Synthesis and properties of 2′-O,4′-C-methyleneoxymethylene bridged nucleic acid

Article abstract of DOI:10.1016/j.bmc.2005.09.020

A novel bridged nucleic acid (BNA) analogue, 2′-O,4′-C- methyleneoxymethylene bridged nucleic acid (2′,4′-BNA ^COC), was synthesized and incorporated into oligonucleotides. The 2′,4′-BNA^COC modified oligonucleotides showed high bindin

Full text of DOI:10.1016/j.bmc.2005.09.020

Bioorganic & Medicinal Chemistry 14 (2006) 1029–1038
Synthesis and properties of
20-O,40-C-methyleneoxymethylene bridged nucleic acid
Yoshiyuki Hari,a,ꢀ Satoshi Obika,a,b Ryo Ohnishi,a Ken Eguchi,a Tomohisa Osaki,a
Hirofumi Ohishic and Takeshi Imanishia,*
aGraduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871, Japan
bPRESTO, JST, 4-1-8 Honcho Kawaguchi, Saitama 332-0012, Japan
cOsaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094, Japan
Received 13 August 2005; revised 5 September 2005; accepted 7 September 2005
Available online 5 October 2005
Abstract—A novel bridged nucleic acid (BNA) analogue, 20-O,40-C-methyleneoxymethylene bridged nucleic acid (20,40-BNACOC),
was synthesized and incorporated into oligonucleotides. The 20,40-BNACOC modified oligonucleotides showed high binding affinity
with an RNA complement and significant enzymatic stability against snake venom phosphodiesterase.
ꢀ 2005 Elsevier Ltd. All rights reserved.
1. Introduction
O
O
O
Base
Base
Base
For a practical application of antisense and/or antigene
methodologies, it is essential to develop modified oligo-
nucleotides, which strongly interact with single-
stranded RNA (ssRNA) and/or double-stranded
DNA (dsDNA) in a sequence-specific manner.1–5 In
addition, high resistance against enzymatic degradation
is also required for in vivo use. We have so far devel-
oped various kinds of bridged nucleic acids (BNAs),6–8
the sugar conformation of which is restricted or locked
by introduction of an additional bridged structure to
the furanose skeleton, and it was observed that one
of the BNAs with a locked N-type sugar conformation,
20,40-BNA6–11/LNA,5,12–15 was prominent in hybridiza-
tion with ssRNA and dsDNA targets (Fig. 1). Recent-
ly, other nucleic acid analogues with a different type of
bridged structure between the 20- and 40-positions,
which have a six- or seven-membered ring, were report-
ed (Fig. 1).16–21 These studies revealed a significant
effect of the size and composition of the ring structure
O
O
O
O
O
O
O
O
O
2',4'-BNA/LNA
(Refs 5–15)
ENA
(Refs 16–18)
PrNA
(Ref 17 )
O
O
O
Base
Base
Base
O
O
O
O
O
O
O
O
O
2',4'-BNACOC
(Refs 19,20)
(Ref 21)
Figure 1. Structures of 20,40-BNACOC and other bridged nucleic acids.
on hybridization ability and/or enzymatic stability of
the nucleic acid analogues. Thus, modification of the
bridged structure in 20,40-BNA/LNA would be a work-
able strategy for development of practical antisense
and/or antigene molecules. Here, we designed a novel
bridged nucleic acid analogue, 20,40-BNACOC, which
has a methyleneoxymethylene (–C–O–C–) linkage be-
tween the O20 and C40 atoms (Fig. 1). The facile syn-
thesis of 20,40-BNACOC monomers and the properties
of the corresponding oligonucleotide derivatives are
described.
Keywords: Bridged nucleic acids; Conformation; Nucleosides;
Oligonucleotides.
*
Corresponding author. Tel.: +81 6 6879 8200; fax: +81 6 6879
8204; e-mail: imanishi@phs.osaka-u.ac.jp
ꢀ
Present address: Graduate School of Pharmaceutical Sciences,
Nagoya City University, 3-1 Tanabe-dori Mizuho-ku, Nagoya,
Aichi 467-8603, Japan.
0968-0896/$ - see front matter ꢀ 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2005.09.020

1030
Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
2. Results and discussion
As shown in Scheme 1, an amidite 9 was synthesized by
using 1 as the starting material, which was prepared
according to our previous report.22 Treatment of 1 with
Ac2O in AcOH in the presence of concd H2SO4 afforded
triacetate 2. According to Vorbruggenꢁs procedure,23,24
¨
the triacetate 2 was coupled with thymine to give a b-an-
omer 3T. Exposure of 3T to K2CO3/MeOH provided a
diol 4T, which was then treated with paraformaldehyde
to yield the desired cyclic acetal product 5T. The tert-
butyldiphenylsilyl (TBDPS) group was removed by
treatment with TBAF and subsequent hydrogenolysis
furnished the 20,40-BNACOC-thymine monomer 7T via
an intermediate 6T. The structural features of 7T were
1
well confirmed by H NMR measurement and X-ray
crystallography.25 It was observed that the sugar
conformation existed in a typical N-form (C30-endo,
pseudorotation phase angle P = 17ꢁ) and the methylene-
oxymethylene (C–O–C) linkage surrounded the O30
atom in 7T. Furthermore, the maximum out-of-plane
pucker (mmax), c, and d values of 7T were 38ꢁ, 58ꢁ, and
78ꢁ, respectively. These values are in good agreement
with those observed in a typical A-type RNA duplex
(P = 14ꢁ, mmax = 38ꢁ, c = 45ꢁ and d = 83ꢁ).26,27 Reaction
of a primary hydroxyl group in 7T with DMTrCl in pyr-
idine gave 8T, and subsequent phosphitylation led to the
desired amidite 9T. The phosphoramidite 9C bearing an
N4-benzoylcytosine nucleobase was synthesized in a sim-
ilar manner (Fig. 2).
Figure 2. X-ray structure of 7T.
cytosine. The thymidine analogue 5T was reacted with
1H-triazole, POCl3, and Et3N in MeCN to afford the
corresponding 4-triazolylpyrimidine intermediate, which
was then treated with aqueous NH3 to give the 5-meth-
ylcytosine derivative 10. Protection of the nucleobase
moiety with a benzoyl group and removal of the
50-O-TBDPS and 30-O-benzyl groups gave the desired
20,40-BNACOC-5-methylcytosine monomer 13. Dimeth-
oxytritylation and subsequent phosphitylation of the
5-methylcytosine monomer 13 afforded the phospho-
ramidite 15. Thus, we achieved the synthesis of novel
bridged nucleic acid monomers and their amidite deriva-
tives via a convenient synthetic route. This facile route
would be readily applicable to the synthesis of the 20,40-
BNACOC bearing other natural or unnatural nucleobases.
As shown in Scheme 2, the nucleobase of the 20,40-
BNACOC-thymine monomer was converted to 5-methyl-
TBDPSO
HO
TBDPSO
AcO
O
O
OAc
i
ii
O
OBn
O
OBn OAc
2
1
Next, the phosphoramidite 9T was incorporated into oli-
gonucleotides by using conventional phosphoramidite
chemistry on an automated DNA synthesizer. Although
a decrease in the coupling efficiency of 9T was supposed
to be due to a steric hindrance of a seven-membered ring
structure with a methyleneoxymethylene linkage, the
corresponding oligonucleotides 16–20 containing one
R1O
TBDPSO
Base
Base
O
O
iv
R2O
O
RO
O
OBn OR
5 R1 = TBDPS, R2 = Bn
6 R1 = H, R2 = Bn
7 R1 = R2 = H
8 R1 = DMTr, R2 = H
9 R1 = DMTr,
3 R = Ac
4 R = H
iii
v
or more 20,40-BNACOC-thymine monomers (TB(COC)
)
vi
vii
were obtained by a standard phosphoramidite chemistry
using 1H-tetrazole as an activator. The coupling time
was prolonged to 45 min for TB(COC), and the coupling
efficiency for TB(COC) was ca. 80%.28 The coupling effi-
ciency was remarkably improved (over 95% yield) when
4,5-dicyanoimidazole or 5-ethylthio-1H-tetrazole was
used as an activator even with shorter coupling time
(20 min).
viii
3T—9T Base = thymin-1- yl
R2 = P(OCH2CH2CN)N(i-Pr)2
3C—9C Base =N4-benzoylcytosin-1-yl
Scheme 1. Regents and conditions: i, Ac2O, AcOH, concd H2SO4,
99%; ii, thymine, N,O-bis(trimethylsilyl)acetamide, TMSOTf, MeCN,
93% for 3T; N4-benzoylcytosine, N,O-bis(trimethylsilyl)acetamide,
TMSOTf, MeCN, 76% for 3C; iii, K2CO3, MeOH, 90% for 4T;
LiOHÆH2O, THF/H2O, 84% for 4C; iv, paraformaldehyde, p-TsOHÆ-
H2O, 1,2-dichloroethane, 81% for 5T and 70% for 5C; v, TBAF, THF,
85% for 6T and 92% for 6C; vi, 20% Pd(OH)2-C, cyclohexene, EtOH,
89% for 7T; 20% Pd(OH)2-C, cyclohexene, MeOH, 71% for 7C; vii,
DMTrCl, pyridine, quant. for 8T and 88% for 8C; viii, (i-
Pr2N)2POCH2CH2CN, 4,5-dicyanoimidazole, MeCN, 94% for 9T; (i-
Pr2N)2POCH2CH2CN, 5-ethylthio-1H-tetrazole, MeCN, 81% for 9C.
