An enzymatic pathway for the biosynthesis of the formylhydroxyornithine required for rhodochelin iron coordination

Article abstract of DOI:10.1021/bi201837f

Rhodochelin, a mixed catecholate-hydroxamate type siderophore isolated from Rhodococcus jostii RHA1, holds two l-δ-N-formyl-δ-N- hydroxyornithine (l-fhOrn) moieties essential for proper iron coordination. Previously, bioinformatic and genetic analysis proposed rmo and rft as the genes required for the tailoring of the l-ornithine (l-Orn) precursor [Bosello, M. (2011) J. Am. Chem. Soc.133, 4587-4595]. In order to investigate if both Rmo and Rft constitute a pathway for l-fhOrn biosynthesis, the enzymes were heterologously produced and assayed in vitro. In the presence of molecular oxygen, NADPH and FAD, Rmo monooxygenase was able to convert l-Orn into l-δ-N-hydroxyornithine (l-hOrn). As confirmed in a coupled reaction assay, this hydroxylated intermediate serves as a substrate for the subsequent N ¹⁰-formyl-tetrahydrofolate-dependent (N¹⁰-fH₄F) Rtf-catalyzed formylation reaction, establishing a route for the l-fhOrn biosynthesis, prior to its incorporation by the NRPS assembly line. It is of particular interest that a major improvement to this study has been reached with the use of an alternative approach to the chemoenzymatic FolD-dependent N ¹⁰-fH₄F conversion, also rescuing the previously inactive CchA, the Rft-homologue in coelichelin assembly line [Buchenau, B. (2004) Arch. Microbiol.182, 313-325; Pohlmann, V. (2008) Org. Biomol. Chem.6, 1843-1848].

Full text of DOI:10.1021/bi201837f

Article
pubs.acs.org/biochemistry
An Enzymatic Pathway for the Biosynthesis of the
Formylhydroxyornithine Required for Rhodochelin Iron Coordination
Mattia Bosello, Andreas Mielcarek, Tobias W. Giessen, and Mohamed A. Marahiel*
Biochemistry, Department of Chemistry, Philipps-University Marburg, Hans-Meerwein-Strasse, D-35043 Marburg, Germany
S
* Supporting Information
ABSTRACT: Rhodochelin, a mixed catecholate−hydroxa-
mate type siderophore isolated from Rhodococcus jostii
RHA1, holds two L-δ-N-formyl-δ-N-hydroxyornithine (L-
fhOrn) moieties essential for proper iron coordination.
Previously, bioinformatic and genetic analysis proposed rmo
and rft as the genes required for the tailoring of the L-ornithine
(L-Orn) precursor [Bosello, M. (2011) J. Am. Chem. Soc. 133,
4587−4595]. In order to investigate if both Rmo and Rft
constitute a pathway for L-fhOrn biosynthesis, the enzymes
were heterologously produced and assayed in vitro. In the presence of molecular oxygen, NADPH and FAD, Rmo
monooxygenase was able to convert L-Orn into L-δ-N-hydroxyornithine (L-hOrn). As confirmed in a coupled reaction assay, this
hydroxylated intermediate serves as a substrate for the subsequent N10-formyl-tetrahydrofolate-dependent (N10-fH4F) Rtf-
catalyzed formylation reaction, establishing a route for the L-fhOrn biosynthesis, prior to its incorporation by the NRPS assembly
line. It is of particular interest that a major improvement to this study has been reached with the use of an alternative approach to
the chemoenzymatic FolD-dependent N10-fH4F conversion, also rescuing the previously inactive CchA, the Rft-homologue in
coelichelin assembly line [Buchenau, B. (2004) Arch. Microbiol. 182, 313−325; Pohlmann, V. (2008) Org. Biomol. Chem. 6,
1843−1848].
he production and the secretion of siderophores is the
most efficient iron-scavenging strategy used by environ-
aeruginosa), CchB (Streptomyces coelicolor), and EtcB (Saccha-
ropolyspora erythraea) are members of this enzyme family.8−13
Once the hydroxylated products have been synthetized, the
monomers can be either directly incorporated into their
corresponding assembly pathways or further modified prior
to assembly on their respective side chains by acetylation or
formylation.6 As a model for the acetylation reaction, the Mcd
enzyme from the erythrochelin gene cluster has been recently
characterized, demonstrating the transfer of an acetyl group
from malonyl- or acetyl-CoA donor to the side chain of an L-
hOrn residue.13 A similar study aimed at the characterization of
the putative formyltransferase CchA, proposed to be involved
in the formylation of L-hOrn in the coelichelin biosynthesis
gene cluster, was not able to successfully confirm its function
(Figure 1). Nevertheless, an analogous “hydroxylation first”
model for the biosynthesis of the nonproteinogenic amino acid
L-fhOrn has been inferred, based on the substrate specificity of
the ornithine monooxygenase CchB.12
T
mental and pathogenic bacteria to mobilize iron from iron-
depleted microbial niches. After secretion out of the
extracellular space, the ferric iron−siderophore complex is
selectively and actively imported into the intracellular space.
Subsequently to its release, the reduced ferrous iron is then
channeled to its dedicated cellular destinations, to be used in
many essential biochemical processes.1 Although all side-
rophores perform the same biological function, they display
great chemical diversity, in both assembly strategy and iron
coordination.2 Regarding the siderophore biosynthesis, two
different classes can be distinguished: NRPS-dependent and
NRPS-independent.3,4 On the other hand, the iron-binding
property relies on the coordination by three major functional
groups: cathecholates, hydroxamates, and carboxylates, which
can be combined to generate mixed type siderophores, further
increasing the iron coordination diversity.5
Hydroxamate-coordinating moieties are ordinarily found in
both NRPS-dependent and NRPS-independent siderophores.
