolved in a mixture of toluene-methylene
chloride-diethyl ether (10:2:0.5, v/v). Upon storage at -23
°C crystals suitable for X-ray analysis were formed (mp 119-
121 °C, δ 31P NMR 107.57 ppm (CD3CN), MS FAB+ 498.2,
MS FAB- 496.1). The bond lengths and valence angles found
for the sugar ring and nucleobase (all experimental and
calculated data are included in Supporting Information) were
similar to those reported in the literature47 and do not deserve
any specific comments. Interestingly, a molecule of compound
21 crystallizes with one molecule of diethyl ether (Figure 8),
which was a cosolvent for crystallization. The solvent molecules
have relatively high thermal oscillation and are located in a
hydrophobic “tunnel” along with molecules of 21 (Figure 9).
They do not form any hydrogen bonds with 21 and are
immobilized in the structure by van der Waals interactions. The
molecules of 21 form a chain due to two intermolecular
hydrogen bonds marked in Figure 9. One of them O5′-H′‚‚‚
O3 is relatively strong (1.86(2) Å), while the second C6-H61‚‚‚
O3 is weaker (2.34(2) Å). Two intramolecular hydrogen bonds
of medium strength C5-H51‚‚‚O4 (2.22(2) Å) and C1′-H11′‚‚‚
O3 (2.36(2) Å), as well as several weak interactions (ca. 2.5
Å) stabilize the geometry of the molecule (see Table 4). Two
five-membered rings present in 21 have different conformations.
The sugar ring adopts an almost perfect open-envelope structure
(asymmetry parameter ∆Cs(C2′)dO.9(2)) with C2′ as an
opening atom, while the oxathiaphospholane ring exists as a
half-chair (asymmetry parameters ∆Cs(C3) ) 10.4(2) and ∆C2-
(C3-C1) ) 11.1(2), (see Table 11 in Supporting Information).
The value -146.0(4)° found for the torsional angle C2-N1-
C1′-O6′ indicates that the O3 atom occupies an exo position
with respect to the sugar ring.
The mechanistic proposal invoking the formation of the
hexacoordinate intermediate became even less justified because
the following experiments demonstrated that a strong nonnu-
cleophilic base such as potassium tert-butoxide also catalyzes
the condensation process. Equimolar amounts of 3a and 3′-O-
acetylated thymidine upon treatment with potassium tert-
butoxide (1.4 equiv) in a mixture of acetonitrile and dimethyl-
formamide (4:1) after 6 h furnished the corresponding protected
dinucleotide in ca. 80% yield (as judged by 31P NMR). The
yield was reasonably good taking into account the stoichiometric
ratio of both reactants, albeit poor solubility of that catalyst,
even in the presence of 18-crown-6, and problems encountered
(48) (a) Uchimaru, T.; Stec, W. J.; Tsuzuki, S.; Hirose, T.; Tanabe, K.;
Taira, K. Chem. Phys. Lett. 1996, 263, 691-696. (b) Uchimaru, T.; Stec,
W. J.; Taira, K. J. Org. Chem. 1997, 62, 5793-5800.
(49) Reed, R.; Reau, R.; Dahan, F.; Bertrand, G. Angew. Chem., Int.
Ed. Engl. 1993, 32, 399.
(50) Stec, W. J.; Karwowski, B.; Guga, P.; Misiura, K.; Wieczorek, M.;
Błaszczyk, J. Phosphorus, Sulfur Silicon 1996, 109-110, 257-260.
(46) (a) Westheimer, F. H. Acc. Chem. Res. 1968, 1, 70-78. (b) Thatcher,
G. R.; Kluger, R. AdV. Phys. Org. Chem. 1989, 25, 99-265. (c) Westheimer,
F. H. Rearrang. Ground Excited State 1980, 2, 229-271.
(47) Cambridge Structural Database, Cambridge Crystallographic Data
Centre; Cambridge, UK.

7164 J. Am. Chem. Soc., Vol. 120, No. 29, 1998
Stec et al.
