Modulating the activity of oligonucleotides by carbohydrate conjugation: Solid phase synthesis of sucrose-oligonucleotide hybrids

Article abstract of DOI:10.1039/b401819b

In order to expand the repertoire of available oligosaccharide- oligonucleotide hybrids, the on-line solid phase synthesis of oligonucleotides conjugated at the 3′- and/or 5′-end with a preformed disaccharide unit has been performed. The key compound in the synthetic scheme described here is an appropriate phosphoramidite derivative of fully protected sucrose, used in association with a solid support functionalized with DMT-protected sucrose. The sucrose units at both ends of selected oligonucleotide sequences were shown to increase their chemical and enzymatic stability, while not interfering with duplex formation and with the ability of G-rich sequences to adopt a quadruplex structure.

Full text of DOI:10.1039/b401819b

View Article Online / Journal Homepage / Table of Contents for this issue
Modulating the activity of oligonucleotides by carbohydrate
conjugation: solid phase synthesis of sucrose-oligonucleotide
hybrids
Matteo Adinolfi, Lorenzo De Napoli, Giovanni Di Fabio, Alfonso Iadonisi
and Daniela Montesarchio*
Dipartimento di Chimica Organica e Biochimica, Università degli Studi di Napoli “Federico II”,
Complesso Universitario di Monte S. Angelo, via Cynthia, 4, I-80126 Napoli, Italy
Received 6th February 2004, Accepted 27th April 2004
First published as an Advance Article on the web 7th June 2004
In order to expand the repertoire of available oligosaccharide-oligonucleotide hybrids, the on-line solid phase
synthesis of oligonucleotides conjugated at the 3Ј- and/or 5Ј-end with a preformed disaccharide unit has been
performed. The key compound in the synthetic scheme described here is an appropriate phosphoramidite derivative
of fully protected sucrose, used in association with a solid support functionalized with DMT-protected sucrose. The
sucrose units at both ends of selected oligonucleotide sequences were shown to increase their chemical and enzymatic
stability, while not interfering with duplex formation and with the ability of G-rich sequences to adopt a quadruplex
structure.
of sugar residues linked by glycosidic junctions is still a very
Introduction
challenging task.23,24 As a consequence, the preparation of
oligonucleotides conjugated to oligosaccharide chains is very
far from being optimised.
Since more than a decade ago, oligonucleotides (ODNs) of
specific sequence have been recognized as highly efficient and
selective gene expression inhibitors in antisense1 or antigene2 in
vitro experiments. In addition, interesting, non-antisense bio-
logical activities recently emerged also in specific short nucleic
acid sequences, called aptamers, acting as efficient protein-
binding agents.3 Unfortunately the therapeutic potential of
unmodified ODNs is dramatically limited by their poor cellular
uptake and lack of stability against enzymatic degradation.
Under in vivo conditions they are rapidly hydrolyzed by nucle-
ases and then cleared from the body through renal excretion.
Therefore intense research activity in this field has produced a
vast number of ODNs bearing chemical modifications in the
backbone, mainly at the sugar moiety or at the phosphodiester
linkages, in order to assure a prolonged in vivo half-life, still
preserving if not improving the hybridization capabilities of the
oligomers vs. the target complementary sequences.4 As an
alternative to the complete replacement of the natural ribose-
phosphate skeleton with different, more stable moieties, con-
jugation at the 3Ј- and/or 5Ј-end of ODNs with appropriate
molecules imparting specific physico-chemical properties has
often resulted in a successful approach, showing several advan-
tages.5,6 Among the various carriers attached to ODNs to
putatively improve their pharmacological profile, carbohydrates
may give rise to particularly useful conjugates for targeting cells
or tissues with DNA fragments. In fact, not only nuclease
resistance and internalisation can be increased, but also aggre-
gation processes can be greatly reduced. As a matter of fact, it is
well documented that cell surface sugar binding receptors
(lectins) specifically bind and internalise glyco-conjugates bear-
ing appropriate sugar residues.7,8 Numerous studies have been
carried out in the field of glycobiology by conjugating peptides
to carbohydrate-based ligands, thus exploiting carbohydrate–
protein interactions in order to enhance cellular uptake and
drug delivery processes.9–11 On the contrary, only a few
examples of glyco-conjugates of DNA have been reported in
the literature. In these syntheses, carbohydrates have been
profitably introduced either to increase the bioavailability of
ODN.12–18 or as scaffolds for producing artificial spatially-
controlled glycoclusters.19–22 Indeed, despite the many efforts
currently addressed to the solid phase synthesis of oligo-
