Synthesis of 1-D- and 1-L-myo-inosityl 2-N-acetamido-2-deoxy-α-D-glucopyranoside establishes substrate specificity of the Mycobacterium tuberculosis enzyme AcGI deacetylase

Article abstract of DOI:10.1016/S0968-0896(03)00154-8

Mycothiol (MSH, 1-D-myo-inosityl 2-(N-acetyl-L-cysteinyl)amido-2-deoxy-α-D-glucopyranoside) is the principal low molecular weight thiol in actinomycetes. The enzyme 1-D-myo-inosityl 2-N-acetamido-2-deoxy-α-D-glucopyranoside deacetylase (AcGI deacetylase)

Full text of DOI:10.1016/S0968-0896(03)00154-8

Bioorganic & Medicinal Chemistry 11 (2003) 2641–2647
Synthesis of 1-D- and 1-L-myo-Inosityl 2-N-Acetamido-2-deoxy-ꢀ-
D-glucopyranoside Establishes Substrate Specificity of the
Mycobacterium tuberculosis Enzyme AcGI Deacetylase
Gillian M. Nicholas,a Lisa L. Eckman,a Pavol Kovac,b Sarah Otero-Quinteroa
a,
andCarole A. Bewley *
aLaboratory of Bioorganic Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases,
National Institutes of Health, Bethesda, MD 20892-0820, USA
bLaboratory of Medicinal Chemistry, National Institute of Diabetes and Digestive and Kidney Diseases,
National Institutes of Health, Bethesda, MD 20892-0820, USA
Received29 August 2002; accepted8 January 2003
Abstract—Mycothiol (MSH, 1-d-myo-inosityl 2-(N-acetyl-l-cysteinyl)amido-2-deoxy-a-d-glucopyranoside) is the principal low
molecular weight thiol in actinomycetes. The enzyme 1-d-myo-inosityl 2-N-acetamido-2-deoxy-a-d-glucopyranoside deacetylase
(AcGI deacetylase) is involved in the biosynthesis of MSH and forms the free amine 1-d-myo-inosityl 2-amino-2-deoxy-a-d-gluco-
pyranoside, which is used in the third of four steps of MSH biosynthesis. Here, we report the synthesis of two isomers of AcGI,
which contain either 1-l-myo-inositol or 1-d-myo-inositol. These synthetic products were used to investigate substrate specificity of
the Mycobacterium tuberculosis enzyme AcGI deacetylase.
# 2003 Elsevier Science Ltd. All rights reserved.
Introduction
side (1a, AcGI) by the putative glycosyl transferase
mshA, followedby deacetylation of AcGI by the enzyme
1-d-myo-inosityl 2-N-acetamido-2-deoxy-a-d-glucopyr-
anoside deacetylase (mshB or AcGI deacetylase),8 to
form the free amine 1-d-myo-inosityl 2-amino-2-deoxy-
a-d-glucopyranoside (GI).9 Transfer of cysteine to GI
by the cysteine transferase mshC10 andthen acetate to
Cys-GI by the acetyl transferase mshD11 completes
MSH biosynthesis. Three of the four enzymes involved
in MSH biosynthesis have been described9ꢀ11 and
include mshB–D leaving only mshA to be identified. In
addition, the detoxification enzyme mycothiol-S-con-
jugate amidase (MCA)12 andthe mycothiol-idsulfied
reducing enzyme mycothione reductase13 were the first
mycothiol-relatedenzymes to be identifiedandchar-
acterized. Recently, we reported a total synthesis of the
bimane derivative of mycothiol, mycothiol bimane
(MSmB), which establishedthe absolute stereo-
chemistry of its three subunits as l-cysteine, d-glucosa-
mine and1- d-myo-inositol; anddemonstratedspecificity
of recombinant Mycobacterium tuberculosis MCA for
MSH possessing that stereochemistry.14 In this paper,
we describe the syntheses of two diastereomers of AcGI
containing either 1-d-myo-inositol or 1-l-myo-inositol,
Mycothiol1ꢀ3 [MSH, 1-d-myo-inosityl 2-(N-acetyl-l-
cysteinyl)amido-2-deoxy-a-d-glucopyranoside] is the
principal low molecular weight thiol produced only by
actinomycetes. Analogous to glutathione, the major low
molecular weight thiol in eukaryotes andGram-nega-
tive bacteria, MSH plays a central role in detoxification
4
andmaintaining a reducing intracellular environment.
Because some of the enzymes involvedin MSH bio-
synthesis and MSH-dependent detoxification are novel
andlimitedto actinomycetes, which include pathogenic
groups such as mycobacteria, interest in MSH bio-
chemistry continues to rise.
In mycobacteria, biosynthesis of MSH is accomplished
in four steps5,6 by the protein products of genes termed
mshA-D (illustratedin Scheme 1 andreviewedin ref 7).
