Binding and Action of Amino Acid Analogs of Chloramphenicol upon the Bacterial Ribosome

Article abstract of DOI:10.1016/j.jmb.2018.01.016

Antibiotic chloramphenicol (CHL) binds with a moderate affinity at the peptidyl transferase center of the bacterial ribosome and inhibits peptide bond formation. As an approach for modifying and potentially improving properties of this inhibitor, we explored ribosome binding and inhibitory activity of a number of amino acid analogs of CHL. The L-histidyl analog binds to the ribosome with the affinity exceeding that of CHL by 10 fold. Several of the newly synthesized analogs were able to inhibit protein synthesis and exhibited the mode of action that was distinct from the action of CHL. However, the inhibitory properties of the semi-synthetic CHL analogs did not correlate with their affinity and in general, the amino acid analogs of CHL were less active inhibitors of translation in comparison with the original antibiotic. The X-ray crystal structures of the Thermus thermophilus 70S ribosome in complex with three semi-synthetic analogs showed that CHL derivatives bind at the peptidyl transferase center, where the aminoacyl moiety of the tested compounds established idiosyncratic interactions with rRNA. Although still fairly inefficient inhibitors of translation, the synthesized compounds represent promising chemical scaffolds that target the peptidyl transferase center of the ribosome and potentially are suitable for further exploration.

Full text of DOI:10.1016/j.jmb.2018.01.016

Accepted Manuscript
Binding and action of amino-acid analogues of chloramphenicol
upon the bacterial ribosome
Andrey G. Tereshchenkov, Malgorzata Dobosz-Bartoszek, Ilya A.
Osterman, James Marks, Vasilina A. Sergeeva, Pavel Kasatsky,
Ekaterina S. Komarova, Andrey A. Stavrianidi, Igor A. Rodin,
Andrey L. Konevega, Petr V. Sergiev, Natalia V. Sumbatyan,
Alexander S. Mankin, Alexey A. Bogdanov, Yury S. Polikanov
PII:
DOI:
Reference:
S0022-2836(18)30042-1
https://doi.org/10.1016/j.jmb.2018.01.016
YJMBI 65598
To appear in:
Received date:
Revised date:
Accepted date:
29 August 2017
22 January 2018
25 January 2018
Please cite this article as: Andrey G. Tereshchenkov, Malgorzata Dobosz-Bartoszek, Ilya
A. Osterman, James Marks, Vasilina A. Sergeeva, Pavel Kasatsky, Ekaterina S. Komarova,
Andrey A. Stavrianidi, Igor A. Rodin, Andrey L. Konevega, Petr V. Sergiev, Natalia V.
Sumbatyan, Alexander S. Mankin, Alexey A. Bogdanov, Yury S. Polikanov , Binding
and action of amino-acid analogues of chloramphenicol upon the bacterial ribosome. The
address for the corresponding author was captured as affiliation for all authors. Please
check if appropriate. Yjmbi(2018), https://doi.org/10.1016/j.jmb.2018.01.016
This is a PDF file of an unedited manuscript that has been accepted for publication. As
a service to our customers we are providing this early version of the manuscript. The
manuscript will undergo copyediting, typesetting, and review of the resulting proof before
it is published in its final form. Please note that during the production process errors may
be discovered which could affect the content, and all legal disclaimers that apply to the
journal pertain.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 1 of 24
Binding and action of amino-acid analogues of chloramphenicol
upon the bacterial ribosome.
Andrey G. Tereshchenkov1, Malgorzata Dobosz-Bartoszek2, Ilya A. Osterman1,3, James Marks4,8,
Vasilina A. Sergeeva1,#, Pavel Kasatsky5, Ekaterina S. Komarova (Andreyanova)3,7, Andrey A.
Stavrianidi1, Igor A. Rodin1, Andrey L. Konevega5,6, Petr V. Sergiev1,3, Natalia V. Sumbatyan1,
Alexander S. Mankin4,8, Alexey A. Bogdanov1,*, and Yury S. Polikanov2,8,*
1
Department of Chemistry and A.N. Belozersky Institute of Physico-Chemical Biology,
Lomonosov Moscow State University, Moscow, 119992, Russia
2 Department of Biological Sciences, University of Illinois at Chicago, Chicago, IL 60607, USA
3 Skolkovo Institute of Science and Technology, Skolkovo, Moscow region, 143025, Russia
4 Center for Biomolecular Sciences, University of Illinois, Chicago, IL 60607, USA
5 Petersburg Nuclear Physics Institute, NRC “Kurchatov Institute”, Gatchina 188300, Russia
6 Peter the Great St. Petersburg Polytechnic University, Saint Petersburg, 195251, Russia
7 Department of Bioengineering and Bioinformatics, Lomonosov Moscow State University,
Moscow, 119992, Russia
8
Department of Medicinal Chemistry and Pharmacognosy, University of Illinois at Chicago,
Chicago, IL 60607, USA
# Present address: Research Centre for Medical Genetics, Russian Academy of Medical Sciences,
Moscow, 115478, Russia
* To whom correspondence should be addressed:
Tel.: 7 (495) 939-5418; Fax: 7 (495) 939-3181; E-mail: bogdanov@belozersky.msu.ru (A.A.B.)
Tel.: 1 (312) 413-2408; Fax: 1 (312) 431-2691; E-mail: yuryp@uic.edu (Y.S.P.)

