Chitosan grafted butein: A metal-free transducer for electrochemical genosensing of exosomal CD24

Article abstract of DOI:10.1016/j.carbpol.2021.118333

Metal-free cost-efficient biocompatible molecules are beneficial for opto-electrochemical bioassays. Herein, chitosan (CS) conjugated butein is prepared via graft polymerization. Structural integrity between radical active sites of CS and its probable conjugation routes with reactive OH group of butein during grafting were comprehensively studied using optical absorbance/emission property, NMR, FT-IR and XPS analysis. Fluorescence emission of CS-conjugated butein (CSB) was studied in dried flaky state as well as in drop casted form. Cyclic voltammetric study of CSB modified glassy carbon electrode exhibits 2e^?/2H⁺ transfer reaction in phosphate buffered saline electrolyte following a surface-confined process with a correlation coefficient of 0.99. Unlike pristine butein, CSB modified electrode display a highly reversible redox behavior under various pH ranging from 4 to 9. For the proof-of-concept CSB-modified flexible screen printed electrodes were processed for electrochemical biosensing of exosomal CD24 specific nucleic acid at an ultralow sample concentration, promising for ovarian cancer diagnosis.

Full text of DOI:10.1016/j.carbpol.2021.118333

Carbohydrate Polymers 269 (2021) 118333
Contents lists available at ScienceDirect
Carbohydrate Polymers
journal homepage: www.elsevier.com/locate/carbpol
Chitosan grafted butein: A metal-free transducer for electrochemical
genosensing of exosomal CD24
,
,b
Vinoth Krishnana, Gaurav R. Pandeya b, Kannadasan Anand Babuc, Selvaraj Paramasivama
,
,
Shanmugam Senthil Kumara b, Subramanian Balasubramaniand, Velayutham Ravichandirane,
,b,*
Gururaja Perumal Pazhanif, Murugan Veerapandiana
a Electrodics and Electrocatalysis Division, CSIR-Central Electrochemical Research Institute (CECRI), Karaikudi 630 003, Tamil Nadu, India
b Academy of Scientific & Innovative Research (AcSIR), Ghaziabad 201 002, India
c Dr. A.P.J Abdul Kalam Centre of Excellence in Innovation and Entrepreneurship, Dr. M.G.R Educational and Research Institute, Chennai 600 095, Tamil Nadu, India
d Electroplating and Metal Finishing Division, CSIR-Central Electrochemical Research Institute (CECRI), Karaikudi 630 003, Tamil Nadu, India
e National Institute of Pharmaceutical Education and Research, Kolkata, West Bengal 700 054, India
f Chettinad School of Pharmaceutical Sciences, Chettinad Academy of Research and Education, Rajiv Gandhi Salai, (OMR), Kelambakkam 603 103, Tamil Nadu, India
A R T I C L E I N F O
A B S T R A C T
Keywords:
Metal-free cost-efficient biocompatible molecules are beneficial for opto-electrochemical bioassays. Herein,
chitosan (CS) conjugated butein is prepared via graft polymerization. Structural integrity between radical active
sites of CS and its probable conjugation routes with reactive OH group of butein during grafting were
comprehensively studied using optical absorbance/emission property, NMR, FT-IR and XPS analysis. Fluores-
cence emission of CS-conjugated butein (CSB) was studied in dried flaky state as well as in drop casted form.
Cyclic voltammetric study of CSB modified glassy carbon electrode exhibits 2eꢀ /2H+ transfer reaction in
phosphate buffered saline electrolyte following a surface-confined process with a correlation coefficient of 0.99.
Unlike pristine butein, CSB modified electrode display a highly reversible redox behavior under various pH
ranging from 4 to 9. For the proof-of-concept CSB-modified flexible screen printed electrodes were processed for
electrochemical biosensing of exosomal CD24 specific nucleic acid at an ultralow sample concentration, prom-
ising for ovarian cancer diagnosis.
Dual functional biocomposite
Phytochemical
Opto-electrochemical
Conjugated polyphenol
Ovarian cancer
Genosensor
1. Introduction
impacting a compound annual growth rate (CAGR) of 24.7% projected
for 2020–2027 (Research, 2020–2027). Abundant hydroxyl and amine
Surface engineering of carbohydrate materials amplifying the
inherent physico-chemical and biological properties are emerging
approach for interdisciplinary applications (Barata et al., 2016; Kadam,
Shah, Palamthodi, & Lele, 2018). Polysaccharides, chitin and chitosan
(CS) have attracted significant interest in healthcare and environmental
application, due to its biocompatibility, broad spectrum antimicrobial,
film forming ability, tunable electrical conductivity and antioxidant (Hu
& Luo, 2016; Kaya, Ayten, & Yas¸ar, 2020; Medeiros Borsagli, Mansur,
Chagas, Oliveira, & Mansur, 2015; Subbiah et al., 2012). CS is the
deacetylated product of chitin available in various chain length or
deacetylation ratio and molecular weight, in addition to hydrogel for-
mation function. Recent market analysis documented that deacetylated
CS has significant use in water treatment process and filtration products,
groups of CS makes them soluble in mild acidic pH offering unique
surface chemistry for variety of cross-linkage with macromolecules,
metal ligands and ionic species through internal complex formation,
ligation and electrostatic binding (Suginta, Khunkaewla, & Schulte,
2013). Thus, quest in the development of CS conjugated metal, metal
oxide and carbon nanostructures for various healthcare applications are
attempted.
For instance, electrostatically interacted CS-ionic liquids modified on
pencil graphite electrode (PGE) exhibited a sequence selective probing
of Hepatitis B virus (Erdem, Muti, Mese, & Eksin, 2014). Carboxymethyl
CS modified calcium carbonate controlled the microparticle size distri-
bution with retained biocompatibility of silver nanoparticles supporting
the electrochemiluminescence based DNA sensing, amplifying the signal
* Corresponding author at: Electrodics and Electrocatalysis Division, CSIR-Central Electrochemical Research Institute (CECRI), Karaikudi 630 003, Tamil Nadu,
India.
E-mail address: vmurugan@cecri.res.in (M. Veerapandian).
https://doi.org/10.1016/j.carbpol.2021.118333
Received 18 February 2021; Received in revised form 24 May 2021; Accepted 9 June 2021
Available online 15 June 2021
0144-8617/© 2021 Elsevier Ltd. All rights reserved.

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
transduction at the interface of poly(diallyldimethylammonium
chloride)-functionalized graphene (Li et al., 2014). An electrostatic
adhesion supported DNA complex formation has been achieved using
graphene oxide/CS electrode with methylene blue as mediator for se-
lective tracing of endocrine-disrupting compounds (Lin, Ni, & Kokot,
2015). CS excelled both as dispersant and electro-affinity membrane at
the interface of multiwalled carbon nanotubes (MWCNTs) modified PGE
for detection of DNA damages (Ensafi, Lesani, Amini, & Rezaei, 2015).
