Thermolytic 4-Methylthio-1-butyl Group for Phosphate/Thiophosphate Protection in Solid-Phase Synthesis of DNA Oligonucleotides

Article abstract of DOI:10.1021/jo035861f

The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppos

Full text of DOI:10.1021/jo035861f

Th er m olytic 4-Meth ylth io-1-bu tyl Gr ou p for P h osp h a te/
Th iop h osp h a te P r otection in Solid -P h a se Syn th esis of DNA
Oligon u cleotid es
J acek Cies´lak,‡ Andrzej Grajkowski, Victor Livengood,† and Serge L. Beaucage*
Division of Therapeutic Proteins, Center for Drug Evaluation and Research, Food and Drug
Administration, 8800 Rockville Pike, Bethesda, Maryland 20892, and Laboratory of Bioorganic
Chemistry, NIDDK, National Institutes of Health, 9000 Rockville Pike, Bethesda, Maryland 20892
beaucage@cber.fda.gov
Received December 22, 2003
The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligo-
nucleotides has been investigated for its potential application to a “heat-driven” process for either
oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation
of therapeutic oligonucleotides. The preparation of phosphoramidites 10a -d is straightforward,
and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds
as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The
versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by
its facile removal from oligonucleotides upon heating for 30 min at 55 °C in an aqueous buffer
under neutral conditions or within 2 h at 55 °C in concentrated NH4OH. The deprotection reaction
occurs through an intramolecular cyclodeesterification mechanism leading to the formation of
sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2′-deoxyribonucleosides
or with a model phosphorothioate diester under conditions approximating those of large-scale (>50
mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases
or desulfurize the phosphorothioate diester model to an appreciable extent.
In tr od u ction
conditions, to avoid the use of harsh chemicals that are
normally required for oligonucleotide chain extension and
deprotection and incur the risk of an irreversible loss of
valuable oligonucleotides from the glass surface. A num-
ber of heat-sensitive phosphate/thiophosphate protecting
groups exhibiting unique thermolytic properties have
already been investigated3 through incorporation into
oligonucleotides via phosphoramidites 1-7 (Scheme 1).
With the advent of DNA microarrays as powerful
diagnostic tools in clinical medicine,1 our research efforts
have recently focused on the development of thermolytic
groups for 5′-hydroxyl2 and phosphate3 protection toward
the implementation of a “heat-driven” method4 for the
synthesis of DNA oligonucleotides on planar glass sur-
faces. Ideal thermolabile 5′-/3′- hydroxyl and phosphate
protecting groups should be quickly and efficiently re-
leased from oligonucleotides, when heated under neutral
Typically, the thermal cleavage of phosphate protecting
groups from oligonucleotides that have been prepared
using phosphoramidites 1,3a 3,3b,d 4,3c,d and 5 is complete
within 3 h, 1 h, 30 min, and 15 min, respectively, upon
heating at 90 °C in an aqueous buffer under neutral
conditions (pH 7.0). Interestingly, the thermolytic phos-
phate deprotection of oligonucleotides that have been
prepared via phosphoramidites 73e occurs spontaneously
while the oxidative step of the solid-phase oligonucleotide
synthesis cycle is progressing. The deprotection mecha-
nism of each phosphate protecting group is consistent
with a well-studied intramolecular cyclodeesterification
reaction,5 which has also been experienced by others.6
Each thermolytic group has its unique attributes in terms
of commercial availability and cost-effectiveness, struc-
tural features, ease of incorporation into phosphoramidite
monomers, solubility and stability properties conferred
to phosphoramidites, coupling efficiency of phosphora-
midites, and ease of thermal deprotection from oligo-
nucleotides. It seems therefore justified to search for
novel thermolytic groups with distinctive properties to
* To whom correspondence should be addressed. Tel: (301) 827-
5162. Fax: (301) 480-3256.
† National Institutes of Health.
‡ On leave from the Institute of Bioorganic Chemistry, Polish
Academy of Sciences, Poznan, Poland.
(1) (a) Guo, Q. M. Curr. Opin. Oncol. 2003, 15, 36-43. (b) Rhodes,
D. R.; Chinnaiyan, A. M. J . Invest. Surg. 2002, 15, 275-279.
(2) Chmielewski, M. K.; Marcha´n, V.; Cies´lak, J .; Grajkowski, A.;
Livengood, V.; Mu¨nch, U.; Wilk, A.; Beaucage, S. L. J . Org. Chem. 2003,
68, 10003-10012.
(3) (a) Grajkowski, A.; Wilk, A.; Chmielewski, M. K.; Phillips, L. R.;
Beaucage, S. L. Org. Lett. 2001, 3, 1287-1290. (b) Wilk, A.; Chmielew-
ski, M. K.; Grajkowski, A.; Phillips, L. R.; Beaucage, S. L. Tetrahedron
Lett. 2001, 42, 5635-5639. (c) Wilk, A.; Chmielewski, M. K.; Graj-
kowski, A.; Phillips, L. R.; Beaucage, S. L. J . Org. Chem. 2002, 67,
6430-6438. (d) Wilk, A.; Chmielewski, M. K.; Grajkowski, A.; Phillips,
L. R.; Beaucage, S. L. In Current Protocols in Nucleic Acid Chemistry;
Beaucage, S. L., Bergstrom, D. E., Glick, G. D., J ones, R. A., Eds.; J ohn
Wiley & Sons: New York, 2002; pp 3.9.1-3.9.15. (e) Cies´lak, J .;
Beaucage, S. L. J . Org. Chem. 2003, 68, 10123-10129.