These include formation of the pseudodisaccharide 1-d-
myo-inosityl 2-N-acetamido-2-deoxy-a-d-glucopyrano-
*Corresponding author. Tel.: +1-301-594-5187; fax: +1-301-402-
0008; e-mail: cb194k@nih.gov
0968-0896/03/$ - see front matter # 2003 Elsevier Science Ltd. All rights reserved.
doi:10.1016/S0968-0896(03)00154-8

2642
G. M. Nicholas et al. / Bioorg. Med. Chem. 11 (2003) 2641–2647
Scheme 1. Mycothiol biosynthetic scheme. With the exception of the first step carriedout by the putative glycosyl transferase mshA (denotedin
bold), the enzymes involved in each step of MSH biosynthesis and MSH-facilitated detoxification have been described. The M. tuberculosis gene
products of Rv1170 and Rv1082 are the deacetylase mshB and the amidase MCA, respectively.8
anddemonstrate specificity of recombinant M. tubercu-
losis AcGI deacetylase (mshB) for the 1-d-myo-inositol-
containing isomer, consistent with the absolute stereo-
chemistry of MSH.
tected1- d-myo-inositol acceptor 2a was carriedout as
described previously.14
Chemistry
d-GlcNAc-a-(1!1)-myo-d-Ins (1a) and d-GlcNAc-a-
(1!1)-myo-l-Ins (1b) were synthesizedusing the same
strategy that we usedpreviously for the synthesis of
MSmB14 (Scheme 2) which employs glycosylation of a
protectedinositol acceptor with an alpha-directing glu-
copyranosyl donor. Thus, 6-O-benzyl-2,3:4,5-di-O-
cyclohexylidene-1-d-myo-inositol (2a) and6- O-benzyl-
2,3:4,5-di-O-cyclohexylidene-1-l-myo-inositol (2b) were
preparedby following the general scheme usedin the
synthesis of galactinol.15 Briefly, preparation of the
protected l-isomer was accomplishedby acylation of
2,3:4,5-di-O-cyclohexylidene-1-l-myo-inositol with (+)-
menthol chloroformate, followedby benzylation of the
remaining free hydroxyl at C-6.15 Removal of the men-
thyl carbonate was achievedby reduction with lithium
aluminum hydride to give the protected 1-l-myo-inosi-
tol acceptor 2b in 96% yield. Preparation of the pro-
As shown in Scheme 3, glycosylation of 2a and 2b with
3,4,5-tri-O-acetyl-2-azido-2-deoxy-a-d-glucopyranosyl
chloride16 in the presence of silver triflate and2,6-di-
t-butyl-4-methylpyridine gave a 2:1 ratio of a/b anomers
in an approximate yieldof 70% for both reactions. The
desired a-anomers 3a and 3b from each glycosylation
reaction (as determined by JH1ꢀH2 values of 4 Hz for the
a-anomers vs 10 Hz for the b-anomers) were isolatedby
column chromatography in 44 and58% yields, respec-
tively. Glycosylation with the 1-l-myo-inositol deriva-
tive 2b gave a relatively higher yieldof the a-anomer
when comparedto the 1- d-myo-inositol derivative 2a,
andrequiredonly two equivalents of 3,4,5-tri- O-acetyl-
2-azido-2-deoxy-a-d-glucopyranosyl chloride for the
reaction to go to completion, as shown by TLC. Com-
plete glycosylation of the 1-d-myo-inositol acceptor, on
the other hand, required 3.8 equivalents of the azide.
Deprotection of the cyclohexylidine groups (CSA, ethyl-
ene glycol), followedby acetylation (Ac 2O, pyridine)
gave compound 4a in 80% yieldover the two steps, and
4b in 76% yield. Debenzylation and concomitant
reduction of the azide with palladium on carbon in the
presence of dilute hydrochloric acid gave amine hydro-
chlorides that were subsequently acetylated to give
amides 5a and 5b in respective yields of 70 and 51%
over two steps. Deacetylation was achievedwith
Scheme 2.

G. M. Nicholas et al. / Bioorg. Med. Chem. 11 (2003) 2641–2647
2643
Scheme 3. Reagents (yields are given in the text): (a) 3,4,5-tri-O-acetyl-2-azido-2-deoxy-a-d-glucopyranosyl chloride, silver (II) trifluoromethane
sulfonate, 2,6-diisopropyl-4-methyl pyridine, CH2Cl2; (b) (i) ethylene glycol, (+)-camphor sulfonic acid, CH3CN; (ii) Ac2O, pyridine, ꢁ80% over
two steps; (c) (i) Pd/C, H2, EtOAc; (ii) Ac2O, pyridine; (d) Pd/C, H2, EtOAc; (e) Mg(MeO)2, MeOH.
Mg(OMe)2,17 andchromatography gave 1a and 1b in 63
and66% yields, respectively.
tylation was measuredby fluorescence-detectedHPLC.
Deacetylation of the 30 and100 mM solutions of 1a
proceeded to 72 and 60%, respectively. In contrast, no
detectable cleavage of the 1-l-inositol-containing isomer
1b was observed under the same conditions. Deacetyl-
ation of 1b was further attemptedusing 20 mg AcGI
deacetylase; however, even in the presence of relatively
high enzyme concentrations, no cleavage products were
detected, thereby establishing the 1-d-myo-inositol-con-
taining isomer as the natural substrate of AcGI deace-
tylase. These results are consistent with a separate study
showing that d-Gln-a-(1!1)-myo-l-Ins was not a sub-
strate for MSH biosynthesis by crude extracts of
Mycobacterium smegmatis.19
Several milligrams of the free amine of 1a, namely d-
Gln-a-(1!1)-myo-d-Ins (1c), were also preparedfor use
as a standard in the enzyme assays. Thus, following
hydrogenolysis of intermediate 4a to give the inter-
mediate amino alcohol heptaacetate (not shown in
Scheme 3a), the reduced product was deprotected with
Mg(OMe)2 to give 1c in approximately 50% yieldfol-
lowing purification over silica gel.