Figure 9. Crystallographic packing in a crystal of 5′-OH-N4-Bz-deoxycytidine-3′-O-(2-thio-4,4-dimethyl-1,3,2-oxathiaphospholane) (21). The
dotted lines indicate hydrogen bonds (see text).
Table 4. Hydrogen Bonds and Contacts with Distance H‚‚‚A Not Greater than 2.80 Å
D
H
A
D, -H, Å
H‚‚‚A (Å)
D‚‚‚A (Å)
(D-H‚‚‚A)(°)
symmetry
O5′
N2
C5
C5
C6
C6
C7
C7
C8
C11
C15
C1′
C2′
C2′
C3′
C5′
C5′
H5′
H2
O3
C11
O4
C9
0.99(2)
0.90(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
0.96(2)
1.86(2)
2.49(2)
2.22(2)
2.77(2)
2.34(2)
2.44(2)
2.68(2)
2.63(2)
2.52(2)
2.60(2)
2.46(2)
2.36(2)
2.70(2)
2.67(2)
2.70(2)
2.66(2)
2.78(2)
2.836(7)
2.882(8)
2.817(7)
2.999(7)
3.183(6)
2.726(6)
3.044(9)
3.563(9)
3.456(9)
2.882(8)
2.761(9)
2.704(6)
3.140(7)
3.475(7)
2.887(7)
3.597(7)
3.374(7)
172(2)
107(2)
119(2)
94(2)
147(2)
97(2)
103(2)
165(2)
167(2)
97(2)
X, 1 + Y, Z
H51
H51
H61
H61
H72
H73
H82
H111
H151
H11′
H21′
H22′
H31′
H52′
H52′
O3
O6′
O1
O3
N3
N2
O4
O3
O5′
O5′
O5′
O1
O2
X, 1 + Y, Z
1 - X, Y, 2 - Z
1 - X, Y, 2 - Z
98(2)
101(2)
109(2)
142(2)
91(2)
165(2)
121(2)
X, -1 + Y, Z
X, 1 + Y, Z
X, 1 + Y, Z
with the stability of the sarcosinylated support27 make the use
of potassium tert-butoxide as a catalyst in solid-phase synthesis
impractical.
process of DBU-assisted 1,3,2-oxathiaphospholane ring-opening
condensation with 5′-OH-deoxyribonucleosides proceeds with
retention of configuration at phosphorus. This result speaks
for an “adjacent”-type A-E mechanism of nucleophilic sub-
stitution at phosphorus. Additional evidence has been provided
to indicate that DBU does not participate as a nucleophile in
that process.
Conclusions
Phosphitylation of appropriately protected deoxyribonucleo-
sides 9a-d at the 3′-O site with 2-chloro-“spiro”-4,4-pentam-
ethylene-1,3,2-oxathiaphospholane (5), followed by sulfuriza-
tion, provides compounds 3 in satisfactory yields. These can
be efficiently resolved by silica gel column chromatography onto
diastereomerically pure species that serve as substrates in the
1,3,2-oxathiaphospholane ring-opening condensation with 5′-
OH oligonucleotides. The condensation occurs effectively (90-
97% yield) in the presence of DBU with stereospecificity higher
than 98%. Independently, 3′-O-phosphitylation of protected
deoxyribonucleosides with 5, followed by treatment of the
intermediary phosphorothioite 10 with selenium dioxide, pro-
vides compounds 4 which in combination with 3 can be used
for stereocontrolled synthesis of “chimeric” phosphate/phos-
phorothioate oligonucleotides. Within the course of this work,
the crystal structure of the “fast”-2c -related (B ) CytBz) N4-
benzoyldeoxycytidine 3′-O-(2-thio-4,4-dimethyl-1,3,2-oxathia-
phospholane) has been solved providing evidence that the
Experimental Section
The nuclear magnetic resonance spectra were recorded on a Bruker
AC-200 instrument (200 MHz, TMS internal standard for 1H and 85%
H3PO4 as the external standard for 31P). The FAB-MS spectra (13 keV,
Cs+) were recorded on a Finnigan MAT 95 spectrometer, negative
ion MALDI mass spectra were recorded on a Voyager-Elite instrument
(PerSeptive Biosystems Inc., Framingham, MA), while electrospray
mass spectrometry analyses were done at Mass Consortium, Corp., San
Diego, CA. Ultraviolet (UV) spectra and melting profiles were recorded
on a GBC 916 spectrophotometer equipped with a Thermocell unit.