(4) Grajkowski, A.; Cies´lak, J .; Chmielewski, M. K.; Marcha´n, V.;
Phillips, L. R.; Wilk, A.; Beaucage, S. L. Ann. N.Y. Acad. Sci. 2003,
1002, 1-11.
10.1021/jo035861f This article not subject to U.S. Copyright. Published 2004 American Chemical Society
Published on Web 03/09/2004
J . Org. Chem. 2004, 69, 2509-2515 2509

Cies´lak et al.
SCHEME 2. Syn th esis of Deoxyr ibon u cleosid e
SCHEME 1a
P h osp h or a m id ites 10a -d
characterized by 31P NMR spectroscopy9 and high-resolu-
tion mass spectrometry.
To assess the thermolytic deprotection kinetics of the
4-methylthio-1-butyl phosphate/thiophosphate protecting
group, the dinucleoside phosphotriester 14 or 15 (Scheme
3) is prepared from the condensation of 10a with thymi-
dine covalently attached to long-chain alkylamine con-
trolled-pore glass (LCAA-CPG) through a 3′-O-succinyl
linker and 1H-tetrazole in dry MeCN. Oxidation/sulfur-
ization10 of the phosphite triester 11 (Scheme 3), followed
by cleavage of the 5′-O-DMTr group under acidic condi-
tions, gives the solid-phase-linked phosphotriester 12 or
13. The dinucleotide is then released from LCAA-CPG
upon a short (∼3 min) exposure to pressurized methyl-
amine gas and eluted from the support with a triethyl-
ammonium acetate buffer (pH 7.0) to provide the di-
nucleoside phosphotriester 14 or 15. Reversed phase high
performance liquid chromatography (RP-HPLC) analysis
of 14 reveals a ∼12% postsynthetic loss of the phosphate
protecting group.11 Heating either 14 or 15 in the elution
buffer for 30 min at 55 °C results in complete cleavage
of the 4-methylthio-1-butyl group to afford the dinucleo-
side phosphodiester 16 or 17 as the major product (>99%)
detected by RP-HPLC analysis of the thermolytic depro-
tection reaction.12,13
a
Keys: DMTr, 4,4′-dimethoxytrityl; BP, thymin-1-yl, 4-N-ben-
zoylcytosin-1-yl, 6-N-benzoyladenin-9-yl, or 2-N-isobutyrylguanin-
9-yl.
enable one to select the group that will optimally address
specific experimental requirements. We now wish to
report the 4-methylthio-1-butyl group as a new thermo-
labile phosphate/thiophosphate protecting group in the
synthesis of oligodeoxyribonucleotides toward the pro-
duction of high quality diagnostic DNA microarrays and/
or therapeutic drugs for clinical studies.
Resu lts a n d Discu ssion
As for all thermolytic phosphate/thiophosphate pro-
tecting groups studied so far, the alcohol conferring
thermolytic properties is first converted to a phosphiny-
lating reagent. Thus, 4-methythio-1-butanol is trans-
formed into phosphorodiamidite 8 (Scheme 2) upon
reaction with bis(N,N-diisopropylamino)chlorophosphine
under conditions described earlier.3 Condensation of 87
with commercially available deoxyribonucleosides 9a -d
and 1H-tetrazole in anhydrous CH2Cl28 affords the deoxy-
ribonucleoside phosphoramidites 10a -d (Scheme 2),
which are purified by silica gel chromatography and
Participation of the 4-methylthio functionality to the
postulated cyclodeesterification reaction (Scheme 3) is
demonstrated via oxidation of 11 with a solution of tert-
(9) 31P NMR spectra are shown as Supporting Information.
(10) The oxidation reaction is performed using commercial 0.02 M
iodine in THF/pyridine/water, whereas the sulfurization reaction is
effected using 0.05 M 3H-1,2-benzodithiol-3-one 1,1-dioxide in MeCN
as recommended in the literature.24
(11) RP-HPLC analyses are performed with a 5-µm Supelcosil LC-
18S column (25 cm × 4.6 mm) under the following conditions: starting
from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1%
MeCN/min is pumped at a flow rate of 1 mL/min for 40 min and then
held isocratic for 20 min.
(12) Coincidentally, the thermolytic deprotection kinetics of the
4-methylthio-1-butyl phosphate/thiophosphate group from 14 or 15 are
very similar to those determined for the 3-(2-pyridyl)-1-propyl phosphate/
thiophosphate protecting group under similar conditions.3e Both groups
are cleaved from dinucleoside phosphotriesters within 30 min (t1/2 ∼225
s) or 5 min (t1/2 ∼40 s) upon heating in an aqueous buffer (pH 7.0) at
55 or 90 °C, respectively. By comparison, deprotection of the 3-(N-tert-
butylcarboxamido)-1-propyl group from dinucleoside phosphotriesters
is much slower (t1/2 ∼100 s3c) under similar thermolytic conditions (pH
7.0, 90 °C).
(13) Alternatively, treatment of 12 or 13 with concentrated NH4-
OH for 30 min at 25 °C followed by heating the ammoniacal solution
for 2 h at 55 °C also results in complete thermolytic cleavage of the
4-methylthio-1-butyl group to generate the dinucleoside phosphodiester
16 or 17 as the major (>99%) product.
(5) (a) Wilk, A.; Srinivasachar, K.; Beaucage, S. L. J . Org. Chem.