Enzyme Activity
Recombinant AcGI deacetylase from M. tuberculosis
was clonedandexpressedin the form of a staphylo-
coccal protein G–AcGI deacetylase fusion protein18
(protG–AcGI, see Experimental). Because AcGI deace-
tylase can cleave the cysteinyl–glucosamine amide bond
of mycothiol-S-conjugates to yield N-acetyl-Cys-S-con-
jugates and d-Gln-a-(1!1)-myo-Ins (1c),9 initial charac-
terization of protG–AcGI was accomplishedusing the
substrate mycothiol bimane (MSmB) andfluorescence-
detected HPLC methods that detect the extent of enzy-
matic cleavage of MSmB, as described previously.12
Incubation of 30 or 100 mM MSmB solutions in the
presence of 3.5 mg protG–AcGI for 20 min ledto 59 and
26% cleavage, respectively, demonstrating activities
consistent with those reportedearlier for AcGI deace-
tylase from M. tuberculosis.9
Further characterization of the recombinant enzyme was
carriedout using time-course experiments to measure
specific activities of the enzyme andto determine a range
To establish substrate specificity of AcGI deacetylase
from M. tuberculosis, solutions of 1a and 1b (30 and
100 mM) were incubatedin the presence of 3.7 mg
recombinant AcGI deacetylase. Quantitated solutions
of 1c [d-Gln-a-(1!1)-myo-d-Ins] were usedas stan-
dards. Following derivatization of the standard solu-
tions andthe reaction mixtures with 6-aminoquinolyl-
N-hydroxysuccinimidyl carbamate, the extent of deace-
Figure 1.

2644
G. M. Nicholas et al. / Bioorg. Med. Chem. 11 (2003) 2641–2647
of protein concentrations cleaving with linear velocities.
Once established, experiments using multiple substrate
concentrations (ranging from 5 to 1000 mM) in the pre-
sence of 3.5 mM protein were carriedout. A oduble
reciprocal plot of the data (shown in Fig. 1) yielded
values for Vmax and Km of 0.68 nmol minꢀ1 and186 mM,
respectively.20 The specific activity under these condi-
tions is 238 nmol minꢀ1 mgꢀ1 protein, in goodagree-
restriction sites, respectively. Following purification
(Promega), PCR products were cut and gel purified
before ligation into the vector GEV218 linearizedwith
the same enzymes. Clones containing the correct
sequence (ABI Prism) were transformedinto competent
BL21 (DE3) cells (Novagen) andselectedon LB-ampi-
cillin plates (1% agar, 100 mg/mL ampicillin). Recombi-
nant protG-AcGI deacetylase was produced as follows:
500 mL of cells were grown with shaking at 220 rpm at
37 ꢂC for ꢁ6 h in LB medium with 100 mg/mL ampi-
cillin, induced with 1 mM IPTG at an OD600 of 0.8, at
which time they were movedto a 25 ꢂC incubator and
shaken overnight. (Growth at a reduced temperature
following induction is required to obtain soluble pro-
tein; induction at 37 ꢂC results in nearly all of the
recombinant protein being locatedin inclusion bodies.)
The following morning, cells were harvestedby cen-
9
ment with previously reportedvalues.
Conclusions
We have described the synthesis of 1-d- and 1-l-myo-
inosityl 2-N-acetamido-2-deoxy-a-d-glucopyranoside,
andestablishedspecificity for the 1- d-inositol-contain-
ing isomer of the mycothiol biosynthetic enzyme AcGI
deacetylase. In addition, we have shown that a recom-
binant ProtG–AcGI deacetylase fusion protein deacetyl-
ates d-GlcNAc-a-(1!1)-myo-d-Ins andcleaves MSmB
at the scissile amide bond with specific activities com-
parable to those reportedfor AcGI deacetylase sub-
clonedfrom M. tuberculsosis H37Rv genomic DNA.9
Earlier we described the structures and activities of nat-
ural product and synthetic inhibitors of mycothiol-S-
conjugate amidase.21ꢀ23 The results of this work pave
the way for future studies aimed toward the design and
synthesis of substrate-basedinhibitors of AcGI deace-
tylase andits homologue mycothiol- S-conjugate ami-
dase.
TM
trifugation (10,000g, 10 min), lysedwith BugBuster
(Novagen) for 20 min at rt, andthe soluble fraction was
obtainedafter centrifugation at 18,000 g, 30 min, 4 ꢂC.
(From this point on, all steps took place at 4 ꢂC.) This
supernatant was concentratedto 2 mL using a 20 mL
10,000 MWCO VIVASPIN filter (Millipore) and
applied directly to a Superdex75 26/60 gel filtration
column (Amersham Pharmacia Biotech) which had
been equilibratedwith 50 mM Tris, pH 7.4 containing
50 mM NaCl, 1 mM DTT and100 mM ZnSO4 (Buffer
A). The column was elutedwith 2 column volumes of
Buffer A and8 mL fractions were collecte.d Active
fractions of greater than 80% purity (SDS gel electro-
phoresis) were combined, concentrated, and purified by
anion exchange chromatography using a 1 mL Resour-
ceQ column (Amersham Pharmacia Biotech) eluting
with a linear gradient of 0–0.5 M NaCl in 50 mM Tris,
pH 7.4 before a final purification/desalting over an
analytical Superdex75 16/60 column (Amersham Phar-
macia Biotech) eluting with Buffer A. Active fractions
of greater than 95% purity were combinedandcon-
centratedto yield1 mL of a 3.73 mg/mL solution that
Experimental
General
Optical rotations were measuredon a Perkin–Elmer 341
polarimeter; IR spectra were recorded on a BioRad
FTS-45 FT-IR spectrophotometer as films on either a
NaCl disk or a ZnSe crystal. Low- and high-resolution
FAB mass spectra were obtainedon a Jeol-SX102
ꢂ
was storedat 4 C andusedfor all assays. FAB-MS: m/z
38,292.05 (average mass 38,296.67).