Biosensor comprising CS-modified with spongy gold film enabled target-
specific detection of peanut allergen DNA with a lowest detection limit
of 0.013 fM (Sun et al., 2015). Electro-affinity membrane effect of CS on
metal oxide nanosystem modified electrodes are available in the liter-
ature, such as CeO2 nanorods for pathogen sensing (Qian et al., 2018),
oligonucleotide based biosensing of exosomal CD24.
2. Materials and methods
2.1. Chemicals and reagents
2,4-Dihydroxyacetophenone and 3,4-Dihydroxybenzaldehyde were
procured from Spectrochem Pvt. Ltd. Chitosan (low molecular weight
50,000–190,000 g molꢀ 1, viscosity 20–300 cp, 75–85% deacetylated) is
purchased from Sigma Aldrich. Ceric ammonium nitrate (CAN), potas-
sium hydroxide, silica gel (100–200 mesh size) and petroleum ether
were purchased from SRL Pvt. Ltd. Methanol, ethyl acetate, acid solu-
tions and TLC plate (Aluminium oxide 150 F254, neutral) were acquired
from Merck. Mix&Go™ Biosensor and Tris-EDTA buffer solution were
procured from Sigma-Aldrich. All other chemicals and solvent were of
research grade and used without further purification. Deionized (DI)
water from Millipore system with resistivity >18.2 MΩ/cm was used
throughout the experimental condition. The oligo bases, i.e., aptamer
specific to CD24 target sequences along with mismatch sequences were
custom synthesized commercially by ProteoGen Biosciences (India) Pvt.,
Ltd.
ˇ
ˇ
´
´
NiO for insulin detection (Sisolakova et al., 2019) and Mn3(PO4)2 to-
wards superoxide anion sensing (Wang et al., 2019). Molecularly
imprinted electrode surface decorated by CS have significant role on
improving the electroactive surface area of nanomaterial reinforced
electrodes (Guo et al., 2017; Manickam et al., 2020; Wu et al., 2020).
Although the CS-modified nanomaterials demonstrated promising
applications in diagnosis, the recent guidelines from public health
agencies provide daunting challenges owing to the long term seques-
´
tration and toxicity of inorganic nanomaterials (Zielinska et al., 2020).
Further, government policies on metal-free active ingredients with a
motto of eco/bio-friendly approach urge novel material development
from alternative chemical sources. Materials derived from natural
products chemistry such as phytochemicals are ecoꢀ /bio-friendly, cost-
efficient and large-scalable for pharmaceuticals and biomedical utilities.
Amongst wide phytochemicals polyphenol derivatives are both biolog-
ical and electrochemically-active promising for theranostics (Dai, Geng,
Yu, Hao, & Cui, 2019; Pandey et al., 2019). For instance, butein is a
chalcone derivatives of flavonoid, ((E)-1-(2′,4′-dihydroxyphenyl)- 3-
(3,4-dihydroxyphenyl) prop-2-en-1-one), known for radical scavenging.
Moreover, protein tyrosine kinase inhibitory action of butein has sig-
nificant impact in phosphorylation enabling anti-cancer function (Yang,
Zhang, Cheng, & Mack, 1998). Because of its rich electroactive OH
functional groups at ring ‘A' and ‘B', butein is recently studied to have
interfacial role in direct-electron transfer reaction at the electrode sur-
face (Darshani et al., 2018; Kalaiyarasan, Raju, Veerapandian, Kumar, &
Joseph, 2020). Though the structural abundance of OH and NH2 groups
of CS conjugated polyphenols are extensively studied in the past (Hu,
Wang, Zhou, Xue, & Luo, 2016), very little is known about the optical
and electrochemical function. Herein, we report the preparation of
chitosan conjugated butein (CSB) as bi-functional bioprobe for fluores-
cence emission and electrochemical biosensor studies. Butein was
chemically synthesized by Claisen-Schmidt aldol condensation followed
by conjugated with CS using graft polymerization. The underlying
structure-property relationship between OH group of butein and -NH2/
OH groups of CS are comprehensively studied using FT-IR, 1H NMR and
X-ray photoelectron spectroscopic techniques. The resulting conjugated
structure exhibited photoluminescence behavior and durable redox
behavior at the electrode-electrolyte interface against wide pH range
promising for further exploration in theranostics. In order to explore the
electrochemical biosensing of CSB a clinically important biomarker,
exosomal CD24, associated to early diagnosis of ovarian cancer has been
2.2. Synthesis of butein
Precursor chemicals of 2,4-Dihydroxyacetophenone (5.5 g) and 3,4-
Dihydroxybenzaldehyde (5 g) were added to a reaction vessel contain-
ing 35 mL of aqueous KOH solution (1.92 g). As-resulted red-colored
reactant mixture was heated under hot plate maintained at 100 ◦C for a
period of 30 min with a stirring of 600 rpm. Then the reaction mixture
was incubated in an ambient temperature and continued with stirring
for another 12 h. After incubation, the mixture was diluted with 25 mL
of deionized H2O and acidified with diluted HCl (0.1 M) until the
occurrence of precipitation in yellow color. Resulted precipitates were
filtered and dried under vacuum. For purification a column chroma-
tography was performed. At first the reaction products were solubilized
in methanol and then mixed with silica gel to form the slurry and dried
using rotary evaporator. Silica gel beads (100–200 mesh size) and sol-
vent petroleum ether was used for the column wet pack. After setting
column bed slurry, the compound was added to the packed column and
resulted fractions were collected by altering the percentage of solvent
and confirmed with TLC.
2.3. Conjugation of chitosan with butein
Round bottom flask containing 1 g of chitosan in 50 mL of acetic acid
(2%) was mixed with 1 mM butein. To initiate graft polymerization ceric
ammonium nitrate (CAN) (0.5 g) dissolved in 10 mL of 1 N HNO3 and
slowly added to the reaction flask and kept stirring for overnight. As-
reacted products were then precipitated by 75 mL of acetone. Unreac-
ted butein was removed by washing with methanol and the final product
was filtered and dried at 50 ◦C for 6 h.
2.4. Exosomal CD24 aptamer design for genosensor platform
´
identified (Soltesz et al., 2019). Ovarian cancer a devasting manifesta-
Oligonucleotide sequences specific to exosomal CD24 mRNA and its
associated transcript variants were analyzed from NCBI data gene
accession number NM_013230.3. From the identified gene sequences
selected complementary short oligonucleotides specific to CD24 were
designed as probes for immobilization on the CSB-modified electrode
surface. Primer details relevant to probe DNA (PDNA) and target DNA
(TDNA) aptamers of exosomal CD24 (sequence 5′ to 3′), along with two
non-complementary DNA (NCDNA) sequences, with an average base
pairing of 33mers, are as follows,
tion of female reproductive system, most of the patients die due to very
late diagnosis of disease (Chang et al., 2019). Conventional diagnostics
often depend on sophisticated instrumentation, skilled manpower,
tedious sample procedures and not affordable at decentralized zones.
