Differential effects of oxytocin receptor antagonists, atosiban and nolasiban, on oxytocin receptor-mediated signaling in human amnion and myometrium

Article abstract of DOI:10.1124/mol.116.106013

One of the most established roles of oxytocin (OT) is in inducing uterine contractions and labor. Apart from inducing contractions, our recent studies showed that OT can also activate proinflammatory pathways in both human myometrial and amnion cells, whi

Full text of DOI:10.1124/mol.116.106013

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Title: Differential effects of oxytocin receptor antagonists, Atosiban and Nolasiban, on OT-mediated
signalling in human amnion and myometrium
Authors:
Sung Hye Kim, Oliver Pohl, Andre Chollet, Jean-Pierre Gotteland, Adam D.J. Fairhurst, Phillip R.
Bennett and Vasso Terzidou.
Institute of Reproductive and Developmental Biology (IRDB), Imperial College London,
Hammersmith Hospital Campus, Du Cane Road, London, W12 0NN, UK
- SK, ADJF, PRB, VT
ObsEva SA, Chemin des Aulx 12, CH-1228 Plan-les-Ouates, Geneva, Switzerland
- OP, AC, JPG
Imperial College School of Medicine, Chelsea and Westminster Hospital, 369 Fulham Road, London,
SW10 9NH, UK
- VT
1

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Running title: Nolasiban suppresses OT-mediated inflammatory responses
Corresponding author: Dr. Vasso Terzidou, Tel: +44(0)20759 43720, Fax: +44(0)20 759 42148, Email:
v.terzidou@imperial.ac.uk
Number of Text pages: 25
Number of Tables: 1
Number of Figures: 14 (plus two supplementary figures)
Number of References: 24
Number of words in Abstract: 239
Number of words in Introduction: 722
Number of words in Discussion: 884
List of Abbreviations:
Arginine vasopressin, AVP; G protein-coupled receptor, GPCR; inositol phosphate, IP3; mitogen
activated protein kinases, MAPKs; oxytocin, OT; oxytocin receptor, OTR; phospholipase A, PLA;
phospholipase C, PLC; preterm labour, PTL; prostaglandin, PG; Proton nuclear magnetic resonance
spectroscopy, 1H NMR; superoxide dismutase 2, SOD2; Thin layer chromatography, TLC.
2

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Abstract:
One of the most established roles of oxytocin (OT) is in inducing uterine contractions and labour. Apart
from contractions, our recent study have shown that OT can also activate pro-inflammatory pathways
in both human myometrial and amnion cells which suggests the pro-inflammatory role of OT should be
taken into account when developing tocolytics targeting the OT/OT receptor (OT/OTR) system. The
OTR antagonist, Atosiban, is currently used therapeutically for the treatment of PTL. We have
previously shown that Atosiban fails to inhibit the pro-inflammatory effects of OT in human amnion,
and Atosiban alone activates NF-κB and MAPKs thus upregulating downstream pro-labour genes. In
contrast to our findings with Atosiban, the presence of the orally active OTR antagonist, Nolasiban,
reduced the effect of OT on NF-κB and p38 kinase activation both in myometrial and amnion cells.
Consistent with the activation of these inflammatory mediators, OT led to increases in the expression
of COX-2 and p-cPLA2, which was reflected in PGE2 synthesis. Inhibition of NF-κB activation by
Nolasiban also translated to suppression of downstream pro-labour gene expression such as COX-2,
CCL2, IL-6, and IL-8. We have also demonstrated that Nolasiban treatment alone has no significant
stimulatory effect on both the myometrium and amnion. In conclusion, our findings indicate that
Nolasiban possesses a promising potential as a novel tocolytic agent for both acute and maintenance
therapy as it inhibits both myometrial contractions and the pro-inflammatory effects of OT without the
biased agonist effects.
3

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Introduction:
Complications arising from preterm labour (PTL) account for 65% of neonatal deaths and 50% of
neurological disabilities worldwide. Advances in the care of preterm infants have dramatically
increased rates of survival, which rise sharply from 1% at 23 weeks to 99% at 32 weeks. However, this
is associated with a reciprocal increase in the risk of handicap (Lawn et al, 2013). Although advances
have been made in prediction and prevention of preterm birth in women identified at high risk based
upon past history, the overall rate has not reduced. The 2012 WHO report “Born Too Soon” (Howson
et al, 2013) highlighted the need for effective tocolytic drugs to delay preterm birth in women with
preterm contractions.
Infection and/or inflammation is associated with activation of contractile pathways leading to both term
and preterm labour. Furthermore, infection/inflammation and the subsequent increases in pro-
inflammatory cytokines have been found to be one of the most potent causes of perinatal brain injury
(Dommergues et al, 2000; Thornton et al, 2012). In normal birth weight infants at term,
chorioamnionitis and intrauterine exposure to maternal infection are associated with periventricular
leukomalacia and cerebral palsy (Grether & Nelson, 1997; Wu & Colford, 2000). In the case of
established chorioamnionitis, it is possible that an effective tocolytic drug based solely on the inhibition
of uterine contractions could result in prolonged exposure of fetus to an adverse environment. Therefore,
an optimal tocolytic should also have an anti-inflammatory activity. While the precise mechanisms
responsible for initiating labour in humans remain ambiguous, it is well established that the
oxytocin/oxytocin receptor (OT/OTR) system plays a central role in the biochemistry of term/preterm
labour. Functional OTR is expressed both in myometrium and fetal membranes (amnion and chorion).
OT is widely used for induction/augmentation of both preterm and term labour, and OT binding to its
receptor leads to OTR coupling with both Gαq/11 and Gαi/o G-proteins (Phaneuf et al, 1993). Gαq/11
signalling in myometrium activates phospholipase C (PLC) to drive increases in intracellular Ca2+ via
inositol triphosphate (IP3), ultimately leading to contractions. Previous studies have shown that OTR
signalling through Gαi/o reduces cAMP by inhibition of adenylate cyclase activity (Blanks & Thornton,
2003; Busnelli et al, 2012). We have recently demonstrated a novel mechanism for OT driving pro-
4