1
instrument. H, 13C andCOSY spectra were recorded
on Varian Mercury 300, Varian Gemini 300, or Bruker
DRX800 spectrometers. HSQC andHSQCLR spectra
were recorded on a Bruker DMX500 spectrometer.
NMR spectra of synthetic intermediates were run in
CDCl3 or CD3OD andreferencedto residual solvent
signals at dH 7.25 and dC 77.05, and dH 3.30 and dC
49.15, respectively. Primednumbers for 1H and 13C
chemical shift assignments correspondto the inositol
ring. Reverse-phase (C18) HPLC (RP-HPLC) was car-
riedout using an Agilent HPLC instrument anda
Waters SpherisorbTM ODS column.
Enzyme assays
ꢂ
Assays were carriedout in 50 mM Tris (pH 7.4) at 32 C
for 20 min using recombinant protG–AcGI deacetylase
andsynthetic samples (30 mM of 100 mM) of MSmB,
d-GlcNAc-a-(1!1)-myo-d-Ins (1a), d-GlcNAc-a-(1!1)-
myo-l-Ins (1b), and d-Gln-a-(1!1)-myo-d-Ins (1c). The
extent of cleavage of MSmB was measureddirectly by
fluorescence detected RP-HPLC as described pre-
viously.12 The extent of deacetylation of d-GlcNAc-a-
(1!1)-myo-d-Ins (1a) was determined by fluorescence
detected RP-HPLC eluting with a linear gradient of 0–
0% MeOH in 5 min, 0–18% MeOH in 10 min, and18–
90% MeOH in 1 min, followedby a 4 min 90% MeOH
wash. The fluorescent amino-derivatives, prepared with
excess 6-aminoquinolyl-N-hydroxysuccinimidyl carba-
mate in 100 mM sodium borate, pH 8.0, eluted with a
retention time of 12.35 min, and the acetylated, under-
ivatizedcompounds 1a and 1b both elutedat 5.6 min.
The injection artifact elutes at 1.15 min under these
conditions.
Subcloning and protein expression
DNA encoding the enzyme AcGI deacetylase (Rv1170)
from M. tuberculosis (H37Rv) was amplifiedby poly-
merase chain reaction using total genomic DNA as
template andprimers with the sequences 5 0-CAT
ATGTCTGAGACGCCGCGGCTG-30 and5 0-GCT
GTTGGATCCTACGTGCCGGACGCGGTGAA - 30
(LofstrandLabs), which contain Bam H1 andXho I

G. M. Nicholas et al. / Bioorg. Med. Chem. 11 (2003) 2641–2647
2645
D-myo-Inosityl 2-N-acetamido-2-deoxy-ꢀ-D-glucopyrano-
side (1a). To a solution of 5a (36 mg, 0.05 mmol) in
MeOH (200 mL) was added Mg(OMe)2 (300 mL,
0.974 M). The reaction was monitoredby TLC at 30-
min intervals andquenchedat 2 h with 0.5% TFA.
Removal of the solvent in vacuo followedby silica gel
chromatography eluting with a gradient from 1:9 to
10 Hz, H4), 5.00 (dd, JHH=3,11 Hz, H30), 5.00 (m, H3),
4.95 (d, JHH=4 Hz, H1), 4.28 (m, H2), 4.20 (dd,
JHH=5, 13 Hz, H6a), 4.08 (m, H6b), 4.04 (m, H5), 3.99
(dd, JHH=3, 10 Hz, H10), 2.29 (CH3C¼O), 2.10
(CH3C¼O), 2.02 (CH3C¼O), 2.00 (CH3C¼O), 1.99
(CH3C¼O), 1.95 (CH3C¼O), 1.98 (CH3C¼O), 1.97
(CH3C¼O), 1.92 (CH3C¼O). 13C NMR (CD3OD,
75 MHz) dC 171.3 ðCH3C¼OÞ, 170.8 ðCH3C¼OÞ,
2:3 MeOH/CHCl3 yielded compound 1a (12 mg, 63%).