1997, 62, 6712-6713. (b) Wilk, A.; Grajkowski, A.; Phillips, L. R.;
Beaucage, S. L. J . Org. Chem. 1999, 64, 7515-7522. (c) Wilk, A.;
Grajkowski, A.; Srinivasachar, K.; Beaucage, S. L. Antisense Nucleic
Acid Drug Dev. 1999, 9, 361-366. (d) Wilk, A.; Grajkowski, A.; Phillips,
L. R.; Beaucage, S. L. J . Am. Chem. Soc. 2000, 122, 2149-2156. (e)
Wilk, A.; Grajkowski, A.; Chmielewski, M. K.; Phillips, L. R.; Beaucage,
S. L. In Current Protocols in Nucleic Acid Chemistry; Beaucage, S. L.,
Bergstrom, D. E., Glick, G. D., J ones, R. A., Eds.; J ohn Wiley & Sons:
New York, 2001; pp 2.7.1-2.7.12.
(6) (a) Van Houten, K. A.; Heath, D. C.; Pilato, R. S. J . Am. Chem.
Soc. 1998, 120, 12359-12360. (b) Guzaev, A. P.; Manoharan, M.
Tetrahedron Lett. 2000, 41, 5623-5626. (c) Guzaev, A. P.; Manoharan,
M. J . Am. Chem. Soc. 2001, 123, 783-793. (d) Zhang, S.-W.; Swager,
T. M. J . Am. Chem. Soc. 2003, 125, 3420-3421.
(7) Crude 8 is characterized by 1H and 13C NMR spectrocopies (data
shown in Experimental Section and spectra provided as Supporting
Information) and used without further purification.
(8) (a) Lee, H.-J .; Moon, S.-H. Chem. Lett. 1984, 1229-1232. (b)
Barone, A. D.; Tang, J .-Y.; Caruthers, M. H. Nucl. Acids Res. 1984,
12, 4051-4061.
2510 J . Org. Chem., Vol. 69, No. 7, 2004

Phosphate/ Thiophosphate Protecting Groups
SCHEME 3. Syn th esis of Din u cleosid e
P h osp h otr iester 14 or 15 a n d Th er m olytic
Clea va ge of th e 4-Meth ylth io-1-bu tyl P h osp h a te/
Th iop h osp h a te P r otectin g Gr ou p u n d er Neu tr a l
Con d ition sa
SCHEME 4a
a
Reagents and conditions: (i) 0.1 M t-BuOOH in decane/CH2Cl2
(1:4 v/v), 3 h or 0.5 M (1S)-(+)-(10-camphorsulfonyl)oxaziridine in
MeCN, 5 min; (ii) 3% TCA in CH2Cl2, 1 min; (iii) 0.25 M (EtO)3P
and 0.30 M NBS in MeCN, 2 h; (iv) concentrated NH4OH, 25 °C,
30 min; (v) concentrated NH4OH, 55 °C, 2 h. Keys: NBS,
N-bromosuccinimide.
phosphate/thiophosphate deprotection of 14 or 15. The
phosphate protecting group is also stable when 20 is
heated for 3 h at 90 °C in an aqueous buffer (pH 7.0).
The nucleophilicity of the 4-methanesulfinyl function is
considerably weaker than that of its 4-methylthio precur-
sor and thus validates the nucleophilic participation of
the 4-methylthio group in the thermolytic deprotection
of 14 or 15.
Given the stability of the 4-methanesulfinyl-1-butyl
group to thermolytic and standard deprotection condi-
tions, the use of tert-butyl hydroperoxide or (1S)-(+)-(10-
camphorsulfonyl)oxaziridine as an oxidant in the syn-
thesis of oligonucleotides functionalized with the thermo-
labile 4-methylthio-1-butyl phosphate protecting group
should therefore be avoided. This apparent limitation
can, however, be circumvented by converting 19 to 12
through reduction of the methanesulfinyl group by treat-
ment with a solution of triethyl phosphite and N-
bromosuccinimide in MeCN over a period of 2 h at 25 °C
(Scheme 4).16
a
Reagents and conditions: (i) 0.45 M 1H-tetrazole in MeCN, 1
min; (ii) 0.02 M I2 in THF/pyridine/water or 0.05 M 3H-1,2-
benzodithiol-3-one 1,1-dioxide in MeCN, 3 min; (iii) 3% trichloro-
acetic acid in CH2Cl2, 1 min; (iv) MeNH2 gas (2.5 bar), 3 min; (v)
0.1 M TEAA, pH 7.0; (vi) 55 °C, 30 min. Keys: Thy, thymin-1-yl;
LCAA-CPG, succinyl long-chain alkylamine controlled-pore glass;
TEAA, triethylammonium acetate.
Treatment of 12 with concentrated NH4OH to release
the dinucleotide from the support followed by heating the
ammoniacal solution for 2 h at 55 °C gives 16 as
essentially the sole nucleotidic product (>99%) detected
by RP-HPLC analysis of the reduction reaction.
butyl hydroperoxide14 or (1S)-(+)-(10-camphorsulfonyl)-
oxaziridine15 to give 19 (Scheme 4).
After cleavage of the 5′-O-DMTr group and release
from the CPG support, the dinucleoside phosphotriester
20 is isolated by RP-HPLC and characterized by mass
spectrometry. The phosphate protecting group in 20 is
completely stable to the conditions used for thermolytic
(16) Reverse engineering of the oxidation of oligonucleosidic phos-
phite triesters effected by NBS-DMSO in MeCN23 led to the develop-
ment of this mild reduction reaction. Even though the conversion of
19 to 12 went smoothly and near quantitatively (>99%), it should be
understood that the reduction reaction has not, as yet, been optimized
and thoroughly investigated in terms of potential nucleobase modifica-
tions and/or other side reactions that might occur with representative
oligonucleotides. Investigations addressing these concerns are currently
underway in our laboratory, and our findings on the scope and
limitations of this reduction reaction will be reported soon.
(14) Hayakawa, Y.; Uchiyama, M.; Noyori, R. Tetrahedron Lett.