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
inflammatory effects in human gestational tissues (Kim et al, 2015). In amnion, this was found to be
via Gαi signalling, which leads to activation of mitogen activated protein kinases (MAPKs) and NF-κB,
and subsequent increase in the expression of NF-κB regulated genes including prostaglandin synthetic
enzymes and inflammatory chemokines/cytokines.
OTR antagonists are used in clinical practice for the treatment of preterm labour through inhibition of
myometrial contractility, but their effect on the pro-inflammatory effects of OT has been largely ignored.
We have recently shown that this OT-driven pro-inflammatory effects in amnion are not inhibited by
Atosiban. Conversely, Atosiban alone results in activation of MAPKs and NF-κB to the same extent as
OT (Kim et al, 2016). Atosiban acts as a biased ligand to the Gαi pathway which may limit its use to 48
hours (Busnelli et al, 2012; Haas et al, 2012), yet OTR still represents an attractive drug target for
tocolysis. Indeed, with growing recognition of the complexity of G protein-coupled receptor (GPCR)
signalling, there has been an impetus to design more specific compounds modulating GPCR action that
show bias towards specific signalling pathways (Busnelli et al, 2012; Whalen et al, 2011).
All clinical studies to date have used OTR antagonists for acute tocolysis rather than for the prevention
of PTL in women at high risk for preterm delivery. The only OTR antagonist currently licensed in
Europe is Atosiban which can only be given as a continuous IV infusion for no more than 48 hours thus
precluding long-term administration for maintenance therapy. Nolasiban is a novel small molecule,
non-peptide OTR antagonist. Nolasiban is selective for OTR against the arginine vasopressin (AVP)
V1a and V2 receptors, whereas Atosiban is primarily a V1a antagonist (Manning et al, 2001). While
the currently available OTR antagonist Atosiban is given via intravenous infusion, Nolasiban is
administered orally thus lending itself to preterm labour treatment beyond 48 hours.
In this study we have investigated whether the OTR antagonist, Nolasiban, can inhibit the OT-driven
activation of inflammatory response in human gestational tissues and we have compared and contrasted
its effects with the currently licensed OTR antagonist Atosiban.
5

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Materials and Methods:
Cell culture
Placentas with fetal membranes and myometrial biopsies were collected from term (38+0 - 40 weeks
of pregnancy), non-labouring women with singleton pregnancies undergoing scheduled low-risk
elective caesarean section. Those with pre-existing medical conditions, pre-eclampsia, multiple
pregnancies and/or had received uterotonics prior to their caesarean sections were excluded from the
study. Samples were collected following an informed consent and with approval from the local research
ethics committees for Queen Charlotte’s and Chelsea Hospital (Placenta; RREC 2002-6283 and
Myometrium; RREC 1997-5089).
From the placenta, the amnion layer was pulled apart from the chorion to use for culture. Primary
amnion epithelial cells were established from fetal membranes as previously described (Bennett et al,
1987). For myometrial smooth muscle cell isolation, the biopsies were dissected into fine pieces and
digested in filter-sterilised collagenase mix (1mg/ml collagenase 1A, 1mg/ml collagenase X and
2mg/ml BSA in 1:1 ratio of DMEM/Nutrient Mixture F-12 HAM and serum-free DMEM, Sigma-
Aldrich) for 45 min at 37°C. The digestion process was halted using DMEM with 10% v/v fetal calf
serum (FCS) and the cell suspension was obtained by filtering out the tissue through a 40µm cell strainer
(Corning). Centrifugation of the suspension at 3000rpm for 5 min collected the cells into a pellet, which
was subsequently resuspended in full DMEM (10% FCS, 2mM LG, and 100U/ml PS) and cultured in
cell culture-treated flasks (Corning) at 37°C in humidified atmosphere of 95% air and 5% CO2. When
myometrial cells reached 95% confluence, they were passaged using 0.25% trypsin with 0.02% EDTA
in PBS. We used myometrial cells between passage numbers one to four.
Real time RT-PCR
Extraction of total RNA was carried out using RNA STAT-60 reagent for a guanidiumthiocyanate-
phenol-chloroform extraction (AMS Biotechnology), following recommended manufacturer's protocol.
6

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Any potential DNA contaminations were eliminated from the extracted RNA by DNaseI treatment
(Invitrogen) prior to cDNA synthesis. The DNaseI-treated RNA was used for first-strand cDNA
synthesis by M-MLV reverse transcriptase (Sigma-Aldrich). The changes in gene expression were
determined by real-time PCR (RT-PCR) with ABI StepOne Plus Real Time PCR system (Applied
Biosystems) using SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich). Primer Express (Applied
Biosystems) software was used to design specific primers for each gene. The sequences of the gene
specific primers are listed in Table 1. The resulting data were analysed using StepOne Software
Version2.3 (Applied Biosystems). All primers were tested for efficiency and comparative Ct method
was used to analyse the relative changes in the gene expression. Ct values for all target gene were
normalised to L-19, the constitutively expressed ribosomal protein and also to GAPDH for amnion and
myometrial cells, respectively.
Western Blotting
Whole-cell lysates were obtained by lysing the monolayer of cells in modified
radioimmunoprecipitation assay (RIPA) buffer (150mM NaCl, 10mM Tris (pH 7.4), 1% Triton X-100,
0.1% SDS, 1% Sodium Deoxycholate, 1mM EDTA, 1mM PMSF, and protease and phosphotase
inhibitor cocktails; Sigma-Aldrich, Thermo-fisher). Concentration of each lysate was determined using
DC™ (detergent compatible) protein assay kit (Bio-Rad) and 40μg of each protein sample was
denatured in loading dye with 50mM DTT by heating for 10 min at 80°C. Proteins were separated by
electrophoresis on a 10% SDS-polyacrylamide gel for 80 min at constant 140V and transferred to PVDF
membrane (Millipore) in wet-transfer chamber system (Bio-Rad) for 90 min at constant 300mA. For
separating more than 15 protein samples, a pre-cast midi-gel (Bio-Rad) was used. The PVDF
membranes were blocked in blocking buffer (5% w/v milk powder in TBS with 0.1% Tween-20) prior
to the primary antibody incubation overnight at 4°C. HRP-conjugated secondary antibody incubation
lasted for 1-2h at room temperature and signal detection was carried out using ECL reagent (Bio-Rad).
7