Densitometry of autoradiograms was performed on an LKB Ultroscan
XL densitometer. CD spectra were recorded on a CD6 dichrograph
(Jobin-Yvon) using cells with 5 mm path length. HPLC analyses were
done on an LDC Analytical system (pumps CM3500 and CM3200,
SpectroMonitor SM4100). The crystallographic analysis was performed
on a CAD4 diffractometer with graphite monochromatized Cu KR

Stereocontrolled Synthesis of PS-Oligos
J. Am. Chem. Soc., Vol. 120, No. 29, 1998 7165
radiation. The elemental analysis was performed by the Laboratory
of Microanalysis of this Centre. Evaporations were carried out at 40
°C (or lower) using an aspirator or oil pump vacuum. Deoxyribo-
nucleosides were purchased from Pharma Waldhof (FRG). Cyclohex-
anecarboxaldehyde was purchased from Aldrich (USA). Acetonitrile
and 1,4-diazabicyclo[5.4.0]undec-7-ene (DBU) were supplied by Merck
(FRG). Acetonitrile to be used as solvent for DBU and oxathiaphos-
pholane monomers 1, 2, 3, and 4 was dried over P2O5 (5 g/L) and
distilled through a 20-cm Vigreux column in an atmosphere of dry
argon. At least one-third of the initial volume must be left in the flask.
Acetonitrile dried in this way must be transferred using gastight syringes
under an atmosphere of dry argon, or by vacuum line. NOTE:
Commercially aVailable acetonitrile marked as “DNA/RNA synthesis
grade” supplied eVen by leading manufacturers is not suitable for that
purpose unless dried as aboVe! Phosphorus trichloride, ethyl acetate,
butyl acetate, and selenium dioxide were purchased from POCH
(Poland). Snake venom phosphodiesterase (svPDE, EC 3.1.15.1) was
obtained from Boehringer Mannheim (FRG). Nuclease P1 (nP1, EC
3.1.30.1), calf spleen phosphodiesterase (EC 3.1.16.1), and poly(dA)
were purchased from Sigma. T4 polynucleotide kinase (EC 2.7.1.78)
was obtained from Amersham (USA). [γ-32P]ATP was synthesized
by Dr. A. Płucienniczak of the Centre of Microbiology and Virology
of the Polish Academy of Sciences (Ło´dz´, Poland).
The reaction was complete in 5 min and then elemental sulfur (15
mmol) was added. Stirring was continued for 12 h and an excess of
sulfur was filtered off. After evaporation of the solvent the residue
was dissolved in 4 mL of chloroform (distilled with pyridine) and
applied to a 230-400 mesh silica gel column (23 × 3 cm, 20 g). The
column was eluted with chloroform (250 mL) and then chloroform-
methanol (98:2, v/v). Appropriate fractions were combined and the
solvents were evaporated under reduced pressure to give desired
compounds 3a-c or 5′-O-DMT-N2-iBu-deoxyguanosine-3′-O-(2-thio-
spiro-4,4-pentamethylene-1,3,2-oxathiaphospholane) (11, a precursor
of 3d) in 78-86% yield. The diastereomeric composition, chemical
shifts in 31P NMR, and TLC parameters of compounds 3a-d are given
in Table 1. Anal. (found/calcd) 3a (B ) Thy) C 61.67/60.79, H 6.15/
5.77, N 3.73/3.73, P 4.06/4.13, S 8.00/8.54; 3b (B ) AdeBz) C 62.84/
62.56, H 5.48/5.37, N 7.73/8.11, P 3.41/3.58, S 6.74/7.42; 3c (B )
CytBz) C 62.53/62.92, H 5.47/5.52, N 5.14/5.00, P 3.65/3.69, S 7.26/
7.63.