1986, 27, 4191-4194.
(15) (a) Davis, F. A.; Towson, J . C.; Weismiller, M. C.; Lal, S.; Carroll,
P. J . J . Am. Chem. Soc. 1988, 110, 8477-8482. (b) Ugi, I.; J acob, P.;
Landgraf, B.; Rupp, C.; Lemmen, P.; Verfu¨rth, U. Nucleosides Nucle-
otides 1988, 7, 605-608.
J . Org. Chem, Vol. 69, No. 7, 2004 2511

Cies´lak et al.
To confirm the formation of sulfonium salt 18 as a
consequence of the thermolytic deprotection of nucleotidic
4-methylthio-1-butyl phosphate/thiophosphate protecting
groups (Scheme 3), we set out to produce the salt from
12 on a 2 µmol scale and characterize it by 1H NMR
spectroscopy. Specifically, the solid-phase-linked dinu-
cleoside phosphotriester is suspended in a solution of 0.1
M NaCl in D2O and heated for 30 min at 55 °C. 1H NMR
analysis of the supernatant reveals signals identical to
those of synthetic 18,17 when compared under similar
conditions.18 These data unambiguously demonstrate the
cyclodeesterification of 4-methylthio-1-butyl phosphate/
thiophosphate protecting groups under thermolytic depro-
tection conditions with concomitant formation of the
sulfonium salt 18.
Given the sensitivity of the 4-methylthio-1-butyl phos-
phate protecting group to certain oxidants (vide supra),
its reactivity toward the standard iodine oxidation re-
agent for oligonucleotide synthesis was reexamined.
Typically, RP-HPLC analysis of 14 that is produced from
exposure of 11 to 0.02 M I2 in THF/pyridine/water for a
period of time ranging from 3 to 180 min revealed the
presence of 20 to the extent of less than 0.5%. While the
concentration of 20 after a 180 min oxidation is not
different than that obtained after a 3 min oxidation, one
can safely conclude that 0.02 M I2 in THF/pyridine/water
does not oxidize the 4-methylthio functional group in 14
to a significant level during solid-phase oligonucleotide
synthesis.19 Altogether, our investigations on the prepa-
ration of 14 or 15 and on the facile thermolytic phosphate/
thiophosphate deprotection of these dinucleotides to 16
or 17 were encouraging and prompted us to employ
phosphoramidites 10a -d in the solid-phase synthesis of
d(ATCCGTAGCTAAGGTCATGC) along with that of its
fully phosphorothioated analogue.20 Commercial 2-cya-
noethyl deoxyribonucleoside phosphoramidites are also
used to synthesize identical oligonucleotides to compare
the coupling efficiency of these monomers with that of
10a -d under similar conditions.21
The solid-phase-linked 5′-O-DMTr-oligonucleotides are
released from the LCAA-CPG support upon treatment
with concentrated NH4OH for 30 min at 25 °C. Each
oligonucleotidic solution is then heated for 10 h at 55 °C
to thermally remove phosphate or thiophosphate protect-
ing groups from the respective oligonucleotide and com-
plete nucleobase deprotection. Comparative analysis of
the crude 5′-O-DMTr-oligonucleotides with each other in
terms of synthesis efficiency by assessing the ratio of full-
length 5′-O-DMTr-20-mers to shorter oligonucleotide
F IGURE 1. Polyacrylamide gel electrophoresis analysis of
d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioated
analogue under denaturing conditions (7 M urea, 1X TBE
buffer, pH 8.3). Left lane: crude oligomer synthesized from
commercial 2-cyanoethyl deoxyribonucleoside phosphoramid-
ites and deprotected by treatment with concentrated NH4OH
for 10 h at 55 °C. Middle lane: crude oligomer synthesized
from phosphoramidites 10a -d and deprotected under condi-
tions identical to those used for the 20-mer shown in the left
lane. Right lane: crude phosphorothioated oligomer synthe-
sized from 10a -d and deprotected under conditions identical
to those used for the 20-mer shown in the left lane. Unmodified
oligonucleotides are visualized as blue bands and fully thioated
oligonucleotides as purple bands, upon staining the gel with
Stains-all. Bromophenol blue is used as a marker and shows
as a large band, in each lane, at the bottom of the gel.
sequences is accomplished using RP-HPLC. Results of
the RP-HPLC analyses show that syntheses of the 20-
mer (Chart 1 in Supporting Information) and that of its
phosphorothioated analogue (Chart 2 in Supporting
Information) via phosphoramidites 10a -d are very com-
parable to those performed with commercial 2-cyanoethyl
deoxyribonucleoside phosphoramidites. Consistent with
these findings is the analysis of the same but 5′-O-
dedimethoxytritylated oligonucleotides by polyacrylamide
gel electrophoresis (PAGE) under denaturing conditions
(Figure 1). Careful examination of the stained gel reveals
that the intensity of bands corresponding to shorter than
full-length sequences relative to that of the band corre-
sponding to each full-length oligonucleotide is similar
regardless of whether the oligonucleotide was synthesized
using phosphoramidites 10a -d or 2-cyanoethyl deoxyri-
bonucleoside phosphoramidites.
To further demonstrate the comparability of d(ATC-
CGTAGCTAAGGTCATGC) prepared via 10a -d or 2-cy-
anoethyl deoxyribonucleoside phosphoramidites, these
20-mers were subjected to enzymatic digestion catalyzed
by bacterial alkaline phosphatase and snake venom
phosphodiesterase to assess whether any nucleobase
modifications might have been caused by the use of 10a -
d . RP-HPLC analyses of the enzymatic digests show
complete digestion of the oligonucleotides with no detect-
able nucleobase modification, thereby demonstrating that
phosphoramidites 10a -d can produce oligonucleotides of
quality comparable to those prepared using 2-cyanoethyl
deoxyribonucleoside phosphoramidites (Chart 3 in Sup-
porting Information).