Thus, development of alternative rapid analysis method with simple
cost-efficient instrumentation and ultra-sensitivity will be beneficial for
effective oncology. Amongst various biorecognition elements, aptamer
the short oligonucleotides of DNA or RNA possesses advantages owing to
its versatility in variant temperature, pH and target specific hybridiza-
tion capability irrespective of interferents (Li, Chen, Li, Tan, & Liu,
2019). Herein, as-prepared CSB modified electrodes were subjected to
PDNA_CD24 (NH2-ACCAGCCGCCTTGGTGGTGGCATTAGTTGGATT)
TDNA_CD24 (AATCCAACTAATGCCACCACCAAGGCGGCTGGT)
2

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
Scheme 1. (a) Synthesis of butein. (b) Plausible radical generation sites at CS by CAN and conjugation reaction with butein.
NCDNA1_CD24 (ATTCGGCTATTAAGCTCCTAGCTTAAGCCGTAC)
NCDNA2_CD24 (CTTATCCGAAGGTTCCATAAGGCCTACGTATGC).
of CSB and incubated at an ambient temperature for 30 min. Then, 2
of Mix&Go binder was drop casted and allowed it to dry for 30 min.
Immobilization of Probe-DNA was processed by drop casting 4 L of
M) on the surface of bioaffinity layer, Modified electrode
μL
μ
PDNA (100
μ
2.5. Instrumentation
was incubated at ambient temperature for 30 min. After a gentle wash
with PBS, different concentration of TDNA solution were drop casted
and allowed to dry for 30 min and all experiment were done using 0.1 M
of PBS as electrolyte solution.
The UV–visible absorbance and fluorescence emission spectra were
studied from Thermo Scientific Evolution 300 UV ꢀ vis spectropho-
tometer and Hitachi Fluorescence Spectrophotometer F–7000, respec-
tively. 1H NMR and solid-state 15N NMR spectral analysis were
investigated using Bruker ASCEND™ 500 MHz spectrometer. The
chemical structure bonding were studied from Fourier transform
infrared spectroscopy (FT-IR) and, BrukerOptik GmbH, Germany Model:
TENSOR 27. A pinch of compound were blended with KBr to make a thin
pellet and the infrared spectra were obtained between 4000 cmꢀ 1 to 400
cmꢀ 1. Surface chemistry of chitosan conjugated butein was studied
using X-ray photoelectron spectroscopy (XPS), an ESCALAB 250XI BASE
3. Results and discussion
3.1. Synthesis of butein and conjugation with CS
To synthesize butein an acid-base catalyst assisted Claisen-Schmidt
aldol condensation was utilized using 2,4-Dihydroxyacetophenone and
3,4-Dihydroxybenzaldehyde as precursor reagents (Scheme 1(a)). For
the conjugation reaction with CS, ceric ammonium nitrate (CAN) was
used as the free radical initiator. CAN is known for activation of radical
sites in the polymer backbone (Kumar, Pandey, Raj, & Kumar, 2017).
Herein, the plausible mechanism for the conjugation reaction between
CS and butein are represented in two steps. Scheme 1(b) illustrates the
probable radical sites generated in CS structure activated by CAN. It is
speculated that the CS can have three probable reactive sites for grafting
of butein. It is also worth to mention that unlike pristine CS, CSB is well
dispersible in aqueous solvents. This added property is derived from
conjugation of butein. Due to steric hindrance it is hypothesized that the
other OH groups of butein at C-2′ (ring-A) and C-3/4 (ring-B) are restrict
themselves in conjugation reaction. The structural correlation of CS
conjugated butein are comprehensively discussed using UV–vis absor-
bance, photoluminescence (PL), 1H NMR, FT-IR and XPS techniques.
system with Al Kα as a probe. The high resolution C1s, O1s and N1s
spectra were fitted using CASA XPS software. Fluorescence microscopic
image of the prepared CSB flakes and drop casted CSB were studied
–
using Nikon Eclipse Ti S Fluorescent Microscope under blue excitation
filter, at 4×, 10× and 20× objectives. Electrochemical measurements
were carried out in a traditional three electrode system with a polished
3 mm glassy carbon electrode (GCE), Ag/AgCl (3 M KCl) and Pt wire as
working, reference and counter electrode, respectively. The electrode
ink was prepared by ultrasonication (10 min) of desired material (5 mg,
butein/CS /CSB) with Nafion (150
μL) as binder. The resultant ink was
drop casted (5 L) on pristine GCE and utilized for electrochemical
μ
analysis, using CHI 1000A Electrochemical Analyzer. To fabricate a
sensor platform for point-of-care diagnostic usage, Carbon Screen
Printed Electrode (CSPE) was purchased from pine research instru-
mentation NC, USA with a working substrate of 2 mm in diameter, an
integrated circular-shaped Ag/AgCl and U-shaped carbon substrates
were utilized as reference and counter electrodes, respectively. The
CD24 DNA solution was prepared using Tris-EDTA buffer solution. After
3.2. Optical absorbance and emission spectral study
Optical absorption property of the prepared butein and CSB were
a gentle wash with PBS, CSPE surface was modified by drop casting 4
μ
L
studied using UV–visible spectroscopy (Fig. 1A). It can be observed that
3

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
Fig. 1. (A) UV–visible absorbance spectra and (B) photoluminescence spectra. Excitation wavelength (λex) for butein and CSB was 383 and 273 nm, respectively.
Fig. 2. 1H NMR spectrum of (A) CS and (B) CSB.
butein exhibit two absorbance located at 257 and 383 nm ascribed to
the visible region at 520 nm, in agreement with earlier report (Darshani
et al., 2018), whereas the emission band for CSB is localized at 450 nm,
denoting a blue shift compared to pristine butein. Since pristine CS is
non-emissive, the obtained PL emission from CSB is correlated to the
π-π* and n-π* transition, respectively (Darshani et al., 2018). This
observation is in agreement with earlier report on chalcone optical
properties, comprising ring-A of benzoyl (200–270 nm) and ring-B of
cinnamoyl group (340–390 nm) (Rammohan, Reddy, Sravya, Rao, &
Zyryanov, 2020). In this study, pristine CS dispersion doesn't have
possible existence of modified
butein.
π-conjugation in the aromatic ring of
characteristic band, while the conjugated CSB enabled π-π* transition
associated band with a red shift at 273 nm. On the other hand, n-
associated transition is broadened. The major change observed in the
* transition suggest that the conjugation of CS might be taken place
π*
3.3. 1H NMR study
π-π
1H NMR spectral analysis was performed to elucidate the structural
modification occurred in CS on conjugation with butein. Fig. 2A shows
the characteristic proton resonance resolved from different functional
groups of pristine CS. For instance, protons of acetylated methyl residues
of CS is resolved at 1.9 ppm. Signals from -CH-NH2 (C-2) and -CH-O- (C-
1) group of glucosamine residue are located at 2.9 and 3.9 ppm,
respectively. The characteristic pyranose ring (C-3 to C-6) associated
resonance were observed in the region 3.3–3.7 ppm (Liu, Lu, Kan, & Jin,
2013; Zhu & Zhang, 2014). Fig. 2B shows the typical proton shifts
with the reactive group in ring-A of butein. In general, chalcones are
recognized for their photoluminescence behavior due to existence of
keto and hydroxyl groups, which are known for electron pulling and
electron pushing during the excitation (Zhuang et al., 2017). Herein, to
validate the structure and its associated optical function, PL study was
performed. Fig. 1B shows the emission spectra of methanolic dispersion
of butein and aqueous dispersion of CSB using the relevant λmax as
excitation wavelength. As can be seen butein exhibit emission band in
4

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
resonance at 37 ppm with a sharp intensity. From these changes it is
suggested that a major grafting occurred between the amine group of CS
and hydroxyl group of butein.