Protection of 5′-O-DMT-N2-iBu-deoxyguanosine-3′-O-(2-thio-
“spiro”-4,4-pentamethylene-1,3,2-oxathiaphospholane) at the O-6
Site with Diphenylcarbamoyl Chloride.51 To a solution of 5′-O-
DMT-N2-iBu-deoxyguanosine-3′-O-(2-thio-“spiro”-4,4-pentamethylene-
1,3,2-oxathiaphospholane) (0.85 g, 1 mmol) in pyridine (5 mL),
diisopropylethylamine (0.26 mL, 1.5 mmol) and diphenylcarbamoyl
chloride (0.46 g, 2.0 mmol) were added, with stirring, at room
temperature. The mixture was stirred for 1 h, concentrated, dissolved
in chloroform (1.5 mL), and applied into a silica gel column (ca. 20
g). The column was eluted with chloroform (300 mL) and appropriate
fractions (TLC control; silica gel plates, Rf ) 0.79, chloroform/methanol
9:1 v/v) were collected and evaporated under reduced pressure to give
a pale yellow oil. The pure product 3d (0.99 g, 95% yield) was
evaporated with dry toluene, and stored in a tightly closed vessel. Its
diastereomeric composition, chemical shifts in 31P NMR, and TLC
parameters are given in Table 1. MS (+FAB) m/z 1041.6 (M+, 1%),
m/z 1042.6 (M+ + 1, 0.6%), m/z 303.2 (DMT+, 100%). Anal. (found/
calcd) C 63.60/63.44, H 5.78/5.52, N 7.77/8.08, P 2.72/2.98, S 5.78/
6.15.
2,2′-Dithiobis(cyclohexanecarboxaldehyde) (8). This compound
was synthesized from cyclohexanecarboxaldehyde (70% yield) as
described by Hayashi.26 The product was crystallized from diethyl ether
(mp 88-89 °C).
1,1′-Dithiobis(1,1-pentamethylenethan-2-ol) (7). Into a suspension
of NaBH4 (62 g, 0.164 mol) in 500 mL of isopropyl alcohol
2,2′-dithiobis(cyclohexanecarboxaldehyde) (23.5 g, 0.082 mol) was
added dropwise over 30 min. The mixture was refluxed for 1 h, then
evaporated, and a 1.5 M solution of sodium hydroxide (200 mL) was
added. The mixture was cautiously neutralized with concentrated
hydrochloric acid and extracted with chloroform (2 × 150 mL). The
organic layer was dried with magnesium sulfate and the solvent was
evaporated. The residue was dissolved in dry benzene (100 mL) and
the solvent was evaporated with exclusion of moisture. The crystalline
product was precipitated from diethyl ether/hexane; 23 g of colorless
crystalline material was collected (97% yield, mp 49-50 °C).