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
To confirm equal loading of samples, the membranes were treated with a mild stripping buffer (0.2M
NaOH) and re-probed for β-actin.
Enzyme-linked immunosorbent assay (ELISA)
Concentrations of PGE2 in the culture supernatants were determined by a standard ELISA. At
completion of treatments, the culture media from both myometrial and amnion cells were collected and
immediately frozen for storage at -20°C until subsequent analysis by ELISA, following the
manufacturer’s instructions (R&D systems).
Materials
The goat anti-COX-2 (C20) antibody (Santa Cruz Biotechnologies) was used at 1:2000 dilution and
rabbit monoclonal antibodies to p-cPLA2; p-p65 (Ser536); p-MAPK14 (p38 MAPK) and p-MAPK3/1
(ERK1/2 p44/42 MAPK) from Cell Signalling Technology were used at 1:1000 dilution. The mouse
monoclonal anti-β-actin antibody (at 1:50,000) was from Abcam. HRP-conjugated secondary
antibodies against goat, mouse and rabbit IgGs were from Santa Cruz Biotechnologies. Oxytocin and
Atosiban were obtained from Alliance Pharmaceuticals and Sigma-Aldrich, respectively. Nolasiban
was synthesised as previously described (Chollet, 2015). Nolasiban chemical formula is (3Z,5S)-5-
(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime (Fig 1).
Nolasiban is prepared following an 8-step synthesis starting from 4-bromobenzoic acid. A detailed
description of Nolasiban preparation is provided below;
A solution of potassium carbonate in water was charged to a slurry of 4-bromobenzoic acid in water at
15 to 25°C. The resulting slurry was stirred at 15 to 25°C and degassed three times using a vacuum-
nitrogen purge cycle. Tetrakis (triphenylphosphine) palladium (0) was charged and the vacuum-
nitrogen purge cycle repeated. A solution of o-tolylboronic acid was degassed three times, using a
vacuum-nitrogen purge cycle, and then charged to the 4-bromobenzoic acid slurry at 15 to 25°C. The
8

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
reaction mixture was heated to and maintained at reflux until reaction completion (The reaction is
considered complete at 95% conversion), as determined by 1H NMR analysis (d6-DMSO), typically 1.5
to 2.5 hours. After work-up, the solid was dried in a vacuum oven at 35 to 40°C to give 4-(2-
1
methylphenyl)benzoic acid H NMR (d6-DMSO) concordant with structure] as a pale yellow solid.
Thionyl chloride was added to a slurry of 4-(2-methylphenyl)benzoic acid in toluene at 10 to 25°C and
1
the mixture was heated to and maintained at 75 to 80°C until complete by H NMR analysis (d6-
benzene), typically 4 to 5 hours. After work-up, the toluene solution of 4-(2-methylphenyl)benzoic acid
chloride [1H NMR (d6-benzene) concordant with structure] was used directly in the next step.
A solution of potassium carbonate was charged to a solution of 4-hydroxy-L- in tetrahydrofuran and
water at 15 to 25°C followed by a line rinse of water. The mixture was cooled to 0 to 5°C with rapid
stirring and a solution of 4-(2-methylphenyl)benzoic acid chloride in toluene charged at that
temperature followed by a line rinse of toluene The reaction mixture was warmed to 15 to 25°C over 1
to 2 hours and stirred at this temperature until judged complete by TLC analysis. After work-up, the
collected solid was dried under vacuum at 40 to 45°C until the water content by Karl Fischer titration
was ≤0.2% w/w to afford (4R)-4-hydroxy-1-[(2’- methyl-1 ,1 ‘-biphenyl-4-yl)carbonyl]-L-proline [1H
NMR (d6-DMSO) concordant with structure] as an off-white solid.
Triethylamine was charged to a solution of (4R)-4-hydroxy-1-[(2’-methyl-1,1’-biphenyl-4-
yl)carbonyl]-L-proline in DMSO at 15 to 20°C. Pyridine-sulphur trioxide complex was charged portion-
wise at 15 and 25°C and the reaction mixture was stirred at that temperature until reaction completion,
as determined by TLC analysis (typically 1 to 3 hours). After work-up, the collected solid was dried
under vacuum at 40 to 45°C to give 1-[(2’-methyl-1,1’- biphenyl-4-yI)carbonyl]-4-oxo-L-proline [1H
NMR (d6-DMSO) concordant with structure] as an off-white solid.
Triethylamine was added to a solution of 1-[(2’-methyl-1,1’-biphenyl-4-yl)carbonyl]-4-oxo-L-proline
in dichloromethane at 10 to 25°C. Methoxylamine hydrochloride was added portionwise at 10 to 25°C
and the reaction mixture was stirred at 10 to 25°C until reaction completion, as determined by TLC
analysis (typically 3 to 5 hours, TLC eluent: dichloromethane:methanol:acetic acid (90:10:1); uv
9

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
visualization). After work-up, the filtrate and washes were combined and concentrated under vacuum
at 35 to 40°C to afford 4-methoxyimino-1-[(2’-methyl-1,1’-biphenyl-4-yl)carbonyl]-L-proline [1H
NMR (CDCl3) concordant with structure) as an off-white solid.
Potassium carbonate was added to a solution of 4-methoxyimino-1-[(2’- methyl-1,1’-biphenyl-4-
yl)carbonyl]-L-proline and the mixture cooled to 0 to 10°C. Dimethyl sulfate was added at 0 to 15°C
and the mixture was stirred at 15 to 25°C until reaction completion, as determined by TLC analysis,
typically 3 to 16 hours. After work-up, excess ethyl acetate was removed by azeotropic distillation with
tetrahydrofuran under vacuum at 40 to 45°C to give (4Z/E, 2S)-methyl-1-[(2’-methyl-1,1’-biphenyl-4-
yl)-carbonyl]-4- methoxyimino pyrrolidine-2-carboxylate [1H NMR (CDCl3) concordant with structure]
as a viscous brown oil.
Lithium borohydride was added portionwise under nitrogen to a stirred solution of (4Z/E, 2S)-methyl-
1-[(2’-methyl-1,1’-biphenyl-4-yl)-carbonyl]-4-
methoxyimino
pyrrolidine-2-carboxylate
in
tetrahydrofuran and methanol at 0 to 30°C. The prepared mixture was stirred at 15 to 25°C to reaction
completion, as determined by TLC analysis (Eluent: ethyl acetate; Visualisation: ninhydrin), typically
2 to 6 hours. After work-up, the combined filtrate and wash were concentrated under vacuum to give a
crude isomeric mixture comprising (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-
yl)carbonyl]pyrrolidin-3-one O-methyloxime and (3E,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-
biphenyl-4-yl)carbonyl]pyrrolidin-3-one O-methyloxime [1H NMR (CDCl3) concordant with structure;
82.0% area by HPLC, 71.4:28.6 Z/E ratio] as a viscous brown oil. The oil was dissolved in toluene and
stored until required. Pure Nolasiban or (3Z,5S)-5-(hydroxymethyl)-1-[(2′-methyl-1,1′-biphenyl-4-
yl)carbonyl]pyrrolidin-3-one O-methyloxime was isolated by chromatography and elution with
Toluene:MeOH (99:1 v/v).
Vehicle for OT was DMEM (Sigma-Aldrich), Atosiban was dissolved in double deionized water, and
Nolasiban in DMSO. Nolasiban was diluted from stock solutions using DMEM shortly prior to the
treatments. The DMSO concentration was adjusted to 0.1% v/v in all dose formulations and control
wells for Nolasiban experiments were treated to contain 0.1% v/v DMSO.
10