3.4. FT-IR spectral analysis
The structural integrity between CS and butein before and after
conjugation was studied using FT-IR spectroscopy (Fig. 3). The charac-
teristic absorption band at 3306 and 1638 cmꢀ 1 is attributed to OH
stretch and keto group of butein, respectively. Bands observed at 1514
and 1591 cmꢀ 1 are ascribed to stretching frequencies of alkene (C=C)
(Darshani et al., 2018). In-plane and out-of-plane OH bending vibrations
were located at 1379 cmꢀ 1 and in the region 544–624 cmꢀ 1, respec-
–
tively. The typical aromatic C H in-plane signals were identified at
1029 and 973 cmꢀ 1, whereas the C H out-of-plane bend is appeared at
–
800 and 660 cmꢀ 1 (Coates, 2006). In the case of CS, the distinct
stretching signatures of amide I and II are identified at 1598 and 1657
cmꢀ 1 (de Vasconcelos et al., 2006). Broad band centered at 3437 cmꢀ 1 is
due to the stretching vibrations of N-H/O-H and intermolecular
hydrogen bonds of the CS (Lazaridis, Kyzas, Vassiliou, & Bikiaris, 2007).
Asymmetric stretching of C-O-C is situated at ~1155 cmꢀ 1. Skeletal
ꢀ 1
–
vibrations of C O stretching are located at ~1080 and ~1030 cm
(Coates, 2006). Band observed at 1382 cmꢀ 1 is ascribed to CH2 bending
vibration (Peniche, Elvira, & San Roman, 1998).
FT-IR spectral study of CSB exhibit their distinct N-H/O-H band at
3437 cmꢀ 1 with a notable broadness. The major shift observed at band
1740 cmꢀ 1 attributed to carbonyl group of butein moiety, indicating the
ring-A might undergo molecular deformation during the conjugation
with CS. Further, appearance of intense vibrational bend of CH2 at 1384
cmꢀ 1 (Oliveira, Martins, Mafra, & Gomes, 2012; Peniche et al., 1998)
Fig. 3. FT-IR spectra of (a) butein, (b) CS and (c) CSB powder samples.
suggest that α-methyl group of CS might unreacted during the conju-
gation reaction, which is in agreement with 1H NMR and solid-state 15
N
observed from CSB. It can be seen that the proton shift related to acet-
ylated methyl and pyranose ring signals from CSB were resolved at 2.03
and 3.2–3.3 ppm, respectively. Appearance of new signal at 5.41 ppm
with a weak hump centered at 5.5 ppm are ascribed to the phenolic OH
(C-2′ or C-4) and -CH- (C-3’or C-5) protons derived from butein. From
the observed chemical shift, CSB acquired grafting via nucleophilic
substitution between C-4′ (ring-A) of butein either at amine macro
–
NMR results. Other structural vibrations associated to alkene, C O and
H groups are situated at 1628, 1030 and 817 cmꢀ 1, respectively
–
O
(Coates, 2006; de Vasconcelos et al., 2006). From the observed signifi-
–
cant changes in the bands of N-H/O-H, C O and CH of CSB, it is further
–
2
assumed that the conjugation occurred predominantly between the
amine group of CS and hydroxyl group of butein.
radical of CS or with α-methyl group of CS (C-6) (Curcio et al., 2009).
3.5. X-ray photoelectron spectroscopy
Since the grafting mechanism is mainly depends on the polysaccharide,
a complementary 15N solid-state NMR was performed to elucidate the
reactivity of amine group (Fig. S1). It can be observed that CS exhibit the
amine group signal at 28 ppm, while CSB enabled a deshielded
To complement 1H NMR/15N NMR and FT-IR spectral analysis, the
surface chemistry of CS conjugated butein was further studied using XPS
method. Fig. 4(A) shows the deconvoluted spectra of C1s from pristine
Fig. 4. High resolution deconvoluted XPS spectra of (A) C1s, (B) O1s and (C) N1s from butein, chitosan and CSB.
5

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
–
an up-shift in the C-OH and C N signal with a binding energy difference
(ΔBE) of 0.43 and 0.11 eV, suggest the possible interaction between the
functional group of butein and CS.
–
O1s spectra (Fig. 4B) of butein exhibit the characteristic C O, C-O/
OH and C-OH binding energies at 529.79, 529.77 and 530.03 eV,
´
respectively (Lapuente, Quijada, Huerta, Cases, & Vazquez, 2003;
´
Vieira, Oliveira, Guibal, Rodríguez-Castellon, & Beppu, 2011). While the
CS O1s peak shows two resolved peaks centered at 529.77 and 531.56
–
eV attributed to C O and C-OH, respectively (Vieira et al., 2011). Upon
conjugation between the amine group of CS and hydroxyl group of
butein an intramolecular bonding is happening which apparently re-
–
flected in the binding energies of C O and C-OH functional groups with
a mild shift at 530.06 and 531.60 eV (Oliveira et al., 2012). From the
N1s (Fig. 4C) spectrum, an evidential signature associated to binding
energy of secondary amine -C-NH-C- is observed from the CSB at 400.59
–
eV (Barata et al., 2016). Moreover, the broadening of C N associated
binding energy at 398.35 eV (Roguska et al., 2011) augments the suc-
cessful interaction between amine group of CS and hydroxyl group of
butein, in agreement with NMR and FT-IR results, suggesting an -NH-C
linkage during the grafting of butein onto CS.
3.6. Fluorescence microscopic analysis
Development of biopolymer, CS, based metal-free fluorescent probe
have recently attracted a significant attention due to its eco-friendly
utility in understanding cell biology and tracing of inorganic/organic
˘
pollutants (Bor, Üçüncü, Emrullahoglu, Tomak, & Sanlı-Mohamed,
¸
2017; Gupta et al., 2015; Pawar, Togiti, Bhattacharya, & Nag, 2019;
Wang et al., 2016). Illuminating the cellular function during the trans-
port of active pharmaceutical ingredients into and efflux of metabolites
from cells is often a vital challenge (Rie; Lee, Kim, Hoang, Jun, & Lee,
2013). Though selected flavonoids have fluorophore function still their
emission is weak at physiological concentrations (Ferrara & Thompson,
2019). Thus, there has been a significant interest in development of
conjugated flavonoid with additional fluorophores. Herein, the inherent
fluorescence emission function of CS conjugated butein was studied in
both dried and liquid state (Fig. 5). The flaky CSB film were obtained by
drying the purified CSB precipitates under hot air oven maintained at
◦
50 C for overnight. Although the representative fluorescence images
are primitive still it provides meaningful information for further
exploration in intracellular imaging.