They mainly derive from the hydroxylation of the side chain
amino group of lysine and ornithine or from the primary amino
group of putrescine. This modification reaction is catalyzed by a
homologous group of enzymes belonging to the N-hydroxylat-
ing flavoprotein monooxygenases (NMO), which have been
extensively characterized on both the biochemical and
structural level, and even as potential drug target candidates
against life-threatening microbial infections.6,7 IucD (Escherichia
coli), SidA (Aspergillus fumigatus), PvdA (Pseudomonas
Rhodochelin is a mixed-type catecholate−hydroxamate
siderophore isolated from Rhodococcus jostii RHA1 (Figure
1). It possesses a unique branched structure with an unusual
ester bond between an L-fhOrn moiety and the side chain of a
threonine residue. Rhodochelin biosynthesis is accomplished by
three distantly located gene clusters, implying an unprece-
Received: December 13, 2011
Revised: March 2, 2012
Published: March 22, 2012
© 2012 American Chemical Society
3059
dx.doi.org/10.1021/bi201837f | Biochemistry 2012, 51, 3059−3066

Biochemistry
Article
vortexed for 2 min. Following a centrifugation step at 13 000
rpm for 5 min, the recovered aqueous phase was added to 800
μL of ice-cold isopropanol. The genomic DNA was precipitated
by centrifugation (5 min, 4 °C, 13 000 rpm), prior to 5 min
incubation on ice. Subsequently, the pellet was washed with
500 μL of ice-cold 70% ethanol solution, dried, and
resuspended in 50 μL of EB buffer (10 mM TRIS, pH 8.5).
Construction of Recombinant Expression Vectors. The
rmo and rft were amplified from genomic DNA using the
primers listed in Table 1, with Phusion High-Fidelity DNA
Polymerase (NEB) following the manufacturer’s protocol with
modifications for GC-rich DNA templates (5% DMSO final).
Amplicons were purified in accordance with QIAgen gel
extraction purification kit instructions, digested with the
corresponding endonucleases (NEB), and cloned into pET28a-
(+) (Novagen) with T4 ligase (NEB). The construct was used
to transform E. coli TOP10 cells (Invitrogen), and after
verification of the correct fragment insertion (sequencing by
GATC Biotech), E. coli BL21 (DE3) (Novagen) was
transformed for subsequent expression.
Figure 1. Chemical structures of rhodochelin and coelichelin with
highlighted δ-N-ornithine modifications involved in Fe3+ coordination
(hydroxylation blue, formylation red).
dented and uncharacterized cross talk mechanism between
them. In particular, rmo and rft are located in close proximity of
a silent NRPS and encode for an ornithine monooxygenase and
a formyltransferase, respectively. They are homologous to
coelichelin’s cchB and cchA, and their essentiality for
rhodochelin biosynthesis has previously been proven through
the construction of their respective isogenic deletion strains.14
Curiously, rhodochelin and coelichelin share another interest-
ing feature regarding the incorporation of the L-fhOrn moiety
by their respective NRPS assembly machineries. Despite the
presence of only one adenylating-domain with proper L-fhOrn
specificity, the non-proteinogenic amino acid is incorporated
twice into the peptide, following a so-called “module skipping”
mechanism.15
In the present work, the biochemical characterization of the
recombinant Rmo and Rft is presented. For both enzymes, the
substrate specificity has been investigated, together with the
determination of the kinetic parameters for the L-Orn tailoring
modifications, confirming their proposed biochemical func-
tions. Finally, in a coupled reaction assay, the capability of Rmo
and Rft to generate the hydroxamate-containing L-fhOrn from
the L-Orn precursor has been investigated, establishing a model
for the generation of the non-proteinogenic amino acid, prior
to its incorporation by the peptide assembly line.
Expression and Purification of the Recombinant
Proteins. Expression and purification of the recombinant
Rmo, Rft, and CchA were performed as follows.12 An overnight
culture was diluted 1/100 in LB medium (supplemented with
50 μg/mL kanamycin) and grown at 25 °C at 230 rpm until
OD600 ∼ 0.5 was reached. Protein expression was induced with
IPTG (50 μM), followed by incubation at 25 °C for 4 h. Cells
were harvested by centrifugation (6000 rpm, 4 °C, 15 min),
resuspended in HEPES A buffer (50 mM HEPES, 300 mM
NaCl, pH 8), and frozen at −20 °C until further processing.
Cells were lysed via French press (SLM Aminco), and after a
centrifugation step (17 000 rpm, 4 °C, 30 min), the cleared
̈
lysate was applied to a Ni-NTA column using an AktaPrime
system (Amersham Pharmacia Biotechnology). The elution was
carried out using a linear gradient from 3 to 50% HEPES B
buffer (50 mM HEPES, 250 mM imidazole, 300 mM NaCl, pH
8) in 30 min, followed by a linear increase to 100% B in 10 min.
Protein-containing fractions were analyzed by SDS-PAGE,
pooled, dialyzed against 25 mM HEPES, 100 mM NaCl, pH 7.5
buffer, and concentrated with Amicon Ultra-15 concentrators
(Millipore). Final protein concentration was determined by
Bradford colorimetric assay using a BSA calibration curve.16
Protein aliquots were flash-frozen in liquid nitrogen and stored
at −80 °C.
EXPERIMENTAL PROCEDURES
■
Isolation of Genomic DNA. Rhodococcus jostii RHA1 was
maintained on agar slants as described before.14 For DNA
isolation, 5 mL of liquid culture was harvested by
centrifugation, and the pellet was washed with 1 mL of water.