Triplex-forming ability of the oligonucleotides 16–20
with dsDNA was evaluated under near physiological
conditions by UV melting experiments (Table 1). In a
triplex formation with a 21 mer dsDNA target, 16–18
containing one or three TB(COC) increased in the Tm

Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
1031
N
N
N
O
N
N
Me
O
Me
NH
TBDPSO
O
TBDPSO
N
O
i
ii
O
O
O
BnO
O
BnO
O
5T
NH2
NHBz
Me
Me
N
N
TBDPSO
R1O
N
O
N
O
O
O
O
iii
BnO
R2O
O
O
O
11 R1 = TBDPS, R2 = Bn
12 R1 = H, R2 = Bn
13 R1 = R2 = H
iv
v
10
vi
14 R1 = DMTr, R2 = H
15 R1 = DMTr,
vii
R2 = P(OCH2CH2CN)N(i-Pr)2
Scheme 2. Regents and conditions: i, 1,2,4-1H-triazole, POCl3, Et3N, MeCN; ii, 28% NH3 aq, 1,4-dioxane, 82% for 2 steps; iii, BzCl, pyridine then
28% NH3 aq, 87%; iv, TBAF, THF, 97 %; v, 20% Pd(OH)2-C, cyclohexene, THF, 68%; vi, DMTrCl, pyridine, 93%; vii, [(i-Pr)2N]2POCH2CH2CN, 5-
ethylthio-1H-tetrazole, MeCN, 95%.
Table 1. Thermal stability of the triplexes and duplexes comprising the oligonucleotides and dsDNA, ssDNA and ssRNA targetsa
Tm (DTm/modification) (ꢁC)
Oligonucleotides
dsDNA target
ssDNA target
ssRNA target
50-TCTTCTTTTTCTCT-30 (natural oligonucleotide)
50-TCTTCTTTB(COC)TTCTCT-30 (16)
50-TCTTCTTB(COC)TB(COC)TB(COC)TCTCT-30 (17)
50-TCTTCTB(COC)TTB(COC)TTB(COC)CTCT-30 (18)
50-TCTTCTB(COC)TB(COC)TB(COC)TB(COC)TB(COC)CTCT-30 (19)
38
47
50
39 (+1.0)
41 (+1.0)
42 (+1.3)
36 (ꢀ0.4)
45 (ꢀ2.0)
41 (ꢀ2.0)
40 (ꢀ2.3)
39 (ꢀ1.6)
51 (+1.0)
55 (+1.7)
56 (+2.0)
60 (+2.0)
a Conditions: for a triplex formation with a dsDNA target, 7 mM sodium phosphate buffer (pH 7.0) containing 140 mM KCl and 10 mM MgCl2; for
a duplex formation with a ssDNA or ssRNA, 10 mM sodium phosphate buffer (pH 7.2) containing 100 mM NaCl. The sequences of targets:
dsDNA, 50-d(GCTAGAAGAAAAAGAGATCG)-30/30- d(CGATCTTCTTTTTCTCTAGC)-50; ssDNA, 50-d(AGAAGAAAAAGAGA)-30;
ssRNA, 50-r(AGAAGAAAAAGAGA)-30. TB(COC) and C mean 20,40-BNACOC unit bearing thymine nucleobase and 20-deoxy-5-methylcytidine,
respectively.
values by +1.0 to +1.3 ꢁC per modification compared
with natural oligonucleotide. However, five successive
modifications in the middle of the oligonucleotide
showed no increment in the binding affinity with the
dsDNA target. On the other hand, duplex-forming abil-
ity of the oligonucleotides 16–20 with ssDNA and
ssRNA targets was also examined (Table 1). The Tm val-
ues of the duplexes comprising the oligonucleotides 16–
19 and the DNA complement were slightly lower than
that of the natural DNA/DNA duplex, while 16–19
formed stable duplexes with the RNA complement.
The increase in the Tm values per modification (DTm)
ranged from +1.0 to +2.0 ꢁC. Thus, the 20,40-BNACOC
modification stabilized the duplexes formed with the
RNA complement but destabilized the duplexes with
the DNA complement. This RNA selective hybridiza-
tion property may be due to the appropriate restriction
of the sugar conformation (P, mmax, c and d values) by
the C–O–C linkage. However, the duplex and triplex
stabilization effects by the 20,40-BNACOC modification
were less than that by the 20,40-BNA/LNA5–15 or
ENA.16–18 One major structural difference between
20,40-BNA/LNA, ENA, and 20,40-BNACOC is that the
former has a relatively larger mmax value (mmax of 20,40-
BNA9 and ENA17 are 57ꢁ and 48ꢁ, respectively), while
the latter has the mmax value similar to that of the typical
A-type duplex (mmax of 20,40-BNACOC is 37ꢁ). Although
the detail is still unclear, the combination between C30-
endo sugar puckering and larger mmax value, in other
words, the magnified N-type sugar conformation may
be suitable for acquiring high binding affinity with the
DNA and RNA complements and also with the dsDNA
target. Alternatively, an increase in the steric hindrance
of the additional linkage between the 20-oxygen and 40-
carbon atoms might negatively affect the hybridization
property. It is also noteworthy that the related nucleic

1032
Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
Optical rotations were recorded on a JASCO DIP-370
instrument. IR spectra were recorded on a JASCO FT/
1
IR-200 spectrometer. H and 13C NMR spectra were
recorded on a JEOL JNM-EX270 (1H, 270 MHz; 13C,
67.8 MHz) or JEOL JNM-EX300 (1H, 300 MHz; 13C,
75.5 MHz), and 31P NMR spectrum was recorded on a
Varian VXR-200 (31P, 86.4 MHz). MS spectra of nucle-
oside analogues were recorded on a JEOL JMS-600 or
JMS-700 MS spectrometer. For flash column, Fuji Sily-
sia FL60D or BW-300 was used. MALDI-TOF-MS
spectra were recorded on an Applied Biosystems Voey-
gerꢂ-DE.
Figure 3. Degradation of the oligonucleotides by snake venom
phosphodiesterase (SVPDE). Conditions: 50 mM TrisÆHCl buffer
(pH 8.0, 350 ll) containing 10 mM MgCl2, 5 nmol oligonucleotides
and 0.2 lg SVPDE. T8TB(COC)T (20), circle; T10, cross; T9-ps-T,
triangle, where TB(COC) and ps mean 20,40-BNACOC unit bearing
thymine nucleobase and phosphorthioate linkage, respectively.
4.1. 4-C-Acetoxymethyl-1,2-di-O-acetyl-3-O-benzyl-5-O-
tert-butyldiphenylsilyl-b-D-erythro-pentofuranose (2)
Ac2O (1 ml) and concd H2SO4 (0.1 ml) were added to a
solution of compound 1 (900 mg, 1.64 mmol) in AcOH
(4 ml) at room temperature and the mixture was stirred
at room temperature for 1 h. After addition of the reac-
tion mixture to saturated aqueous NaHCO3 solution,
the mixture was extracted with AcOEt. The organic ex-
tracts were washed with water and brine, dried over
Na2SO4, and concentrated under reduced pressure.
The residue was purified by flash silica gel column chro-
matography [hexane/AcOEt (3:1, v/v)] to give com-
pound 2 (1.03 g, 99%). Colorless oil. IR mmax (KBr):
acid analogue, PrNA, which possesses a propylene (C–
C–C) linkage instead of a C–O–C linkage (Fig. 1),
showed no significant increase in binding affinity with
the RNA complement.17 The hydration of dsDNA is
well known to be a key factor in the stabilization of
secondary and tertiary structure.27,29,30 The results
obtained here clearly indicate an importance of the
hydrophilicity of the additional bridged structure.
3059, 2943, 2865, 1749, 1461, 1371, 1230, 1107 cmꢀ1
.