3.7. Cyclic voltammetric studies
Biocompatible material system with intrinsic redox behavior is po-
tential for electrochemical (bio)sensor studies. Polyphenolic derivatives
are well known for its redox reaction at electrode-electrolyte interface
(Darshani et al., 2018; Kanagavalli et al., 2020; Veerapandian, Seo, Yun,
& Lee, 2014). From the chemical structure analysis of CSB, it is assumed
that OH group at C-4′ (ring-A) of butein majorly involved in the
conjugation with amine group of CS, leaving the catechol OH groups in
the ring-B free. Since catechol OH groups are known for durable redox
behavior, herein, CSB is modified on GCE to further elucidate the elec-
tron transfer kinetics and reaction mechanism. From the Fig. 6A inset, it
can be observed that the butein-modified GCE shows an high anodic
Fig. 5. (A) Photographic images of chitosan conjugated butein (CSB) bulk
flakes and its representative single flake. Fluorescence microscopic images of
(B) CSB flakes and drop casted CSB on glass substrate in (C) dried state and (D)
liquid state.
–
butein, CS and CSB. As can be seen butein exhibited the C C and C-H/
C=C functional group associated binding energies at 283.07 and 284.66
eV, respectively (Krishnamoorthy, Veerapandian, Zhang, Yun, & Kim,
2012; Pandey et al., 2019).
peak current of 12.53 μA at Epa + 0.250 V and less cathodic peak current
–
–
Binding energies with respect to C O and C O are identified at
–
of ꢀ 4.60 μA at Epc + 0.116 V with the peak potential difference of 0.134
288.60 and 285.23 eV, respectively. C1s spectrum of CS fitted into three
V, suggesting an irreversible redox behavior.
–
–
components associated to C C, C-OH and C N observed at 283.39,
284.89 and 286.52 eV, respectively (Kanagavalli & Veerapandian, 2020;
Li et al., 2016; Xiao et al., 2017). In the case of conjugated CSB, four
Interestingly, the CSB modified GCE exhibit anodic peak current of
2.02 μA at Epa + 0.245 V and cathodic reduction peak current of ꢀ 0.197
μ
A at Epc + 0.160 V. The obtained anodic and cathodic peaks are similar
–
binding energies were identified pertaining to C C (283.36 eV), C=C/
with peak potential difference of 0.85 V clearly confirming the revers-
ible behavior of CSB at the electrode interface with high rate of electron
transfer kinetics. Moreover, the obtained redox behavior is attributed to
the oxidation of catechol OH group into quinone species, suggesting
two-electron and two-proton transfer reaction at the interface
–
C-H (284.71 eV), C-OH (285.23 eV) and C N group (286.63 eV)
(Kanagavalli & Veerapandian, 2020; Krishnamoorthy et al., 2012; Li
et al., 2016; Pandey et al., 2019). Unlike pristine CS, the conjugated CSB
exhibit new peak at 284.71 eV belongs to C=C/C-H of butein. Further,
6

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
Fig. 6. (A) CVs of pristine butein (inset), chitosan and chitosan conjugated butein (CSB) modified GCE under PBS (pH 7.4) at a scan rate of 50 mV/s. (B) Skeletal
structure of chalcone. (C) Plausible redox mechanism for CSB modified electrode at the interface. (D) Scan rate dependent study on CSB-modified electrode and (E) its
corresponding linear fit depicting the anodic and cathodic peak current plot. (F) CVs of CSB-modified GCE under different pH condition (scan rate 50 mV/s) and (G)
its corresponding peak potential changes.
´
(Kanagavalli et al., 2020; Tesio, Robledo, Fernandez, & Zon, 2013).
Fig. 6B and 6C illustrates the general chalcone structure and plausible
redox reaction of CSB↔CSB conjugated o-quinone, respectively. To
ensure the reversibility of the observed redox reaction of CSB on GCE, a
scan-rate dependant study was further performed (Fig. 6D). It is ascer-
tained that the delocalized electrons of ortho and para position stabilizes
the phenoxy radicals apparently decreasing the required overpotential
(Darshani et al., 2018; Gil & Couto, 2013). Phenolic groups of ring-B in
chalcone derivatives are known to have structural modulations due to
electron/proton donation influencing the electrochemical behavior, in
addition to radical scavenging function in in vitro and in vivo conditions
(Gil & Couto, 2013). Fig. 6E illustrates the sequential linearity of peak
current with respect to scan rate, enabling coefficient of variation 0.99
(Ipa and Ipc), denoting the surface confined process at the electrode-
electrolyte interface.
Understanding the protonation and deprotonation effect of modified
electrodes under various pH conditions are useful for exploiting their
utility in quality control/assurance studies. In general reversible redox
behavior of metal modified electrodes could be influenced by ion pair-
ing/electrostatic interaction, intra/inter molecular hydrogen bonding
and polarity of supporting electrolyte (Darshani et al., 2018; Guin, Das,
& Mandal, 2011). Fig. 6F demonstrates the inherent CVs of CSB studied
under varied pH conditions like 4,5,6,7,8 and 9 at a constant scan rate of
0.05 V/s. With increase of pH the peak potential of CSB is shifting
Fig. 7. Schematic representation of CSB-modified SPE with oligonucleotide modification specific to CD24 biosensor platform.
7

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
Fig. 8. (A) CVs of electrodes with different modification (a) pristine CSB, (b) CSB-BAL, (c) CSB-BAL/PDNA, (d) CSB-BAL/PDNA/NCDNA1, (e) CSB-BAL/PDNA/
NCDNA2, (f) CSB-BAL/PDNA/TDNA. (B) LSVs of CSB-BAL/PDNA against varied concentrations from
with selected ultra concentration of target analyte and (D) its corresponding linear plot.
μM to fM of TDNA. (C) LSVs of CSB-BAL/PDNA electrode
towards the negative region, expressing the highest peak current at pH
8/9. It can be correlated that the existence of abundant amine functional
groups of CS mediates intrinsic conjugation with butein providing
catechol OH groups for reversible redox reaction at the interface. Fig. 6G
depicts the anodic peak potential variation with respect to pH condi-
tions. CSB-modified GCE exhibit better resolved peak current under
electrolyte pH 7 and 8 suggesting their potential suitability for sensing
the biomarkers at physiological condition.
noticeable decrease in the peak current to 0.03 μA, indicating a possible
hybridization between the oligonucleotides. To check the specificity of
the PDNA two non-complementary sequences were introduced on the
genosensor platform and the resulted peak currents were observed to be
similar to that of BAL modified CSB electrodes. This denotes that the
custom designed PDNA sequences are specific towards the TDNA of
CD24 exosomal aptamers. Fig. 8B illustrates the LSVs of CSB-modified
PDNA measured against wide concentrations of TDNA ranging from
100 fM to 1 μM using 0.1 M PBS as supporting electrolyte (pH 7.4). It is
clear that the LSVs of CSB-BAL/PDNA/TDNA are exhibiting
a
3.8. Electrochemical biosensing of exosomal CD24 nucleic acid
concentration-dependent coherence in the quenching of anodic peak
current. To check their probing capability under ultralow concentration
of aptamers, specific picomolar concentrations of test samples were
introduced on the electrode surface.
LSV technique was adopted to sense the exosomal CD24 nucleic acid.