+60ꢂ (c 0.1, MeOH). 1H NMR (CD3OD,
20
D
½aŠ
170.3
ðCH3C¼OÞ,
170.2
ðCH3C¼OÞ,
170.1
300 MHz) dH 5.06 (d, JHH=4 Hz, H1), 4.16 (dd,
JHH=2 Hz, H20), 3.92 (dd, JHH=4, 10 Hz, H2), 3.86 (m,
H6a), 3.84 (m, H5), 3.78 (dd, JHH=10, 10 Hz, H60), 3.69
(dd, JHH=9, 11 Hz, H3), 3.64 (dd, JHH=7, 12 Hz,
H6b), 3.58 (dd, JHH=10, 10 Hz, H40), 3.41 (dd, JHH=2,
9 Hz, H10), 3.34 (dd, JHH=3, 10 Hz, H30), 3.31 (m, H4),
3.15 (dd, JHH=10, 10 Hz, H50), 1.98 (s, CH3). 13C NMR
(CD3OD, 75 MHz) dC 173.9 ðCH3C¼OÞ, 103.7 (C1),
84.6 (C10), 79.6 (C60), 77.1 (C40), 76.4 (C20), 76.3 (C50),
76.2 (C30), 76.1 (C3), 75.7 (C4), 65.8 (C6), 62.9 (C50),
56.8 (C2), 23.0 ðCH3C¼OÞ. IR (NaCl, film) 3350 (br),
ðCH3C¼OÞ, 169.7 ðCH3C¼OÞ, 169.6 ðCH3C¼OÞ,
169.5 ðCH3C¼OÞ, 169.3 (CH3C¼O), 98.9 (C1), 72.9
(C10), 71.6 (C60), 70.8 (C50), 70.4 (C30), 69.4 (C5), 69.1
(C20 or C30), 69.0 (C20 or C30), 68.7 (C3), 67.5 (C4), 61.9
(C6), 51.5 (C2), 22.9 ðCH3C¼OÞ, 20.8 ðCH3C¼OÞ,
20.6 ðCH3C¼OÞ, 20.6 ðCH3C¼OÞ, 20.5 ðCH3C¼OÞ,
20.4 ðCH3C¼OÞ, 20.4 ðCH3C¼OÞ. IR (NaCl, film)
1761 (C¼O), 1756 (C¼O), 1751 (C¼O), 1740 (C¼O),
1734 (C¼O), 1369, 1226, 1039 cmꢀ1. MS m/z MH+
720.2336 (C30H42NO19 calcd720.2351).
1684 (C¼O), 1204, 1141, 1039 cmꢀ1
.
MS m/z
Compound 1b. To a solution of 5b (12 mg, 0.017 mmol)
in MeOH (200 mL) was added Mg(OMe)2 (300 mL,
974 mM solution). The reaction was monitoredby TLC
at 30 min, 1 and2 h andquenchedat 2 h with 0.5%
TFA. Removal of the solvent in vacuo followedby
silica gel chromatography with a gradient from 1:9 to
2:3 methanol/chloroform yielded compound 1b (4.3 mg,
384.1497 MH+ (C14H26NO11 calcd384.1506).
D-myo-Inosityl 2-amino-2-deoxy-ꢀ-D-glucopyranoside (1c).
(i) To a suspension of palladium on carbon (5%, 12 mg)
in EtOAc (0.5 mL) andHCl (30 mL of 1 M solution) was
added a solution of compound 4a (20 mg, 0.033 mmol)