The cell pellet was resuspended in 500 μL of lysis buffer (100
mM TRIS, 50 mM EDTA, 1% (w/v) SDS, pH 8), and acid-
washed glass beads were added to a final volume of 1.25 mL.
The mixture was vortexed for 2 min, and the recovered
supernatant was transferred into a new microfuge tube. 275 μL
of 7 M ammonium acetate pH 7 was added, and the solution
was incubated at 65 °C for 5 min and then further on ice for 5
min. 500 μL of chloroform was added, and the mixture was
Analytical Size-Exclusion Chromatography. 25 μL of a
50 μM Rmo or Rft solution was analyzed using a Superdex 200
̈
5/150 GL column combined with an AktaPurifier system
(Amersham Pharmacia Biotechnology) equilibrated with 25
mM TRIS, 150 mM NaCl, pH 8 buffer. Protein elution was
monitored at 280 nm. Aldolase (158 kDa), ovalbumin (43
kDa), ribonuclease (13.7 kDa), and aprotinin (6.5 kDa) were
used as standards to determine the molecular weight of the
proteins in solution.
Table 1. List of Primers Used in This Study
primer name
restriction site
sequence (5′−3′)
rftF
NdeI
NotI
NdeI
NotI
GGAATTCCATATGAGAGTCGCCACACTCGGATATC
ATAAGAATGCGGCCGCTCAGCTGAGGTAGCCGCCG
GGAATTCCATATGAGTGAATCGCCGGAAACGGTCG
ATAAGAATGCGGCCGCTCATCTCGCCTCGCTTGTCGCATAC
rftR
rmoF
rmoR
3060
dx.doi.org/10.1021/bi201837f | Biochemistry 2012, 51, 3059−3066

Biochemistry
Article
Figure 2. Rmo-mediated L-Orn hydroxylation. (A) HPLC-MS single-ion chromatogram (SIC) of the hydroxylation assays is shown: in the presence
of the L-Orn substrate and the reducing cosubstrate NADPH, Rmo catalyzes the conversion of L-Orn to L-hOrn (blue trace). The control reactions
evidence that Rmo is unable to hydroxylate D-Orn (red trace) and that the reaction does not proceed if either NADPH or the enzyme is missing
(green and purple traces, respectively). (B) Chemical structures and observed ESI-MS spectra of the L-Orn substrate and the L-hOrn product.
Rmo-Mediated L-Orn Hydroxylation. A 50 μL reaction
contained the following: 100 mM TRIS pH 8, 1 mM L-Orn, 2
mM NADPH, 25 μM FAD, and 20 μM Rmo. Reaction controls
included the absence of cosubstrate NADPH or enzyme as well
as a panel of different amino acids tested for substrate
specificity (Supporting Information Table 1). Reactions were
incubated for 4 h at 30 °C and stopped by the addition of 2 μL
of formic acid and analyzed via HPLC-MS (see below).
Determination of the kinetic parameters for the Rmo-
dependent hydroxylation was performed maintaining the
NADPH and FAD concentration at 0.5 mM and 20 μM,
respectively, and varying L-Orn substrate concentration
between 0.10 and 20 mM. Reactions were started by the
addition of Rmo to a final concentration of 5 μM and stopped
with 2 μL of formic acid after 2.5 min incubation. Product
formation was quantified via HPLC-MS, using a L-hOrn
calibration curve. All reactions were perfomed in triplicate.
Synthesis of the Formyl-Donor Cosubstrate Inter-
mediate N5,N10-methenylH4F. In the first half-reaction, 7 mg
of N5-fH4F was dissolved in 1.5 mL of water and was converted
to N5,N10-methenylH4F by dropwise addition of 0.1 M HCl,
until pH 1.9 was reached. The solution was then brought to a
final volume of 2.2 mL with water and further incubated at
room temperature for 4 h. The formation of N5,N10-
methenylH4F resulted in a color change of the solution, from
colorless to pale yellow, and was further verified via ESI-MS
measurements (Supporting Information Figure S1). The
obtained compound (∼6 mM final concentration) was
aliquoted and stored at −20 °C until usage.
mM L-hOrn, 1.5 mM N5,N10-methenylH4F, and 25 μM Rft (or
CchA). Prior to the addition of the amino acid and the enzyme,
the cosubstrate intermediate was preincubated in the reaction
buffer at 30 °C for 30 min, to permit the final pH-dependent
conversion to N10-fH4F. After the addition of the substrate and
the enzyme, the reaction was allowed to proceed for 4 h at 30
°C, then stopped by the addition of 2 μL formic acid, and
analyzed via HPLC-MS. L-hOrn was synthesized according to a
protocol previously described.17
The kinetic parameters for Rft-mediated transformylation
were determined by maintaining the N5,N10-methenylH4F
concentration at 1.5 mM and varying the L-hOrn between
0.25 and 15 mM. Prior to the beginning of the reaction, the
final N5,N10-methenylH4F conversion to N10-fH4F was allowed
as described. Reactions were started by adding Rft to a final 5
μM concentration and stopped with 2 μL of formic acid after 5
min incubation. Product formation was quantified via HPLC-
MS. All reactions were performed in triplicate.
Coupled L-Orn Hydroxylation and Formylation. In a
similar fashion, coupled enzymatic assays containing both
enzymes have been performed in HEPES buffer, where the N10-
fH4F cosubstrate has first been generated as described, followed
by the addition of all the other components needed for the
reaction. A typical assay in HEPES buffer contained 1 mM L-
Orn, 2 mM NADPH, 1.5 mM N5,N10-methenylH4F, 40 μM
FAD, 25 μM Rmo, and 25 μM Rft. The reaction was carried
out for 4 h, stopped with 2 μL of formic acid, and analyzed via
HPLC-MS.