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Statistical analysis
Prism software v5.0 (Graphpad) was used for our statistical analysis. We tested our data sets for
normality using the Kolmogorov-Smirnov test prior to appropriate statistical comparisons. When data
were normally distributed, multiple comparisons for all pairwise comparisons were performed using
ANOVA, followed by Tukey-Kramer (or Tukey’s HSD) post hoc test. For not-normally distributed
data, multiple comparisons were performed using Freidman’s test, followed by Dunn’s Multiple
Comparisons post hoc test. In this study, all data sets were presented as mean ± SEM values and
the significant statistical differences with probability value of p < 0.05 are indicated with ‘*’ in all
figures.
Results:
Atosiban has no effect on OT-mediated upregulation of pro-inflammatory mediators, but mimics
the effects of OT in human amnion
We have previously demonstrated that Atosiban presence in amnion cells has no significant effect on
the OT-driven activation of NF-κB and MAPKs, and the upregulation of downstream pro-labour genes
at OT concentration of 100nM (Kim et al, 2016). In this study, amnion cells were treated with
Atosiban and a lower dose of OT (10nM), which is more physiologically relevant. There was no
significant inhibition of OT effects in presence of Atosiban and similar to recently published data,
Atosiban consistently led to activation of pro-inflammatory mediators including NF-κB and MAPKs
and subsequent expression of prostaglandin (PG) synthetic enzymes COX-2 and p-cPLA2 (Fig 2).
These effects of Atosiban translated to changes in the expression of downstream NF-κB regulated
genes. The presence of Atosiban did not inhiibt OT-mediated expression of COX-2, IL-6, CCL5, IL-8
and SOD2 at mRNA level (Fig 3). Furthermore, Atosiban treatment alone resulted in 2.8-, 2.3- and
2.4-fold increases in the expression of COX-2 (p<0.05), IL-6 (p<0.05) and CCL5 (p<0.05),
respectively (Fig 3A-C).
11

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Unlike Atosiban, Nolasiban suppresses the effects of OT on pro-inflammatory mediators
including activation of NF-κB and MAPKs, and pro-labour gene expression in human amnion
Matching experiments in amnion cells using Nolasiban showed markedly different results to Atosiban.
The presence of Nolasiban led to significant reduction in OT-driven activation of both NF-κB p65 and
p38 kinase at equimolar concentration of Atosiban as well as at lower doses (Fig 4A-C). There was a
slight reduction in OT-induced ERK1/2 activation in a dose dependent manner, however, this did not
reach significance (Fig 4D). Nolasiban alone did not have a significant effect on NF-κB and p38
activation, or the expression of PG synthetic enzymes (Supplementary Fig S1). However, at the
maximum dose of Nolasiban, 30 µM, we observed activation of ERK1/2 (p<0.001) with no effect on
downstream targets, indicating that at this high concentration of Nolasiban which is physiologically
irrelevant, the effect may be due to activation of an alternative signalling pathway, independent to that
of OT.
Treatment of amnion cells with Nolasiban also completely inhibited OT-mediated expression of PG
synthetic enzymes, COX-2 and p-cPLA2, from the lowest dose of 1µM (p<0.05 and p<0.001,
respectively, Fig 5) and consequently, OT-mediated PGE2 release (p<0.001; Fig 6). Further
experiments looking at the mRNA expression of other NF-κB regulated genes revealed a clear dose-
dependent inhibitory effect of Nolasiban on COX-2, IL-6, CCL5, IL-8, CCL2 and SOD2 (Fig 7).
Atosiban acts as a partial inhibitor of OT-mediated responses, but it alone consistently activates
NF-κB and ERK1/2, whilst inducing CCL5 expression in human myometrium
In contrast to our findings in human amnion, treatment with Atosiban significantly reduced OT-driven
activation of p38 kinase and the upregulation of COX-2 in human myometrial cells (Fig 8). However,
despite these inhibitory effects, Atosiban failed to suppress the effect of OT on NF-κB and ERK1/2
activation and on the reverse resulted in activation of both NF-κB and ERK1/2 in the absence of OT
(Fig 8).
Presence of Atosiban showed variable effects on the expression of downstream NF-κB regulated genes.
Complementary to the findings in COX-2 expression at protein level, Atosiban successfully inhibited
12

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
the OT-induced mRNA expression of COX-2 and IL-8 (Fig 9A and D). There was marginal reduction
in OT-induced IL-6 expression, but not reaching statistical significance (Fig 9B). Of particular note
were the changes in the mRNA expression of CCL5 which increased with Atosiban in the absence of
OT stimulation (Fig 9C).
Similar to amnion, Nolasiban suppresses the effects of OT on pro-inflammatory mediators in
human myometrium
Myometrial smooth muscle cells were incubated with increasing doses of Nolasiban with or without
OT stimulation. The OTR antagonist, Nolasiban, alone had no significant effect on the OT-induced
activation of NF-κB and MAPKs, and the presence of Nolasiban blocked the effects of OT on NF-κB
and p38 kinase, reaching significance at the dose of 10µM (p<0.01; Fig 10). Moreover, Nolasiban
suppressed the OT-driven upregulation of COX-2 and p-cPLA2 (Fig 11), ultimately leading to the
reduction of PGE2 synthesis (Fig 12). In addition to COX-2 expression, Nolasiban also resulted in
suppression of other NF-κB regulated genes, IL-8, IL-6, and CCL5, in a dose dependent manner (Fig
13 A-D). Similar to amnion, Nolasiban treatment alone in myometrium had no effect on the activation
of NF-κB and p38, or the expression of PG synthetic enzymes (Supplementary Fig S2). Nolasiban at
30 µM activated of ERK1/2 (p<0.01) without affecting the expression of downstream targets such as
COX-2 and p-cPLA2.
Discussion:
We have investigated the effect of Nolasiban, a novel orally active OTR antagonist, on OT-driven
activation of inflammatory responses in human gestational tissues. We have previously shown that OT
activates a cassette of inflammatory mediators in both human amnion and myometrium, demonstrating
a role for OT as an endogenous inflammatory signalling molecule (Kim et al, 2015). Atosiban, an OTR
antagonist, is used in clinical practice in Europe for the treatment of preterm labour and other OTR
antagonists are in clinical trials. Although OTR antagonists can inhibit myometrial contractility they
appear to have differential effects upon mediators of inflammation within the gestational tissues. The
13