1-Mercapto-1,1-pentamethylenethan-2-ol (6). Into a suspension
of lithium aluminum hydride (5.9 g, 0.16 mol) in 500 mL of dry diethyl
ether (atmosphere of dry argon, two neck flask equipped with a
condenser and a funnel) a solution of 1,1′-dithiobis(1,1-pentamethyl-
enethan-2-ol) (4.6 g, 0.16 mol) in 150 mL of diethyl ether was added,
with magnetic stirring, dropwise over 60 min. The reaction was
exothermic and mild reflux occurred. The stirring was continued for
1 h and an excess of reducing agent was cautiously decomposed with
ethyl acetate, followed by THF containing traces of moisture, and finally
with 10% water/THF. Inorganic salts were filtered off and the filtrate
was dried with magnesium sulfate. The solvents were evaporated and
the residue was distilled under reduced pressure to give 32.4 g (70%
Separation of the Diastereomers of 3a-d. A solution of 300 mg
of monomer 3 in 1.0 mL of appropriate eluent (vide infra) was applied
onto a column (30 × 2 cm) containing 20 g of silica gel (Merck 60H,
particle size 5-40 µm). The column was eluted with 300 mL of ethyl
acetate-butyl acetate-pyridine (2:1:0.003 v/v/v for the dA and dC
derivatives, 1:2:0.003 v/v/v for the dG derivative) or butyl acetate-
benzene-pyridine (1:1:0.002 v/v/v for the T monomer), and fractions
of 10-12 mL were collected. TLC control of the eluate was performed
on HP-TLC plates. Typically for dA, dT, and dC monomers one
passage gave 75-80% of separated diastereomers of 96.8-100%
diastereomeric purity. For the dG derivative the “fast” isomer was
obtained in 28% yield (100% diastereomeric purity) while the “slow”
isomer was obtained in 50% yield (90% diastereomeric purity), and
had to be rechromatographed.
5′-O-DMT-deoxyribonucleoside-3′-O-(2-oxo-“spiro”-4,4-penta-
methylene-1,3,2-oxathiaphospholane)s (4). Appropriately protected
deoxyribonucleosides 9a-d (1 mmol) were phosphitylated with
2-chloro-“spiro”-4,4-pentamethylene-1,3,2-oxathiaphospholane (vide
supra) and oxidized in situ by addition of 0.61 g of selenium dioxide
(0.55 mmol) at room temperature. The reaction was complete after 3
h (TLC monitoring, chloroform/methanol 9:1, v/v). The reaction
mixture was filtered and the solvent was evaporated. The residue was
dissolved in 2 mL of chloroform (distilled with pyridine) and applied
to a 230-400 mesh silica gel column (20 × 3 cm, 30 g). The column
was eluted with chloroform and appropriate fractions were combined
and evaporated under reduced pressure to give the desired compounds
(5′-O-DMT-deoxyribonucleoside-3′-O-(2-oxo-“spiro”-4,4-pentameth-
ylene-1,3,2-oxathiaphospholane)) in 41-55% yield. The diastereomeric
composition, chemical shifts in 31P NMR, and TLC parameters of
compounds 4a-d are given in Table 1. Anal. (found/calcd) 4a (B )
Thy) C 59.45/62.11, H 5.95/5,85, N 3.82/3.81, P 4.34/4.22, S 4.08/
4.35; 4b (B ) AdeBz) C 61.12/63.74, H 5.65/5.43, N 7.74/8.26, P 3.87/
yield) of a colorless oil (bp 74-76 °C/0.05 mmHg, n20 1.5188).
D
2-Chloro-“spiro”-4,4-pentamethylene-1,3,2-oxathiaphospho-
lane (5). A solution of PCl3 (0.21 mol, 28.2 g) in 500 mL of dry
benzene was poured into a flask equipped with a thermometer and a
separatory funnel. The flask was cooled to 5 °C, and a solution of
1-mercapto-1,1-pentamethylenethan-2-ol (0.14 mol, 20 g) and pyridine
(0.27 mol, 22 mL) in 35 mL of benzene was added dropwise over 15
min with magnetic stirring. The temperature of the reaction mixture
was kept below 10 °C. Stirring was continued at room temperature
for 30 min and pyridine hydrochloride was filtered off. After
evaporation of the solvent under reduced pressure, the product was
distilled to give 21 g of a colorless liquid (76% yield; bp 82-84 °C/
0.01 mmHg; δ 31P NMR 217.7 ppm (C6D6); EI-MS (70 eV) m/z 210,
M+, 12%; m/z 175, [M - Cl]+, 5.8%; m/z 90, 100%.