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 2 of 24
ABSTRACT
Antibiotic chloramphenicol (CHL) binds with a moderate affinity at the peptidyl transferase
center of the bacterial ribosome and inhibits peptide bond formation. As an approach for
modifying and potentially improving properties of this inhibitor, we explored ribosome binding
and inhibitory activity of a number of amino-acid analogues of CHL. The L-histidyl analogue
binds to the ribosome with the affinity exceeding that of CHL by 10 fold. Several of the newly
synthesized analogues were able to inhibit protein synthesis and exhibited the mode of action
that was distinct from the action of CHL. However, the inhibitory properties of the semi-
synthetic CHL-analogues did not correlate with their affinity and in general, the amino-acid
analogues of CHL were less active inhibitors of translation in comparison with the original
antibiotic. The X-ray crystal structures of the Thermus thermophilus 70S ribosome in complex
with three semi-synthetic analogues showed that CHL derivatives bind at the peptidyl transferase
center, where the aminoacyl moiety of the tested compounds established idiosyncratic
interactions with rRNA. Although still fairly inefficient inhibitors of translation, the synthesized
compounds represent promising chemical scaffolds that target the peptidyl transferase center of
the ribosome and potentially are suitable for further exploration.
KEYWORDS
Antibiotic; ribosome; X-ray structure; protein synthesis; peptidyl transferase center.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 3 of 24
RESEARCH HIGHLIGHTS
 Aminoacyl derivatives of the antibiotic chloramphenicol (AA-CAMs) can bind to the
peptidyl transferase center of the bacterial ribosome with better affinities than the parent
compound;
 AA-CAM derivatives show different site-specificity of action compared to chloramphenicol
and establish compound-specific interactions with the nucleotides of the 23S rRNA;
 The inhibitory properties of the semi-synthetic CHL-analogues do not correlate with their
affinities to the vacant ribosome;
 AA-CAMs represent promising chemical scaffolds that target the peptidyl transferase center
and the nascent peptide exit tunnel.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 4 of 24
INTRODUCTION
Many antibiotics stop growth of pathogenic bacteria, and thereby cure infections, by selectively
binding to the bacterial ribosomes and inhibiting protein synthesis. Antibiotics can interfere with
translation by interacting with various functional centers of the ribosome and either locking of a
particular conformation of the ribosome or hindering the binding of its ligands. The peptidyl
transferase center (PTC), located in the large ribosomal subunit, is targeted by a particularly
broad array of inhibitors belonging to several distinct chemical classes, such as phenicols,
lincosamides, oxazolidinones, pleuromutilins, streptogramins A, and others [1]. From the oldest
chloramphenicol (CHL) to the newest FDA-approved retapamulin, PTC-targeting drugs are
known as excellent antibacterial agents.
Most of the PTC-targeting compounds inhibit protein synthesis by competing with the
positioning of the amino acid side chain of the incoming aminoacyl-tRNA (aa-tRNA) in the A
site [2-4]. CHL, a typical example from this family, inhibits translation in a wide range of Gram-
positive and Gram-negative bacteria [5]. It binds to the A site of the PTC in a crevice formed by
the bases of the conserved nucleotides U2504, A2451, and C2452 of the 23S rRNA and its
nitrobenzyl ring forms a -stacking interaction with the base of C2452 [6, 7]. The aromatic ring
of the ribosome-bound CHL overlaps with the placement of the side chains of the incoming aa-
tRNAs, thus efficiently preventing the aminoacyl moiety of aa-tRNA from properly
accommodating into the PTC active site. CHL was originally viewed as a universal inhibitor of
peptide bond formation [8]. However, this model has been recently revised because the newer
data revealed CHL as a context-specific inhibitor of translation, whose activity depends on the
nature of specific amino acids in the nascent chain and the identity of the residue entering the A
site [9].
While CHL does not act upon the eukaryotic cytoplasmic ribosome, it readily binds to the
ribosomes of the mammalian mitochondria [10-14]. The interference with mitochondrial
translation, which is the cause of the major side effects of CHL, significantly curbed the medical
use of this drug in many countries [5, 15, 16]. Amending the CHL structure with the additional
chemical entities that would form idiosyncratic interactions specifically with the bacterial
ribosome could be one approach for the development of more selective inhibitors. In addition,
the rapid spread of antibiotic resistance has significantly limited the medical utility of many

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 5 of 24
available antibiotics, including the PTC-targeting drugs. One of the recently discovered but
rapidly spreading resistance mechanisms operates via modification of the 23S rRNA nucleotide
A2503, which is located in the binding site of several inhibitors. The rRNA methyltransferase
Cfr adds a methyl group to the C8 position of the A2503 and renders bacteria resistant to a wide
range of antibiotics targeting the catalytic center of the ribosome [17, 18]. The development of
newer derivatives of the existing antibiotic platform, which could avoid a clash with the C8
methyl group of the Cfr-modified A2503, has proven to be a viable approach for overcoming
such resistance [19].
Previously, attempts were made to prepare peptide derivatives of CHL containing peptides of up
to 10 amino acids long aiming to identify interactions between the peptide chain and the
elements of the nascent peptide exit tunnel (NPET) [20, 21]. In the current study, with the goal of
paving the way for development newer derivatives of CHL, that would target the PTC, we have
prepared several semi-synthetic analogues carrying various individual amino acids attached to
the drug. Using competition binding experiments, we investigated the affinities of the newly
prepared compounds for their target and found that some of them show improved binding to the
bacterial ribosome. We also showed that the mode of action of the newer analogues differs from
the site-specific action of CHL. By solving the X-ray crystal structures of the Thermus
thermophilus 70S ribosome in complex with several CHL-analogues we observe specific
interactions of the amino acid moiety with rRNA thereby rationalizing the improved binding.
Although the higher affinity of the derivatives to the vacant E. coli ribosome does not directly
translate into stronger inhibition of protein synthesis, the compounds described here could open
new directions for improving the medical utility of amphenicol class of the ribosome inhibitors.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 6 of 24
RESULTS AND DISCUSSION
Synthesis of CAM-derivatives.
Chemical synthesis of CHL-analogues carrying amino acid residues instead of dichloroacetic
moiety is based on acylation of CHL amine (CAM), an inactive CHL-derivative, with activated
amino acids (Figures 1, S1) [22]. The overall synthesis scheme includes three steps: (i) acid
hydrolysis of CHL to yield CAM [23]; (ii) acylation of CAM by succinimide esters of amino
acids with protected -amino group and side-chain amino groups; and (iii) de-protection of the
obtained CAM-derivatives to yield aminoacyl-CAM (AA-CAM) (Figures 1, S1). Using this
approach, we have prepared CHL analogues aminoacylated with different amino acids, including
the N-protected ones (Table 1). Molecular weights and chemical structures of all synthesized
1
13
CAM-derivatives were confirmed by mass spectrometry and H- and C-NMR. Although few
individual amino-acid analogues of CHL have been studied previously [22, 24, 25], this work
represents the first systematic approach to synthesis and functional assessment of more than
three dozens of various AA-CAMs.
AA-CAM compounds bind tightly to the bacterial ribosome.
We used the competition-binding assay, exploiting BODIPY-labeled erythromycin (BODIPY-
ERY) to assess the affinity of the synthesized compounds for the ribosome [26, 27]. While CHL
binds in the A site of the PTC [6, 28], ERY binds in the upper part of the NPET [7] but their
binding sites sufficiently overlap so that even unmodified CHL and ERY compete for their
binding to the ribosome [29] (Figure S2). The overlap of the AA-CAMs with ERY is expected
to be even more pronounced. The apparent dissociation constant KDapp of CHL obtained using
competition with BODIPY-ERY (2.8 ± 0.5 µM) is consistent with the previously published data
determined by direct [14C]-CHL binding (2.3 µM [30]). Using this approach, we found that many
of the synthesized CAM derivatives exhibited considerable affinity for the ribosome (KDapp in the
low micromolar range) (Table 1). Interestingly, all of the AA-CAM derivatives carrying free -
amino groups bind to the ribosome with higher affinities than the corresponding compounds in
which the -amino group was modified by acetylation, formylation or protected by the Boc
group (Figure S3; Table 1). This result suggests that either the positive charge, the small size of