in EtOAc (0.5 mL). The mixture was evacuated, flushed
with hydrogen and stirred at rt under an atmosphere of
hydrogen for 3 h. The reaction mixture was filtered and
concentrated to give the crude amine hydrochloride
(12 mg). (ii) To a solution of the crude amine in MeOH
(200 mL) was added Mg(OMe)2 (200 mL, 0.974 M). The
reaction was monitoredby TLC andquenchedwith
0.5% TFA after 2 h. The solvent was removedin vacuo
followedby silica gel chromatography, eluting with a
gradient from 1:9 to 2:3 MeOH/CHCl3, to yield 1c
(6 mg, 53% over two steps). 1H NMR (CD3OD,
500 MHz) dH 5.06 (d, JHH=4 Hz, H1), 4.16 (dd,
JHH=2 Hz, H20), 3.92 (dd, JHH=4, 10 Hz, H2), 3.86 (m,
H6a), 3.84 (m, H5), 3.78 (dd, JHH=10,10 Hz, H60), 3.69
(dd, JHH=9, 11 Hz, H3), 3.64 (dd, JHH=7, 12 Hz,
H6b), 3.58 (dd, JHH=10, 10 Hz, H40), 3.41 (dd, JHH=2,
9 Hz, H10), 3.34 (dd, JHH=3, 10 Hz, H30), 3.31 (m, H4),
3.15 (dd, JHH=10,10 Hz, H50). FAB-MS m/z
342.11 MH+ (C12H24NO10 calcd342.14).
20
D
66%). ½aŠ +89ꢂ (c 0.1, MeOH). H NMR (CD3OD,
1
300 MHz) 1H 4.91 (d, JHH=4 Hz, H1), 4.04 (dd,
JHH=3, 3 Hz, H20), 3.95 (dd, JHH=4, 11 Hz, H2), 3.81
(dd, JHH=2, 12 Hz, H6a), 3.74 (m, H30), 3.72 (m, H3),
3.69 (m, H5), 3.68 (m, H6b), 3.64 (dd, JHH=10, 10 Hz,
H50), 3.49 (dd, JHH=3, 10 Hz, H10), 3.33 (m, H4), 3.30
(m, H40), 3.18 (dd, JHH=9, 9 Hz, H60), 2.03 (s,
1
1
CH3C¼O). H NMR (D2O, 800 MHz) H 5.04 (br s,
H1), 3.96, 9.94, 3.83, 3.84, 3.80, 3.71, 3.66, 3.59, 3.53,
3.48, 3.31, 2.05 (s, CH3). 13C NMR (D2O, 75 MHz) dC
176.1 ðCH3C¼OÞ, 95.7 (C1), 77.1 (C20), 75.8, 73.7, 73.6,
72.7, 72.6, 72.4, 71.4, 69.9, 62.0 (C6), 55.2 (C2), 23.5
ðCH3C¼OÞ. IR (NaCl, film) 3337 (br), 2921, 1651
(C¼O), 1558, 1542, 1378, 1107, 1039 cmꢀ1. MS m/z
384.1501 MH+ (C14H26NO11 calcd384.1506).
Compound 3b. To a solution of 2b (75 mg, 0.17 mmol),
2,6-diisopropyl-4-methyl pyridine (0.85 mmol, 175 mg),
and silver triflate (45 mg, 0.17 mmol) was added
1-chloro-2-azo-3,4,6-acetyl glucosamine (800 mL of a
185 mM soln, 0.15 mmol) dropwise. After 30 min, an
aliquot of silver triflate (45 mg, 0.17 mmol) was added,
followed by dropwise addition of a second aliquot of
1-chloro-2-azo-3,4,6-acetyl glucosamine (800 mL of a 1
mmol/5.4 mL soln, 0.15 mmol) 30 min later. A thirdali-
quot of silver triflate was then added (45 mg, 0.17 mmol)
30 min later. The reaction was quenchedby diluting
with EtOAc andwashing with aq satdNa 2SO4, brine,
Compound 5a. (i) To a suspension of palladium on car-
bon (5%, 26 mg) in EtOAc (1 mL) andHCl (60 mL of
1 M solution) was added compound 4a (46 mg,
0.05 mmol) in EtOAc (1 mL). The mixture was evac-
uated, flushed with hydrogen and stirred at rt under an
atmosphere of hydrogen for 3 h. The reaction was fil-
teredandconcentratedto give the crude amine hydro-
chloride (30 mg). (ii) To a solution of the crude amine
(30 mg) in pyridine (1 mL) was added acetic anhydride
(500 mL). The mixture was stirredat rt for 13 h.
Removal of the volatiles in vacuo followedby silica gel
chromatography yielded compound 5a (24 mg, 70%
andthen dried(NaSO 4) andconcentratedin vacuo.
Purification using flash silica gel chromatography (pet-
roleum ether ! 5:1 petroleum ether/EtOAc) gave the
20
a-glycosylation product 3b (45 mg, 58%). ½aŠ +116ꢂ (c
D
20
D
over two steps). ½aŠ +50ꢂ (c 0.1, CHCl3). H NMR
1.0, CHCl3). H NMR (CDCl3, 300 MHz) dH 7.27–7.38
1
1
(CDCl3, 300 MHz) dH 5.57 (m, H20), 5.49 (dd,
JHH=10,10 Hz, H60), 5.47 (dd, JHH=10,10 Hz, H40),
5.10 (dd, JHH=10, 10 Hz, H50), 5.05 (dd, JHH=10,
(m, ArH), 5.52 (dd, JHH=9, 10 Hz, H3), 5.27 (d,
JHH=4 Hz, H1), 5.04 (dd, JHH=10, 10, H4), 4.90 (d,
JHH=11 Hz, PhCH2), 4.71 (d, JHH=11 Hz, PhCH2),

2646
G. M. Nicholas et al. / Bioorg. Med. Chem. 11 (2003) 2641–2647
4.52 (dd, JHH=5, 5 Hz, H20), 4.26 (dd, JHH=5, 8 Hz,
H30), 4.19 (m, H5), 4.02 (m, H10), 4.00 (m, H6a), 3.96
(dd, JHH=3, 9 Hz, H60), 3.92 (m, H6b), 3.84 (dd,
JHH=9, 10 Hz, H40), 3.40 (dd, JHH=9, 10 Hz, H50),
3.24 (dd, JHH=4, 10 Hz, H2), 2.09 (s, CH3C¼O), 2.04,
(s, CH3C¼O), 2.02 (s, CH3C¼O), 1.39–1.80 (m, cyclo-
hexylidene). 13C NMR (CDCl3, 75 MHz) dC 170.6
ðCH3C¼OÞ, 169.9 ðCH3C¼OÞ, 169.6 ðCH3C¼OÞ,
137.9 (Bn), 128.5 (Bn), 128.3 (Bn), 127.8 (Bn), 113.0
ðOꢀCꢀOÞ, 111.2 (s, OꢀCꢀO), 95.3 (C1), 78.5 (C60),
78.5 (C40), 78.2 (C50), 75.8 (C30), 74.8 (C10), 72.8 (C20),
72.8 CH2Ph, 70.0 (C3), 68.2 (C4), 67.8 (C5), 61.3 (C6),
60.5 (C2), 37.5, 36.5, 36.4, 34.5, 25.0, 25.0, 23.9, 23.8,
23.7, 20.7 ð2CH3C¼OÞ, 20.6 ðCH3C¼OÞ. IR (NaCl,
film) 2937, 2861, 2110 (N3), 1754 (C¼O), 1367, 1227,
1034 cmꢀ1. MS m/z 744.3328 MH+ (C37H50N3O13 calcd
744.3344).
next reaction. (ii) To a solution of the above amine
in pyridine (1 mL) was added acetic anhydride
(500 mL). The reaction was stirredat rt for 13 h.