saccharides, the regio- and stereocontrolled sequential addition
In our ongoing studies on the on-line solid phase synthesis
of modified oligonucleotides, we recently reported a straight-
forward protocol for the insertion of one glucose moiety at the
5Ј-OH end of oligonucleotides by direct solid phase glyco-
sidation, using a trichloroacetimidate donor sugar in the
presence of TMSOTf.25,26 The applicability of this extremely
practical and simple method is rather limited to oligo-
pyrimidine sequences, since the acidic conditions required for
trichloroacetimidate activation, though very mild, still induced
some depurination. In addition, the successive introduction of
other sugar residues on the polymer-supported chain, with the
aim of serially attaching glucose moieties to ODN chains, was
not explored, appearing intrinsically cumbersome and low-
yielding. Therefore we developed an alternative approach,
based on the usage of an appropriate glucose phosphoramidite
derivative, which can be incorporated at the last stage of
the automated oligonucleotide synthesis.27 Within this strategy,
it is possible to exploit efficient and high fidelity reactions, based
on the phosphoramidite chemistry, to generate hydrolytically,
enzymatically and thermally stable phosphodiester linkages
tethering the saccharide residues to one or both ends of the
oligonucleotide. The main advantages of a phosphoramidite-
based chemical strategy as an entry to glyco-conjugates of
ODNs can be summarized as follows: 1) the same chemistry is
exploited to elongate both the carbohydrate and the oligo-
nucleotide domains, so that a unique, on-line solid phase syn-
thetic protocol can be easily and profitably adopted; 2) several
saccharidic residues can be sequentially coupled with high
efficiency, since the reactivity of the corresponding phosphor-
amidites proved to be similar to that exhibited by a standard
nucleoside 3Ј-phosphoramidite, with typical coupling yields
superior to 98%; 3) the entire oligomer, including the sacchar-
idic surrogate domain, can be assembled by an automated
process; 4) the presence of the sugar-phosphate tail was shown
to protect the ODNs from nuclease degradation, while not alter-
ing the normal hybridization properties of the selected antisense
ODN sequence towards complementary nucleic acid fragments.
The first example of ODN chains conjugated with sugar
monomers through
a phosphodiester junction has been
reported in the literature by Akhtar and coworkers, who
T h i s j o u r n a l i s © T h e R o y a l S o c i e t y o f C h e m i s t r y 2 0 0 4
O r g . B i o m o l . C h e m . , 2 0 0 4 , 2, 1 8 7 9 – 1 8 8 6
1879

View Article Online
Scheme 1 Synthetic scheme for the preparation of building block 5 and support 7.
described the synthesis and use of a mannoside phosphor-
amidite derivative.12 Wong et al. synthesized ODNs functional-
ized with glucose- and lactose-phosphate units, baptising this
new class of DNA-carbohydrate hybrids ‘nucleo-glyco-
block 5 (Scheme 1), which was prepared in five steps and 12%
overall yield, starting from unprotected sucrose 1. The synthetic
procedure adopted here is essentially similar to the one already
described for the synthesis of the corresponding protected
glucose 4-phosphoramidite.27 Sucrose 1 was first converted, in a
one-pot reaction, into peracetylated compound 2 in 34% yield
by reaction with benzal bromide in pyridine, affording the
corresponding 4,6-benzylidene derivative, and subsequent
treatment with Ac2O/Py. The successive addition of I2 in
CH3OH allowed the selective removal of the benzylidene
protecting group, giving diol 3 in 54% yield. Reaction with
DMTCl and cat. DMAP in Py/Et3N gave desired 4 in 75%
yield. This was next phosphitylated by addition of 2-cyano-
conjugates’.14 More recently, starting from
a phosphor-
amidite derivative of N-acetylglucosamine, Wang and
Sheppard successfully prepared a 5Ј-glucosylated ODN, which
was then enzymatically converted into the corresponding Lewis
X conjugate.18
In an effort to expand the repertoire of easily accessible
carbohydrate-oligonucleotide conjugates by exploiting highly
efficient phosphoramidite chemistry, we here report the syn-
thesis of ODNs tethering a preformed disaccharide unit either
at the 5Ј- or 3Ј-end, or incorporated within the chain. As the
model disaccharide, we chose sucrose, many derivatives of
which were recently found to show multidrug resistance modu-
lator activity.28 To this purpose, sucrose-functionalized CPG
support 7 and protected sucrose phosphoramidite building
block 5 have been synthesized in few steps, and used in a typical
elongation cycle for the solid phase assembly of oligonucleo-
tides by standard phosphoramidite procedure.29 To test the
feasibility of the proposed synthetic strategy for the prepar-
ation of new ODN conjugates, several sucrose-ODN hybrids
have been synthesized and fully characterized by 1H, 31P NMR
and ESI-MS techniques.