HPLC-MS Analysis of the Enzymatic Assays. All
enzymatic assays were analyzed on a Hypercarb column
(Thermo Fisher) combined with an Agilent 1100 HPLC
system connected to an ESI-MS detector (Agilent 1100 MSD).
In Situ N10-fH4F Conversion and L-hOrn Formylation
Assay. The transformylation reaction assay was setup in a 50
μL volume, in the presence of 50 mM HEPES buffer pH 7.5, 1
3061
dx.doi.org/10.1021/bi201837f | Biochemistry 2012, 51, 3059−3066

Biochemistry
Article
Table 2. Kinetic Parameter for Rmo-Mediated L-Orn Hydroxylation and Comparison with Other Homologues L-Orn
Monooxygenases Involved in Siderophore Biosynthesis
enzyme
siderophore
KM (mM)
kcat (s−1
)
kcat/KM (s−1 mM−1
)
a
Rmo
rhodochelin
erythrocelin
coelichelin
vicibactin
1.6 0.2
0.286 0.035
3.6 0.58
0.2331 0.008
0.3267 0.0005
0.290 0.01
1.80 0.03
0.400 0.05
0.4833 0.005
0.611
0.15
1.14
0.081
5.90
0.67
0.284
1.0
b
EtcB (13)
b
CchB (12)
b
VbsO (18)
0.305 0.024
0.60 0.07
1.70 0.06
a
PvdA (11)
pyoverdin
a
SidA (9)
ferrichrome
ferrichrome
a
SidA (10)
0.58 0.07
a
b
Steady state parameters for hydroxylated product formation. Steady state parameters for coupled NADPH oxidation assay.
20 mM aqueous NFPA (solvent A) and acetonitrile (solvent B)
were used, employing a linear gradient from 0% to 15% B
within 25 min, followed by a linear increase to 100% B in 2 min
and finally holding B for an additional 3 min. The flow rate was
set to 0.2 mL/min and the column temperature to 20 °C. The
elution was monitored in single-ion mode (SIM). Additional
high-resolution FTICR-MS (HR-MS) measurements were
carried out on a LTQ-FT instrument (Thermo Fisher
Scientific).
Kinetic parameters for Rmo-mediated L-Orn hydroxylation
were determined monitoring the product formation and
plotting the starting velocity as a function of the increasing
substrate concentration. The kinetic parameters were deter-
mined using a Michaelis−Menten equation plot and were
calculated to an apparent KM = 1.6 0.2 mM and kcat = 0.2331
0.008 s−1, resulting in a catalytic efficiency kcat/KM = 0.15 s−1
mM−1 (Figure S5). When compared with other L-Orn
monooxygenase homologues, the obtained values are in
accordance with previously published results, despite the fact
that Rmo does not possess similarly high catalytic efficiency as
EtcB or VbsO (Table 2).13,18
RESULTS
■
Biochemical Characterization of L-Orn Hydroxylation.
In a previous study, it has been demonstrated that rmo encodes
for a putative L-Orn monooxygenase involved in rhodochelin
biosynthesis, since its deletion from the chromosome results in
an abolished siderophore production. rmo is located in a cryptic
cluster (rhodochelin cluster 2), whose product has only been
postulated on the basis of the predicted A-domain specificities
and the presence of a second ORF encoding for a
formyltransferase function (rft, see further).14
In conclusion, Rmo represents a typical member of the
NADPH/FAD-dependent monooxygenases required for the δ-
N-hydroxylation of L-Orn or L-Lys side chains associated with
the biosynthesis of hydroxamate-type siderophores.6
Biochemical Characterization of the L-hOrn Formyla-
tion. Similarly to rmo, rft is essential for rhodochelin
biosynthesis.14 A bioinformatic analysis showed that Rft
exhibits an overall sequence conservation compared to the
proposed formyltransferases CchA and AmcP, putatively
involved in the generation of the formyl-derived iron-
coordinating hydroxamate moieties in coelichelin and amyche-
lin, respectively.15,19 Additionally, the sequence homology also
extendes to the N-terminal domain of ArnA (a bifunctional
enzyme required for the generation of a lipid A analogue
essential for polymixine resistance in Escherichia and Salmonella
spp.) and to the endogenous and essential bacterial methionyl-
tRNAfMet-formyltransferase.20,21 In a derived phylogenetic tree,
these sequences clearly clusters into different clades, according
to their different substrate specificities (Figure S6).
Additionally, Rft shares a bimodular organization with the
above-mentioned enzymes (Figure S7).22 The N-terminal
subdomain displays typical elements for tetrahydrofolate
binding enzymes: the catalytic Asn, His, Asp triad, and the
N10-fH4F “SLLP” binding motif. These conserved residues are
also found in the formyltransferases FxbA and PvdF (associated
with the biosynthesis of L-fhOrn in exochelin and pyoverdine
systems), the N-terminal formylation domain of the initiation
module of the linear gramicidine NRPS LgrA1, and the
glycinamide ribonucleotide formyltransferases (GARF) family
proteins, although in this latter case, additional structural
differences and less sequence homology have already been
reported (Figure S8).21,23−26 On the other hand, the overall
sequence homology between Rft and its above-discussed closest
homologues decreases through the C-terminal subdomain,
which seems not to be involved in catalysis and, as
demonstrated for the methionyl-tRNAfMet-formyltransferase,
could be associated with proper substrate recognition.23
A bioinformatic analysis showed that Rmo belongs to the
class of NADPH/FAD-dependent and, when compared to
already characterized homologues (CchB, EtcB, PvdA, SidA,
and IucD), it displays an overall sequence conservation,
especially on the sites involved in substrate, NADPH, and
FAD binding (Figure S2).6,8,9,11−13 rmo was amplified from the
R. jostii RHA1 chromosome and cloned into the pET28a(+)
expression vector. The recombinant protein was heterologously
produced in E. coli as an N-terminal His-tag fusion and purified
via Ni-NTA affinity chromatography. The enzyme was purified
in the apo form, without bound FAD cofactor (Figure S3). The
estimated molecular mass of Rmo in solution was calculated to
be 220 kDa, suggesting the enzyme to adopt a tetrameric
quaternary structure (Figure S4).