Distinctly to explore the clinical utility, unlike conventional electro-
chemical sensor, disposable and flexible screen printed electrodes (SPE)
were modified with CSB for construction of CD24 genosensor. Exosomal
CD24 specific aptamers are short DNA oligonucleotides of 33mers with
high molecular weight of glycosylated glycosylphosphatidylinositol-
linked cell surface protein (Keller et al., 2007), expressed in ovarian
cancer and solid tumours (Kristiansen et al., 2002). In this work, to
construct the genosensor platform, CSB-modified SPE electrodes were
treated with a bioaffinity layer (BAL) Mix&Go™ Biosensor. Surface
modification of BAL on CSB activates the immobilization of PDNA on the
electrode surface specific to complementary pairing of TDNA aptamers
of CD24. Fig. 7 shows the steps involved in the sequential surface
modification of SPE with CSB, BAL, activation of PDNA and specific
hybridization of TDNA. Representative LSVs of CSB before and after
oligonucleotide hybridization were also illustrated depicting the varia-
tions in the peak current.
Fig. 8C shows the LSVs measured in the concentration region of
20,40,60,80 and 100 pM. From the linear decrease in the anodic peak
current intensities and its corresponding linear fit shown in Fig. 8D, it is
evident that the prepared genosensors are quite suitable for monitoring
the ultralow concentrations of free nucleic acid. Observed correlation
coefficient variation of 0.98 with a slope value of 0.0063 and standard
deviation (
σ
) of 3.8621Eꢀ 4, the limit of detection (LOD) for the prepared
genosensor was calculated, using the formulae LOD = 3 × σ/slope, to be
2.24 pM. The results indicates that CSB structure exhibit both optical
emission and electrochemical biosensor function promising for bio-
imaging and oncological diagnostics.
4. Conclusion
In summary, a biofriendly composite comprising chitosan conju-
gated butein (CSB) has been developed using graft polymerization.
Usage of ceric ammonium nitrate act as radical initiator mediating three
possible reactive sites at CS. Spectroscopic studies evidenced that the
macroradical of amine group in CS is predominantly involved in the
Fig. 8A shows the comparative CVs of pristine CSB and CSB modified
with PDNA measured against TDNA and NCDNA sequences. It can be
observed that the redox behavior of CSB (0.08 μA) is decreased after
introduction of BAL (0.05
μA) at the same time allowed the localization
of PDNA on the surface. With addition of TDNA there were further
8

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
conjugation reaction with OH group at C-4′ of butein (ring-A). Aqueous
dispersion of CSB exhibit an in situ fluorescence emission in the visible
region 450 nm, due to excited intramolecular charge transfer, which
might be useful for exploration in bioimaging. CSB modified glassy
carbon and flexible screen printed electrodes exhibit a durable and
reversible redox behavior attributed to catechol OH groups in ring-B of
conjugated butein irrespective of electrolyte's pH. Activation of bio-
affinity layer on CSB-modified electrode offer better immobilization of
exosomal CD24 oligonucleotides suitable for specific detection of target
analyte over a wide range of concentrations useful for genosensor design
and application.
Gil, E. S., & Couto, R. O. (2013). Flavonoid electrochemistry: A review on the
electroanalytical applications. Revista Brasileira de Farmacognosia, 23(3), 542–558.
Guin, P. S., Das, S., & Mandal, P. C. (2011). Electrochemical reduction of quinones in
different media: A review. International Journal of Electrochemistry, 2011, 816202.
Guo, W., Pi, F., Zhang, H., Sun, J., Zhang, Y., & Sun, X. (2017). A novel molecularly
imprinted electrochemical sensor modified with carbon dots, chitosan, gold
nanoparticles for the determination of patulin. Biosensors and Bioelectronics, 98,
299–304.
Gupta, A., Chaudhary, A., Mehta, P., Dwivedi, C., Khan, S., Verma, N., & Nandi, C.
(2015). Nitrogen doped Thiol functionalized carbon dots for ultrasensitive Hg (II)
detection. Chemical Communications, 51.
Hu, Q., & Luo, Y. (2016). Polyphenol-chitosan conjugates: Synthesis, characterization,
and applications. Carbohydrate Polymers, 151, 624–639.
Hu, Q., Wang, T., Zhou, M., Xue, J., & Luo, Y. (2016). In vitro antioxidant-activity
evaluation of gallic-acid-grafted chitosan conjugate synthesized by free-radical-
induced grafting method. Journal of Agricultural and Food Chemistry, 64(29),
5893–5900.
CRediT authorship contribution statement
Kadam, D., Shah, N., Palamthodi, S., & Lele, S. S. (2018). An investigation on the effect of
polyphenolic extracts of Nigella sativa seedcake on physicochemical properties of
chitosan-based films. Carbohydrate Polymers, 192, 347–355.
Vinoth Krishnan: Formal analysis, Investigation, Writing – original
draft, Data curation. Gaurav R. Pandey: Validation, Investigation.
Kannadasan Anand Babu: Investigation. Selvaraj Paramasivam:
Investigation. Shanmugam Senthil Kumar: Resources. Subramanian
Balasubramanian: Resources. Velayutham Ravichandiran: Supervi-
sion. Gururaja Perumal Pazhani: Validation, Supervision. Murugan
Veerapandian: Funding acquisition, Writing – review & editing, Su-
pervision, Project administration, Visualization.
Kalaiyarasan, G., Raju, C. V., Veerapandian, M., Kumar, S. S., & Joseph, J. (2020). Impact
of aminated carbon quantum dots as a novel co-reactant for Ru(bpy)32+: Resolving
specific electrochemiluminescence for butein detection. Analytical and Bioanalytical
Chemistry, 412(3), 539–546.
Kanagavalli, P., Radhakrishnan, S., Pandey, G., Ravichandiran, V., Perumal Pazhani, G.,
Veerapandian, M., & Hegde, G. (2020). Electrochemical tracing of Butein using
carbon nanoparticles interfaced electrode processed from biowaste. Electroanalysis,
32(6), 1220–1225.
Kanagavalli, P., & Veerapandian, M. (2020). Opto-electrochemical functionality of Ru
(II)-reinforced graphene oxide nanosheets for immunosensing of dengue virus non-
structural 1 protein. Biosensors and Bioelectronics, 150, Article 111878.
˙
¨
Kaya, I., Ayten, B., & Yas¸ar, A.O. (2020). Synthesis and electrochemical properties of
chitosan-polyphenol composites. Reactive and Functional Polymers, 154, Article
104667.
Acknowledgement
Keller, S., Rupp, C., Stoeck, A., Runz, S., Fogel, M., Lugert, S., … Altevogt, P. (2007).
CD24 is a marker of exosomes secreted into urine and amniotic fluid. Kidney
International, 72(9), 1095–1102.
G.P. gratefully acknowledge the ICMR for awarding the SRF (No. 5/
3/8/26/ITR-F/2020). S.S acknowledge the SERB for providing the
Extramural Research (EMR) Fund (No. EMR/2017/004449). M.V
acknowledge the SERB-DST, Government of India for providing the
Start-up Research Grant (SRG/2019/000238). CSIR-CECRI Manuscript
Communication Number CECRI/PESVC/Pubs./2021-053.