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
OTR antagonist Atosiban has been shown to inhibit myometrial contractility (Phaneuf et al, 1994),
however, Atosiban only acts as a partial inhibitor of OT-mediated pro-inflammatory responses in human
myometrium and has a purely stimulatory and no inhibitory effect in human amnion. We have shown
that in contrast to Atosiban, Nolasiban suppresses OT-mediated pro-inflammatory effects in both
human amnion and myometrium (Fig 14).
We have previously shown that there are differences in OT-mediated activation of NF-κB between
amnion and myometrium which are associated with differential NF-κB subunit translocation and
MAPKs crosstalk. In myometrium, OT-driven NF-κB activation resembles a canonical NF-κB
signalling pathway involving both p65 and p50 translocation. OT-induced NF-κB activation in amnion
involves nuclear translocation of p65 but not p50, and requires ERK1/2 and p38 activation (Kim et al,
2015). Such tissue-specific signalling may provide an explanation for the variable effects of Atosiban
in amnion and myometrium where it acts as an ‘anti-labour’ agent though inhibition of OT-induced
contractility in myometrium, whilst acting as a ‘pro-labour agent’ in amnion and partially so in
myometrium possibly via differential OTR G-protein coupling in the two cell types. In amnion,
Atosiban has no inhibitory effect and notably, it alone mimics the pro-inflammatory effects of OT
whereas in myometrium, Atosiban significantly reduces OT-driven activation of p38 kinase and the
upregulation of COX-2, and IL-8 but remains unable to suppress the effect of OT on NF-κB and ERK1/2
activation and increases CCL5 expression regardless of OT stimulation. The data which we present here
shows that, unlike Atosiban, Nolasiban completely inhibits all OT-mediated responses and suppresses
expression and activation of pro-inflammatory mediators both in amnion and myometrium without any
downstream effects when treated alone. Despite the complete inhibition of OT-induced COX-2
upregulation and PGE2 levels in presence of Nolasiban, relatively high levels of PGE2 were detected
in samples treated with Nolasiban and OT at earlier time points. This may be due to the release of PGE2
rather than synthesis as Nolasiban successfully inhibits COX-2 expression as early as 2 h. There has
been reports in rat models where OT was able to stimulate immediate pulsatile release of PGE2 via Ca2+
responses (Chen et al, 2015).
14

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Preterm and term labour are characterised by a marked inflammatory cascade (Osman et al, 2003;
Shynlova et al, 2013) associated with the upregulation of pro-inflammatory cytokines and chemokines,
such as IL-1β, IL-6, IL-8, CCL2 and CCL5, in both human amnion and myometrium. Amnion is an
important site of prostaglandin and pro-inflammatory cytokine/chemokine release and leads to fetal
membrane remodelling and cervical ripening (Kim et al, 2015). Fetal membrane activation is
considered to be a prelude to the onset of labour (Lim et al, 2012). This involves activation of inducible
NF-κB and the upregulation of pro-labour pro-inflammatory genes such as COX-2 and OTR (Lim et al,
2012). We have previously demonstrated that treatment with OT drives a similar set of inflammatory
gene expression as those in amnion activation, indicating that OT may act as an endogenous
inflammatory signalling molecule in human gestational tissues (Kim et al, 2015).
Knowledge of G protein-coupled receptors (GPCRs) continues to evolve, and the diversity of its actions
and complexity of its signalling mechanisms are becoming increasingly evident (Berchiche & Sakmar,
2016). The biology of the OT/OTR system appears to be no exception. Nolasiban is a novel orally active,
small molecule, non-peptide OTR antagonist which is more selective for OTR than Atosiban as it binds
to the human OTR with a Ki of 52nM and is 2.5- and 50- fold selective against the AVP V1a and V2
receptors, respectively. We have previously shown that Nolasiban can inhibit spontaneous and OT-
stimulated contractions in a dose-dependent way, affecting the rate, the contraction peak, the tension
and the contraction duration to similar extent as Atosiban (Arulkumaran et al, 2016). Unlike Atosiban,
inhibition of uterine contractions by Nolasiban did not evoke a proinflammatory signalling pathway,
therefore, it appears to be a pure OTR antagonist, blocking both Gαi and Gαq mediated OT signalling in
both amnion and myometrium.
Early preterm birth, typically classified as delivery before 34 weeks of gestation, is often associated
with infection and/or inflammation. It is now recognized that cytokine-mediated cerebral injury
represents an important cause of prematurity linked handicap, thus inflammation within the uterus is a
important risk factor for fetal and neonatal CNS damage and poor outcome (Peebles, 2007). Therefore,
it is crucial that any tocolytic agent used in acute preterm labour, including those modulating the
OT/OTR system, should evade activation or aggravation of inflammation. The current study indicates
15

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
that Nolasiban is a promising new tocolytic as it has the ability not only to inhibit myometrial
contractility but can also suppress the OT-mediated pro-inflammatory responses in human gestational
tissues.
Acknowledgements:
The authors would like to thank labour ward patients and staff at Queen Charlotte’s and Chelsea
hospital, who provided and assisted the collection of placenta and myometrial biopsies.
Authorship contributions:
Participated in research design: Kim, Bennett and Terzidou
Conducted experiments: Kim and Fairhurst
Contributed new reagents or analytic tools: Pohl, Gotteland and Chollet
Performed data analysis: Kim, Bennett and Terzidou
Wrote or contributed to the writing of the manuscript: Kim, Pohl, Gotteland, Chollet, Bennett and
Terzidou
16