In order to investigate if Rmo is able to catalyze the
conversion of L-Orn to L-hOrn, substrate and enzyme were
incubated in the presence of the NADPH cosubstrate and the
FAD cofactor. After a 4 h incubation, HPLC-MS analysis
revealed 65% conversion of L-Orn (tR 12.1 min, m/z 133.1 [M
+ H]+ observed, m/z 133.1 [M + H]+ calculated) to L-hOrn (tR
19.4 min, m/z = 149.1 [M + H]+ observed, m/z 149.1 [M +
H]+ calculated) in the presence of the enzyme and molecular
oxygen (Figure 2). HR-MS analysis confirmed the identity of L-
hOrn (m/z 149.0916 [M + H]+ observed, 149.0921 [M + H]+
calculated). No enzymatic conversion was observed if either
Rmo or NADPH was omitted or if NADH was used as the
reducing cosubstrate. In addition, the enzyme showed exclusive
substrate specificity toward L-Orn over a panel of different
amino acids (Supporting Information Table 1).
3062
dx.doi.org/10.1021/bi201837f | Biochemistry 2012, 51, 3059−3066

Biochemistry
Article
Figure 3. Rft- and CchA-mediated L-hOrn formylation. (A) Lower traces: HPLC-MS single-ion chromatogram (SIC) of the formyltransferase
reaction assay is shown: in the presence of the L-hOrn substrate and the in situ generated N10-fH4F formyl-donor cosubstrate, Rft catalyzes the
conversion of L-hOrn to L-fhOrn (blue trace). Control reactions were carried out in the absence of the donor cosubstrate or the enzyme (green and
light blue traces, respectively). Upper traces: a similar assay performed in the presence or the absence of CchA (red and orange traces, respectively)
rescues the enzymatic activity of this Rft homologue from the coelichelin biosynthesis gene cluster, which was previously reported to be inactive. (B)
Chemical structures and observed ESI-MS spectra of the L-hOrn substrate and the L-fhOrn product.
In order to investigate the role of Rft in L-fhOrn biosynthesis,
the corresponding gene was amplified and cloned in pET28a-
(+) expression vector. The recombinant protein was purified as
an N-terminal His-tag fusion and tested for in vitro activity
(Figure S9). The required N10-fH4F cofactor was generated in
situ from its N5,N10-methenylH4F intermediate, through a 30
min preincubation in the assay buffer. In the presence of L-
hOrn and N10-fH4F, Rft was able to transfer the formyl group
from the donor cosubstrate to the side chain of the
hydroxylated amino acid. After a 4 h incubation, HPLC-MS
analysis revealed 55% conversion of L-hOrn (tR 18.9 min, m/z
149.1 [M + H]+ observed, m/z 149.1 [M + H]+ calculated) to
L-fhOrn (tR 12.9 min, m/z = 177.1 [M + H]+ observed, m/z
177.1 [M + H]+ calculated; Figure 3). L-fhOrn identity was
confirmed by HR-MS analysis (m/z 177.0871 [M + H]+
observed, 177.0870 [M + H]+ calculated). No conversion was
observed in the absence of enzyme or cosubstrate. In addition,
in similar assay conditions, Rft is unable to formylate L-Orn or
both L-Orn and L-hOrn if N5-fH4F was used as the donor
cofactor (data not shown).
but inactive form or was rendered inactive by the incubation in
the reaction assay.12 Therefore, on the basis of the obtained
results for Rft, CchA was expressed, purified, and assayed for
enzymatic activity. As shown in Figure 3, CchA was able to
catalyze the conversion of L-hOrn to L-fhOrn (75% after 4 h
incubation).
The kinetic parameters of Rft tranformylation were
determined monitoring the conversion of substrate to product
and plotting the starting velocities as a function of the
increasing substrate concentration. Surprisingly, the exper-
imental data could be fitted best using a sigmoidal curve,
indicative of an allosteric kinetic mechanism, rather than the
typical rectangular hyperbola characteristic of classical
Michaelis−Menten kinetic (Figure S10).28 Normalized param-
eter values were calculated through the nonlinear Hill-fit
regression and were found to be equal to a Vmax = 0.078
0.001 μmol L−1 s−1, a K0.5 = 1.2 0.1 mM, and n = 2.7 0.2. A
value of the Hill parameter n greater than 1 is indicative of a
positive cooperative mechanism. To further clarify the origin of
this cooperative behavior, analytical size exclusion chromatog-
raphy was employed to elucidate the oligomeric state of Rft.29
As shown in Figure S4, the estimated molecular weight of Rft
was 146 kDa, suggesting the enzyme to adopt a tetrameric
quaternary structure in solution.