Removal of the volatiles in vacuo followedby silica
gel chromatography yielded compound 5b (19.6 mg,
20
D
51% over two steps), ½aŠ +60ꢂ (c 0.1, CHCl3). 1H
NMR (CDCl3, 300 MHz) dH 6.08 (br d, JHH=9 Hz,
NH), 5.65 (dd, JHH=3, 3 Hz, H20), 5.50 (dd,
JHH=10, 10 Hz, H40), 5.46 (dd, JHH=10, 10 Hz, H60),
5.12 (dd, JHH=10, 10 Hz, H50), 5.10 (dd, JHH=10,
10 Hz, H4), 4.98 (m, H3), 4.95 (m, H30), 4.93 (d,
JHH=3 Hz, H1), 4.32 (m, H2), 4.16 (dd, JHH=2, 12 Hz,
H6a), 4.11 (dd, JHH=4, 12 Hz, H6b), 3.91 (dd, JHH=3,
10 Hz, H10), 3.87 (m, H5), 2.26 (s, CH3C¼O), 2.13 (s,
CH3C¼O), 2.09 (s, CH3C¼O), 2.03 (s, CH3C¼O), 2.02
(s, CH3 C¼O), 2.01 (s, CH3C¼O), 2.00 (s, CH3C¼O),
2.00 (s, CH3C¼O), 1.95 (s, CH3C¼O). 13C NMR
(CDCl3, 75 MHz) dC 171.1 ðCH3C¼OÞ, 170.7
ðCH3C¼OÞ, 170.3 ðCH3C¼OÞ, 170.2 ðCH3C¼OÞ,
Compound 4b. (i) To a solution of camphor sulfonic
acid(16 mg, 0.07 mmol) andethylene glycol (34 mg,
0.55 mmol) in CH3CN (1 mL) was added compound 3b
(85 mg, 0.11 mmol) in CH3CN (2 mL). The mixture was
stirredat rt for 14 h, andquenchedby addition of tri-
ethylamine andconcentratedin vacuo. A solution of the
residue in CH3CN was passedthrough a layer of silica
gel eluting with EtOAc andconcentratedto give a crude
sample of 55 mg, which was useddirectly in the follow-
ing step. (ii) The above material (55 mg) was treated
with acetic anhydride (0.5 mL) and pyridine (1 mL), and
stirredat rt for 16 h. Flash silica chromatography, elut-
ing with a gradient from petroleum ether through 3:2
169.8
ðCH3C¼OÞ,
169.7
ðCH3C¼OÞ,
169.7
ðCH3C¼OÞ, 169.6 ðCH3C¼OÞ, 169.1 ðCH3C¼OÞ,
97.1 (C1), 73.8 (C10), 70.9 (C50), 70.5 (C60), 70.2 (C3),
69.2 (C40), 68.9 (C5), 68.7 (C30), 67.8 (C4), 67.1 (C20),
61.5 (C6), 51.5 (C2), 22.9 (CH3), 20.8 (CH3), 20.7
(CH3), 20.7 (CH3), 20.6 (CH3), 20.5 (CH3), 20.4 (CH3).
IR (NaCl, film) 2951, 1754 (C¼O), 1744 (C¼O), 1689,
1369, 1224, 1042 cmꢀ1
.
MS m/z 720.2354 MH+
(C30H42NO19 calcd720.2351).
Acknowledgements
and2:3 petroleum ether/EtOAc, yieldedcompound
4b
20
(63 mg, 76% over two steps), ½aŠ +81ꢂ (c 0.1, CHCl3).
1H NMR (CDCl3, 300 MHz) dDH 7.22–7.31 (m, ArH),
5.70 (dd, JHH=2, 2 Hz, H20), 5.43 (dd, JHH=10, 10 Hz,
H40), 5.40 (d, JHH=9, 10 Hz, H3), 5.16 (dd, JHH=10,
10 Hz, H50), 5.12 (d, JHH=3 Hz, H1), 4.95 (m, H4), 4.93
(m, H30), 4.81 (d, JHH=11 Hz, PhCH2), 4.71 (d,
JHH=11 Hz, PhCH2), 4.05 (m, H5), 4.00 (dd, JHH=9,
10 Hz, H60), 3.92 (m, H10), 3.89 (m, H6a/H6b), 3.29 (dd,
JHH=4, 10 Hz, H2), 2.21 (s, CH3C¼O), 2.07 (s,
CH3C¼O), 2.04 (s, CH3C¼O), 2.00 (s, CH3C¼O), 1.99
(s, CH3C¼O), 1.95 (s, CH3C¼O), 1.88 (s, CH3C¼O).
13C NMR (CDCl3, 75 MHz) dC 170.5 ðCH3C¼OÞ,
We thank Noel Whittaker andLewis Pannell for mass
spectrometry andBrandon Fetterolf, John Louis and
Andrew Phillips for helpful discussions. This work was
supportedin part by the Intramural AIDS Targeted
Antiviral Program of the Office of the Director,
National Institutes of Health (C.A.B.).
References and Notes
1. Sakuda, S.; Zhou, Z.; Yamada, Y. Biosci. Biotech. Bio-
chem. 1994, 58, 1347.
2. Spies, H. S.; Steenkamp, D. J. Eur. J. Biochem. 1994, 224,
203.
3. Newton, G. L.; Bewley, C. A.; Dwyer, T. J.; Horn, R.;
Aharonowitz, Y.; Cohen, G.; Davies, J.; Faulkner, D. J.;
Fahey, R. C. Eur. J. Biochem. 1995, 230, 821.
4. Reviewedin Fahey, R. C. Ann. Rev. Microbiol. 2001, 55,
333.
5. Bornemann, C.; Jardine, M. A.; Spies, H. S. C.; Steen-
kamp, D. J. Biochem. J. 1997, 325, 623.
6. Anderberg, S.; Newton, G. L.; Fahey, R. C. J. Biol. Chem.
1998, 273, 30391.
7. Newton, G. L.; Fahey, R. C. Arch. Microbiol. 2002, 178,
388.