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
References:
Arulkumaran S, Kim SH, Pohl O, Chollet A, Bennett PR, terzidou V (2016) The OTR antagonist,
OBE001, inhibits both spontaneous and OT-induced contractions of human pregnant myometrium in
vitro. Reproductive sciences 23
Bennett PR, Rose MP, Myatt L, Elder MG (1987) Preterm labor: stimulation of arachidonic acid
metabolism in human amnion cells by bacterial products. Am J Obstet Gynecol 156: 649-655
Berchiche YA, Sakmar TP (2016) CXC Chemokine Receptor 3 Alternative Splice Variants Selectively
Activate Different Signaling Pathways. Mol Pharmacol
Blanks AM, Thornton S (2003) The role of oxytocin in parturition. BJOG : an international journal of
obstetrics and gynaecology 110 Suppl 20: 46-51
Busnelli M, Sauliere A, Manning M, Bouvier M, Gales C, Chini B (2012) Functional selective oxytocin-
derived agonists discriminate between individual G protein family subtypes. J Biol Chem 287: 3617-
3629
Chen D, Zhao J, Wang H, An N, Zhou Y, Fan J, Luo J, Su W, Liu C, Li J (2015) Oxytocin evokes a
pulsatile PGE2 release from ileum mucosa and is required for repair of intestinal epithelium after injury.
Scientific reports 5: 11731
Chollet A. (2015) Pyrrolidine derivatives as oxytocin/vasopressin V1a receptors antagonists. In
Organization WIP (ed.).
Dommergues MA, Patkai J, Renauld JC, Evrard P, Gressens P (2000) Proinflammatory cytokines and
interleukin-9 exacerbate excitotoxic lesions of the newborn murine neopallium. Ann Neurol 47: 54-63
Grether JK, Nelson KB (1997) Maternal infection and cerebral palsy in infants of normal birth weight.
JAMA : the journal of the American Medical Association 278: 207-211
Haas DM, Caldwell DM, Kirkpatrick P, McIntosh JJ, Welton NJ (2012) Tocolytic therapy for preterm
delivery: systematic review and network meta-analysis. Bmj 345: e6226
Howson CP, Kinney MV, McDougall L, Lawn JE, Born Too Soon Preterm Birth Action G (2013) Born
too soon: preterm birth matters. Reproductive health 10 Suppl 1: S1
Kim SH, MacIntyre DA, Firmino Da Silva M, Blanks AM, Lee YS, Thornton S, Bennett PR, Terzidou
V (2015) Oxytocin activates NF-kappaB-mediated inflammatory pathways in human gestational tissues.
Molecular and cellular endocrinology 403: 64-77
17

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Kim SH, MacIntyre DA, Hanyaloglu AC, Blanks AM, Thornton S, Bennett PR, Terzidou V (2016) The
oxytocin receptor antagonist, Atosiban, activates pro-inflammatory pathways in human amnion via
Galphai signalling. Molecular and cellular endocrinology 420: 11-23
Lawn JE, Davidge R, Paul VK, von Xylander S, de Graft Johnson J, Costello A, Kinney MV, Segre J,
Molyneux L (2013) Born too soon: care for the preterm baby. Reproductive health 10 Suppl 1: S5
Lim S, Macintyre DA, Lee YS, Khanjani S, Terzidou V, Teoh TG, Bennett PR (2012) Nuclear factor
kappa B activation occurs in the amnion prior to labour onset and modulates the expression of numerous
labour associated genes. PLoS One 7: e34707
Manning M, Stoev S, Cheng LL, Wo NC, Chan WY (2001) Design of oxytocin antagonists, which are
more selective than atosiban. Journal of peptide science : an official publication of the European
Peptide Society 7: 449-465
Osman I, Young A, Ledingham MA, Thomson AJ, Jordan F, Greer IA, Norman JE (2003) Leukocyte
density and pro-inflammatory cytokine expression in human fetal membranes, decidua, cervix and
myometrium before and during labour at term. Molecular Human Reproduction 9: 41-45
Peebles DM. (2007) Intrauterine infection and perinatal brain injury. Scientific Advisory Committee
Opinion Paper 3 RCOG.
Phaneuf S, Asboth G, MacKenzie IZ, Melin P, Lopez Bernal A (1994) Effect of oxytocin antagonists
on the activation of human myometrium in vitro: atosiban prevents oxytocin-induced desensitization.
Am J Obstet Gynecol 171: 1627-1634
Phaneuf S, Europe-Finner GN, Varney M, MacKenzie IZ, Watson SP, Lopez Bernal A (1993)
Oxytocin-stimulated phosphoinositide hydrolysis in human myometrial cells: involvement of pertussis
toxin-sensitive and -insensitive G-proteins. J Endocrinol 136: 497-509
Shynlova O, Lee YH, Srikhajon K, Lye SJ (2013) Physiologic uterine inflammation and labor onset:
integration of endocrine and mechanical signals. Reproductive sciences 20: 154-167
Thornton C, Rousset CI, Kichev A, Miyakuni Y, Vontell R, Baburamani AA, Fleiss B, Gressens P,
Hagberg H (2012) Molecular mechanisms of neonatal brain injury. Neurol Res Int 2012: 506320
Whalen E, Rajagopal S, Lefkowitz R (2011) Therapeutic potential of β-arrestin- and G protein-biased
agonists. Trends in molecular medicine 17: 126-165
Wu YW, Colford JM, Jr. (2000) Chorioamnionitis as a risk factor for cerebral palsy: A meta-analysis.
JAMA : the journal of the American Medical Association 284: 1417-1424
18

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Footnotes:
This work was supported in part by Genesis Research Trust (Grant ref. P14758) and the National
Institute for Health Research (NIHR) Biomedical Research Centre based at Imperial College
Healthcare NHS Trust (Grant ref. P45272) and Imperial College London.
Disclosure Statement:
VT has worked as a consultant to GlaxoSmithKline. PB has worked as a consultant to Boehringer
Ingelheim, GlaxoSmithKline, Merck Serono, ObsEva SA and Tokyo Tanabe Pharmaceuticals, drug
companies with an interest in the pharmacological effects of oxytocin and oxytocin antagonists. PB
holds shares of ObsEva SA. AC, JPG and OP are salaried employees of ObsEva SA.
19

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Figure legends:
Figure 1. Chemical structure of Nolasiban.
Figure 2. The effect of Atosiban on OT-induced pro-inflammatory responses in amnion cells. Pre-
labour amnion epithelial cells were stimulated for 5 min, 15 min, 30 min, 2 h, 4 h and 6 h with Atosiban
(10 μM) and/or OT (10 nM). Representative Western blots for phosphorylated NF-κB p65 subunit,
ERK1/2 and p38 MAPK (A), as well as COX-2 and p-cPLA2 (B) are shown above their corresponding
densitometry graphs with fold changes compared to non-stimulated (NS) controls. Matched β-actin
loading controls confirm equal loading (n = 6; * p<0.05, ** p<0.01 compared with NS). Significance
was tested using ANOVA, with correction for multiple testing by Tukey-Kramer multiple comparison
test.
Figure 3. Increase in pro-labour NF-κB-regulated gene expression with Atosiban stimulation in
amnion cells. Pre-labour amnion epithelial cells were stimulated for 1 h, 2 h, 4 h, and 6 h with Atosiban
(10 μM) and/or OT (10 nM). Expression of downstream NF-κB regulated genes; COX-2 (A), IL-6 (B),
CCL5 (C), IL-8 (D) and SOD2 (E) were examined from total RNA extracts. Atosiban had no effect on
OT-induced upregulation, but Atosiban alone increased the expression of COX-2, IL-6 and CCL5 (n =
6; * p<0.05, *** p<0.001 compared with NS, ANOVA). Significance was tested using ANOVA, with
correction for multiple testing by Tukey-Kramer multiple comparison test.
Figure 4. The effect of Nolasiban on OT-mediated activation of NF-κB and MAPKs in amnion
cells. Pre-labour primary amnion epithelial cells were stimulated with OT (10 nM) in presence of
absence of Nolasiban (1, 3, or 10µM) for 5 min, 15 min and 30 min. Western blots were used to examine
the effect of Nolasiban on OT-mediated activation of p65 NF-κB and MAPKs, ERK1/2 and p38 MAPK
(A). Solid lines indicated cropping boundaries of strips (please note that this editing is done in the blot
20