ethyl-N,N-diisopropylamino-chlorophosphoramidite
and
DIPEA in anhydrous CH2Cl2, leading to 5 in 87% yield
after silica gel chromatography. To obtain support 7, inter-
mediate 4 was first succinylated by reaction with succinic
anhydride, giving 6 (65% yield). This was then reacted with
CPG-NH2 solid support in the presence of DCCI, leading to an
average functionalization of 0.07 meq/g, as evaluated by DMT
test. All the synthesized compounds were identified on the
basis of their 1H, 13C NMR and mass spectral data and
found to be pure within the detection limit of the NMR tech-
niques. In the case of phosphoramidite 5, 31P NMR data
confirmed its structure as a mixture of diastereomers at
phosphorus (see Fig. 1), showing the compound to be pure
from the H-phosphonate derivative. The homogeneity of
sucrose derivatives 5 and 6, after column chromatography, was
also checked by HPLC, which confirmed the compounds to be
more than 98% pure.
Results and discussion
The key compound in the synthesis of oligosaccharide-oligo-
nucleotide conjugates described here is saccharide building
O r g . B i o m o l . C h e m . , 2 0 0 4 , 2, 1 8 7 9 – 1 8 8 6
1880

View Article Online
Scheme 2 a: aq. NH4OH (conc.), 12 h, 55 ЊC.
of an oligonucleotide. Then 5 was inserted in the middle of a
short sequence, leading to 5ЈT-p-sucrose-p-C3Ј (9). Starting from
support 7, as a test for 3Ј-conjugation of ODN fragments, two
standard couplings with nucleoside 3Ј-phosphoramidites
were carried out, obtaining 5ЈC-p-A3Ј-p-sucrose (10), which
confirmed the high efficiency of coupling with the 6-OH
function of the glucose residue in the polymer-supported
disaccharide. The combined use of 5 and support 7 allowed the
preparation of 3Ј,5Ј-bis-conjugated trinucleotide sucrose-p-5ЈT-
p-C-p-A3Ј-p-sucrose 11. Also in the case of 3Ј,5Ј-conjugation,
the usual yields were observed, as calculated by colorimetric
DMT test during the chain assembly.
Fig. 1 31P NMR spectrum (161.98 MHz, CDCl3) of compound 5.
All the syntheses of the ODNs were carried out on a 5 µmol
scale by automated solid phase protocols, by employing slightly
modified phosphoramidite procedures.29 The final detachment
from the solid support and deprotection of the conjugated
oligomers were achieved by conc. aq. ammonia treatment at
55 ЊC for 12 h. The synthesized ODNs were then purified
by HPLC on an analytical anionic exchange column. As an
example, the HPLC profile of crude 11 is shown in Fig. 2
(panel A). The collected peaks were then desalted by gel
filtration chromatography on a Sephadex G25 column eluted
with H2O/EtOH 4 : 1 (v/v). The purity of the compounds
was then checked by RP-HPLC and their identity ascertained
by 1H, 31P NMR and ESI-MS analysis.
Building block 5 contains all the typical reactive functional
groups necessary in nucleotide monomers for standard ODN
assembly via the phosphoramidite strategy. So it could be
exploited, in connection with the usage of functionalized sup-
port 7, for the synthesis of several hybrids, as models for the
preparation of new ODN glyco-conjugates. In all the syntheses,
the reactivity of phosphoramidite 5 was similar to that typically
found in the coupling with a standard nucleoside 3Ј-phos-
phoramidite, i.e. in the range 96–98%, as evaluated by
spectroscopic DMT test. Hybrids 8, 9, 10 and 11, after HPLC
purification, have been fully characterized by 1H, 31P NMR and
ESI MS techniques.