8. Owing to the sharedsequence homology with mycothiol- S-
conjugate amidase (MCA), AcGI deacetylase was first identi-
fiedby subcloning the gene Rv1170 from genomic DNA of M.
tuberculsosis H37Rv.9 Thus, AcGI deacetylase is also referred
to as Rv1170 and mshB. Likewise, MCA has been referredto as
Rv1082 as annotatedin the M. tuberculosis genome sequence
publishedby: Cole, S. T.; Brosch, R.; Parkhill, J.; Garnier, T.;
170.1
ðCH3C¼OÞ,
170.0
ðCH3C¼OÞ,
169.9
ðCH3C¼OÞ, 169.7 ðCH3C¼OÞ, 169.5 ðCH3C¼OÞ,
137.3 (Bn), 128.5 (Bn), 127.9 (Bn), 127.6 (Bn), 93.8 (C1),
77.6 (C60), 76.1 ðCH2PhÞ, 72.6 (C50), 72.4 (C10), 70.0
(C3 or C40), 69.6 (C3 or C40), 68.9 (C4 or C30), 67.9 (C4
or C30), 67.7 (C5), 65.1 (C20), 61.2 (C6), 60.5 (C2), 20.8
ðCH3C¼OÞ, 20.7 ðCH3C¼OÞ, 20.7 ðCH3C¼OÞ, 20.7
ðCH3C¼OÞ, 20.7 ðCH3C¼OÞ, 20.6 ðCH3C¼OÞ. IR
(NaCl, film) 2945, 2112 (N3), 1753 (C¼O), 1368, 1226,
1036 cmꢀ1. MS m/z 884.1492 MCs+ (C33H41N3O17Cs
calcd884.1490).
Compound 5b. (i) To a suspension of palladium on car-
bon (5%, 30 mg) in EtOAc (1 mL) was added a solution
of compound 4b (40 mg, 0.05 mmol) in EtOAc (1 mL).
The reaction vessel was evacuated, flushed with hydro-
gen and the mixture was stirred at rt under hydrogen for
5 h. The mixture was filteredandconcentrate.d The
crude amine thus obtained was used directly in the

G. M. Nicholas et al. / Bioorg. Med. Chem. 11 (2003) 2641–2647
2647
Churcher, C.; Harris, D.; Gordon, S. V.; Eiglmeier, K.; Gas,
S.; Barry, III, C. R.; Tekaia, F.; Badcock, K.; Basham, D.;
Brown, D.; Chillingworth, T.; Connor, R.; Davis, R.; Devlin,
K.; Feltwell, T.; Gentles, S.; Hamlin, N.; Holroyd, S.;
Hornsby, T.; Jagels, K.; Krogh, A.; McLean, J.; Moule, S.;
Murphy, L.; Oliver, K.; Osborne, J.; Quail, M. A.; Rajan-
dream, M.-A.; Rogers, J.; Rutter, S.; Seeger, K.; Skelton, J.;
Squares, R.; Squares, S.; Sulston, J. E.; Taylor, K.; White-
head, S.; Barrell, B. G . Nature 1998, 393, 537.
9. Newton, G. L.; Av-Gay, Y.; Fahey, R. C. J. Bacteriol.
2000, 182, 6958.
10. Sareen, D.; Steffek, M.; Newton, G. L.; Fahey, R. C.
Biochemistry 2002, 41, 6885.
11. Koledin, T.; Newton, G. L.; Fahey, R. C. Arch. Microbiol.
2002, 178, 331.
12. Newton, G. L.; Av-Gay, Y.; Fahey, R. C. Biochemistry
2000, 39, 10739.
13. Patel, M. P.; Blanchard, J. S. Biochemistry 1999, 38,
11827.
15. Mayer, T. G.; Schmidt, R. R. Liebigs Ann./Recueil. 1997,
859.
16. Pavliak, V.; Kovac, P. Carbohydr. Res. 1991, 210, 333.
17. Xu, Y. C.; Bizuneh, A.; Walker, C. J. Org. Chem. 1996,
61, 9086.
18. Huth, J. R.; Bewley, C. A.; Jackson, B. M.; Hinnebusch,
A. G.; Clore, G. M.; Gronenborn, A. M. Prot. Sci. 1997, 6, 2359.
19. Jardine, M. A.; Spies, H. S.; Nkambule, C. M.; Gammon,
D. W.; Steenkamp, D. J. Bioorg. Med. Chem. 2002, 10, 875.
Note that in this paper the stereochemistry of 1-d-myo-inositol
is depicted as 1-l, and1- l-myo-inositol is depicted as 1-d.
20. A direct linear plot of the same data yielded similar results
with Vmax and Km values of 0.57 nmol minꢀ1 and155 mM,
respectively.
21. Nicholas, G. M.; Newton, G. L.; Fahey, R. C.; Bewley,
C. A. Org. Lett. 2001, 3, 1543.
22. Nicholas, G. M.; Eckman, L. L.; Ray, S.; Hughes, R.;
Pfefferkorn, J.; Barluenga, S.; Nicolaou, K. C.; Bewley, C. A.
Bioorg. Med. Chem. Lett. 2002, 12, 2487.
14. Nicholas, G. M.; Kovac, P.; Bewley, C. A. J. Am. Chem.
Soc. 2002, 124, 3492.
23. Nicholas, G. M.; Eckman, L. L.; Newton, G. L.; Fahey, R.
C.; Ray, S.; Bewley, C. A. Bioorg. Med. Chem. 2003, 11, 601.