Enzymatic stability of the oligonucleotide 20 containing
one TB(COC) unit against snake venom phosphodiesterase
(SVPDE) was examined. After reaction with SVPDE for
certain time periods, the amount of the intact oligonucle-
otides was evaluated by RP-HPLC analysis (Fig. 3). An
immediate degradation of the natural oligothymidylate
T10 was observed, whereas the oligonucleotide 20 showed
almost no degradation under the same conditions even
after 90 min reaction. The excellent enzymatic stability
of 20 against SVPDE, which is comparable to that of
the corresponding phosphorothioate analogue, is proba-
bly due to the steric hindrance of the C–O–C linkage sur-
rounding the O30 atom. This result clearly indicates that
the 20,40-BNACOC modified oligonucleotide is promising
for in vitro and/or in vivo use.
1H NMR (CDCl3) d 1.07 (9H, s), 1.84 (3H, s), 1.95
(3H, s), 2.10 (3H, s), 3.66, 3.88 (2H, AB, J = 11 Hz),
4.38, 4.44 (2H, AB, J = 12 Hz), 4.50 (1H, d, J = 5 Hz),
4.55, 4.61 (2H, AB, J = 11 Hz), 5.40 (1H, d, J = 5 Hz),
6.19 (1H, s), 7.23–7.45 (11H, m), 7.63–7.66 (4H, m).
13C NMR (CDCl3) d 19.3, 20.8, 20.9, 20.9, 26.8, 63.9,
65.1, 73.6, 74.2, 79.2, 85.6, 97.6, 127.3, 127.6, 127.6,
127.7, 128.2, 129.6, 129.7, 132.5, 132.8, 135.3, 135.4,
137.0, 168.6, 169.4, 170.4. MS (FAB): m/z 657
(MNa+). High-resolution MS (FAB): calcd for
C35H42N2O9SiNa (MNa+): 657.2496. Found: 657.2504.
4.2. 40-C-Acetoxymethyl-20-O-acetyl-30-O-benzyl-50-O-tert-
butyldiphenylsilyl-5-methyluridine (3T)
Under N2 atmosphere, thymine (296 mg, 2.35 mmol)
and
3. Conclusion
N,O-bis(trimethylsilyl)acetamide
(0.78 ml,
5.48 mmol) were added to a solution of compound 2
(1.00 g, 1.57 mmol) in anhydrous MeCN (10 ml) at
room temperature and the mixture was refluxed for
1 h. TMSOTf (0.14 ml, 0.78 mmol) was added to the
reaction mixture at 0 ꢁC and the mixture was refluxed
for 1 h. After addition of saturated aqueous NaHCO3
solution, the mixture was extracted with AcOEt. The
organic extracts were washed with water and brine,
dried over Na2SO4, and concentrated under reduced
pressure. The residue was purified by flash silica gel col-
umn chromatography [hexane/AcOEt (3:2, v/v)] to give
In conclusion, 20,40-BNACOC monomers bearing a
thymine, cytosine or 5-methylcytosine nucleobase were
easily synthesized, and the 20,40-BNACOC-thymine
monomer was successfully incorporated into oligonucle-
otides. The corresponding 20,40-BNACOC modified oli-
gonucleotides showed interesting features, such as high
binding affinity towards an RNA complement and excel-
lent nuclease resistance. These results show that the
20,40-BNACOC is a potential material for antisense and/
or antigene strategies. Further application of the 20,40-
BNACOC is now in progress.
compound 3T (1.07 g, 93%). White powder; mp 68–
25
D
3175, 3066, 2957, 2860, 1711, 1465, 1375, 1239,
70 ꢁC. ½aꢁ +24.3 (c 0.50, CHCl3). IR mmax (KBr):
1114 cmꢀ1 1H NMR (CDCl3) d 1.11 (9H, s), 1.63
.
4. Experimental
(3H, s), 1.93 (3H, s), 2.09 (3H, s), 3.71, 3.89 (2H, AB,
J = 11 Hz), 4.10, 4.40 (2H, AB, J = 12 Hz), 4.47, 4.59
(2H, AB, J = 11 Hz), 4.52 (1H, d, J = 6 Hz), 5.42 (1H,
All melting points were measured with a Yanagimoto
micro melting point apparatus and are uncorrected.

Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
1033
dd, J = 6, 6 Hz), 6.22 (1H, d, J = 6 Hz), 7.27–7.48 (12H,
m), 7.63–7.67 (4H, m), 9.37 (1H, s). 13C NMR (CDCl3)
d 12.1, 19.4, 20.8, 20.8, 27.1, 63.1, 65.3, 74.3, 74.8, 77.4,
86.3, 86.4, 111.6, 127.7, 127.9, 128.0, 128.4, 130.0, 130.1,
131.9, 132.4, 135.2, 135.4, 135.5, 136.9, 150.0, 163.2,
170.1, 170.2. MS (FAB): m/z 701 (MH+). Anal. Calcd
for C38H44N2O9 SiÆH2O: C, 63.49; H, 6.45; N, 3.89.
Found: C, 63.43; H, 6.16; N, 3.86.
7.30–7.44 (12H, m), 7.57–7.60 (4H, m), 10.1 (1H, br s).
13C NMR (CDCl3) d 12.0, 19.4, 27.0, 62.7, 73.5, 74.5,
77.0, 88.3, 89.7, 111.2, 127.8, 127.8, 128.4, 129.8,
129.9, 132.0, 132.6, 135.1, 135.3, 135.4, 137.1, 151.0,
163.9. MS (FAB): m/z 617 (MH+). Anal. Calcd for
3
C34H40N2O7Si ꢂ H2O: C, 64.79; H, 6.64; N, 4.44.
4
Found: C, 64.66; H, 6.48; N, 4.41.
4.5. 4-N-Benzoyl-30-O-benzyl-50-O-tert-butyldiphenylsilyl-
40-C-(hydroxymethyl)cytidine (4C)
4.3. 40-C-Acetoxymethyl-20-O-acetyl-4-N-benzoyl-30-O-ben-
zyl-50-O-tert-butyldiphenylsilylcytidine (3C)
LiOHÆH2O (1.60 g, 8.23 mmol) was added to a solution of
compound 3C (6.50 g, 8.23 mmol) in THF/H2O (1:1, v/v,
90 ml) at room temperature and the mixture was stirred at
room temperature for 2 h. The mixture was extracted with
AcOEt. The organic extracts were washed with water and
brine, dried over Na2SO4, and concentrated under re-
duced pressure. The residue was purified by recrystalliza-
Under N2 atmosphere, N4-benzoylcytosine (8.13 g,
37.8 mmol)
and
N,O-bis(trimethylsilyl)acetamide
(16.3 ml, 0.11 mol) were added to a solution of com-
pound 2 (16.0 g, 25.2 mmol) in anhydrous MeCN
(75 ml) at room temperature and the mixture was re-
fluxed for 3 h. TMSOTf (11.4 ml, 53.0 mmol) was added
to the reaction mixture at 0 ꢁC and the mixture was re-
fluxed for 9 h. After addition of saturated aqueous
NaHCO3 solution at 0 ꢁC, the mixture was extracted
with AcOEt. The organic extracts were washed with
water and brine, dried over Na2SO4, and concentrated
under reduced pressure. The residue was purified by
flash silica gel column chromatography [hexane/AcOEt
tion from AcOEt to give compound 4C (5.24 g, 84%).
25
D
Colorless crystals; mp 144–145 ꢁC (AcOEt). ½aꢁ +61.5
(c 1.02, AcOEt). IR mmax (KBr): 3265, 3069, 1700, 1651,
1561, 1485, 1388, 1314, 1256, 1116 cmꢀ1 1H NMR
.
(CDCl3) d 1.06 (9H, s), 3.57, 3.84 (2H, AB, J = 12 Hz),
3.68, 3.87 (2H, AB, J = 12 Hz), 4.36 (1H, d, J = 6 Hz),
4.38 (1H, d, J = 6 Hz), 4.42, 4.78 (2H, AB, J = 11 Hz),
4.49 (1H, br s), 5.75 (1H, br s), 6.23 (1H, s), 7.24–7.62
(19H, m), 7.96 (2H, d, J = 7 Hz), 8.25 (1H, d, J = 7 Hz),
9.46 (1H, br s). 13C NMR (CDCl3) d 19.2, 26.9, 60.3,
61.4, 63.8, 71.9, 74.8, 75.1, 90.3, 93.8, 97.0, 127.1, 127.5,
127.7, 127.8, 128.1, 128.6, 129.9, 131.8, 132.2, 132.8,
135.1, 135.3, 137.2, 143.9, 155.9, 162.4, 166.5. MS
(3:2, v/v)] to give compound 3C (15.1 g, 76%). White
24
D
powder; mp 113–115 ꢁC. ½aꢁ +57.5 (c 1.03, CHCl3).