As described in Scheme 2, phosphoramidite 5 was first
exploited in a standard coupling with a CPG-bound 2Ј-deoxy-
cytidine affording, after deprotection and detachment,
sucrose-p-5ЈC (8) as a model compound to mimic the solid phase
insertion of one sucrose phosphoramidite residue at the 5Ј-OH
The chemical stability of the sucrose conjugates was analysed
by incubating 1.0 OD of purified hybrid 11 at 37 ЊC in 1.0 mL
of a phosphate buffer (20 mM KH2PO4 aq. solution, pH 7.0,
containing 20% (v/v) CH3CN at pH = 7.0); no degradation was
observed even after 10 d in the HPLC profile on an analytical
O r g . B i o m o l . C h e m . , 2 0 0 4 , 2, 1 8 7 9 – 1 8 8 6
1881

View Article Online
Fig. 2 A: HPLC profile of crude 11 (Nucleogel SAX column –
Macherey-Nagel, 1000-8/46, linear gradient from 0 to 100% B in 30
min, flow rate 0.8 mL minϪ1, of buffer A: 20 mM KH2PO4 aq. solution,
pH 7.0, containing 20% (v/v) CH3CN, in H2O); B: HPLC profile of
purified 11 after 10 days of incubation at 37 ЊC in a phosphate buffer
(20 mM KH2PO4 aq. solution, pH 7.0).
anionic exchange column (Fig. 2, panel B). Compound 11 was
also completely stable in biological media: when incubated at
37 ЊC in bovine fœtal serum, no hydrolysis or degradation
products were found in the mixture, analysed by HPLC after
10 d. For comparison, unconjugated trimer 5ЈTCA3Ј, treated
under the same conditions, was completely degraded after
4 h of incubation.
We next studied the influence of sucrose units at the ends of
oligonucleotide chains on their recognition properties, due to
specific H-bonding abilities. As a first experiment, G-rich
sequences were chosen as valuable substrates for studying the
effect of this conjugation, in view of their well known
propensity to adopt stable G-quadruplex structures.30,31 In fact
they are highly represented in telomers and are responsible
for telomer stabilization and therefore deeply involved in
fundamental cellular processes as senescence. Particularly,
5ЈTGGGT3Ј,32 and 5ЈTGGGAG3Ј,33 have both been demon-
strated to give stable parallel four stranded quadruplex
Fig. 3 A: CD spectra of glycoconjugate 13 (blue line) and of 6-mer
5ЈTGGGAG3Ј (green line) at 3.3 × 10Ϫ5 M at 20 ЊC; B: CD spectra of
glycoconjugate 12 (blue line) and of 5-mer 5ЈTGGGT3Ј (green line) at
1.0 × 10Ϫ4 M at 20 ЊC.
currently underway to get a deeper insight into the structural
details of the synthesized quadruplex structures.
Successively, we investigated the duplex formation ability
of sucrose-conjugates of ODNs. Two 18-mers of sequence
d(5ЈGCGTGCCTCCTCACTGGC3Ј),34 having one sucrose-
phosphate residue either at the 3Ј or at the 5Ј-end (14 and 15,
Scheme 3), were therefore synthesized following a standard
automated phosphoramidite procedure. After ammonia
deprotection and HPLC purification, the conjugated ODNs
were characterised by MALDI-TOF mass spectrometry, giving
in both cases a single peak in accordance with the calculated
molecular weight. In order to evaluate the influence of the
sugar-phosphate tethers on the hybridization properties of the
synthesized ODNs, thermal denaturation studies were carried
out mixing glyco-conjugates 14 or 15 in 1 : 1 ratio with
complementary 22-mer d(5ЈTTGCCAGTGAGGAGGCACG-
CAT3Ј). The melting curves of both modified duplexes were
almost superimposable with that of the natural, unmodified
duplex (T m = 60 ЊC), thus showing that the conjugation
described here does not negatively interfere with the hybridis-
ation properties of ODNs.