Krishnamoorthy, K., Veerapandian, M., Zhang, L.-H., Yun, K., & Kim, S. J. (2012).
Antibacterial efficiency of graphene nanosheets against pathogenic bacteria via lipid
peroxidation. The Journal of Physical Chemistry C, 116(32), 17280–17287.
Kristiansen, G., Denkert, C., Schlüns, K., Dahl, E., Pilarsky, C., & Hauptmann, S. (2002).
CD24 is expressed in ovarian cancer and is a new independent prognostic marker of
patient survival. The American Journal of Pathology, 161(4), 1215–1221.
Kumar, D., Pandey, J., Raj, V., & Kumar, P. (2017). A review on the modification of
polysaccharide through graft copolymerization for various potential applications.
The Open Medicinal Chemistry Journal, 11, 109–126.
Appendix A. Supplementary data
´
Lapuente, R., Quijada, C., Huerta, F., Cases, F., & Vazquez, J. L. (2003). X-ray
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.carbpol.2021.118333.
photoelectron spectroscopy study of the composition of polyphenol films formed on
Pt by electropolymerisation of phenol in the presence of sulphide in carbonate
medium. Polymer Journal, 35(12), 911–919.
Lazaridis, N. K., Kyzas, G. Z., Vassiliou, A. A., & Bikiaris, D. N. (2007). Chitosan
derivatives as biosorbents for basic dyes. Langmuir, 23(14), 7634–7643.
Lee, J., Kim, Y., Hoang, M.-H., Jun, H.-J., & Lee, S.-J. (2013). Rapid quantification of
cellular flavonoid levels using quercetin and a fluorescent diphenylboric acid 2-
amino ethyl ester probe. Food Science and Biotechnology, 23, 75–79.
References
Barata, J. F. B., Pinto, R. J. B., Vaz Serra, V. I. R. C., Silvestre, A. J. D., Trindade, T.,
Neves, M. G. P. M. S., … Freire, C. S. R. (2016). Fluorescent bioactive corrole grafted-
chitosan films. Biomacromolecules, 17(4), 1395–1403.
Li, K., Chen, Y., Li, A., Tan, C., & Liu, X. (2019). Exosomes play roles in sequential
processes of tumor metastasis. International Journal of Cancer, 144(7), 1486–1495.
Li, M., Wang, Y., Zhang, Y., Yu, J., Ge, S., & Yan, M. (2014). Graphene functionalized
porous Au-paper based electrochemiluminescence device for detection of DNA using
luminescent silver nanoparticles coated calcium carbonate/carboxymethyl chitosan
hybrid microspheres as labels. Biosensors and Bioelectronics, 59, 307–313.
Li, P.-C., Liao, G. M., Kumar, S. R., Shih, C.-M., Yang, C.-C., Wang, D.-M., & Lue, S. J.
(2016). Fabrication and characterization of chitosan nanoparticle-incorporated
quaternized poly(vinyl alcohol) composite membranes as solid electrolytes for direct
methanol alkaline fuel cells. Electrochimica Acta, 187, 616–628.
˘
Bor, G., Üçüncü, M., Emrullahoglu, M., Tomak, A., & S¸anlı-Mohamed, G. (2017).
BODIPY-conjugated chitosan nanoparticles as a fluorescent probe. Drug and Chemical
Toxicology, 40(4), 375–382.
Chang, L., Ni, J., Zhu, Y., Pang, B., Graham, P., Zhang, H., & Li, Y. (2019). Liquid biopsy
in ovarian cancer: Recent advances in circulating extracellular vesicle detection for
early diagnosis and monitoring progression. Theranostics, 9, 4130–4140.
Coates, J. (2006). Interpretation of infrared spectra, a practical approach. In Encyclopedia
of analytical chemistry.
Curcio, M., Puoci, F., Iemma, F., Parisi, O. I., Cirillo, G., Spizzirri, U. G., & Picci, N.
(2009). Covalent insertion of antioxidant molecules on chitosan by a free radical
grafting procedure. Journal of Agricultural and Food Chemistry, 57(13), 5933–5938.
Dai, Q., Geng, H., Yu, Q., Hao, J., & Cui, J. (2019). Polyphenol-based particles for
theranostics. Theranostics, 9, 3170–3190.
Lin, X., Ni, Y., & Kokot, S. (2015). An electrochemical DNA-sensor developed with the
use of methylene blue as a redox indicator for the detection of DNA damage induced
by endocrine-disrupting compounds. Analytica Chimica Acta, 867, 29–37.
Liu, J., Lu, J.-f., Kan, J., & Jin, C.-h. (2013). Synthesis of chitosan-gallic acid conjugate:
Structure characterization and in vitro anti-diabetic potential. International Journal of
Biological Macromolecules, 62, 321–329.
Darshani, P., Gumpu, M. B., Thumpati, P., Rayappan, J. B. B., Ravichandiran, V.,
Pazhani, G. P., & Veerapandian, M. (2018). Chemically synthesized butein and butin:
Optical, structure and electrochemical redox functionality at electrode interface.
Journal of Photochemistry and Photobiology B: Biology, 182, 122–129.
de Vasconcelos, C. L., Bezerril, P. M., dos Santos, D. E. S., Dantas, T. N. C., Pereira, M. R.,
& Fonseca, J. L. C. (2006). Effect of molecular weight and ionic strength on the
formation of polyelectrolyte complexes based on poly(methacrylic acid) and
chitosan. Biomacromolecules, 7(4), 1245–1252.
Manickam, P., Vashist, A., Madhu, S., Sadasivam, M., Sakthivel, A., Kaushik, A., &
Nair, M. (2020). Gold nanocubes embedded biocompatible hybrid hydrogels for
electrochemical detection of H2O2. Bioelectrochemistry, 131, Article 107373.
Medeiros Borsagli, F. G. L., Mansur, A. A. P., Chagas, P., Oliveira, L. C. A., &
Mansur, H. S. (2015). O-carboxymethyl functionalization of chitosan: Complexation
and adsorption of Cd (II) and Cr (VI) as heavy metal pollutant ions. Reactive and
Functional Polymers, 97, 37–47.
Ensafi, A. A., Lesani, S., Amini, M., & Rezaei, B. (2015). Electrochemical ds-DNA-based
biosensor decorated with chitosan modified multiwall carbon nanotubes for
phenazopyridine biodetection. Journal of the Taiwan Institute of Chemical Engineers,
54, 165–169.
Oliveira, J. R., Martins, M. C. L., Mafra, L., & Gomes, P. (2012). Synthesis of an O-
alkynyl-chitosan and its chemoselective conjugation with a PEG-like amino-azide
through click chemistry. Carbohydrate Polymers, 87(1), 240–249.
Erdem, A., Muti, M., Mese, F., & Eksin, E. (2014). Chitosan–ionic liquid modified single-
use sensor for electrochemical monitoring of sequence-selective DNA hybridization.
Colloids and Surfaces B: Biointerfaces, 114, 261–268.