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 7 of 24
the -amino group, or both, contribute to the efficient ribosome binding of AA-CAMs.
Importantly, one AA-CAM variant, His-CAM, binds to the ribosome with a more than 10-fold
higher affinity than CHL (His-CAM, KDapp = 0.24 ± 0.06 M) (Figure 2A; Table 1).
AA-CAM compounds are less efficient inhibitors of translation than CHL and do not show
the same context-specificity.
To check whether the binding strength of AA-CAMs correlates with inhibition of translation we
tested their ability to interfere with in vitro protein synthesis. Addition of 30 µM CHL to the cell-
free transcription-translation system based on the E. coli cell extract resulted in a near-complete
inhibition of synthesis of firefly luciferase reporter (Figure 2B). Consistent with previously
published results, removal of the dichloroacetyl moiety from CHL results in nearly complete loss
of its biological activity (Figure 2B, CHL vs. CAM) [23], likely due to the loss of interactions of
the dichloroacetic moiety with the ribosome [6]. However, similar to the previous studies
employing peptide derivatives of CHL [5, 20, 31], the inhibitory activity of CAM can be
partially restored by incorporation of specific amino acids (Figure 2B), indicating that the
contacts of the aminoacyl side chain of AA-CAMs with the ribosome may compensate for the
interactions lost upon the removal of the dichloroacetic group. However, most of the tested AA-
CAM-derivatives were less potent inhibitors of translation than CHL (Figure 2B). Even His-
CAM, which exhibited higher than CHL affinity for the ribosome, reduced the yield of the
functional luciferase by only 60%. Only the activity of -Ala-CAM approached that of CHL
even though this derivative demonstrated a 2-fold weaker binding to the ribosome compared to
the parental compound. The modification of the -amino group of AA-CAMs (with formyl,
acetyl, or Boc groups) leads to a nearly complete loss of their inhibitory potency (Figure 2B).
The inability of most of the AA-CAM compounds to efficiently inhibit translation could be
potentially explained by the susceptibility of AA-CAMs to the action of peptidases present in the
bacterial extract-based cell-free translation system. Therefore, we re-tested the inhibitory activity
of some of the compounds in the PURE cell-free translation system reconstituted from purified
components and thus, lacking peptidases [32]. All of the tested compounds exhibited inhibitory
activity in the PURE system (Figure 2C), suggesting that the stability of our compounds is
unlikely to be the key issue. Although the overall inhibition of translation by AA-CAM

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 8 of 24
derivatives in the PURE system has improved compared to their effect upon translation in the
cell extract, it still did not reach the level of inhibition elicited by the CHL, suggesting that the
equilibrium binding affinities of the tested inhibitors to a vacant ribosome might not adequately
reflect the interactions of these compounds with the translating ribosome carrying mRNAs,
tRNAs and nascent peptide chain. Several peptide derivatives of CAM have been prepared and
tested previously in the binding and inhibition assays [20, 31]. Similar to our findings, those
derivatives were found to be poor inhibitors of translation.
The inhibition of protein synthesis by CHL depends on the amino-acid sequence of the nascent
peptide and the identity of the aminoacyl-tRNA with the most efficient arrests occurring after
alanine (and to a lesser extent after serine or threonine) that appear at the penultimate position of
the nascent chain [9]. To test whether the specificity of action of AA-CAM compounds matches
that of CHL, we used primer extension inhibition assay (toe-printing) to check whether the
derivatives that exhibited inhibitory activity in the PURE system (Figure 2D), would arrest the
ribosome at the same codon(s) where translation is arrested by CHL. In these experiments, we
used a short synthetic open reading frame (ORF) encoding the peptide MFKAFKNIIRTRTL,
where CHL efficiently arrests the ribosome at the 5th codon after the MFKAF peptide has been
synthesized (Figure 2D, lanes 3 and 9, green arrowheads). Some translation reactions were
additionally supplemented with mupirocin, an inhibitor of isoleucyl-tRNA synthetase. The
depletion of isoleucyl-tRNA efficiently traps the ribosomes at the 7th codon of the ORF if they
were not arrested at any of the prior codons by the action of the ribosome inhibitor (Figure 2D,
lanes 1-6, blue arrowheads) helping to evaluate the efficiency of the antibiotic-dependent arrest
[33]. Only a small fraction of ribosomes pre-incubated with CHL was able to reach the ‘trap’
codon (Figure 2D, lane 3) because most of the translation complexes were arrested at the 5th
codon. In contrast, the intensity of the trap-codon band was only slightly diminished in samples
supplemented with AA-CAM analogues and no strong arrest was observed at the 5th codon
(Figure 2D, lanes 4-6). This was in spite of the fact that the concentrations of AA-CAM
compounds in the toe-printing experiments (100 M) were several-fold higher than those used in
the cell-free translation experiments (Figure 2B, C), where the same derivatives were able to
inhibit expression of the luciferase reporter with a considerable activity. We noted, however, that
the toe-print bands corresponding to the initiating ribosome were slightly enhanced compared to
the no-drug (+/- mupirocin) control (Figure 2D, lanes 2 and 8 vs. lanes 4-6 and 10-12,