complexes. Interestingly, as
a
consequence of their
characteristic structure, many 5Ј-derivatives of 5ЈTGGGAG3Ј
have displayed a significant biological activity as non antisense
anti-HIV agents.33 These model sequences have therefore been
conjugated with one sucrose unit via a phosphodiester linkage,
either to the 3Ј- or 5Ј-end, giving oligomers 12 and 13, respect-
ively. In order to verify that the ability of 5-mer 5ЈTGGGT3Ј and
6-mer 5ЈTGGGAG3Ј to form quadruplex structures was not
inhibited when a sucrose tail was attached at either end of the
oligonucleotide sequence, a CD analysis was undertaken on the
conjugated sucrose-p-5ЈTGGGAG3Ј and 5ЈTGGGT3Ј-p-sucrose
in comparison with the corresponding unmodified oligomers. It
has been found that the conformational behaviour of glyco-
conjugates 12 and 13 in the buffer 10 mM KH2PO4, 1.00 M KCl
and 0.1 mM EDTA, where typically G-rich sequences form
quadruplexes, is qualitatively very similar to one of the parent
oligomers. Particularly, in all the spectra a large positive band
at 260 nm and a negative band at 240 nm were apparent (see
Fig. 3), indicative of a parallel four stranded structure, stabil-
ized by a set of specific H-bond arrays.30–33 Interestingly, at
20 ЊC the CD profile of 13 showed an increased ellipticity in the
bands at 260 nm and at 240 nm in comparison with the parent
6-mer, thus showing that, upon insertion of one sucrose-
phosphate tether at the 5Ј-end of the oligomer, a stabilization
of the quadruplex structure occurred, in analogy with other 5Ј-
derivatives of the same sequence described in the literature.33
On the contrary, conjugation at the 3Ј-end caused a drop in the
positive and negative Cotton effects, at 260 nm and at 240 nm
respectively, indicating the presence of a less stable quadruplex
structure in 12 with respect to the unmodified oligomer.
Further studies, involving NMR and DSC analyses, are
Conclusions
In this paper we have synthesized, exploiting an on-line solid
phase procedure, new oligonucleotide hybrids, conjugated with
preformed sucrose units linked to the 3Ј and/or 5Ј OH groups
of the ODN chain through stable phosphodiester junctions.
The synthetic protocol we have developed is based on the
preparation of a stable phosphoramidite derivative of suitably
protected sucrose (5) and on the usage of a polymeric support
ad hoc functionalized with a DMT-protected sucrose residue
(7). In all cases, 7 and 5 exhibited the typical efficiency in
coupling with standard nucleosides 3Ј-phosphoramidite or with
standard functionalized CPG supports (i.e. 98% on average),
O r g . B i o m o l . C h e m . , 2 0 0 4 , 2, 1 8 7 9 – 1 8 8 6
1882

View Article Online
Scheme 3
which allowed the synthesis of several hybrid molecules. The
kept constant with a thermoelectrically controlled cell holder
presence of the sucrose tail was shown not to inhibit the ability
of G-rich sequences to adopt typical quadruplex structures, as
demonstrated by CD studies, neither of mixed sequence ODNs
to form stable duplexes with complementary DNA strands,
as evaluated by UV thermal denaturation studies. The disac-
charide tail significantly protected oligonucleotides from
chemical and enzymatic degradation.
(JASCO PTC-348).
Synthesis of phosphoramidite 5
Sucrose (1.50 g, 4.38 mmol) was suspended in pyridine (15 mL)
and the mixture was heated to 90 ЊC. Benzal bromide was
added in two aliquots (700 µL each, 4.2 mmol) within two
hours. After two hours from the last addition, the mixture was
cooled to room temperature, and acetic anhydride (5 mL)
was added. After completion of the reaction (TLC analysis),
methanol was added at 0 ЊC to destroy excess acetic anhydride.
The mixture was then extracted with DCM and the organic
phase was washed with water and taken to dryness. Silica gel
chromatography of the residue (eluent petroleum ether/ethyl
acetate from 75 : 25 to 70 : 30) furnished compound 2 (1.013 g,
yield 34%) as a foam.
Experimental
Materials and methods
NMR spectra were recorded on Bruker WM-400, Varian
Gemini 300 and Varian Inova 500 spectrometers. All chemical
shifts are expressed in ppm with respect to the residual solvent
signal. The solid support functionalizations were carried out in
a short glass column (5 cm length, 1 cm i.d.) equipped with a
sintered glass filter, a stopcock and a cap. The oligonucleotides
were assembled on a Millipore Cyclone Plus DNA synthesizer,
using commercially available 3Ј-O-(2-cyanoethyl)-N,N-diiso-
propylphosphoramidite 2Ј-deoxyribonucleosides as building
blocks.