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
panels in Figs 4A, 9A, 10A). NS controls and OT only treatments were adjusted to contain the vehicle,
DMSO, at 0.1% v/v. β-actin confirmed equal protein loading. Densitometric analyses showed
significant decreases in OT-mediated activation of p65 (B) and p38 (C) in the presence of Nolasiban,
but not ERK1/2 (D). (n=6; * p<0.05 vs NS, # p<0.05 vs OT-treated samples, ANOVA). Significance
was tested using ANOVA, with correction for multiple testing by Tukey-Kramer multiple comparison
test.
Figure 5. The effect of Nolasiban on OT-mediated expression of PG synthetic enzymes in amnion
cells. Pre-labour primary amnion epithelial cells were stimulated with OT (10 nM) in presence of
absence of Nolasiban (1, 3, or 10µM) for 2 h, 4 h and 6 h. Western blots were used to examine the
effect of Nolasiban on OT-mediated expression of COX-2 and p-cPLA2 (A). NS controls and OT only
treatments were adjusted to contain the vehicle, DMSO, at 0.1% v/v. β-actin confirmed equal protein
loading. Densitometric analyses showed significant decreases in OT-mediated expression of COX-2 (B)
and p-cPLA2 (C) in the presence of Nolasiban (n=6; *** p<0.001 vs NS, # p<0.05, ## p<0.01, ###
p<0.001 vs OT-treated samples, ANOVA). Significance was tested using ANOVA, with correction for
multiple testing by Tukey-Kramer multiple comparison test.
Figure 6. The effect of Nolasiban on OT-mediated PGE2 release in amnion cells. Pre-labour
primary amnion epithelial cells were stimulated with OT (10 nM) in presence of absence of Nolasiban
(1, 3, 10 or 30µM) for 2 h, 4 h and 6 h. PGE2 ELISA demonstrated a significant inhibition of OT-
mediated PGE2 production by Nolasiban (n=6; * p<0.05, *** p<0.001 vs NS, ### p<0.001 vs OT-
treated samples, ANOVA). Significance was tested using ANOVA, with correction for multiple testing
by Dunn’s multiple comparison test.
Figure 7. The effect of Nolasiban on OT-mediated expression of downstream NF-κB-regulated
genes in amnion cells. Pre-labor primary amnion epithelial cells were treated with OT (10 nM) in
21

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
presence or absence of Nolasiban (1, 3, 10, or 30µM) for 1 h, 2 h, 4 h, 6 h and 24 h, and changes in the
expression of downstream NF-κB-regulated genes, COX-2 (A), IL-8 (B), IL-6 (C), CCL5 (D), CCL2
(E) and SOD2 (F), were analysed using qRT-PCR. For qRT-PCR analysis, target gene mRNA levels
were normalised to that of the housekeeping gene, L19 (n=4; * p<0.05, *** p<0.001 vs NS, # p<0.05
vs OT-treated samples, ANOVA). Significance was tested using ANOVA, with correction for multiple
testing by Tukey-Kramer multiple comparison test.
Figure 8. The effect of Atosiban on OT-induced proinflammatory responses in myometrial cells.
Pre-labour myometrial smooth muscle cells were stimulated with OT (10 nM) for 5 min, 15 min, 30
min, 2 h, 4 h and 6 h in presence/absence of Atosiban (10 μM). Representative Western blots for
phosphorylated NF-κB p65 subunit, ERK1/2 and p38 MAPK (A), as well as COX-2 and p-cPLA2 (B)
shown above their corresponding densitometry graphs with fold changes compared to non-stimulated
(NS) controls. Matched β-actin loading controls confirm equal loading (n = 6; * p<0.05, ** p<0.01, ***
p<0.001 compared with NS, ANOVA). Significance was tested using ANOVA, with correction for
multiple testing by Tukey-Kramer multiple comparison test.
Figure 9. The effect of Atosiban on OT-induced upregulation of NF-κB-regulated genes in
myometrial cells. Pre-labour myometrial smooth muscle cells were stimulated for 1 h, 2 h, 4 h, and 6
h with Atosiban (10 μM) and/or OT (10 nM). Expression of downstream NF-κB regulated genes; COX-
2 (A), IL-6 (B), CCL5 (C), IL-8 (D) and SOD2 (E) were examined from total RNA extracts. Atosiban
inhibited the effect on OT-induced upregulation of COX-2, IL-6, and IL-8, but Atosiban failed to inhibit
CCL5 expression and it alone increased the expression of CCL5 (n = 6; * p<0.05 vs NS, # p<0.05 vs
OT-treated samples, ANOVA). Significance was tested using ANOVA, with correction for multiple
testing by Tukey-Kramer multiple comparison test.
22