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 9 of 24
respectively, black arrowheads), indicating that AA-CAM analogues weakly interfered with
translation initiation, likely by inhibiting the formation of the first peptide bond. We concluded
that AA-CAM derivatives do not show the same site-specificity of action as the parent
compound CHL, apparently due to idiosyncratic interactions of the aminoacyl moieties of AA-
CAMs with the ribosome.
Aminoacyl moieties of AA-CAMs mediate specific interactions with the ribosome.
To unambiguously determine the mode of binding of AA-CAM derivatives to the ribosome, we
crystallized Thermus thermophilus (Tth) 70S ribosomes in the presence of mRNA, deacylated A-,
P-, and E-site tRNAs, and His-CAM and solved the structure of the complex at 2.8Å resolution.
However, the other complexes prepared in this way did not diffract sufficiently well. Therefore,
we amended our crystallization approach by using ribosome complexed with the protein Y (PY)
as a tool to obtain structures of higher resolution [34, 35]. This approach is based on our recent
finding that binding of PY to a vacant 70S ribosome stabilizes it by locking the head of the 30S
subunit in an unrotated state, which leads to a better diffraction [34, 35]. Since PY binds in the
mRNA channel on the 30S subunit far away from the CHL binding site in the PTC of the 50S
subunit, it precludes the presence of mRNA or A- and P-tRNAs [34]. However, this does not
interfere with the binding of AA-CAMs. Using this approach, we were able to solve two
additional structures of D-His-CAM and Lys-CAM in complex with the PY-bound 70S ribosome
at 2.7Å and 2.6Å resolution, respectively (Table S1). An unbiased difference Fourier map,
calculated using the amplitudes from the crystals and phases derived from a model of the
ribosome without the bound compound, revealed positive electron density resembling
characteristic features of each of the compounds (Figure 3). A single binding site for each of the
AA-CAMs is observed in the ribosome within the PTC of the large ribosomal subunit (Figure 4).
The binding position of the amphenicol parts of AA-CAMs is identical to those observed
previously for parent CHL in the Tth [7] or Eco [28] ribosomes in the absence of mRNA and
tRNAs (Figure S4). The amino acid moieties of AA-CAMs are oriented towards the NPET and
exhibit unique compound-specific interactions at the PTC (Figures 4, 5). Histidine side chain of
His-CAM forms tilted edge-to-face -stacking with the nucleobase of U2506 (Figures 4D and
5A). In addition, the -amino group of His-CAM forms hydrogen bond (H-bond) via a water

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 10 of 24
molecule with the phosphate of nucleotide G2505 (Figure 5A). These additional interactions of
the aminoacyl moiety likely account for its increased affinity to the ribosome compared to CHL.
Contrary to His-CAM and consistent with its significantly lower affinity, -amino group of the
D-His-CAM stereoisomer does not form the water-mediated H-bond with G2505 (Figure 5B).
Surprisingly, the orientation of the amino acid side chain of L-Lys-CAM is similar to that of D-
His-CAM (Figure 5C). The lysine moiety of Lys-CAM extends towards the wall of the NPET
and, similar to D-His-CAM, forms a single H-bond with the nucleobase of A2059 explaining
why their binding is less tight in comparison with His-CAM.
In the structure of the ribosome/His-CAM complex, the oxygens of the nitro group in the CAM
moiety form H-bonds with the A76 ribose hydroxyls of deacylated A- and P-site tRNAs (Figure
4C). It is unclear whether such interactions are possible in the translating ribosome when the P-
site tRNA is attached to the aminoacyl or peptidyl groups. Nevertheless, our structures clearly
demonstrate that amphenicol part of the AA-CAMs is capable of anchoring the derivatives in the
PTC active site directing the attached amino acids in the direction corresponding to the growing
peptide chain.
Resistance to many peptidyl transferase inhibitors (including CHL) can be conferred by Cfr, a
methyltransferase that methylates A2503 of the 23S rRNA at the C8 atom [18]. The methyl
group added to A2503 by Cfr would invade the CHL binding pocket if the placement of the
modified A2503 remains unchanged (Figure 6A). In silico modeling shows, however, that the
ribosome-bound His-CAM whose placement in the PTC is somewhat shifted relative to CHL,
would avoid the collision with C8-methyl group of A2503 (Figure 6B), suggesting that this
compound could retain certain activity against the Cfr-modified ribosome. Likewise, the
resistance to CHL conferred by the mutation of A2503 to G [36], is likely to be less pronounced
in the case of His-CAM due to a more remote position of the amino acid side chain of His-CAM
relative to the site of the mutation. Therefore, the structure of the ribosome with the AA-CAM
derivatives suggest that some of the amino acid analogues of CHL could be less susceptible to
the action of specific resistance mechanisms. Further experiments would be required to check
whether any of the synthesized CHL-analogues are active against ribosomes rendered resistant to
CHL.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 11 of 24
The structure of PTC is highly conserved among evolutionary distant ribosomes, including the
ribosomes of mitochondria which are known to be targeted by CHL [10-14]. However, even
minor variations in the placement of the nucleotides directly interacting with the drug, which
could be influenced by the less conserved second-shell nucleotides, could account for the
selectivity of the antibiotics that bind in the PTC active site as well as for the differential effect
of these drugs upon ribosomes from different species. Because the compounds examined in our
study have fairly low activity against the bacterial ribosome, we have not pursued studies of their
effects upon mitochondrial translation. However, we believe that adding an amino acid or its
analogue to the drug core could potentially influence the spectrum of action of this class of the
ribosomal antibiotics opening a possibility of making them more selective inhibitors of bacterial
translation.
CONCLUSIONS
The goal of the current study was to develop amino-acid analogues of CHL as an approach for
exploring this line of derivatives as new inhibitors of translation. We used organic synthesis to
generate a diverse set of amino-acid analogues of native CHL and examined their ribosome
binding and inhibitory properties. We have demonstrated that His-CAM, a histidine analogue of
CHL, exhibits 10 times higher affinity for the bacterial ribosome as compared to CHL. We have
noted, however, that the inhibitory properties of the semi-synthetic CHL-analogues do not
correlate with their binding affinities to the vacant ribosomes and the compounds with high
affinities, such as His-CAM, inhibit translation less efficiently than CHL, while compounds with
low affinities, such as -Ala-CAM, demonstrated inhibitory properties similar to those of the
parental drug. Our crystal structures show that amino-acid analogues of CHL establish
compound-specific interactions with the nucleotides of the 23S rRNA at the PTC and orient the
amino acid moiety in the direction of the upper part of the peptide exit tunnel. The idiosyncratic
interactions with the ribosome of the amino acid residue attached to the CHL core open the
possibility of increasing the selectivity of this class of antibiotics and possibly diminish their side
effects mediated by the action upon mitochondrial translation. Moreover, the possibility that
some of the amino-acid derivatives of CHL might act upon drug-resistant ribosome makes them
attractive compounds for further exploration by medicinal chemists, and we expect that our