Pandey, G., Marimuthu, M., Kanagavalli, P., Ravichandiran, V., Balamurugan, K., &
Veerapandian, M. (2019). Chitosanylated MoO3–ruthenium(II) nanocomposite as
biocompatible probe for bioimaging and herbaceutical detection. ACS Biomaterials
Science & Engineering, 5(7), 3606–3617.
Ferrara, B. T., & Thompson, E. P. (2019). A method for visualizing fluorescence of
flavonoid therapeutics in vivo in the model eukaryote Dictyostelium discoideum.
BioTechniques, 66(2), 65–71.
9

V. Krishnan et al.
Carbohydrate Polymers 269 (2021) 118333
Pawar, S., Togiti, U. K., Bhattacharya, A., & Nag, A. (2019). Functionalized
chitosan–carbon dots: A fluorescent probe for detecting trace amount of water in
organic solvents. ACS Omega, 4(6), 11301–11311.
Sun, X., Jia, M., Ji, J., Guan, L., Zhang, Y., Tang, L., & Li, Z. (2015). Enzymatic
amplification detection of peanut allergen Ara h1 using a stem-loop DNA biosensor
modified with a chitosan-mutiwalled carbon nanotube nanocomposite and spongy
gold film. Talanta, 131, 521–527.
Peniche, C., Elvira, C., & San Roman, J. (1998). Interpolymer complexes of chitosan and
polymethacrylic derivatives of salicylic acid: Preparation, characterization and
modification by thermal treatment. Polymer, 39(25), 6549–6554.
Qian, X., Qu, Q., Li, L., Ran, X., Zuo, L., Huang, R., & Wang, Q. (2018). Ultrasensitive
electrochemical detection of Clostridium perfringens DNA based morphology-
dependent DNA adsorption properties of CeO2 nanorods in dairy products. Sensors,
18, 1878.
´
Tesio, A. Y., Robledo, S. N., Fernandez, H., & Zon, M. A. (2013). Electrochemical
oxidation of butein at glassy carbon electrodes. Bioelectrochemistry, 91, 62–69.
Veerapandian, M., Seo, Y.-T., Yun, K., & Lee, M.-H. (2014). Graphene oxide
functionalized with silver@silica–polyethylene glycol hybrid nanoparticles for direct
electrochemical detection of quercetin. Biosensors and Bioelectronics, 58, 200–204.
´
Vieira, R. S., Oliveira, M. L. M., Guibal, E., Rodríguez-Castellon, E., & Beppu, M. M.
Rammohan, A., Reddy, J. S., Sravya, G., Rao, C. N., & Zyryanov, G. V. (2020). Chalcone
synthesis, properties and medicinal applications: A review. Environmental Chemistry
Letters, 18(2), 433–458.
(2011). Copper, mercury and chromium adsorption on natural and crosslinked
chitosan films: An XPS investigation of mechanism. Colloids and Surfaces A:
Physicochemical and Engineering Aspects, 374(1), 108–114.
Research, G. V., Chitosan market size share & trends analysis report by application
(Pharmaceutical & Biomedical, Water Treatment, Cosmetics, Food & Beverage).
(2020–2027). https://www.grandviewresearch.com/industry-analysis/global-chi
tosan-market Accessed.
Wang, K., Fan, X., Zhang, X., Zhang, X., Chen, Y., & Wei, Y. (2016). Red fluorescent
chitosan nanoparticles grafted with poly(2-methacryloyloxyethyl
phosphorylcholine) for live cell imaging. Colloids and Surfaces B: Biointerfaces, 144,
188–195.
Rie, M. - Determination of subcellular localization of flavonol in cultured cells by laser
scanning - Ch. 12.
Wang, Y., Wang, D., Sun, L.-H., Xue, P., Wang, M.-Q., Lu, Z., … Bao, S.-J. (2019).
Constructing high effective nano-Mn3(PO4)2-chitosan in situ electrochemical
detection interface for superoxide anions released from living cell. Biosensors and
Bioelectronics, 133, 133–140.
Roguska, A., Pisarek, M., Andrzejczuk, M., Dolata, M., Lewandowska, M., & Janik-
Czachor, M. (2011). Characterization of a calcium phosphate–TiO2 nanotube
composite layer for biomedical applications. Materials Science and Engineering: C, 31
(5), 906–914.
Wu, Y., Deng, P., Tian, Y., Ding, Z., Li, G., Liu, J., … He, Q. (2020). Rapid recognition and
determination of tryptophan by carbon nanotubes and molecularly imprinted
polymer-modified glassy carbon electrode. Bioelectrochemistry, 131, Article 107393.
Xiao, S., Xu, P., Peng, Q., Chen, J., Huang, J., Wang, F., & Noor, N. (2017). Layer-by-layer
assembly of polyelectrolyte multilayer onto PET fabric for highly tunable dyeing
with water soluble dyestuffs. Polymers, 9, 735.
ˇ
ˇ
´
´
´
ˇ
´
ˇ
Sisolakova, I., Hovancova, J., Orinakova, R., Orinak, A., Rueda Garcia, D., Shylenko, O.,
ˇ´
& Radonak, J. (2019). Comparison of insulin determination on NiNPs/chitosan-
MWCNTs and NiONPs/chitosan-MWCNTs modified pencil graphite electrode.
Electroanalysis, 31(1), 103–112.
´
´
´
´
´
´
´
Soltesz, B., Lukacs, J., Szilagyi, E., Marton, E., Szilagyi Bonizs, M., Penyige, A., & Nagy, B.
(2019). Expression of CD24 in plasma, exosome and ovarian tissue samples of serous
ovarian cancer patients. Journal of Biotechnology, 298, 16–20.
Subbiah, R., Ramalingam, P., Ramasundaram, S., Kim, D. Y., Park, K., Ramasamy, M. K.,
& Choi, K. J. (2012). N,N,N-Trimethyl chitosan nanoparticles for controlled
intranasal delivery of HBV surface antigen. Carbohydrate Polymers, 89(4),
1289–1297.
Yang, E.-B., Zhang, K., Cheng, L. Y., & Mack, P. (1998). Butein, a specific protein tyrosine
kinase inhibitor. Biochemical and Biophysical Research Communications, 245(2),
435–438.
Zhu, W., & Zhang, Z. (2014). Preparation and characterization of catechin-grafted
chitosan with antioxidant and antidiabetic potential. International Journal of
Biological Macromolecules, 70, 150–155.
Zhuang, C., Zhang, W., Sheng, C., Zhang, W., Xing, C., & Miao, Z. (2017). Chalcone: A
privileged structure in medicinal chemistry. Chemical Reviews, 117(12), 7762–7810.
Suginta, W., Khunkaewla, P., & Schulte, A. (2013). Electrochemical biosensor
applications of polysaccharides chitin and chitosan. Chemical Reviews, 113(7),
5458–5479.
´
´
Zielinska, A., Costa, B., Ferreira, M., Migueis, D., Louros, J., Durazzo, A., … Souto, E. B.
(2020). Nanotoxicology and nanosafety: Safety-by-design and testing at a glance.
International Journal of Environmental Research and Public Health, 17, 4657.
10