(17) Compound 18 (as its chloride salt) is prepared from the reaction
of tetrahydrothiophene with methyl chloroformate. See: Byrne, B.;
Lafleur Lawter, L. M. Tetrahedron Lett. 1986, 27, 1233-1236.
(18) 1H NMR spectra of 18 produced from the thermolytic depro-
tection of 12 in D2O containing 0.1 M NaCl and that of synthetic 18 in
D2O are shown as Supporting Information.
(19) The origin of trace amounts of 20 contaminating 14 is still
unclear and is currently under investigation.
(20) Solid-phase synthesis of the fully thioated 20-mer involves
replacing the standard 0.02 M solution of iodine in THF/pyridine/water
with a 0.05 M solution of 3H-1,2-benzodithiol-3-one 1,1-dioxide in
MeCN and performing the capping reaction after the sulfurization
step.24
(21) Phosphoramidites 10a -d and the corresponding 2-cyanoethyl
deoxyribonucleoside phosphoramidites were used as 0.1 M solutions
in dry MeCN in accordance with a standard automated solid-phase
oligonucleotide synthesis program executed by a commercial DNA/RNA
synthesizer.
2512 J . Org. Chem., Vol. 69, No. 7, 2004

Phosphate/ Thiophosphate Protecting Groups
Whereas the 4-methylthio-1-butyl group for phosphate/
thiophosphate protection has been adequately tested in
the solid-phase synthesis of oligonucleotides on a small
scale (0.2 µmol), the protecting group may also be suitable
for the preparation of therapeutic oligonucleotides on a
large-scale (>50 mmol) to support clinical studies. In this
context, one must investigate whether oligonucleotides
synthesized via 10a -d would undergo nucleobase modifi-
cation5b under deprotection conditions similar to those
used for large-scale oligonucleotide syntheses. Thus,
thymidine, 2′-deoxycytidine, 2′-deoxyadenosine, 2′-deoxy-
guanosine, N4-benzoyl-2′-deoxycytidine, N6-benzoyl-2′-
deoxyadenosine, and N2-isobutyryl-2′-deoxyguanosine are
mixed with the sulfonium salt 18 in concentrations
approximating those existing in large-scale (>50 mmol)
oligonucleotide deprotection reactions and heated in NH4-
OH for 10 h at 55 °C. The model reaction is then analyzed
by RP-HPLC to determine the extent of nucleobase
modification, if any (Chart 4 in Supporting Information).
No significant nucleobase alkylation products or other
nucleoside modifications are detected under these condi-
tions, thereby indicating that the use of phosphoramidites
10a -d is suitable for large-scale preparations of thera-
peutic oligonucleotides.
Given that small-scale (0.2 µmol) solid-phase synthesis
of phosphorothioated oligonucleotides via 10a -d does not
generate substantial amounts of partially desulfurized
products (<5%) under postsynthesis processing condi-
tions on the basis of 31P NMR data (Chart 5 in Supporting
Information), it is nonetheless questionable as to whether
the sulfonium salt 18 can desulfurize phosphorothioated
oligonucleotides when produced in concentrations com-
parable to those prevailing under large-scale oligonucle-
otide deprotection conditions. To assess this concern, the
potassium salt of O,O-diethyl thiophosphate is used as
a model mimicking thioated oligonucleotides and is mixed
with 18 in concentrations and under conditions simulat-
ing large-scale oligonucleotide deprotection reactions (see
Experimental Section). 31P NMR analysis of the reaction
did not indicate any conversion of O,O-diethyl thiophos-
phate (δP ∼55 ppm) to O,O-diethyl phosphate (δP ∼2 ppm)
induced by the sulfonium salt 18 (Chart 6 in Supporting
Information). Consequently, it is likely that 18 will not
cause significant desulfurization of thioated oligonucle-
otides under a large-scale deprotection process.
with bis(N,N-diisopropylamino)chlorophosphine.3 Re-
placement of 10a with 22 in Scheme 3 also led to the
preparation of 16 or 17 under identical conditions.
Accurate RP-HPLC analysis of the thermolytic deprotec-
tion kinetics of the 2-(methylthio)ethyl group from di-
nucleotides homologous to 14 or 15 indicates that the
2-(methylthio)ethyl group is removed faster (t1/2 ∼115 s
at 55 °C) than the 4-methylthio-1-butyl group (t1/2 ∼225
s) under identical deprotection conditions.22 The ther-
molytic deprotection mechanism appears consistent with
that of a cyclodeesterification process, although no at-
tempts have been made at this time to characterize the
cyclodeesterification side product and evaluate the DNA-
modifying or phosphorothioate desulfurization properties
of such a species.
Con clu sion
The 4-methylthio-1-butyl group for phosphate/thio-
phosphate protection in the solid-phase synthesis of DNA
oligonucleotides is distinctive in its structural simplicity.
This protecting group is not much different than the
2-cyanoethyl group in terms of steric considerations, and
yet its versatility allows its removal from DNA oligo-
nucleotides under neutral conditions in an aqueous buffer
or under the basic conditions used to cleave the 2-cya-
noethyl group. We have demonstrated that the ther-
molytic deprotection of 4-methylthio-1-butyl phosphate/
thiophosphate protecting groups occurred through a
cyclodeesterification reaction, which resulted in the
simultaneous formation of a sulfonium salt side product.