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 12 of 24
findings, including the structure of the AA-CAM-ribosome complexes described here, will serve
as a starting point for such studies.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 13 of 24
MATERIALS AND METHODS
Reagents.
Various amino acid derivatives used in chemical synthesis (Supplementary Methods) were
from Fluka or Reanal; CHL was from Sigma; Succinimide ester of BODIPY was from
Invitrogen; N-hydroxysuccinimide, N,N’-dicyclohexylcarbodiimide (DCC) and DMAP were
from Merck. BODIPY-ERY was synthesized as described previously [37].
Chemical synthesis of AA-CAM derivatives.
The general scheme for the synthesis of AA-CAM derivatives is shown in Figure S1 and the
details of chemical synthesis are provided in the Supplementary Methods section. CAM
[(1R,2R)-2-amino-1-(4-nitrophenyl)propane-1,3-diol)] was prepared as described previously [23].
Amino acids with protected - and side-chain amino groups were activated by reaction with N-
hydroxysuccinimide in the presence of DCC at 0°C. The resulting succinimide-reactive esters
were used for the acylation of CAM in the presence of diisopropylethylamine as a base at room
temperature. Subsequent deprotection was achieved by treatment of the obtained amino-acid
CAM derivatives with trifluoroacetic acid and appropriate scavengers. Synthesized AA-CAM
derivatives were purified by column chromatography on silica gel using suitable systems of
solvents. For generating N-acetylated variants of AA-CAM, additional acetylation was
performed by reacting the unprotected AA-CAM derivatives with the N-acetylsuccinimide.
Purity and chemical structures of obtained compounds were confirmed by HPLC, LC-MS and
NMR spectroscopy (see Supplementary Methods).
In vitro binding assay.
Binding affinities of CAM-derivatives to E. coli ribosomes was analyzed by competition binding
assay using fluorescently-labeled BODIPY-ERY as described before [26, 27, 37]. BODIPY-
ERY (4 nM) was incubated with ribosomes (25 nM) for 30 min at 25°C in the buffer containing
20 mM HEPES-KOH (pH 7.5), 50 mM NH4Cl, 10 mM Mg(CH3COO)2, and 0.05% Tween-20.
The solution of CAM derivatives in a range of concentrations from 0.1 µM to 1 mM was added

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 14 of 24
to the formed complex. The mixture was incubated for 2 hours until equilibrium was reached and
the values of fluorescence polarization were measured.
In vitro translation.
Inhibition of firefly luciferase synthesis in cell-free translation systems by AA-CAMs was tested
as described previously [38]. Briefly, the in vitro transcribed firefly luciferase mRNA was
translated using either PURExpress system (New England Biolabs) or E. coli S30 extract
prepared according to [39]. Reactions were programmed with 100 ng mRNA and were carried
out in 5 µL aliquots at 37°C for 30 minutes. The AA-CAMs were added to 30 µM final
concentration. The activity of in vitro synthesized luciferase was assessed using 5 µL of the
substrate from the Steady-Glo Luciferase Assay System (Promega).
Toe-printing analysis of compound-induced ribosome stalling.
Toe-printing experiments were performed in the PURExpress cell-free translation system (New
England Biolabs) following our published protocols [40, 41]. The synthetic template encoding
the amino acid sequence MFKAFKNIIRTRTL was initially generated by PCR reaction using a
combination of five primers: 2 µM T7 (ATTAATACGACTCACTATAGGG), 2 µM NV1
(GGTTATAATGAATTTTGCTTATTAAC) and 0.2 µM of each of the following: Fv
(AATACGACTCACTATAGGGCAACCTAAAACTTACACACGCCCCGGTAAGGAAATAA
AAAT),
(GCCCCGGTAAGGAAATAAAAATGTTCAAAGCATTCAAAAACATCATACGTACTCGT
ACTC) and Rev
inner
(GGTTATAATGAATTTTGCTTATTAACCTTGCCTGCGCTTAAAGAGTACGAGTACGTA
TGATGT) as described in [42]. The product was cloned into the pUC18 plasmid cut with the
SmaI restriction enzyme and the resulting pUCMFKAFK plasmid was verified by capillary
sequencing. For the toe-printing reaction, the template was PCR-amplified from the
pUCMFKAFK plasmid using T7 and NV1 primers. When needed, the other antibiotics
(retapamulin, CHL, and AA-CAM analogues) were present in the reaction at the final
concentration of 100 µM. In addition, all the toe-printing reactions were supplemented with the

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 15 of 24
Ile-RS inhibitor mupirocin (final concentration 50 µM), which caused translating ribosomes to
pause when an isoleucine codon was encountered.
Crystallographic structure determination.
Ribosome complexes with mRNA and tRNAs or with protein Y were formed as described
previously [35]. CAM-derivatives were added to the pre-formed ribosome complexes to a final
concentration of 250 µM prior to crystallization. All Tth 70S ribosome complexes were formed
in the buffer containing 5 mM HEPES-KOH (pH 7.6), 50 mM KCl, 10 mM NH4Cl, and 10 mM
Mg(CH3COO)2, and then crystallized in the buffer containing 100 mM Tris-HCl (pH 7.6), 2.9%
(w/v) PEG-20K, 7-12% (v/v) MPD, 100-200 mM arginine, 0.5 mM β-mercaptoethanol. Crystals
were grown by the vapor diffusion method in sitting drops at 19°C and stabilized as described
previously [35] with the corresponding CAM-derivatives being added to the stabilization buffers
(100 µM each). Diffraction data were collected using beamlines 24ID-C and 24ID-E at the
Advanced Photon Source (Argonne, IL). All crystals belonged to the primitive orthorhombic
space group P212121 with approximate unit cell dimensions of 210Å x 450Å x 620Å and
contained two copies of the 70S ribosome per asymmetric unit. Each structure was solved by
molecular replacement using PHASER from the CCP4 program suite [43]. The search model
was generated from the previously published structures of T. thermophilus 70S ribosome with
bound mRNA and tRNAs (PDB entry 4Y4P from [35]) or with protein Y (PDB entry 4Y4O
from [35]). The initial molecular replacement solutions were refined by rigid body refinement
with the ribosome split into multiple domains, followed by positional and individual B-factor
refinement. The final models of the 70S ribosome in complex with His-CAM and mRNA/tRNAs,
or in complex with D-His-CAM/Lys-CAM and protein Y were generated by multiple rounds of
model building in COOT [44], followed by refinement in PHENIX [45]. The statistics of data
collection and refinement are compiled in Table S1.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 16 of 24
AUTHOR CONTRIBUTIONS
A.G.T. and V.A.S. performed chemical synthesis of CAM-derivatives; N.V.S. purified CAM-
derivatives; A.G.T. performed 70S ribosome binding assay; A.A.S. and I.A.R. performed mass
spectrometry analysis; I.A.O., E.S.K., and P.V.S. designed and performed in vitro translation
inhibition assays; P.S.K. and A.L.K. prepared E. coli 70S ribosomes; J.M. and A.S.M designed
and performed toe-printing experiments; M.D.B. and Y.S.P. designed and performed X-ray
crystallographic experiments. N.V.S., A.S.M., A.A.B., and Y.S.P. supervised the experiments.
All authors interpreted the results. A.G.T., N.V.S., A.S.M., A.A.B., and Y.S.P. wrote the
manuscript.
ACKNOWLEDGMENTS
We thank V. N. Tashlitsky for help with LCMS analysis, Y. K. Grishin and I. A. Godovikov for
help with interpreting NMR spectra, E. N. Shapovalova for help with chiral chromatography
analysis, M. S. Svetlov for help with translation inhibition assays, G. A. Korshunova for
providing Boc derivatives of amino acids, and А. А. Bogdanov Jr. for providing Ac derivatives
of amino acids. We are also thankful to the members of the A.A.B, P.V.S., A.S.M., and Y.S.P.
laboratories for discussions and critical feedback.
This work is based upon research conducted at the Northeastern Collaborative Access Team
beamlines, which are funded by the National Institute of General Medical Sciences from the
National Institutes of Health (P41 GM103403). The Pilatus 6M detector on 24ID-C beamline is
funded by a NIH-ORIP HEI grant (S10 RR029205). The Eiger 16M detector on 24ID-E
beamline is funded by a NIH-ORIP HEI grant (S10 OD021527). This research used resources of
the Advanced Photon Source, a U.S. Department of Energy (DOE) Office of Science User
Facility operated for the DOE Office of Science by Argonne National Laboratory under Contract
No. DE-AC02-06CH11357.
This work was supported by Illinois State startup funds (to Y.S.P.), Russian Science Foundation
grant 14-24-00061-P (to Tatyana S. Oretskaya, “Study of antibiotics binding to bacterial
ribosomes”), and Russian Foundation for Basic Research grants 16-04-00709 (to N.V.S.,
“Synthesis of CHL analogues”) and 15-34-20139 (to I.A.O., “Translation inhibition analysis”),