Previous attempts to characterize Rft using the N10-fH4F
cosubstrate generated via a chemoenzymatic synthesis approach
(chemical conversion of H4F to N5,N10-methyleneH4F in the
presence of formaldehyde, followed by a FolD-catalyzed
regiospecific oxidation/cyclohydrolysation) always resulted in
no detectable enzymatic activity (data not shown).27 Similar
results were obtained during the characterization of CchA,
which left unclear whether the enzyme was purified in a soluble
L-fhOrn Coupled Enzymatic Biosynthesis. In order to
verify whether Rmo and Rft were able to act in tandem to
generate L-fhOrn from the L-Orn substrate, a similar assay to
the Rft-dependent L-hOrn transformylation was set up, where
3063
dx.doi.org/10.1021/bi201837f | Biochemistry 2012, 51, 3059−3066

Biochemistry
Article
Figure 4. HPLC-MS single-ion chromatogram (SIC) of the coupled enzymatic biosynthesis of L-fhOrn from its L-Orn precursor in the presence of
the Rmo monooxygenase and the Rft formyltransferase (blue trace). If Rft is omitted, the reaction stops generating only the L-hOrn intermediate
(red trace); if Rmo is excluded, no conversion at all is observed (green trace).
first the N10-fH4F cosubstrate was generated in situ, followed by
the addition of all the remaining components needed for the
enzymatic tandem conversion to L-fhOrn. Comparison of
HPLC-MS traces showed the substrate conversion to the L-
hOrn intermediate and the L-fhOrn product if both enzymes
were present or, as expected, only to L-hOrn if Rft was omitted.
On the other hand, if Rmo was missing, no substrate
conversion was observed (Figure 4).
NADPH. In addition, likewise SidA, Rmo adopts a tetrameric
quaternary structure in solution, which does not alter the
catalytic properties of the single subunits, resulting in a classical
Michaelis−Menten kinetic.9
The biochemical characterization of Rft represents the first in
vitro study of a tailoring formyltransferase involved in the
biosynthesis of formyl-based iron-coordinating hydroxamate
moieties. In fact, previous attempts to elucidate the role of
homologous and analogous enzymes (Ccha, PvdF, and FxbA)
were not successful or relied on the use of genetic strategies
employing indirect detection methods.12,24,25 Additionally, in
contrast to the endogenous methionyl-tRNAfMet-formyltransfer-
ase, ArnA, and the F-domain embedded within the LgrA1
initiation module, Rft catalyzes the formylation of a secondary
amine, whereas the previously mentioned enzymes modify a
primary amino group.20,21,26
The use of an alternative strategy for the generation of the
unstable, and thus commercially unavailable, N10-fH4F
cosubstrate, namely the in situ transformation of N5,N10-
methenylH4F to the desired N10-fH4F, through preincubation
in the assay buffer, has proved to be successful, resulting in
enzymatically active cofactor. Likewise, this strategy was applied
to the hitherto inactive CchA, promoting the conversion of L-
hOrn to L-fhOrn, implying a similar biosynthetic mechanism for
the same iron-coordinating group in the siderophore
coelichelin.12
Rft kinetic characterization indicates a positive cooperative
effect, possibly resulting from the fact that, in solution, the
enzyme adopts a tetrameric quaternary structure. In this
context, the conserved presence of the C-terminal subdomain
(which does not feature any catalytic residues) could be seen as
a modification of the original tRNA binding function of the
methionyl-tRNAfMet-formyltransferase to an oligomerization
and/or allosteric role in Rft.23 In addition, the positive
cooperative control mechanism could improve the overall
biosynthesis of the non-proteinogenic L-fhOrn amino acid (and
DISCUSSION
■
The use of hydroxamate groups as iron-coordinating moieties is
a shared strategy employed by both NRPS-dependent and
NRPS-independent enzymes for siderophores biosynthesis.4 In
both cases, it generally requires the hydroxylation of the lateral
amino group of a basic amino acid (lysine or ornithine),
followed by the additional transfer of an acetyl or formyl group
to the secondary amine intermediate, generating the functional
hydroxamate moiety. This building block is subsequently
incorporated by the NRPS-dependent or NRPS-independent
assembly enzymes into the siderophore peptide scaffold.6,30 In
this study we report the biochemical characterization of Rmo
and Rft, the tailoring enzymes required for the biosynthesis of
the L-fhOrn moieties found in rhodochelin, the siderophore
isolated from R. jostii RHA1.14
On the basis of a bioinformatic analysis, Rmo was predicted
to belong to the N-hydroxylating flavoprotein monooxygenases
(NMO), of which different homologues have previously been
characterized through extensive biochemical and structural
studies.6,9−13,18 The recombinant enzyme was purified in the
apo form, without bound FAD cofactor. The crystal structure of
PvdA (Rmo homologue from P. aeruginosa) demonstrates that
the FAD binding site is located in close proximity to the surface
of the enzyme. Therefore, the loss of the flavin cofactor during
purification is not unexpected.31 As other members of the
NMO family, Rmo shows an exclusive preference toward its
cognate amino acid substrate and the reducing cosubstrate
3064
dx.doi.org/10.1021/bi201837f | Biochemistry 2012, 51, 3059−3066

Biochemistry
Article
thus its incorporation by the NRPS assembly line), providing
an enhancement for siderophore biosynthesis under the
restrictive iron-limiting growing conditions.
sodium dodecyl sulfate−polyacrylamide gel electrophoresis;
SIC, single-ion chromatogram; SIM, single-ion mode; TRIS,
tris(hydroxymethyl)aminomethane.