IR mmax (KBr): 3069, 1744, 1671, 1555, 1484, 1370,
1
1311, 1242, 1109 cmꢀ1. H NMR (CDCl3) d 1.12 (9H,
s), 1.94 (3H, s), 2.12 (3H, s), 3.78, 4.04 (2H, AB,
J = 11 Hz), 4.12, 4.53 (2H, AB, J = 13 Hz), 4.40, 4.61
(2H, AB, J = 11 Hz), 4.54 (1H, d, J = 6 Hz), 5.53 (1H,
(FAB): m/z 706 (MH+). Anal. Calcd for C40H43
1
dd, J = 5, 6 Hz), 6.26 (1H, d, J = 5 Hz), 7.21–7.53
(14H, m), 7.58–7.67 (5H, m), 7.89 (2H, d, J = 7 Hz),
8.13 (1H, d, J = 7 Hz), 8.67 (1H, br s). 13C NMR
(CDCl3) d 19.2, 20.7, 20.7, 27.0, 63.1, 64.1, 74.2, 74.9,
76.7, 86.8, 89.0, 96.9, 127.5, 127.8, 127.8, 128.2, 128.7,
130.0, 130.0, 131.8, 132.1, 132.9, 135.2, 135.4, 136.8,
144.3, 154.2, 162.2, 166.6, 169.5, 170.1. MS (FAB): m/
z 790 (MH+). Anal. Calcd for C44H47N3O9Si: C,
66.90; H, 6.00; N, 5.32. Found: C, 66.52; H, 6.06; N,
5.33.
N3O7Si ꢂ H2O: C, 67.72; H, 6.17; N, 5.92. Found: C,
67.55; H,56.20; N, 5.88.
4.6. 30-O-Benzyl-50-O-tert-butyldiphenylsily-5-methyl-20-
O,40-C-(methylenoxymethylene)uridine (5T)
Under N2 atmosphere, paraformaldehyde (1.20 g) and
TsOHÆH2O (180 mg, 0.94 mmol) were added to a solu-
tion of compound 4T (360 mg, 0.52 mmol) in anhydrous
1,2-dichloroethane (30 ml) at room temperature and the
mixture was reflued for 3 h. After addition of saturated
aqueous NaHCO3 solution, the mixture was extracted
with AcOEt. The organic extracts were washed with
water and brine, dried over Na2SO4, and concentrated
under reduced pressure. The residue was purified by
flash silica gel column chromatography [hexane/AcOEt
4.4. 30-O-Benzyl-50-O-tert-butyldiphenylsilyl-40-C-hydroxy-
methyl-5-methyluridine (4T)
K2CO3 (355 mg, 2.56 mmol) was added to a solution of
compound 3T (360 mg, 0.52 mmol) in MeOH (10 ml) at
room temperature and the mixture was stirred at room
temperature for 4 h. After being neutralized by diluted
aqueous HCl solution, the mixture was extracted with
AcOEt. The organic extracts were washed with water
and brine, dried over Na2SO4, and concentrated under
reduced pressure. The residue was purified by flash silica
gel column chromatography [hexane/AcOEt (2:1, v/v)]
(3:1, v/v)] to give compound 5T (664 mg, 81%). White
23
D
powder; mp 59–62 ꢁC. ½aꢁ +42.7 (c 0.34, CHCl3). IR
mmax (KBr): 3189, 3067, 2933, 2860, 1691, 1466, 1270,
1177, 1120 cmꢀ1 1H NMR (CDCl3) d :1.09 (9H, s),
.
1.57 (3H, s), 3.67, 3.80 (2H, AB, J = 12 Hz), 3.74, 3.92
(2H, AB, J = 12 Hz), 4.57 (1H, d, J = 6Hz), 4.59, 4.83
(2H, AB, J = 11 Hz), 4.61 (1H, d, J = 6 Hz), 5.25, 5.33
(2H, AB, J = 6 Hz), 6.22 (1H, s), 7.28–7.43 (12H, m),
7.59–7.67 (4H, m), 9.78 (1H, br s). 13C NMR (CDCl3)
d 12.0, 19.3, 26.9, 62.2, 71.4, 72.5. 75.2, 76.3, 88.7,
93.1, 95.8, 110.2, 127.6, 127.7, 127.9, 128.3, 129.8,
129.8, 131.9, 132.5, 135.0, 135.1, 135.4, 136.6, 149.9,
164.0. MS (FAB): m/z 629 (MH+). Anal. Calcd for
to give compound 4T (288 mg, 90%). White powder;
22
D
mp 63–65 ꢁC. ½aꢁ +43.2 (c 1.01, MeOH). IR mmax
(KBr): 3174, 3069, 2937, 2860, 1701, 1468, 1260,
1119 cmꢀ1.1H NMR (CDCl3) d 1.06 (9H, s), 1.50 (3H,
s), 3,42 (1H, br s), 3.55, 3.77 (2H, AB, J = 12 Hz),
3.64, 3.80 (2H, AB, J = 11 Hz), 4.31 (1H, d, J = 6 Hz),
4.38 (1H, dd, J = 5,6 Hz), 4.52, 4.87 (2H, AB,
J = 12 Hz), 4.96 (1H, br d), 6.14 (1H, d, J = 5 Hz),
3
C35H40N2O7Si ꢂ H2O: C, 65.45; H, 6.51; N, 4.36.
4
Found: C, 65.27; H, 6.35; N, 4.22.

1034
Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
4.7. 4-N-Benzoyl-30-O-benzyl-50-O-tert-butyldiphenylsily-
20-O,40-C-(methylenoxymethylene)cytidine (5C)
vent under reduced pressure, the residue was purified by
flash silica gel column chromatography [hexane/AcOEt
(1:3, v/v)] to give compound 6C (1.45 g, 92%). White
24
D
Under N2 atmosphere, TsOHÆH2O (130 mg, 0.68 mmol)
was added to a solution of compound 4C (324 mg,
0.46 mmol) in anhydrous 1,2-dichloroethane (30 ml) at
room temperature and paraformaldehyde (41 mg) was
added at 60 ꢁC. The mixture was stirred at 60 ꢁC for
1.5 h. After addition of saturated aqueous NaHCO3
solution at 0 ꢁC, the mixture was extracted with AcOEt.
The organic extracts were washed with water and brine,
dried over Na2SO4, and concentrated under reduced
pressure. The residue was purified by flash silica gel col-
umn chromatography [hexane/AcOEt (2:3, v/v)] to give
powder; mp 242–243ꢁC. ½aꢁ +116.7 (c 1.06, THF). IR
mmax (KBr): 3247, 1658, 1558, 1493, 1362, 1306, 1265,
1
1178, 1124 cmꢀ1. H NMR (CDCl3) d 3.23 (1H, br s),
3.72, 3.80 (2H, AB, J = 12 Hz), 3.72, 3.90 (2H, AB,
J = 12 Hz), 4.50 (1H, d, J = 6 Hz), 4.55 (1H, d,
J = 6 Hz), 4.57, 4.77 (2H, AB, J = 11 Hz), 5.22, 5.36
(2H, AB, J = 6 Hz), 6.17 (1H, s), 7.31–7.59 (9H, m),
7.80 (2H, d, J = 8 Hz), 8.36 (1H, d, J = 7 Hz), 8.93
(1H, br s). 13C NMR (DMSO-d6) d 59.1, 70.5, 71.8,
74.5, 76.0, 89.0, 91.9, 94.6, 95.6, 127.3, 127.6, 128.2,
128.3, 132.6, 133.0, 137.6, 144.2, 154.1, 162.9, 167.1.
MS (FAB): m/z 480 (MH+). Anal. Calcd for
compound 5C (230 mg, 70%). White powder; mp 210–
25
D
3
212 ꢁC. ½aꢁ +85.2 (c 0.99, THF). IR mmax (KBr): 3069,
C25H25N3O7 ꢂ H2O: C, 59.28; H, 5.57; N, 8.29. Found:
2
C, 59.43; H, 5.34; N, 8.31.
1667, 1556, 1484, 1363, 1301, 1262, 1179, 1126 cmꢀ1
.
1H NMR (CDCl3) d 1.05 (9H, s), 3.56, 3.63 (2H, AB,
J = 12 Hz), 3.64, 3.86 (2H, AB, J = 12 Hz), 4.38 (1H,
d, J = 6 Hz), 4.45, 4.73 (2H, AB, J = 11 Hz), 4.48 (1H,
d, J = 6 Hz), 5.19, 5.22 (2H, AB, J = 6 Hz), 6.21 (1H,
s), 7.15–7.59 (19H, m), 7.81 (2H, d, J = 7 Hz), 8.33
(1H, d, J = 7 Hz), 8.63 (1H, br s). 13C NMR (CDCl3)
d 19.3, 26.9, 61.7, 71.0, 72.5, 74.3, 76.4, 89.5, 93.2,
95.8, 96.1, 127.5, 127.8, 128.0, 128.1, 128.2, 128.6,
129.0, 130.2, 130.2, 131.8, 132.2, 133.1, 135.3, 135.5,
136.7, 143.9, 154.8, 162.2, 166.3. MS (FAB): m/z 718
4.10. 5-Methyl-20-O,40-C-(methylenoxymethylene) uridine
(7T)
Under N2 atmosphere 20% Pd(OH)2-C (25 mg) and
cyclohexene (0.38 ml) were added to a solution of com-
pound 6T (36 mg,75 lmol) in EtOH (2 ml) at room tem-
perature and the mixture was refluxed for 3 h. The
mixture was filtered, and after addition of SiO2 (0.2 g)
to the filtrate, the mixture was concentrated under re-
duced pressure. The residue was purified by flash silica
gel column chromatography [CHCl3/MeOH (12:1, v/v)]
+
3
(MH ). Anal. Calcd for C41H43N3O7Si ꢂ H2O: C,
4
67.33; H, 6.13; N, 5.75. Found: C, 67.43; H, 5.95; N,
5.72.
to give compound 7T (25 mg, 89%). Colorless crystals;
24
D
mp 294–295 ꢁC (MeOH). ½aꢁ +48.4 (c 0.56, MeOH).