Phosphitylation of Protected Deoxyribonucleosides with 2-Chloro-
“spiro”-4,4-pentamethylene-1,3,2-oxathiaphospholane: General Pro-
cedure. To the magnetically stirred solution of 10 mmol of appro-
priately protected deoxyribonucleoside (dABz, dGiBu, T, or dCBz) and
1.91 mL of diisopropylethylamine (11 mmol) in 10 mL of dry
acetonitrile, 11 mmol of 5 was added dropwise at room temperature.
(51) Kanimura, T.; Tsuchiya, M.; Urakami, K.; Sekine, M.; Shinozaki,
K.; Miura, K.; Hata, T., J. Am. Chem. Soc. 1984, 106, 4552-4557.

7166 J. Am. Chem. Soc., Vol. 120, No. 29, 1998
Stec et al.
3.66, S 3.76/3.79; 4c (B ) CytBz) C 64.54/64.14, H 5.50/5.58, N 4.62/
5.10, P 4.17/3.76, S 4.09/3.88; 4d (B ) GiBu) C 62.38/60.78, H 6.36/
5.78, N 7.41/8.43, P 3.67/3.74, S 4.08/3.86.
mM MgCl2; 70 mM or 1 M NaCl). The samples were incubated at 90
°C for 2 min, slowly cooled to 8 °C, and kept at this temperature for
20 min. Temperature dissociation was carried out with a temperature
gradient 0.2 °C/min until final temperature 60 °C was reached. The
melting points were determined using the first derivative method. The
plots for 1/Tm vs ln (CT), where CT is a total concentration of
oligonucleotides (CT ) 2Cm for dA12 template, 4Cm/3 for dA30, or Cm
for poly(dA), were optimized using the least-squares method. The
slopes (R/∆H°) and the intercepts ((∆S° - R ln 4)/∆H°) were used for
calculation of ∆H° and ∆S°.43 Melting curves were also fit numerically
(as described in Results and Discussion) and obtained parameters ∆H°
and Tm° were used for calculation of standard entropy and free Gibbs’
energy.
Solid-Phase Synthesis of PS- and PS/PO-Oligos. The automated
synthesis of PS- and PS/PO-Oligos was performed on an ABI 391
synthesizer (Applied Biosystems, Inc., Foster City, CA). Standard
solutions of DCA in methylene chloride and DMAP/Ac2O/lutidine in
THF were used for detritylation and capping steps, respectively. A
1.5 M (or 1 M for synthesis of “chimeric” oligomers) solution of DBU
in CH3CN was delivered from the position for 1-H-tetrazole. The
crucial parameters of the protocol are shown in Table 2. The detailed
protocol for the synthesis is available upon request. For manual
synthesis, gastight syringes were used while all reagents and solvents
were stored under an atmosphere of dry argon, in vials (or bottles)
capped with rubber septa. A column containing solid support was
equipped with two Teflon adapters: one for insertion of a syringe to
deliver reagents, second ended with a needle (or a piece of low diameter
Teflon tubing) to allow for safe collecting of wastes. After each wash
step the excess of solvent was removed from the column by suction
(an aspirator) while dry argon was delivered from the opposite side.
Before each coupling step the column was dried under high vacuum
(0.1 mmHg) for 5 min. The drying vessel was filled up with dry argon
before the column was taken out. An appropriate monomer (20 mg)
was dissolved in dry acetonitrile (140 µL) just before each condensation
step. To that solution, 30 µL of a solution of DBU in acetonitrile (1:
1, v/v) was added and the mixture was applied to the column, followed
by intensive swirling. Swirling was continued over whole coupling
time, approximately 8 min. The reagents were expelled and the support
was washed with dry methylene chloride (4-5 mL) and dry acetonitrile
(7 mL). Other steps as detritylation and capping were performed using
standard reagent solutions with each step followed by exhaustive
washing with 5 mL of dry acetonitrile.