This salt is essentially inert to DNA nucleobases and does
not cause significant desulfurization of phosphorothioate
diesters. A limitation in the use of the 4-methylthio-1-
butyl phosphate protecting group is the selection of the
oxidant necessary for converting phosphite to phosphate
triesters during oligonucleotide assembly via phosphora-
midite chemistry. Whereas the methylthio function is not
noticeably oxidized upon treatment with the standard
iodine solution routinely used in solid-phase oligonucle-
otide synthesis, the functional group is particularly
sensitive to (1S)-(+)-(10-camphorsulfonyl)oxaziridine and
tert-butyl hydroperoxide. However, this limitation is
negated by the facile conversion of oxidized methylthio
species to the original methylthio functional group by
treatment with N-bromosuccinimide and triethyl phos-
phite. Although the scope and limitations of this reduc-
tion method are currently under investigation, the method
is innovative in its ability to reverse the condition caused
by unwanted oxidation of methylthio groups.
A logical extension of our studies is to assess the
thermolytic properties of the 2-(methylthio)ethyl group
for potential phosphate/thiophosphate protection in oli-
gonucleotide synthesis. Specifically, the deoxyribonucleo-
side phosphoramidite 22 is synthesized from the conden-
sation of 9a with crude phosphorodiamidite 21 under
conditions identical to those described for the preparation
of 10a -d (Scheme 2).
Extension of this work has led us to evaluate the
2-(methylthio)ethyl group for phosphate/thiophosphate
protection in solid-phase oligonucleotide synthesis. Our
preliminary results indicate that the 2-(methylthio)ethyl
group is even faster-deprotecting than the 4-methylthio-
1-butyl group under identical thermolytic deprotection
conditions and thus deserves further investigations.
The thermosensitivity of 4-methylthio-1-butyl and that
of other previously studied phosphate/thiophosphate
(22) In agreement with our findings is the relative instability of bis-
(S-â-D-glucopyranosidyl-2-thioethyl) 3′-azido-3′-deoxythymidin-5′-yl phos-
phate in aqueous media reported earlier by others. See: Schlienger,
N.; Pe´rigaud, C.; Gosselin, G.; Imbach, J .-L. J . Org. Chem. 1997, 62,
7216-7221.
The phosphorodiamidite 21 is prepared, much like 8,
from the reaction of commercial 2-(methylthio)ethanol
J . Org. Chem, Vol. 69, No. 7, 2004 2513

Cies´lak et al.
N6-Ben zoyl-5′-O-(4,4′-d im eth oxytr ityl)-3′-O-[(N,N-d iiso-
p r op yla m in o)(4-m et h ylt h io-1-b u t yloxy)]p h osp h in yl-2′-
d eoxya d en osin e (10c). 31P NMR (121 MHz, CDCl3): δ 147.3,
protecting groups,3 along with the recent development
of heat-sensitive carbonates as 5′-hydroxyl protecting
groups,2 bring closer to reality the conceptual heat-driven
approach to the synthesis of DNA oligonucleotides on
planar glass surfaces proposed earlier.4
Finally, the application of the 4-methylthio-1-butyl
phosphate/thiophosphate protecting group to the large-
scale preparation of therapeutic DNA or RNA oligonucle-
otides is likely given the mild thermolytic conditions used
for its deprotection and the lack of side products being
produced during oligonucleotide deprotection that would
modify DNA nucleobases and/or compromise the resis-
tance of these oligonucleotides to nucleases through
partial desulfurization.
147.7. FAB-HRMS: calcd for
C
49H59N6O7PS (M + Cs)+
1039.2958, found 1039.2996.
N2-Isobu tyr yl-5′-O-(4,4′-d im eth oxytr ityl)-3′-O-[(N,N-d i-
isop r op yla m in o)(4-m eth ylth io-1-bu tyloxy)]p h osp h in yl-
2′-d eoxygu a n osin e (10d ). 31P NMR (121 MHz, CDCl3): δ
147.4, 147.8. FAB-HRMS: calcd for C46H61N6O8PS (M + Cs)+
1021.3064, found 1021.3011.
5′-O-(4,4′-Dim eth oxytr ityl)-3′-O-[(N,N-d iisop r op yla m i-
n o)-2-(m et h ylt h io)et h yloxy]p h osp h in yl-2′-d eoxyt h ym i-
d in e (22). This compound is prepared, purified, and isolated
in a manner identical to that used for the preparation of 10
a -d . 31P NMR (121 MHz, C6H6): δ 147.6, 148.0. FAB-
HRMS: calcd for C40H52N3O8PS (M + Cs)+ 898.2267, found
898.2256.
Exp er im en ta l Section
Isola tion a n d Ch a r a cter iza tion of S-Meth yltetr a h y-
d r oth iop h en iu m Ch lor id e (18). Dry phosphoramidite 10a
(40 mg, 50 µmol) is dissolved with 0.45 M 1H-tetrazole in
MeCN (250 µL) and added by syringe to a commercial
synthesis column containing thymidine covalently attached to
LCAA-CPG through a 3′-O-succinyl linker (50 mg, 2 µmol).
The suspension is then manually agitated, and after 3 min,
the phosphitylation reaction is stopped by flushing activated
10a off the column with MeCN (10 mL). A 0.02 M solution of
I2 in THF/pyridine/water (1 mL) is mixed with the CPG
support for 3 min. Excess oxidant is pushed through the
column with MeCN (10 mL), and a solution of 3% trichloro-
acetic acid (TCA) in CH2Cl2 (2 mL) is added to the column to
cleave the 5′-O-DMTr group over an exposure time of 1 min.