In conclusion, on the basis of the results of the coupled assay
and the additional inability of Rmo to hydroxylate L-fOrn and
of Rft to transformyate L-Orn, a model for the biosynthesis of
the formyl-based hydroxamate-containing siderophores could
be proposed, according to the so-called “hydroxylation first”
mechanism, recently described for the acetyl-based hydrox-
amates.13 Initially, the L-Orn side chain amino group is
hydroxylated by a NMO enzyme, and then the newly modified
L-hOrn could be either incorporated by the NRPS assembly
line (coelichelin) or further modified by formylation, leading to
the generation of iron-coordinating L-fhOrn (coelichelin or
rhodochelin).
REFERENCES
■
(1) Sandy, M., and Butler, A. (2009) Microbial iron acquisition:
marine and terrestrial siderophores. Chem. Rev. 109, 4580−4595.
(2) Oves-Costales, D., Kadi, N., and Challis, G. L. (2009) The long-
overlooked enzymology of a nonribosomal peptide synthetase-
independent pathway for virulence-conferring siderophore biosyn-
thesis. Chem. Commun. (Cambridge, U. K.), 6530−6541.
(3) Crosa, J. H., and Walsh, C. T. (2002) Genetics and assembly line
enzymology of siderophore biosynthesis in bacteria. Microbiol. Mol.
Biol. Rev. 66, 223−249.
(4) Barry, S. M., and Challis, G. L. (2009) Recent advances in
siderophore biosynthesis. Curr. Opin. Chem. Biol. 13, 205−215.
(5) Miethke, M., and Marahiel, M. A. (2007) Siderophore-based iron
acquisition and pathogen control. Microbiol. Mol. Biol. Rev. 71, 413−
451.
ASSOCIATED CONTENT
■
S
* Supporting Information
Substrate specificity table for Rmo-mediated hydroxylation,
reaction scheme, and ESI-MS measurements for N5,N10-
methenylH4F intermediate synthesis, SDS-PAGE of purified
recombinant enzymes, analytical size exclusion chromatogra-
phy, and results of the bioinformatics analysis and kinetic
parameter determination for both Rmo and Rft. This material is
available free of charge via the Internet at http://pubs.acs.org.
(6) Olucha, J., and Lamb, A. L. (2011) Mechanistic and structural
studies of the N-hydroxylating flavoprotein monooxygenases. Bioorg.
Chem. 39, 171−177.
(7) Hissen, A. H. T., Wan, A. N. C., Warwas, M. L., Pinto, L. J., and
Moore, M. M. (2005) The Aspergillus fumigatus siderophore
biosynthetic gene sidA, encoding L-ornithine N5-oxygenase, is
required for virulence. Infect. Immun. 73, 5493−5503.
(8) Macheroux, P., Plattner, H. J., Romaguera, A., and Diekmann, H.
(1993) FAD and substrate analogs as probes for lysine N6-hydroxylase
from Escherichia coli EN 222. Eur. J. Biochem. 213, 995−1002.
(9) Chocklett, S. W., and Sobrado, P. (2010) Aspergillus fumigatus
SidA is a highly specific ornithine hydroxylase with bound flavin
cofactor. Biochemistry 49, 6777−6783.
AUTHOR INFORMATION
■
Corresponding Author
*E-mail: marahiel@staff.uni-marburg.de; Tel: +49 (0) 6421 28
25722; Fax: +49 (0) 6421 28 22191.
(10) Mayfield, J. A., Frederick, R. E., Streit, B. R., Wencewicz, T. A.,
Ballou, D. P., and DuBois, J. L. (2010) Comprehensive spectroscopic,
steady state, and transient kinetic studies of a representative
siderophore-associated flavin monooxygenase. J. Biol. Chem. 285,
30375−30388.
(11) Meneely, K. M., and Lamb, A. L. (2007) Biochemical
characterization of a flavin adenine dinucleotide-dependent mono-
oxygenase, ornithine hydroxylase from Pseudomonas aeruginosa,
suggests a novel reaction mechanism. Biochemistry 46, 11930−11937.
(12) Pohlmann, V., and Marahiel, M. A. (2008) Delta-amino group
hydroxylation of L-ornithine during coelichelin biosynthesis. Org.
Biomol. Chem. 6, 1843−1848.
Funding
This work was supported by the Deutsche Forschungsgemein-
schaft.
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
Authors gratefully acknowledge Dr. Uwe Linne (Department of
Chemistry, Philipps-University Marburg) for additional HR-MS
measurements.
(13) Robbel, L., Helmetag, V., Knappe, T. A., and Marahiel, M. A.
(2011) Consecutive enzymatic modification of ornithine generates the
hydroxamate moieties of the siderophore erythrochelin. Biochemistry
50, 6073−6080.
(14) Bosello, M., Robbel, L., Linne, U., Xie, X., and Marahiel, M. A.
(2011) Biosynthesis of the siderophore rhodochelin requires the
coordinated expression of three independent gene clusters in
Rhodococcus jostii RHA1. J. Am. Chem. Soc. 133, 4587−4595.
(15) Lautru, S., Deeth, R. J., Bailey, L. M., and Challis, G. L. (2005)
Discovery of a new peptide natural product by Streptomyces coelicolor
genome mining. Nat. Chem. Biol. 1, 265−269.
(16) Bradford, M. M. (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Anal. Biochem. 72, 248−254.
(17) Lin, Y., and Miller, M. (1999) Practical Synthesis of
Hydroxamate-Derived Siderophore Components by an Indirect
Oxidation Method and Syntheses of a DIG− Siderophore Conjugate
and a BiotCin. J. Org. Chem.,.