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 17 of 24
and the National Institutes of Health grants R01 AI125518 (to A.S.M.) and R01 GM106386 (to
A.S.M.).
ACCESSION NUMBERS
Coordinates and structure factors were deposited in the RCSB Protein Data Bank with accession
code 5XXX for the T. thermophilus 70S ribosome in complex with His-CAM, mRNA, A-, P-
and E-site tRNAs; 5XXX for the T. thermophilus 70S ribosome in complex with D-His-CAM
and protein Y; and 5XXX for the T. thermophilus 70S ribosome in complex with Lys-CAM and
protein Y.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 18 of 24
REFERENCES
[1] Polacek N, Mankin AS. The ribosomal peptidyl transferase center: structure, function,
evolution, inhibition. Crit Rev Biochem Mol Biol. 2005;40:285-311.
[2] Wilson DN. Ribosome-targeting antibiotics and mechanisms of bacterial resistance. Nat Rev
Microbiol. 2014;12:35-48.
[3] Schwarz S, Shen J, Kadlec K, Wang Y, Brenner Michael G, Fessler AT, et al. Lincosamides,
Streptogramins, Phenicols, and Pleuromutilins: Mode of Action and Mechanisms of Resistance.
Cold Spring Harb Perspect Med. 2016;6.
[4] McKie SA. Antibiotics: where to throw the spanner in the ribosomal machinery? Future Med
Chem. 2016;8:1981-2002.
[5] Dinos GP, Athanassopoulos CM, Missiri DA, Giannopoulou PC, Vlachogiannis IA,
Papadopoulos GE, et al. Chloramphenicol derivatives as antibacterial and anticancer agents:
Historic problems and current solutions. Antibiotics. 2016;5.
[6] Hansen JL, Moore PB, Steitz TA. Structures of five antibiotics bound at the peptidyl
transferase center of the large ribosomal subunit. J Mol Biol. 2003;330:1061-75.
[7] Bulkley D, Innis CA, Blaha G, Steitz TA. Revisiting the structures of several antibiotics
bound to the bacterial ribosome. Proc Natl Acad Sci USA. 2010;107:17158-63.
[8] Pestka S. Chloramphenicol. In: Corcoran JW, Hahn FE, Snell JF, Arora KL, editors.
Antibitoics: Mechanism of action of antimicrobial and antitumor agents: Springer-Verlag, Berlin,
Heidelberg, New York; 1975. p. 370-95.
[9] Marks J, Kannan K, Roncase EJ, Klepacki D, Kefi A, Orelle C, et al. Context-specific
inhibition of translation by ribosomal antibiotics targeting the peptidyl transferase center. Proc
Natl Acad Sci USA. 2016;113:12150-5.
[10] Barnhill AE, Brewer MT, Carlson SA. Adverse effects of antimicrobials via predictable or
idiosyncratic inhibition of host mitochondrial components. Antimicrob Agents Chemother.
2012;56:4046-51.
[11] Singh R, Sripada L, Singh R. Side effects of antibiotics during bacterial infection:
mitochondria, the main target in host cell. Mitochondrion. 2014;16:50-4.
[12] Jones CN, Miller C, Tenenbaum A, Spremulli LL, Saada A. Antibiotic effects on
mitochondrial translation and in patients with mitochondrial translational defects. Mitochondrion.
2009;9:429-37.
[13] Ibrahim NG, Burke JP, Beattie DS. The sensitivity of rat liver and yeast mitochondrial
ribosomes to inhibitors of protein synthesis. J Biol Chem. 1974;249:6806-11.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 19 of 24
[14] Lamb AJ, Clark-Walker GD, Linnane AW. The biogenesis of mitochondria. 4. The
differentiation of mitochondrial and cytoplasmic protein synthesizing systems in vitro by
antibiotics. Biochimica et biophysica acta. 1968;161:415-27.
[15] Hanekamp JC, Bast A. Antibiotics exposure and health risks: chloramphenicol. Environ
Toxicol Pharmacol. 2015;39:213-20.
[16] Cohen BH, Saneto RP. Mitochondrial translational inhibitors in the pharmacopeia.
Biochimica et biophysica acta. 2012;1819:1067-74.
[17] Smith LK, Mankin AS. Transcriptional and translational control of the mlr operon, which
confers resistance to seven classes of protein synthesis inhibitors. Antimicrob Agents Chemother.
2008;52:1703-12.
[18] Long KS, Poehlsgaard J, Kehrenberg C, Schwarz S, Vester B. The Cfr rRNA
methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins,
and Streptogramin A antibiotics. Antimicrob Agents Chemother. 2006;50:2500-5.
[19] Locke JB, Zurenko GE, Shaw KJ, Bartizal K. Tedizolid for the management of human
infections: in vitro characteristics. Clin Infect Dis. 2014;58 Suppl 1:S35-S42.
[20] Mamos P, Krokidis MG, Papadas A, Karahalios P, Starosta AL, Wilson DN, et al. On the
use of the antibiotic chloramphenicol to target polypeptide chain mimics to the ribosomal exit
tunnel. Biochimie. 2013;95:1765-72.
[21] Bougas A, Vlachogiannis IA, Gatos D, Arenz S, Dinos GP. Dual effect of chloramphenicol
peptides on ribosome inhibition. Amino acids. 2017;49:995-1004.
[22] Vince R, Almquist RG, Ritter CL, Daluge S. Chloramphenicol binding site with analogues
of chloramphenicol and puromycin. Antimicrob Agents Chemother. 1975;8:439-43.
[23] Rebstock MC, Crooks HM, Controulis J, Bartz QR. Chloramphenicol (chloromycetin). IV.
Chemical studies. J Am Chem Soc 1949;71:2458-62.
[24] Drainas D, Mamos P, Coutsogeorgopoulos C. Aminoacyl analogs of chloramphenicol:
examination of the kinetics of inhibition of peptide bond formation. J Med Chem. 1993;36:3542-
5.
[25] Michelinaki M, Mamos P, Coutsogeorgopoulos C, Kalpaxis DL. Aminoacyl and peptidyl
analogs of chloramphenicol as slow-binding inhibitors of ribosomal peptidyltransferase: a new
approach for evaluating their potency. Mol Pharmacol. 1997;51:139-46.
[26] Yan K, Hunt E, Berge J, May E, Copeland RA, Gontarek RR. Fluorescence polarization
method to characterize macrolide-ribosome interactions. Antimicrob Agents Chemother.
2005;49:3367-72.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 20 of 24
[27] Tereshchenkov AG, Shishkina AV, Karpenko VV, Chertkov VA, Konevega AL, Kasatsky
PS, et al. New fluorescent macrolide derivatives for studying interactions of antibiotics and their
analogs with the ribosomal exit tunnel. Biochemistry (Mosc). 2016;81:1163-72.
[28] Dunkle JA, Xiong L, Mankin AS, Cate JH. Structures of the Escherichia coli ribosome with
antibiotics bound near the peptidyl transferase center explain spectra of drug action. Proc Natl
Acad Sci USA. 2010;107:17152-7.
[29] Vazquez D. Binding of chloramphenicol to ribosomes. The effect of a number of antibiotics.
Biochimica et biophysica acta. 1966;114:277-88.
[30] Lessard JL, Pestka S. Studies on the formation of transfer ribonucleic acid-ribosome
complexes. 23. Chloramphenicol, aminoacyl-oligonucleotides, and Escherichia coli ribosomes. J
Biol Chem. 1972;247:6909-12.
[31] Tereshchenkov AG, Shishkina AV, Tashlitsky VN, Korshunova GA, Bogdanov AA,
Sumbatyan NV. Interaction of chloramphenicol tripeptide analogs with ribosomes. Biochemistry
(Moscow). 2016;81:392-400.
[32] Shimizu Y, Kuruma Y, Kanamori T, Ueda T. The PURE system for protein production.
Methods Mol Biol. 2014;1118:275-84.
[33] Vazquez-Laslop N, Klepacki D, Mulhearn DC, Ramu H, Krasnykh O, Franzblau S, et al.
Role of antibiotic ligand in nascent peptide-dependent ribosome stalling. Proc Natl Acad Sci
USA. 2011;108:10496-501.
[34] Polikanov YS, Blaha GM, Steitz TA. How hibernation factors RMF, HPF, and YfiA turn off
protein synthesis. Science. 2012;336:915-8.
[35] Polikanov YS, Melnikov SV, Soll D, Steitz TA. Structural insights into the role of rRNA
modifications in protein synthesis and ribosome assembly. Nat Struct Mol Biol. 2015;22:342-4.
[36] Porse BT, Garrett RA. Sites of interaction of streptogramin A and B antibiotics in the
peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms. J Mol
Biol. 1999;286:375-87.
[37] Shishkina A, Makarov G, Tereshchenkov A, Korshunova G, Sumbatyan N, Golovin A, et al.
Conjugates of amino acids and peptides with 5-o-mycaminosyltylonolide and their interaction
with the ribosomal exit tunnel. Bioconjug Chem. 2013;24:1861-9.
[38] Polikanov YS, Osterman IA, Szal T, Tashlitsky VN, Serebryakova MV, Kusochek P, et al.
Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome. Mol
Cell. 2014;56:531-40.
[39] Svetlov MS, Kommer A, Kolb VA, Spirin AS. Effective cotranslational folding of firefly
luciferase without chaperones of the Hsp70 family. Protein Sci. 2006;15:242-7.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 21 of 24
[40] Vazquez-Laslop N, Thum C, Mankin AS. Molecular mechanism of drug-dependent
ribosome stalling. Mol Cell. 2008;30:190-202.
[41] Orelle C, Szal T, Klepacki D, Shaw KJ, Vazquez-Laslop N, Mankin AS. Identifying the
targets of aminoacyl-tRNA synthetase inhibitors by primer extension inhibition. Nucleic Acids
Res. 2013;41:e144.
[42] Orelle C, Carlson S, Kaushal B, Almutairi MM, Liu H, Ochabowicz A, et al. Tools for
characterizing bacterial protein synthesis inhibitors. Antimicrob Agents Chemother.
2013;57:5994-6004.
[43] McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read RJ. Phaser
crystallographic software. J Appl Crystallogr. 2007;40:658-74.
[44] Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr
D Biol Crystallogr. 2004;60:2126-32.
[45] Adams PD, Afonine PV, Bunkoczi G, Chen VB, Davis IW, Echols N, et al. PHENIX: a
comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D
Biol Crystallogr. 2010;66:213-21.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 22 of 24
FIGURE LEGENDS
Figure 1. Schematic diagram of chemical synthesis of the histidine analogue of CHL.
Figure 2. Binding and inhibitory properties of AA-CAM-derivatives. (A) Competition
binding assay to test the inhibition of BODIPY-ERY binding to the E. coli ribosomes in the
presence of increasing concentrations of AA-CAM derivatives measured by fluorescence
anisotropy. (B, C) Inhibition of in vitro synthesis of firefly luciferase by AA-CAM derivatives in
the E. coli S30 cell extract (B) or in the PURE system (C). All the inhibitors were present in the
reaction at 30 µM. All the reactions were performed in triplicates and error bars represent
confidence interval (α = 0.05). Inhibitory activity of AA-CAM compounds with free α-amino
groups are shown as light grey bars, N-protected AA-CAM compounds – dark grey, positive
control CHL – white bars. (D) Primer extension inhibition (toe-printing) analysis of site
specificity of action of CHL and AA-CAMs. The synthetic mini-gene was translated in the cell-
free translation (‘PURE’) system and sites of antibiotic-induced translation arrest were analyzed
by primer extension. The reactions loaded onto lanes 1-6 contained mupirocin, an inhibitor of
isoleucyl-tRNA synthetase. The sample in lane 2 (labeled ‘NONE’) contained no other
antibiotics besides mupirocin. The control antibiotic retapamulin (RET) inhibits translation
initiation and arrests the ribosome at the start codon (black arrowheads). Bands corresponding to
the CHL-induced translation arrest at the 5th codon are indicated by the green arrowheads.
Stalling of ribosomes at the 7th codon of the ORF due to the presence of mupirocin that causes
depletion of isoleucyl-tRNA (lanes 1-6) is indicated by the blue arrowheads. U- and A-specific
sequencing lanes are indicated. The nucleotide sequence of the gene and the corresponding
encoded amino acids are indicated on the left. Note that the reverse transcriptase stops 15-16
nucleotides downstream from the first nucleotide of the P-site codon as indicated by the dashed
arrow.
Figure 3. Chemical structures and electron density maps of CAM-derivatives. Chemical
structures and difference Fourier maps of His-CAM (A), D-His-CAM (B), and Lys-CAM (C) in
complex with the T. thermophilus 70S ribosome. The refined model of each compound is
displayed in its respective electron density before the refinement (green mesh). Carbon atoms are