Excess TCA is washed off the column with MeCN (10 mL),
and the CPG support is air-dried prior to being transferred to
a 4-mL glass vial. A 0.1 M solution of NaCl in D2O is added to
the solid support, and the suspension is heated for 30 min at
55 °C in a heating block. The supernatant is syringed into a 5
mm NMR tube for analysis. 1H NMR spectrum of the solution
shows signals identical to those of 18, which has been
synthesized according to a published method.17 1H NMR (300
MHz, D2O): δ 3.49 (m, 2H), 3.25 (m, 2H), 2.69 (s, 3H), 2.23
(m, 4H). 13C NMR (75 MHz, DMSO-d6): δ 25.0, 27.6, 44.3.
FAB-HRMS: calcd for C5H11S (M+) 103.0581, found 103.0576.
P r ep a r a tion of Th ym id ilyl-(3′f5′)-th ym id in e [4-(m eth -
a n esu lfin yl)-1-bu tyl]p h osp h a te (20). Dry phosphoramidite
10a (20 mg, 25 µmol) is dissolved with 0.45 M 1H-tetrazole in
MeCN (250 µL) and added by syringe to a commercial
synthesis column containing thymidine covalently attached to
LCAA-CPG through a 3′-O-succinyl linker (8 mg, 0.2 µmol).
The suspension is manually agitated, and after 3 min, the
column is flushed with MeCN (10 mL). The CPG support is
then exposed to a 0.1 M solution of tert-butyl hydroperoxide
in decane/CH2Cl2 (1:4 v/v, 1 mL) over a period of 3 h. Excess
oxidant is washed off the column with MeCN (10 mL), and
the 5′-O-DMTr group is removed by treatment with a solution
of 3% TCA in CH2Cl2 (2 mL) for 1 min. Excess TCA is pushed
through the column with MeCN (10 mL). The dinucleotide is
then released from the CPG support upon treatment with
pressurized methylamine gas (2.5 bar, 3 min) and elution of
crude 20 from the column is accomplished with 0.1 M triethyl-
ammonium acetate buffer (pH 7.0, 1 mL). The dinucleoside
phosphotriester is then purified by RP-HPLC with a 5 µm
Supelcosil LC-18S column (25 cm × 4.6 mm) under the
following conditions: starting from 0.1 M triethylammonium
acetate pH 7.0, a linear gradient of 1% MeCN/min is pumped
at a flow rate of 1 mL/min for 40 min. Under these chromato-
graphic conditions, 20 appears as a mixture of diastereomers
exhibiting a retention time (tR) of 19.1 min. The material
corresponding to the peak is collected, and the eluates are
evaporated to dryness under reduced pressure. The dry
material is analyzed by high-resolution mass spectrometry.
FAB-HRMS: calcd for C25H37N4O13PS (M + Cs)+ 797.0870,
found 797.0899.
O-(4-Meth ylth io-1-bu tyl)-N,N,N′,N′-tetr aisopr opylph os-
p h or od ia m id ite (8). 4-Methylthio-1-butanol (2.7 mL, 22
mmol) is added by syringe to a stirred solution of bis(N,N-
diisopropylamino)chlorophosphine3c-e (20 mmol) in dry ben-
zene (100 mL). Formation of the phosphorodiamidite 8 at 25
°C is monitored by 31P NMR spectroscopy. Complete conversion
of bis(N,N-diisopropylamino)chlorophosphine (δP 135.5 ppm)
to 8 (δP 118.5 ppm) is achieved within 2 h. The suspension is
filtered, and the filtrate is evaporated to an oil under reduced
pressure. The crude phosphorodiamidite is used without
further purification in the preparation of 10a -d . 1H NMR (300
MHz, C6D6): δ 3.56 (m, 2H), 3.53 (sept, J ) 6.9 Hz, 2H), 3.49
(sept, J ) 6.9 Hz, 2H), 2.30 (m, 2H), 1.80 (s, 3H), 1.63 (m, 4H),
1.23 (d, J ) 6.9 Hz, 12H), 1.19 (d, J ) 6.9 Hz, 12H). 13C NMR
(75 MHz, C6D6): δ 15.2, 24.0, 24.1, 24.7, 24.8, 26.2, 31.1 (d,
J PC ) 9.6 Hz), 34.2, 44.6, 44.7, 64.1 (d, J PC ) 21.5 Hz). 31P
NMR (121 MHz, C6D6): δ 118.5.
O-2-(Met h ylt h io)et h yl-N,N,N′,N′-t et r a isop r op ylp h os-
p h or od ia m id ite (21). This phosphinylating reagent is pre-
pared in a manner identical to that of 8 and used without
further purification in the synthesis of phosphoramidite 22.1H
2
3
NMR (300 MHz, CDCl3): δ 3.71 (dt, J ) 7.2 Hz, J PH ) 7.7
Hz, 2H), 3.52 (sept, J ) 6.9 Hz, 2H), 3.49 (sept, J ) 6.9 Hz,
2H), 2.71(t, J ) 7.2 Hz, 2H), 2.13 (s, 3H), 1.15 (t, J ) 6.4 Hz,
24H). 13C NMR (75 MHz, CDCl3): δ 15.9, 23.6, 23.7, 24.5, 24.6,
35.4 (d, J PC ) 8.4 Hz), 44.2, 44.4, 63.5 (d, J PC ) 22.7 Hz). 31P
2
NMR (121 MHz, CDCl3): δ 121.5.