When synthesis was complete, the oligomer was cleaved from the
support under standard conditions (25% NH4OH, 2 h) and the protecting
groups from nucleobases were removed at 55 °C over 12 h. The sample
was concentrated under reduced pressure in a Speed-Vac concentrator
and two-step RP-HPLC (DMT-on and DMT-off) was used to isolate
the product (a column Econosphere, RP-C18, 220 × 4.6 mm; buffer
A, 0.1 M TEAB; buffer B, 40% acetonitrile in 0.1 M TEAB; gradient
1%/min; flow rate 1 mL/min. Retention times in the range 35-40 or
16-23 min were recorded for DMT-on or DMT-off analyses, respec-
tively. For “chimeric” PS/PO oligonucleotide 15 rechromatography
(DMT-off) was necessary (a PTH-C18 column, Brownlee, 220 × 2.1
mm; gradient 0.7%/min, buffers as above, flow rate 0.3 mL/min) to
obtain the product of satisfactory purity.
Enzymatic Analysis of PS/PO Oligonucleotides. For 5′-end
labeling of PS/PO-Oligos by [γ-32P]ATP and T4 polynucleotide kinase
was used the procedure published for labeling of PS-Oligos.16 Labeled
oligonucleotides (1 µg, 0.2 nmol) were hydrolyzed with either svPDE
or Nuclease P1, and the hydrolyzates were analyzed by 20% polyacry-
lamide/7 M urea gel electrophoresis. Because of significant differences
in the rates of hydrolysis of phosphate versus phosphorothioate
internucleotide bonds by each enzyme, to obtain diagnostic autorad-
iograms the amounts of nucleases were adjusted experimentally.
Hydrolysis with svPDE. General Procedure. In a typical experi-
ment the reaction mixture (30 µL) containing 0.006-0.15 µg of svPDE,
100 mM Tris-Cl (pH 8.5), 15 mM MgCl2, and an oligomer (0.2 nmol)
labeled at the 5′-end with 32P was incubated at 37 °C; 10-µL aliquots,
taken after 5, 10, and 15 min, were heat-denaturated and analyzed by
PAGE.
Hydrolysis with Nuclease P1. General Procedure. In a typical
experiment the reaction mixture (30 µL) containing 0.015-0.15 µg of
nuclease P1, 100 mM Tris-Cl (pH 7.2), 1 mM ZnCl2, and labeled
oligonucleotide (0.2 nmol) was incubated at 37 °C; 10-µL aliquots,
taken after 15, 30, and 90 min, were heat-denaturated and analyzed by
PAGE.
Thermodynamic Analysis of Chimeric Oligothymidylates. The
chimeric oligothymidylates [RP]-, [SP]-, or [mix]-PS/PO-T10 at concen-
trations Cm ) 1.15, 2.3, 3.45, 4.6, 5.75, or 6.9 µM, were mixed with
equimolar amount of dA12, or equimolar per nucleotide amount of dA30
or poly(dA) (MW ∼86 000) matrixes (10 mM Tris-HCl, pH 7.5; 10
Enzymatic Degradation followed by MALDI-MS. A mixture of
a 0.05 M solution of 2,4,6-trihydroxyacetophenone in 50% acetonitrile
and 0.2 M solution of diammonium hydrogen citrate in water (8:1,
v/v) was used as a matrix for MALDI-MS analyses.
All enzymatic reaction were performed in deionized water without
the addition of buffers: (5′f3′ degradation) 4 µL of oligonucleotide
solution (0.0005 OD/µL) were mixed with 1 µL of 0.02, 0.03, or 0.07
mU/µL solutions of calf spleen phosphodiesterase and kept for 15 min
at 37 °C; (3′f5′ degradation) 4 µL of oligonucleotide solution (0.0005
OD/µL) were mixed with 1 µL of 0.1, 0.2, or 0.3 mU/µL solutions of
snake venom phosphodiesterase and kept at 37 °C for 15 min. A 1-µL
sample of matrix solution was mixed with 1 µL of enzymatic
degradation mixture, applied onto the probe plate, and allowed to
crystalize. In the resulting spectra (in each experiment 50-100 spectra
were collected in a linear mode and averaged), the negative ions for
intact, as well as for partially digested oligomers, were found (m/z 3043,
2739, 2418, 2114, 1794, 1489, 1168, 864).