4.8. 30-O-Benzyl-5-methyl-20-O,40-C-(methyleneoxymethyl-
IR mmax (KBr): 3525, 3366, 3187, 1691, 1275, 1186,
ene)uridine (6T)
1097 cmꢀ1 1H NMR (CD3OD)
. d 1.86 (3H, d,
J = 1 Hz), 3.65, 3.71 (2H, AB, J = 12 Hz), 3.70 (2H, s),
4.18 (1H, d, J = 6 Hz), 4.49 (1H, d, J = 6 Hz), 5.07,
5.32 (2H, AB, J = 6 Hz), 6.05 (1H, s), 7.99 (1H, q,
J = 1 Hz). 13C NMR (DMSO-d6) d 12.4, 59.3, 67.6,
70.4, 78.6, 88.7, 90.4, 94.6, 108.4, 135.5, 150.0, 163.7.
MS (FAB): m/z 301 (MH+). Anal. Calcd for
C12H16O7N2: C, 48.00; H, 5.37; N, 9.33. Found: C,
47.61; H, 5.39; N, 9.09.
Under N2 atmosphere, TBAF (1 M solution in THF,
4.0 ml, 4.00 mmol) was added to a solution of com-
pound 5T (2.20 g, 3.50 mmol) in anhydrous THF
(50 ml) at room temperature and the mixture was stirred
at room temperature for 4 h. After removal of the sol-
vent under reduced pressure, the residue was purified
by flash silica gel column chromatography [CHCl3/
MeOH (20:1, v/v)] to give compound 6T (1.16 g, 85%).
22
D
White powder; mp 103–105 ꢁC. ½aꢁ +57.5 (c 1.05,
4.11. 4-N-Benzoyl-20-O,40C-(methylenoxymethylene)cyti-
MeOH). IR mmax (KBr): 3167, 3073, 1715, 1470, 1274,
dine (7C)
1179, 1127 cmꢀ1 1H NMR (CDCl3) d :1.86 (3H, s),
.
2.99 (1H, br s), 3.65–3.81 (4H, m), 4.55 (1H, d,
J = 6 Hz), 4.63, 4.77 (2H, AB, J = 10 Hz), 4.68 (1H, d,
J = 6 Hz), 5.19, 5.36 (2H, AB, J = 6 Hz), 6.02 (1H, s),
7.31–7.39 (6H, m), 9.54 (1H, br s). 13C NMR (CDCl3)
d 12.3, 60.9, 71.5, 72.8, 75.4, 76.4, 88.7, 95.2, 95.9,
110.5, 127.8, 128.5, 137.1, 137.9, 150.2, 164.2. MS
(FAB): m/z 391 (MH+). Anal. Calcd for
Under N2 atmosphere 20% Pd(OH)2-C (50 mg) and
cyclohexene (2 ml) were added to a solution of com-
pound 6C (50 mg, 0.10 mmol) in MeOH (20 ml) at room
temperature and the mixture was refluxed for 1 h. After
filtration of the reaction mixture, 20% Pd(OH)2-C
(50 mg) was added to the filtrate and the mixture was
further refluxed for 1 h. The mixture was filtered and
after addition of SiO2 (0.2 g) to the filtrate, the mixture
was concentrated under reduced pressure. The residue
was purified by flash silica gel column chromatography
1
C19H22N2O7 ꢂ H2O: C, 57.14; H, 5.80; N, 7.01. Found:
2
C, 57.25; H, 5.77; N, 7.01.
4.9. 4-N-Benzoyl-30-O-benzyl-20-O,40-C-(methyleneoxym-
[CHCl3/MeOH (15:1, v/v)] to give compound 7C
23
D
ethylene)cytidine (6C)
(29 mg, 71%). White powder; mp 244–246 ꢁC. ½aꢁ
+90.3 (c 1.00, DMSO). IR mmax (KBr): 3376, 3157,
Under N2 atmosphere, TBAF (1 M solution in THF,
5.0 ml, 5.00 mmol) was added to a solution of com-
pound 5C (2.37 g, 3.30 mmol) in anhydrous THF
(50 ml) at room temperature and the mixture was stirred
at room temperature for 18 h. After removal of the sol-
1712, 1653, 1485, 1246, 1123, 1094 cmꢀ1 1H NMR
.
(C5D5N) d 4.03, 4.10 (2H, AB, J = 12 Hz), 4.13, 4.21
(2H, AB, J = 12 Hz), 4.90 (1H, d, J = 6 Hz), 5.29 (1H,
d, J = 6 Hz), 5.47, 5.85 (2H, AB, J = 6 Hz), 6.87 (1H,
s), 7.42–7.67 (4H, m), 8.18 (2H, d, J = 7 Hz), 8.35 (1H,

Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
1035
br s), 9.11 (1H, d, J = 8 Hz), 12.19 (1H, br s). 13C NMR
(C5D5N) d 60.2, 68.4, 71.6, 80.6, 90.8, 93.3, 95.8, 96.4,
128.8, 128.9, 132.6, 135.3, 144.6, 155.3, 163.7, 169.0.
MS (FAB): m/z 390 (MH+). Anal. Calcd for
168.1. MS (FAB): m/z 692 (MH+). Anal. Calcd for
1
C39H37N3O9 ꢂ H2O: C, 66.85; H, 5.47; N, 6.00. Found:
2
C, 66.45; H, 5.53; N, 5.96.
1
C18H19N3O7 ꢂ H2O: C, 55.02; H, 4.98; N, 10.69. Found:
4.14. 30-O-[2-Cyanoethoxy(diisopropylamino)phosphino]-50-
O-(4,40-dimethoxytrityl)-5-methyl-20-O,40-C-(methylenoxy-
methylene)uridine (9T)
5
C, 55.01; H, 4.97; N, 10.40.
4.12. 50-O-(4,40-Dimethoxytrityl)-5-methyl-20-O,40-C-(methy-
lenoxymethylene)uridine (8T)
Under N2 atmosphere, (i-Pr2N)2POCH2CH2CN
(0.33 ml, 1.04 mmol) was added to a solution of com-
pound 8T (250 mg, 0.42 mmol), 4,5-dicyanoimidazole
(98 mg, 0.83 mmol) in anhydrous MeCN (20 ml) at room
temperature and the mixture was stirred at room temper-
ature for 2 h. Then, (i-Pr2N)2POCH2CH2CN (0.33 ml,
1.04 mmol) was added and the mixture was further stirred
for 10 h. After addition of saturated aqueous NaHCO3
solution, the mixture was extracted with AcOEt. The
organic extracts were washed with water and brine, dried
over Na2SO4, and concentrated under reduced pressure.
The residue was purified by flash silica gel column chro-
matography [hexane/AcOEt (1:1, v/v)] and by the repre-
cipitation from hexane/AcOEt to give compound 9T
(328 mg, 94%). White powder; mp 81–87 ꢁC. 31P NMR
(acetone-d6) d 150.7, 151.1. MS (FAB): m/z 803 (MH+).
High-resolution MS (FAB): calcd for C42H52N4O10P
(MH+): 803.3421. Found: 803.3394.
Under N2 atmosphere, DMTrCl (266 mg, 0.79 mmol)
was added to a solution of compound 7T (157 mg,
0.52 mmol) in anhydrous pyridine (3 ml) at room tem-
perature and the mixture was stirred at room tempera-
ture for 3 h. After addition of saturated aqueous
solution of sodium hydrogen carbonate, the mixture
was extracted with ethyl acetate. The organic extracts
were washed with water and brine, dried over sodium
sulfate, and concentrated under reduced pressure. The
residue was purified by flash silica gel column chroma-
tography [CHCl3/MeOH (50:1, v/v)] to give compound
8T (315 mg, quant). White powder; mp 189–194 ꢁC.