Gen er a l P r oced u r e for P r ep a r a tion of Deoxyr ibo-
n u cleosid e P h osp h or a m id ites 10a -d . To a stirred solution
of 9a -d (2.2 mmol) in dry CH2Cl2 (10 mL) is added by syringe,
under a positive pressure of argon, crude 8 (∼700 mg, 2 mmol)
followed by sublimed 1H-tetrazole (112 mg, 1.6 mmol). 31P
NMR analysis of the reaction indicates that 8 is completely
consumed within 2 h. Upon addition of triethylamine (1 mL),
the solution is then immediately concentrated to a syrup under
reduced pressure. The material is purified by silica gel
chromatography using benzene/triethylamine (9:1 v/v) as the
eluent. Fractions that are identified by TLC as containing the
product are pooled together and rotoevaporated under low
pressure to a white foam. The material is dissolved in dry
benzene, frozen, and then lyophilized under high vacuum to
give 10a -d as white powders in yields ranging from 72% to
85%.
5′-O-(4,4′-Dim eth oxytr ityl)-3′-O-[(N,N-d iisop r op yla m i-
n o)(4-m eth ylth io-1-bu tyloxy)]p h osp h in yl-2′-d eoxyth ym i-
d in e (10a ). 31P NMR (121 MHz, CDCl3): δ 147.6, 147.9. FAB-
HRMS: calcd for C42H56N3O8PS (M + Cs)+ 926.2580, found
926.2537.
N4-Ben zoyl-5′-O-(4,4′-d im eth oxytr ityl)-3′-O-[(N,N-d iiso-
p r op yla m in o)(4-m et h ylt h io-1-b u t yloxy)]p h osp h in yl-2′-
d eoxycytid in e (10b). 31P NMR (121 MHz, CDCl3): δ 147.5,
147.9. FAB-HRMS: calcd for
1015.2846, found 1015.2870.
C
48H59N4O8PS (M + Cs)+
2514 J . Org. Chem., Vol. 69, No. 7, 2004

Phosphate/ Thiophosphate Protecting Groups
P r oced u r e for Deter m in in g th e DNA-Mod ifyin g P r op -
er ties of 18. To thymidine, 2′-deoxycytidine, 2′-deoxyadeno-
sine, 2′-deoxyguanosine, N4-benzoyl-2′-deoxycytidine, N6-ben-
zoyl-2′-deoxyadenosine, and N2-isobutyryl-2′-deoxyguanosine
(0.5 mmol each) in a 7 mL screw-capped glass vial are added
18 (556 mg, 4 mmol), concentrated NH4OH (1.1 mL), and
MeCN (3 mL). The suspension solubilizes within 5 min when
heated at 55 °C. The solution is then kept at 55 °C for a total
time of 10 h. For comparison purposes, a control reaction is
performed in the absence of 18 under otherwise identical
conditions. Aliquots of the reaction mixtures are analyzed by
RP-HPLC under the chromatographic conditions used for the
purification of 20. Two negligible unidentified peaks exhibiting
a tR of 11.4 min (0.1%) and 14.8 min (0.2%), respectively, are
detected along with peaks corresponding to thymidine, 2′-
deoxycytidine, 2′-deoxyadenosine, 2′-deoxyguanosine, benz-
amide, and their individual trace amount impurities when
compared with the peaks observed from the analysis of the
control reaction (Supporting Information).
Ack n ow led gm en t. This research is supported in
part by an appointment to the Postgraduate Research
Participation Program at the Center for Biologics Evalu-
ation and Research administered by the Oak Ridge
Institute for Science and Education through an inter-
agency agreement between the U.S. Department of
Energy and the U.S. Food and Drug Administration.
Su p por tin g In for m a tion Ava ila ble: Materials and meth-
ods; preparation and characterization of oligonucleotides; 1H,
13C, and 31P NMR spectra of crude 8 and 21; 31P NMR spectra
of 10a -d and 22; 1H NMR spectra of 18; RP-HPLC chromato-
grams of crude 5′-DMTr-d(ATCCGTAGCTAAGGTCATGC)
and that of its fully phosphorothioated analogue synthesized
using 10a -d ; RP-HPLC chromatograms of the snake venom
phosphodiesterase and bacterial alkaline phosphatase diges-
tion of crude d(ATCCGTAGCTAAGGTCATGC); 31P NMR
spectra of crude phosphorothioated d(ATCCGTAGCTAAGGT-
CATGC); RP-HPLC chromatograms of analyses aimed at
determining the DNA-modifying properties of 18 under condi-
tions mimicking those of large-scale oligonucleotide deprotec-
tion reactions; and 31P NMR spectra of the reaction of O,O-
diethyl thiophosphate with 18 under conditions simulating
those of large-scale oligonucleotide deprotections. This material
is available free of charge via the Internet at http://pubs.acs.org.
P r oced u r e for Deter m in in g th e P h osp h or oth ioa te
Desu lfu r iza tion P r op er ties of 18. A solution of 0.5 M
potassium O,O-diethyl thiophosphate and 0.75 M 18 in
concentrated NH4OH is heated for 10 h at 55 °C. Analysis of
the reaction mixture by 31P NMR spectroscopy does not reveal
any conversion of O,O-diethyl thiophosphate (δP ∼55 ppm) to
O,O-diethyl phosphate (δP ∼2 ppm) (Supporting Information).
J O035861F
(24) Iyer, R. P.; Phillips, L. R.; Egan, W.; Regan, J . B.; Beaucage, S.
L. J . Org. Chem. 1990, 55, 4693-4699. See also: Regan, J . B.; Phillips,
L. R.; Beaucage, S. L. Org. Prep. Proc. Int. 1992, 24, 488-492.
(23) Uzagare, M. C.; Padiya, K. J .; Salunkhe, M. M.; Sanghvi, Y. S.
Bioorg. Med. Chem. Lett. 2003, 13, 3537-3540.
J . Org. Chem, Vol. 69, No. 7, 2004 2515