X-ray Analysis of 21. The absolute configuration of crystalline 21
(detritylated “fast”-eluted 2c; X ) S, R ) Me, B ) CytBz)16 was
determined using data collected at room temperature. The compound
crystallizes in monoclinic system, space group C2. Experimental details
as well as crystal data are presented in Tables 5-13 in Supporting
Information. Lattice constants were refined by least-squares fit of 25
reflections in Θ range 20.2-30.0°. Decline in intensities of three
standard reflections (0,-3,-6; 0,6,-6; -1,-3,-5) was 14.9% during
164.9 h of exposure. Intensity data were corrected by use of the
DECAY program.52 Absorption correction was applied using ψ-scan
method (EAC program52,53). The observed reflections with I g 3σ(I)
were used to solve the structure by direct methods, and to refine it by
full matrix least-squares using F’s.54,55 Hydrogen atoms connected with
carbon atoms were placed geometrically at idealized positions, other
were found in a difference Fourier map. All hydrogens were set as
riding, with fixed isotropic thermal parameters. Anisotropic thermal
parameters were applied for all nonhydrogen atoms.
The absolute structure RP was determined by use of three methods:
the Hamilton test,56 η-refinement,57 and Flack x parameter.58 The
Hamilton test showed (Rratio ) 1.088, N ) 4075) that the probability
of opposite configuration R , 10-6 55
The Rogers’ parameter η refines
.
to η ) 1.12(7), and where opposite configuration is assumed, to ηinv
) -1.12(7). The Flack parameter x ) 0.02(4).
Acknowledgment. An early contribution of Dr B. Uznan´ski
to the synthesis of “spiro”-type 1,3,2-oxathiaphospholanes is
highly appreciated. Authors are indebted to Dr. Gerald Zon for
his comments on the manuscript, and to Mrs. Karen Fearon (both
of Lynx Therapeutics, Hayward, CA) for recording of ESI MS
spectra. Research presented in this report was financially assisted
(52) Frenz, B. A. SDP-Structure Determination Package; Enraf-
Nonius: Delft, Holland, 1984.
(53) North, A. C. T.; Phillips, D. C.; Mathews, F. S. Acta Crystallogr.
1968, A24, 351.
(54) International Tables for X-ray Crystallography; The Kynoch
Press: Birmingham, England, 1974.
(55) SHELXTL PC, Release 4.1: Program for Structure Determination;
Siemens Analytical X-ray Instruments, Inc.: Madison, WI, 1990.
(56) Hamilton, W. C. Acta Crystallogr. 1965, 18, 502-510.
(57) Rogers, D. Acta Crystallogr. 1981, A37, 734-741.
(58) Flack, H. D. Acta Crystallogr. 1983, A39, 876-881.

Stereocontrolled Synthesis of PS-Oligos
J. Am. Chem. Soc., Vol. 120, No. 29, 1998 7167
by Human Science Promotion Foundation (Japan, Grant K-1007,
Principal Investigator - Professor H. Takaku of Chiba Institute
of Technology, and the State Committee for Scientific Research
(KBN, Grant no. 4.PO5F.023.10 to W.J.S.). This paper is
dedicated to Prof. Dr. Fritz Eckstein on the occasion of his 65th
birthday.
for 14 digested with svPDE and calf spleen phosphodiesterase;
plots for 1/Tm vs ln (CT) for 14/dA12 and 15/dA12; CD spectra
for duplexes 14, 15, or 16 and dA12, dA30, or poly-dA templates;
experimental details, crystal data, and atomic coordinates for
X-ray analysis of 21 (15 pages, print/PDF). See any current
masthead page for ordering information and Web access
instructions.
Supporting Information Available: Chromatograms for RP
HPLC purification (DMT-off) of 14 and 15; MALDI spectra
JA973801J