(18) Heemstra, J. R., Walsh, C. T., and Sattely, E. S. (2009)
Enzymatic tailoring of ornithine in the biosynthesis of the Rhizobium
cyclic trihydroxamate siderophore vicibactin. J. Am. Chem. Soc. 131,
15317−15329.
(19) Seyedsayamdost, M. R., Traxler, M. F., Zheng, S.-L., Kolter, R.,
and Clardy, J. (2011) Structure and Biosynthesis of Amychelin, an
ABBREVIATIONS
■
A-domain, adenylation domain; BSA, bovine serum albumin;
CoA, coenzyme A; DMSO, dimethyl sulfoxide; EDTA,
ethylenediaminetetraacetic acid; ESI-MS, electrospray ioniza-
tion mass spectrometry; F-domain, formylation domain; FAD,
flavin adenine dinucleotide; FTICR-MS, Fourier transform ion
cyclotron resonance mass spectrometry; HEPES, (4-(2-
hydroxyethyl)-1-piperazineethanesulfonic acid; HPLC, high-
performance liquid chromatography; IPTG, isopropyl β-D-1-
thiogalactopyranoside; NADH, nicotinamide adenine dinucleo-
tide; NADPH, nicotinamide adenine dinucleotide phosphate; L-
Orn, L -ornithine; L-fOrn, L-δ-N-formylornithine; L-fhOrn, L-δ-
N-formyl-δ-N-hydroxyornithine; L-hOrn, L-δ-N-hydroxyorni-
thine; LB, Luria−Bertani; MS, mass spectrometry; N5-fH4F,
N5-formyl-tetrahydrofolate; N5,N10-methenylH4F, N5,N10-meth-
enyl-tetrahydrofolate; N5,N10-methyleneH4F, N5,N10-methyl-
ene-tetrahydrofolate; N10-fH4F, N10-formyl-tetrahydrofolate;
NMO, N-hydroxylating flavoprotein monooxygenase; Ni-
NTA, Ni-nitrilotriacetic acid; NFPA, nonafluoropentanoic
acid; NRPS, nonribosomal peptide synthetase; ORF, open
reading frame; PCP, peptidyl carrier protein; SDS−PAGE,
3065
dx.doi.org/10.1021/bi201837f | Biochemistry 2012, 51, 3059−3066

Biochemistry
Article
Unusual Mixed-Ligand Siderophore from Amycolatopsis sp. AA4. J.
Am. Chem. Soc. 133, 11434−11437.
(20) Breazeale, S. D., Ribeiro, A. A., McClerren, A. L., and Raetz, C.
R. H. (2005) A formyltransferase required for polymyxin resistance in
Escherichia coli and the modification of lipid A with 4-Amino-4-deoxy-
L-arabinose. Identification and function oF UDP-4-deoxy-4-formami-
do-L-arabinose. J. Biol. Chem. 280, 14154−14167.
(21) Schmitt, E., Blanquet, S., and Mechulam, Y. (1996) Structure of
crystalline Escherichia coli methionyl-tRNA(f)Met formyltransferase:
comparison with glycinamide ribonucleotide formyltransferase. EMBO
J. 15, 4749−4758.
(22) Schultz, J., Milpetz, F., Bork, P., and Ponting, C. P. (1998)
SMART, a simple modular architecture research tool: identification of
signaling domains. Proc. Natl. Acad. Sci. U. S. A. 95, 5857−5864.
(23) Schmitt, E., Panvert, M., Blanquet, S., and Mechulam, Y. (1998)
Crystal structure of methionyl-tRNAfMet transformylase complexed
with the initiator formyl-methionyl-tRNAfMet. EMBO J. 17, 6819−
6826.
(24) Fiss, E. H., Yu, S., and Jacobs, W. R. (1994) Identification of
genes involved in the sequestration of iron in mycobacteria: the ferric
exochelin biosynthetic and uptake pathways. Mol. Microbiol. 14, 557−
569.
(25) McMorran, B. J., Shanta Kumara, H. M., Sullivan, K., and
Lamont, I. L. (2001) Involvement of a transformylase enzyme in
siderophore synthesis in Pseudomonas aeruginosa. Microbiology 147,
1517−1524.
(26) Schoenafinger, G., Schracke, N., Linne, U., and Marahiel, M. A.
(2006) Formylation Domain: An Essential Modifying Enzyme for the
Nonribosomal Biosynthesis of Linear Gramicidin. J. Am. Chem. Soc.
128, 7406−7407.
(27) Buchenau, B., and Thauer, R. K. (2004) Tetrahydrofolate-
specific enzymes in Methanosarcina barkeri and growth dependence of
this methanogenic archaeon on folic acid or p-aminobenzoic acid.
Arch. Microbiol. 182, 313−325.
(28) Hammes, G. G., and Wu, C. W. (1974) Kinetics of allosteric
enzymes. Annu. Rev. Biophys. Bioeng. 3, 1−33.
(29) Porter, C. M., and Miller, B. G. (2011) Cooperativity in
monomeric enzymes with single ligand-binding sites. Bioorg. Chem.,
http://dx.doi.org/10.1016/j.bioorg.2011.11.001.
(30) Challis, G. L. (2005) A widely distributed bacterial pathway for
siderophore biosynthesis independent of nonribosomal peptide
synthetases. ChemBioChem 6, 601−611.
(31) Olucha, J., Meneely, K. M., Chilton, A. S., and Lamb, A. L.
(2011) Two structures of an N-hydroxylating flavoprotein mono-
oxgenase: the ornithine hydroxylase from Pseudomonas aeruginosa. J.
Biol. Chem.,.
3066
dx.doi.org/10.1021/bi201837f | Biochemistry 2012, 51, 3059−3066