24
½aꢁ ꢀ16.4 (c 0.72, CHCl3). IR mmax (KBr): 3388, 1692,
D
1
1508, 1253, 1178, 1073 cmꢀ1. H NMR (acetone-d6) d
1.41 (3H, d, J = 1 Hz), 3.33, 3.40 (2H, AB, J =11 Hz),
3.68, 3.85 (2H, AB, J = 12 Hz), 3.79 (6H, s), 4.34 (1H,
d, J = 6 Hz), 4.91 (1H, dd, J = 6, 6 Hz), 5.07, 5.30
(2H, AB, J = 6 Hz), 5.32 (1H, d, J = 6 Hz), 6.15 (1H,
s), 6.89 (4H, d, J = 8 Hz), 7.22–7.39 (7H, m), 7.50
(2H, d, J = 10 Hz), 7.61 (1H, s), 10.04 (1H, s). 13C
NMR (acetone-d6) d 12.2, 55.5, 63.4, 70.8, 72.2, 80.0,
87.3, 89.3, 92.7, 96.0, 110.2, 114.0, 127.7, 128.7, 129.0,
131.0, 136.2, 136.2, 136.4, 145.8, 151.0, 159.7, 164.3.
MS (FAB): m/z 625 [MNa+]. Anal. Calcd for
4.15. 4-N-Benzoyl-30-O-[2-cyanoethoxy(diisopropylami-
no)phosphino]-50-O-(4,40-dimethoxytrityl)-20-O,40-C-(methy-
lenoxymethylene)cytidine (9C)
Under N2 atmosphere, (i-Pr2N)2POCH2CH2CN
(0.28 ml, 0.87 mmol) was added to a solution of com-
pound 8C (304 mg, 0.43 mmol), 5-ethylthio-1H-tetrazole
(86 mg, 0.66 mmol) in anhydrous MeCN (20 ml) at
room temperature and the mixture was stirred at room
temperature for 20 h. Then, (i-Pr2N)2POCH2CH2CN
(0.14 ml, 0.43 mmol) was added and the mixture was
further stirred for 6 h. After addition of saturated aque-
ous NaHCO3 solution, the mixture was extracted with
AcOEt. The organic extracts were washed with water
and brine, dried over Na2SO4, and concentrated under
reduced pressure. The residue was purified by flash silica
gel column chromatography [hexane/AcOEt (1:2, v/v)]
and by the reprecipitation from hexane/AcOEt to give
compound 9C (319 mg, 81%). White powder; mp 97–
101 ꢁC. 31P NMR (acetone-d6) d 151.58, 151.65. MS
(FAB): m/z 892 (MH+). High-resolution MS (FAB):
calcd for C48H55N5O10P (MH+): 892.3687. Found:
892.3688.
1
C33H34N2O9 ꢂ H2O: C, 64.80; H, 5.77; N, 4.58. Found:
2
C, 64.75; H, 5.77; N, 4.63.
4.13. 4-N-Benzoyl-50-O-(4,40-dimethoxytrityl)-20-O,40-C-
(methylenoxymethylene)cytidine (8C)
Under N2 atmosphere, DMTrCl (79 mg, 0.23 mmol) was
added to a solution of compound 7C (70 mg, 0.18 mmol)
in anhydrous pyridine (3 ml) at room temperature and
the mixture was stirred at room temperature for 5 h. After
addition of saturated aqueous NaHCO3 solution, the
mixture was extracted with AcOEt. The organic extracts
were washed with water and brine, dried over Na2SO4,
and concentrated under reduced pressure. The residue
was purified by flash silica gel column chromatography
[CHCl3/MeOH (20:1, v/v)] to give compound 8C
24
D
(110 mg, 88%). White powder; mp 155–161 ꢁC. ½aꢁ
+37.8 (c 1.03, MeOH). IR mmax (KBr): 3269, 1653, 1611,
1556, 1483, 1302, 1254, 1179, 1119 cmꢀ1. 1H NMR (ace-
tone-d6) d 3.38, 3.49 (2H, AB, J = 11 Hz), 3.71, 3.80
(2H, AB, J = 12 Hz), 3.82 (6H, s), 4.35 (1H, d,
J = 6 Hz), 4.87 (1H, br d, J = 6 Hz), 5.08, 5.31 (2H, AB,
J = 6 Hz), 5.25 (1H, br s). 6.12 (1H, s), 6.92 (4H, d,
J = 9 Hz), 7.15 (1H, br s), 7.25–7.41 (7H, m), 7.49–7.68
(5H, m), 8.15 (2H, d, J = 7 Hz), 8.44 (1H, d, J = 8 Hz),
9.72 (1H, br s). 13C NMR (acetone-d6) d 55.4, 55.5, 63.0,
70.1, 72.0, 79.9, 87.7, 89.7, 93.2, 95.6, 96.7, 114.0, 127.8,
128.8, 129.0, 129.1, 129.4, 130.9, 131.0, 133.5, 134.5,
136.2, 136.4, 145.1, 145.3, 155.0, 159.7, 159.7, 163.6,
4.16. 30-O-Benzyl-50-O-tert-butyldiphenylsily-5-methyl-
20-O,40-C-(methylenoxymethylene)cytidine (10)
Under N2 atmosphere, POCl3 (1.09 g, 7.15 mmol) was
added dropwise to a suspension of 1,2,4-1H-triazole
(1.98 g, 28.6 mmol) in anhydrous MeCN (20 ml) at
0 ꢁC and the mixture was vigorously stirred at 0 ꢁC for
10 min. Et3N (2.89 g, 26.6 mmol) was added dropwise
to the mixture and the mixture was further stirred at
0 ꢁC for 35 min. Then, a solution of compound 5T
(300 mg, 0.48 mmol) in anhydrous MeCN (10 ml) was
added dropwise and the mixture was stirred at room

1036
Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
temperature for 5.5 h. After addition of saturated aque-
ous NaHCO3 solution, the mixture was extracted with
AcOEt. The organic extracts were washed with water
and brine, dried over Na2SO4, and concentrated under
reduced pressure. To the residue 28% aq NH3/1,4-diox-
ane (1:6, v/v, 11 ml) was added and the mixture was stir-
red at room temperature for 2 h. After removal of the
solvent under reduced pressure, the residue was purified
by flash silica gel column chromatography [AcOEt/
MeOH (10:1, v/v)] and by the reprecipitation from hex-
(20 ml) at room temperature and the mixture was stirred
at room temperature for 10 h. After removal of the sol-
vent under reduced pressure, the residue was purified by
flash silica gel column chromatography [CHCl3/MeOH
(60:1, v/v)] to give compound 12 (631 mg, 97%). White
23
D
powder; mp 255–257 ꢁC. ½aꢁ +159.0 (c 1.00, DMSO).
IR mmax (KBr): 3399, 3083, 1677, 1641, 1566, 1320,
1278, 1174, 1122 cmꢀ1 1H NMR (DMSO-d6) d 2.02
.
(3H,s), 3.58, 3.70 (2H, AB, J = 12 Hz), 3.59, 3.70 (2H,
AB, J = 12 Hz), 4.42 (1H, d, J = 5 Hz), 4.61 (1H, d,
J = 5 Hz), 4.64, 4.71 (2H, AB, J = 12 Hz), 5.11, 5.20
(2H, AB, J = 6 Hz), 5.67 (1H, br s), 5.97 (1H, s), 7.28–
7.36 (5H, m), 7.47–7.62 (3H, m), 8.18 (2H, d,
J = 8 Hz), 8.27 (1H, s), 12.90 (1H, br s). 13C NMR
(DMSO-d6) d 13.2, 58.7, 70.3, 71.6, 74.3, 75.6, 88.8,
91.3, 94.4, 108.6, 127.1, 127.4, 128.0, 128.1, 128.9,
132.2, 136.1, 137.4, 138.8, 147.9, 159.9, 176.2. MS
(FAB): m/z 494 (MH+). Anal. Calcd for
ane/AcOEt to give compound 10 (246 mg, 82%). White
23
D
powder; mp 63–66 ꢁC. ½aꢁ +58.1 (c 1.00, CHCl3). IR
mmax (KBr): 3072, 1658, 1602, 1483, 1178, 1121,
1080 cmꢀ1 1H NMR (CDCl3) d 1.09 (9H, s), 1.50
.
(3H,s), 3.67, 3.76 (2H, AB, J = 12 Hz), 3.76, 3.97 (2H,
AB, J = 11 Hz), 4.46 (1H, d, J = 6 Hz), 4.52, 4.80 (2H,
AB, J = 11 Hz), 4.56 (1H, d, J = 6 Hz), 5.26, 5.32 (2H,
AB, J = 6 Hz), 6.22 (1H, s), 7.27–7.47 (10H, m), 7.59–
7.68 (5H, m), 8.17 (1H, s). 13C NMR (CDCl3) d 12.7,
19.5, 27.1, 62.2, 71.3, 72.4, 74.8, 76.7, 89.0, 93.2, 95.8,
101.9, 127.7, 127.9, 127.9, 128.1, 128.4, 129.9, 130.0,
132.0, 132.8, 135.0, 135.2, 136.7, 137.1, 155.9, 165.8.