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 23 of 24
colored yellow for His-CAM, orange for D-His-CAM, magenta for Lys-CAM, nitrogens are blue,
oxygens are red.
Figure 4. Structure of His-CAM in complex with the 70S ribosome and A- and P-tRNAs. (A,
B) Overview of the His-CAM binding site (yellow) in the T. thermophilus 70S ribosome viewed
from the PTC down the tunnel as indicated by the inset (A), or as a cross-cut section through the
ribosome (B). The 30S subunit is shown in light yellow, the 50S subunit is in light blue, the
mRNA is magenta and the A- and P-site tRNAs are green and dark blue, respectively. The E-site
tRNA is omitted for clarity. (C, D) Close-up views of the His-CAM bound in the PTC. The E.
coli nucleotide numbering is used throughout. Potential H-bond interactions are indicated with
dashed lines. Note that side chain of His-CAM compound forms tilted edge-to-face -stacking
with the nucleobase of U2506 of the 23S rRNA (shown as spheres).
Figure 5. Side-chain-specific interactions of AA-CAMs with the ribosome. Compound-
specific H-bond interactions of His-CAM (A), D-His-CAM (B), or Lys-CAM (C) with the
nucleotides of the 23S rRNA are indicated with dashed lines. Stacking interactions of His-CAM
are shown with the black arrow.
Figure 6. Structural basis for resistance to CHL (A) and His-CAM (B). Molecular modeling
of the C8-methylation of A2503 (red sphere) catalyzed by the Cfr-methyltransferase reveals a
small clash with CHL (A) but not with histidine analogue of CHL (B). Note that the path of the
His-CAM in the PTC is located further away from the C8-position of A2503 (compared to CHL)
that should allow it to avoid a possible steric clash with this position carrying methyl group in
the Cfr-modified ribosome.