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Figure 10. The effect of Nolasiban on OT-mediated activation of NF-κB and MAPKs in
myometrial cells. Pre-labour primary myometrial smooth muscle cells were stimulated with OT (10
nM) in presence of absence of Nolasiban (1, 3, or 10µM) for 5 min, 15 min and 30 min. Western blots
were used to examine the effect of Nolasiban on OT-mediated activation of p65 NF-κB and MAPKs,
ERK and p38 (A). NS controls and OT only treatments were adjusted to contain the vehicle, DMSO, at
0.1% v/v. β-actin confirmed equal protein loading. Densitometric analyses showed significant decreases
in OT-mediated activation of p65 (B) and p38 (C) in the presence of Nolasiban, but not ERK1/2 (D).
(n=6; * p<0.05, ** p<0.01; *** p<0.001 vs NS, ## p<0.01 vs OT-treated samples, ANOVA).
Significance was tested using ANOVA, with correction for multiple testing by Tukey-Kramer multiple
comparison test.
Figure 11. The effect of Nolasiban on OT-mediated expression of PG synthetic enzymes in
myometrial cells. Pre-labour primary myometrial smooth muscle cells were stimulated with OT (10nM)
in presence of absence of Nolasiban (1, 3, or 10µM) for 2 h, 4 h and 6 h. Western blots to examine the
effect of Nolasiban on OT-mediated expression of COX-2 and p-cPLA2 (A). NS controls and OT only
treatments were adjusted to contain the vehicle, DMSO, at 0.1% v/v. β-actin confirmed equal protein
loading. Densitometric analyses showed significant decreases in OT-mediated expression of COX-2 (B)
and p-cPLA2 (C) in the presence of Nolasiban (n=6; ** p<0.01, *** p<0.001 vs NS, ## p<0.01, ###
p<0.001 vs OT-treated samples, ANOVA). Significance was tested using ANOVA, with correction for
multiple testing by Tukey-Kramer multiple comparison test.
Figure 12. The effect of Nolasiban on OT-mediated PGE2 release in myometrial cells. Pre-labour
primary myometrial smooth muscle cells were stimulated with OT (10 nM) in presence of absence of
Nolasiban (1, 3, 10 or 30µM) for 2 h, 4 h and 6 h. PGE2 ELISA demonstrated a significant inhibition
of OT-mediated PGE2 production by Nolasiban (n=6; ** p<0.01, *** p<0.001 vs NS, ## p<0.01, ###
23

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
p<0.001 vs OT-treated samples, ANOVA). Significance was tested using ANOVA, with correction for
multiple testing by Dunn’s multiple comparison test.
Figure 13. The effect of Nolasiban on OT-mediated expression of downstream NF-κB-regulated
genes in myometrial cells. Pre-labour primary myometrial smooth muscle cells were treated with OT
(10 nM) in presence or absence of Nolasiban (1, 3, 10, or 30µM) for 1 h, 2 h, 4 h, 6 h and 24 h, and the
expression of downstream NF-κB-regulated genes, COX-2 (A), IL-8 (B), IL-6 (C), CCL5 (D), CCL2
(E) and SOD2 (F) were analysed using qRT-PCR. For qRT-PCR analysis, target gene mRNA levels
were normalised to that of the housekeeping gene, GAPDH (n=4; * p<0.05, *** p<0.001 vs NS, #
p<0.05 vs OT-treated samples, ANOVA). Significance was tested using ANOVA, with correction for
multiple testing by Tukey-Kramer multiple comparison test.
Figure 14. Schematic diagram describing the effects of OT, Atosiban and Nolasiban on
downstream signaling pathways in both human amnion and myometrium. Our data indicate that
in amnion, Atosiban mimics the proinflammatory effects of OT whereas Nolasiban completely inhibits
the effects of OT. In myometrium, Atosiban appears to show biased agonist properties where it acts as
an antagonist to inhibit myometrial contractions whilst driving expression of NF-κB-regulated gene,
CCL5. Similar to amnion, Nolasiban appeared to inhibit both the inflammatory and contractile effects
of OT.
24

Molecular Pharmacology Fast Forward. Published on February 10, 2017 as DOI: 10.1124/mol.116.106013
This article has not been copyedited and formatted. The final version may differ from this version.
MOL #106013
Table 1. Primer sequences for real-time PCR (RT-PCR)
Target
Forward Primer Sequence (5’ to 3’)
Gene
Reverse Primer Sequence (5’ to 3’)
GCAGCCGGCGCAAA
L19
GCGGAAGGGTACAGCCAAT
GAPDH TGATGACATCAAGAAGGTGGTGAAG TCCTTGGAGGCCATGTAGGCCAT
CCL2
CCL5
COX-2
IL-6
TCTGTGCCTGCTGCTCATAG
CCATATTCCTCGGACACCAC
TGTGCAACACTTGAGTGGCT
CCTTCCAAAGATGGCTGAAA
GCCTTCCTGATTTCTGCAGC
TTGGCCAAGGGAGATGTTAC
AGATCTCCTTGGCCACAATG
TGTACTCCCGAACCCATTTC
ACTTTCTGTACTGCGGGTGG
AGCTCTGGCTTGTTCCTCAC
CGCAGTGTGGTCCACTCTCA
AGTCACGTTTGATGGCTTCC
IL-8
SOD2
25

Figure 1

Figure 2
Ato10µM
+OT
Ato10µM
Ato 10µM
+OT
OT
Ato10µM
OT
A
B
NS 2h 4h 6h 2h 4h 6h 2h 4h 6h
NS 5’ 15’ 30’ 5’ 15’ 30’ 5’ 15’ 30’
COX-2
p-cPLA2
β-actin
p-p65
p-ERK
p-p38
β-actin
COX-2
p-p65
1.4
1.2
1
**
*
*
1.2
1
*
*
*
0.8
0.6
0.4
0.2
0
0.8
0.6
0.4
0.2
0
p-cPLA2
p-ERK
1.2
1
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
*
**
**
0.8
0.6
0.4
0.2
0
*
p-p38
1
0.8
0.6
0.4
0.2
0
**
*

Figure 3
A
COX-2
***
6
OT
**
Ato
***
4
2
0
*
Ato+OT
NS
1h
2h
4h
IL6
*
6h 24h
B
3.5
3
2.5
2
*
*
1.5
1
0.5
0
NS
1h
2h
4h
6h 24h
C
CCL5
5
4
3
2
1
0
*
NS
1h
1h
1h
2h
4h
6h 24h
D
5
IL8
*
4
3
2
1
0
*
*
NS
2h
4h
6h 24h
E
SOD2
3
*
2
1
0
NS
2h
4h
6h 24h

Figure 4
3µM
+ OT
10µM
+ OT
1µM
+ OT
A
OT
NS 5’ 15’ 30’
5’ 15’ 30’ 5’ 15’ 30’ 5’ 15’ 30’
p-p65
p-p38
p-ERK
β-actin
B
1.4
1.2
1
p-p65
*
0.8
0.6
0.4
0.2
0
#
#
#
C
1.2
*
p-p38
1
0.8
0.6
0.4
0.2
0
#
#
#
#
#
#
D
1.2
1
p-ERK
*
0.8
0.6
0.4
0.2
0

Figure 5
3µM
+ OT
10µM
+ OT
1µM
+ OT
A
OT
NS 2h 4h 6h
2h 4h 6h 2h 4h 6h 2h 4h 6h
COX-2
p-cPLA2
β-actin
B
2.5
COX-2
***
2
1.5
1
#
#
## ##
##
###
##
0.5
0
C
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
p-cPLA2
***
***
***
###
###
###
###
###
###
###
###
###