MS (FAB): m/z 628 (MH+). High-resolution MS
(FAB): calcd for C35H42N3O6Si (MH+): 628.2843.
Found: 628.2861.
1
C26H27O7N3 ꢂ H2O: C, 62.82; H, 5.56; N, 8.45. Found:
5
C, 62.86; H, 5.56; N, 8.44.
4.19. 4-N-Benzoyl-5-methyl-20-O,40-C-(methylenoxymethyl-
ene)cytidine (13)
Under N2 atmosphere 20% Pd(OH)2-C (800 mg) and
cyclohexene (4 ml) were added to a solution of com-
pound 12 (216 mg, 0.44 mmol) in anhydrous THF
(20 ml) at room temperature and the mixture was re-
fluxed for 4 h. After filtration of the mixture, the filtrate
was concentrated under reduced pressure. The residue
was purified by flash silica gel column chromatography
4.17. 4-N-Benzoyl-30-O-benzyl-50-O-tert-butyldiphenylsily-
5-methyl-20-O,40-C-(methylenoxymethylene)cytidine (11)
Under N2 atmosphere, BzCl (1.59 g, 11.3 mmol) was
added to a solution of compound 10 (2.37 g, 3.77 mmol)
in anhydrous pyridine (20 ml) at room temperature and
the mixture was stirred at room temperature for 3.5 h.
After addition of aq NH3, the mixture was further stir-
red at room temperature for 1 h. After removal of the
solvent under reduced pressure, the mixture was extract-
ed with AcOEt. The organic extracts were washed with
water and brine, dried over Na2SO4, and concentrated
under reduced pressure. The residue was purified by
flash silica gel column chromatography [hexane/AcOEt
[CHCl3/THF (8:1, v/v)] to give compound 13 (121 mg,
23
D
68%). Colorless crystals; mp 204–206 ꢁC. ½aꢁ +87.9 (c
0.64, DMSO). IR mmax (KBr): 3426, 3072, 1678, 1572,
1273, 1119 cmꢀ1 1H NMR (C5D5N) d 1.93 (3H, s),
.
3.98, 4.07 (2H, AB, J = 12 Hz), 4.09, 4.18 (2H, ABX,
J = 4, 12 Hz), 4.86 (1H, dd, J = 5, 6 Hz), 5.29 (1H, br
s), 5.44, 5.82 (2H, AB, J = 6 Hz), 6.69 (1H, d,
J = 3 Hz), 7.43–7.61 (4H, m), 8.46 (1H, br s), 8.55
(2H, dd, J = 1, 8 Hz), 8.66 (1H, s), 13.6 (1H, br s). 13C
NMR (C5D5N) d 13.5, 59.9, 68.2, 71.5, 80.3, 90.8,
92.8, 95.8, 110.1, 128.5, 130.3, 132.6, 138.1, 138.9,
148.2, 160.4, 179.1. MS (FAB): m/z 404 (MH+). Anal.
(3:1, v/v)] to give compound 11 (2.40 g, 87%). White
21
D
powder; mp 56–58 ꢁC. ½aꢁ +101.4 (c 1.09, CHCl3). IR
mmax (KBr): 3069, 1700, 1647, 1571, 1329, 1270, 1174,
1129 cmꢀ1
.
1H NMR (CDCl3) d 1.11 (9H, s), 1.69
Calcd for C19H21N3O7 ꢂ H2O: C, 56.07; H, 5.30; N,
1
5
10.32. Found: C, 56.01; H, 5.27; N, 10.11.
(3H, s), 3.67, 3.78 (2H, AB, J = 12 Hz), 3.76, 3.96 (2H,
AB, J = 12 Hz), 4.53 (1H, d, J = 6 Hz), 4.57 (1H, d,
J = 6 Hz), 4.58, 4.83 (2H, AB, J = 11 Hz), 5.25, 5.33
(2H, AB, J = 6 Hz), 6.23 (1H, s), 7.30–7.48 (14H, m),
7.60–7.68 (5H, m), 8.27–8.30 (2H, m). 13C NMR
(CDCl3) d 13.1, 19.5, 27.0, 62.0, 71.3, 72.5, 74.9, 76.4,
89.2, 93.3, 95.9, 111.2, 127.7, 127.8, 127.8, 127.9,
128.1, 128.4, 129.6, 129.9, 130.0, 131.9, 132.2, 132.6,
135.0, 135.2, 136.3, 136.5, 136.9, 147.4, 159.6, 179.0.
MS (FAB): m/z 732 (MH+). Anal. Calcd for
C42H45N3O7Si: C, 68.92; H, 6.20; N, 5.74. Found: C,
68.72; H, 6.46; N, 5.54.
4.20. 4-N-Benzoyl-50-O-(4,40-dimethoxytrityl)-5-methyl-
20-O,40-C-(methylenoxymethylene)cytidine (14)
Under N2 atmosphere, DMTrCl (55 mg, 0.16 mmol) was
added to a solution of compound 13 (50 mg, 0.12 mmol)
in anhydrous pyridine (3 ml) at room temperature and
the mixture was stirred at room temperature for 12 h.
After addition of saturated aqueous NaHCO3 solution,
the mixture was extracted with AcOEt. The organic ex-
tracts were washed with water and brine, dried over
Na2SO4, and concentrated under reduced pressure. The
residue was purified by flash silica gel column chromatog-
4.18. 4-N-Benzoyl-30-O-benzyl-5-methyl-20-O,40-C-(methyl-
eneoxymethylene)cytidine (12)
raphy [CHCl3/MeOH (50:1, v/v)] to give compound 14
(81 mg, 93%). White powder; mp 123–126 ꢁC. ½aꢁ
20
D
Under N2 atmosphere, TBAF (1 M solution in THF,
1.9 ml, 1.90 mmol) was added to a solution of com-
pound 11 (1.00 g, 1.37 mmol) in anhydrous THF
+19.0 (c 1.04, CHCl3). IR mmax (KBr): 3267, 3067, 1700,
1
1642, 1566, 1254, 1177, 1120 cmꢀ1. H NMR (acetone-
d6) d 1.62 (3H, d, J = 1 Hz), 3.38, 3.46 (2H, AB,

Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
1037
J = 11 Hz), 3.71, 3.85 (2H, AB, J = 12 Hz), 3.79 (6H, s),
4.45 (1H, d, J = 6 Hz), 4.96 (1H, dd, J = 5, 6 Hz), 5.09,
5.31 (2H, AB, J = 6 Hz), 5.41 (1H, d, J = 5 Hz), 6.16
(1H, s), 6.89–6.93 (4H, m), 7.23–7.55 (12H, m), 7.95
(1H, d, J = 1 Hz), 8.26–8.30 (2H, m), 8.56 (1H, br s).
13C NMR (C5D5N) d 13.2, 55.5, 63.1, 70.4, 72.0, 79.7,
87.5, 89.8, 93.2, 96.0, 111.0, 114.0, 127.8, 127.8, 128.9,
129.0, 130.5, 131.1, 133.1, 136.1, 136.3, 138.3, 138.7,
145.7, 148.3, 150.6, 159.7, 159.7, 161.5, 179.9. MS
(FAB): m/z 706 (MH+). Anal. Calcd for C40H39N3O9ꢂ
12 H2O: C, 67.22; H, 5.64; N, 5.89. Found: C, 67.20; H,
5.58; N, 5.79.
cal path length. The UV melting profiles were recorded
in 7 mM sodium phosphate buffer (pH 7.0) containing
140 mM KCl and 10 mM MgCl2 for triplexes and in
10 mM sodium phosphate buffer (pH 7.2) containing
100 mM NaCl for duplexes at a scan rate of 0.5 ꢁC/
min with detection at 260 nm. The final concentration
of each oligonucleotide was 1.5 lM for triplexes and
4 lM for duplexes. The melting temperatures were ob-
tained as the maxima of the first derivative of the melt-
ing curves.
4.24. Degradation of oligonucleotides by SVPDE
4.21. 4-N-Benzoyl-30-O-[2-cyanoethoxy(diisopropyl-
amino)phosphino]-50-O-(4,40-dimethoxytrityl)-5-methyl-20-
O,40-C-(methylenoxymethylene)cytidine (15)
SVPDE (0.2 lg) was added to a solution of an oligonu-
cleotide (5 nmol) in 50 mM TrisÆHCl buffer (pH 8.0,
350 ll) containing 10 mM MgCl2. The reaction was car-
ried out at 37 ꢁC. After certain periods of time (7, 10, 20,
40, and 90 min) passed, part of the mixture was heated
to 90 ꢁC for 2 min because of inactivation of SVPDE.