ACCEPTED MANUSCRIPT
Tereshchenkov, A.G. et al.
Manuscript
P a g e | 24 of 24
TABLES
Table 1. Apparent dissociation constants (KDapp) of amino-acid CAM-derivatives with the E.
coli 70S ribosomes. Numbers in the parenthesis correspond to the particular compound from the
synthesis scheme shown in Figure S1.
N-unprotected Compounds
Compound KDapp (µM)
CHL 2.8 ± 0.5
N-Protected Compounds
Compound
KDapp (µM)
10 ± 1.5
26 ± 10
34 ± 5
Ac-Pro-CAM (7a)
Ac-Arg-CAM (3a)
Ac-His-CAM (1a)
Ac-Lys-CAM (2a)
Ac-Ala-CAM (4a)
Ac-Gly-CAM (5a)
Ac-Phe-CAM (11a)
Ac-Trp-CAM (10a)
Ac-Tyr-CAM (8a)
Boc-His-CAM (1d)
Boc-Gly-CAM (5d)
Boc-Phe-CAM (11d)
Boc-Ala-CAM (4d)
Boc-Pro-CAM (7d)
f-Gly-CAM (5b)
His-CAM (1)
Lys-CAM (2)
Arg-CAM (3)
Ala-CAM (4)
Gly-CAM (5)
Gln-CAM (6)
Pro-CAM (7)
0.24 ± 0.06
1.6 ± 0.5
3.2 ± 1.4
5.3 ± 0.9
5.7 ± 0.9
6.3 ± 5.1
7.5 ± 1.6
8.2 ± 1.5
8.4 ± 2.4
12 ± 2
43 ± 12
55 ± 13
69 ± 14
92 ± 22
106 ± 36
140 ± 50
19 ± 5
Tyr-CAM (8)
Ser-CAM (9)
Trp-CAM (10)
Phe-CAM (11)
Val-CAM (12)
Leu-CAM (13)
Ile-CAM (14)
Asn-CAM (15)
D-His-CAM (1b)
D-Ala-CAM (4b)
D-Pro-CAM (7b)
β-Ala-CAM (16)
45 ± 8
19 ± 8
160 ± 120
170 ± 60
440 ± 230
45 ± 6
34 ± 8
36 ± 6
36 ± 10
40 ± 26
2.9 ± 0.8
7.9 ± 1.4
13 ± 2
6.3 ± 1.3

Graphics Abstract

Figure 1

Figure 2

Figure 3

Figure 4