The amount of the intact oligonucleotides was evaluated
by reversed-phase HPLC (Wako Wakopakꢂ WS-DNA,
4.6 mm · 250 mm) analysis.
Under N2 atmosphere, (i-Pr2N)2POCH2CH2CN (45 ll,
0.14 mmol) was added to a solution of compound
14 (50 mg, 71 ll), 5-ethylthio-1H-tetrazole (14 mg,
0.11 mmol) in anhydrous MeCN (10 ml) at room tem-
perature and the mixture was stirred at room tempera-
ture for 6 h. Then, (i-Pr2N)2POCH2CH2CN (23 ll,
71 lmol) was added and the mixture was further stirred
for 6 h. After addition of saturated aqueous NaHCO3
solution, the mixture was extracted with AcOEt. The
organic extracts were washed with water and brine,
dried over Na2SO4, and concentrated under reduced
pressure. The residue was purified by flash silica gel col-
umn chromatography [hexane/AcOEt (3:1, v/v)] and by
the reprecipitation from hexane/AcOEt to give com-
pound 15 (61 mg, 95%). White powder; mp 65–68 ꢁC.
31P NMR (acetone-d6) d 149.5, 150.9. MS (FAB): m/z
906 (MH+). High-resolution MS (FAB): calcd for
C49H57N5O10P (MH+): 906.3843. Found: 906.3844.
Acknowledgments
Part of this work was supported by Industrial Technol-
0
ogy Research Grant Program in 00 from New Energy
and Industrial Technology Development Organization
(NEDO) of Japan, PRESTO from Japan Science
and Technology Agency (JST), a Grant-in-Aid from
Japan Society for the Promotion of Science, and a
Grant-in-Aid from the Ministry of Education, Science,
and Culture, Japan.
References and notes
4.22. Synthesis of oligonucleotides 16–20
1. Stein, C. A.; Krieg, A. M. Applied Antisense Oligonucleo-
tide Technology; Wiley-Liss: NewYork, 1998.
2. Schlingensiepen, R.; Brysch, W.; Schingensiepen, K. H.
Antisense- from Technology to Therapy; Black Sciences
Ltd.: Berlin, 1997.
3. Malvy, C.; Hael-Bellan, A.; Pritchard, L. L. Triple Helix
Forming Oligonucleotides; Kluwer Academic Publishers:
Boston, 1999.
4. Buchini, S.; Leumann, C. J. Curr. Opin. Chem. Biol. 2003,
7, 717–726.
5. Jepsen, J. S.; Wengel, J. Curr. Opin. Drug Discov. Dev.
2004, 7, 188–194.
Synthesis of oligonucleotides 16–20 was performed in
0.2 lmol scale on an automated DNA synthesizer (Ap-
plied Biosystems, Expediteꢂ 8909) using the standard
phosphoramidite protocol. The oligonucleotide synthesis
was performed on DMTr-ON mode. Cleavage from the
CPG support and removal of the protecting groups were
accomplished by using 28% ammonia solution (55 ꢁC for
20 h). The crude oligonucleotides bearing a DMTr
group were detritylated and purified with Dupon
NensorbTM Prep according to the manufacturerꢁs proto-
col. The obtained oligonucleotides were again purified
by reversed-phase HPLC (Wako Wakopakꢂ WS-DNA,
10 mm · 250 mm). The composition of the oligonucleo-
tides was confirmed by MALDI-TOF-MS analysis.
MALDI-TOF-MS data ([MꢀH]ꢀ) for oligonucleotides
16–20: 16, found 4250.17 (calcd 4249.89); 17, found
4366.38 (calcd 4365.97); 18, found 4366.89 (calcd
4365.97); 19, found 4481.12 (calcd 4482.04); 20, found
3036.39 (calcd 3037.04).
6. Imanishi, T.; Obika, S. J. Syn. Org. Chem. Jpn. 1999, 57,
969–980.
7. Imanishi, T.; Obika, S. Chem. Commun. 2002, 1653–1659.
8. Obika, S. Chem. Pharm. Bull. 2004, 52, 1399–1404.
9. Obika, S.; Nanbu, D.; Hari, Y.; Morio, K.; In, Y.; Ishida,
T.; Imanishi, T. Tetrahedron Lett. 1997, 38, 8735–8738.
10. Obika, S.; Nanbu, D.; Hari, Y.; Andoh, J.; Morio, K.;
Doi, T.; Imanishi, T. Tetrahedron Lett. 1998, 39, 5401–
5404.
11. Obika, S.; Uneda, T.; Sugimoto, T.; Nanbu, D.; Minami,
T.; Doi, T.; Imanishi, T. Bioorg. Med. Chem. 2001, 9,
1001–1011.
4.23. Tm measurements
12. The 20,40-BNA was independently synthesized by the
group of Wengel et al. immediately after our first report
(Ref. 9), and it is called a locked nucleic acid (LNA). See
Refs. 5,13–15.
The UV melting experiments were carried out on a
Beckman DU-650 spectrophotometer equipped with
Tm analysis accessory using quartz cuvettes of 1 cm opti-

1038
Y. Hari et al. / Bioorg. Med. Chem. 14 (2006) 1029–1038
13. Singh, S. K.; Nielsen, P.; Koshkin, A. A.; Wengel, J.
Chem. Commun. 1998, 455–456.
14. Koshkin, A. A.; Singh, S. K.; Nielsen, P.; Rajwanshi, V.
K.; Kumar, R.; Meldgaard, M.; Olsen, C. E.; Wengel, J.
Tetrahedron 1998, 54, 3607–3630.
24. Vorbruggen, H.; Ho¨fle, G. Chem. Ber. 1981, 114, 1256–
¨
1268.
25. Crystal data for 7T: C12H16N2O7, M = 300.27, ortho-
˚
rhombic, a = 14.23(1), b = 14.780(5), c = 6.236(4) A,
3
˚
V = 1312(1) A , T = 298 K, space group P212121 (no.
15. Jepsen, J. S.; Wengel, J. Biochemistry 2004, 43, 13233–
13244.
16. Morita, K.; Hasegawa, C.; Kaneko, M.; Tsutsumi, S.;
Sone, J.; Ishikawa, T.; Imanishi, T.; Koizumi, M. Bioorg.
Med. Chem. Lett. 2002, 12, 73–76.
17. Morita, K.; Takagi, M.; Hasegawa, C.; Kaneko, M.;
Tsutsumi, S.; Sone, J.; Ishikawa, T.; Imanishi, T.; Koiz-
umi, M. Bioorg. Med. Chem. 2003, 11, 2211–2226.
18. Koizumi, M.; Morita, K.; Daigo, M.; Tsutsumi, S.; Abe, K.;
Obika, S.; Imanishi, T. Nucleic Acids Res. 2003, 31, 3267–
3273.
19), Z = 4, l(Cu-Ka) = 1.09 mmꢀ1, 1405 reflections mea-
sured. The final wR(F) and R(F) were 0.052 and 0.039 for
1195 observed reflections [F2 > 3r(F2)] used in all calcu-
lations. CCDC-183683 contains the supplementary crys-
tallographic data for this paper. These data can be
obtained free of charge via www.ccdc.cam.ac.uk/conts/
retrieving.html (or from the Cambridge Crystallographic
Data Centre, 12 Union Road, Cambridge CB2 1EZ, UK;
fax: +44 1223 336033; or deposit@ccdc.cam.ac.uk).
26. Arnott, S.; Hukins, D. W. L. Biochem. Biophys. Res.
Commun. 1972, 47, 1504–1509.
19. Wang, G.; Gunic, E.; Girardet, J.-L.; Stoisavljevic, V.
Bioorg. Med. Chem. Lett. 1999, 9, 1147–1150.
20. Wang, G.; Girardet, J.-L.; Gunic, E. Tetrahedron 1999, 57,
7707–7724.
21. Freier, S. M.; Altmann, K.-H. Nucleic Acids Res. 1997, 25,
4429–4443.
27. Saenger, W. Principles of Nucleic Acid Structure; Springer-
Verlag: New York, 1984.
28. In the case of PrNA which also has a seven-membered
ring structure, the coupling efficiency was not good
(ca. 50–60%) even with the use of more active
5-ethylthio-1H-tetrazole instead of a common activator,
1H-tetrazole.17
29. Westhof, E. Annu. Rev. Biophys. Biophys. Chem. 1988, 17,
125–144.
30. Berman, H. M. Curr. Opin. Struct. Biol. 1991, 1, 423–427.
22. Obika, S.; Morio, K.; Nanbu, D.; Hari, Y.; Itoh, H.;
Imanishi, T. Tetrahedron 2002, 58, 3039–3049.
23. Vorbruggen, H.; Krolikiewiczz, K.; Bennua, B. Chem. Ber.
¨
1981, 114, 1234–1255.