2 – Rf (ethyl acetate/petroleum ether 1 : 1) 0.50; [α]20D = ϩ45.7
(c 0.2 in CH2Cl2); λmax (CH2Cl2)/nm 258 (ε/dm3 molϪ1 cmϪ1
1
371); H NMR data of 2 were identical to those previously
reported.35
13C NMR (50 MHz, CDCl3) δ 170.6, 170.3, 170.2, 170.2,
169.8, and 169.8 (6 × COCH3); 136.9 (aromatic quaternary C);
129.0, 128.2 and 126.1 (aromatic CH); 104.0 (C-2 Fru); 101.6
(benzylic CH benzylidene); 90.4 (C-1 Glc); 79.1, 78.8, 75.5,
74.7, 71.0, 68.7, 68.4 (C-3 Fru, C-4 Fru, C-5 Fru, C-2 Glc, C-3
Glc, C-4 Glc and C-5 Glc); 63.5, 63.3 and 63.1 (C-1 and C-6
Fru, C-6 Glc); 20.6 (COCH3).
The following abbreviations were used throughout the text:
Controlled Pore Glass (CPG), dichloroacetic acid (DCA),
dichloromethane
(DCM),
N,N-dicyclohexylcarbodiimide
(DCCI), diisopropylethylamine (DIPEA), N,N-dimethylamino-
pyridine (DMAP), 4,4Ј-dimethoxytrityl (DMT), fructose
residue of sucrose (Fru), glucose residue of sucrose (Glc),
pyridine (Py), triethylamine (TEA), triethylammonium bicarb-
onate (TEAB), trimethylsilyltriflate (TMSOTf ).
ESI-MS (positive ions): calculated mass for C31H38O17:
682.211; found: m/z 705.35 (M ϩ Na)ϩ; 721.29 (M ϩ K)ϩ.
Compound 2 (1.01 g, 1.48 mmol) was dissolved in a
solution of iodine in methanol (1%, 27.5 mL). The resulting
mixture was refluxed for 6 h and then sodium thiosulfate
was added at room temperature until the iodine was
consumed. The mixture was extracted several times with ethyl
acetate and the organic phase concentrated under reduced pres-
sure. Silica gel chromatography of the residue (eluent ethyl
acetate/hexanes 85 : 15) afforded pure diol 3 as a foam (474 mg,
yield 54%).
HPLC analyses and purifications were performed on a
Beckman System Gold instrument equipped with a UV
detector module 166 and a Shimadzu Chromatopac C-R6A
integrator. By HPLC analysis on a Partisphere Whatman RP18
analytical column (125 × 4.0 mm, 5 µm), eluted with a linear
gradient from 0 to 100% in 60 min of CH3CN in TEAB buffer
(0.1 M, pH 7.0), flow = 0.8 mL minϪ1, the isolated oligomers
8–15 were determined to be more than 98% pure. For the ESI
MS analyses a Waters Micromass ZQ instrument – equipped
with an Electrospray source – was used in the positive and/or
negative mode. For compounds 9, 10, 11, 12 and 13 the
reported mass is the calculated value on the basis of the com-
bination of the found multiple charged ions. MALDI TOF
mass spectrometric analyses were performed on a PerSeptive
Biosystems Voyager-De Pro MALDI mass spectrometer in the
Linear mode using a picolinic/3-hydroxypicolinic acid mixture
as the matrix. Optical rotations were measured with a Perkin
Elmer 141 polarimeter at 20 ЊC and are quoted in units of 10Ϫ1
3 – Rf (ethyl acetate/petroleum ether 9 : 1) 0.50; [α]20D = ϩ56.4
(c 0.4 in CH2Cl2); λmax (CH2Cl2)/nm 252, shoulder (ε/dm3 molϪ1
cmϪ1 109); 1H NMR (200 MHz, CDCl3) δ 5.62 (1H, d, J1,2 = 3.6
Hz, H-1 Glc); 5.44 (1H, d, J3,4 = 5.6 Hz, H-3 Fru); 5.37 (1H, t,
J3,4 = J4,5 = 5.6 Hz, H-4 Fru); 5.32 (1H, t, J2,3 = J3,4 = 9.2 Hz, H-3
Glc); 4.76 (1H, dd, H-2 Glu); 4.52–4.18 (5H, overlapped
signals, H2-1 Fru, H-5 Fru, and H2-6 Fru); 3.98 (1H, m, H-5
Glc); 3.90 (1H, dd, J5,6a = 3.0 Hz, J6a,6b = 12.6 Hz, H-6a Glc);
3.79 (1H, dd, J5,6b = 5.0 Hz, J6a,6b = 12.6 Hz, H-6b Glc); 3.63
(1H, t, J3,4 = J4,5 = 9.2 Hz, H-4 Glc); 2.16, 2.10, 2.10, 2.09, 2.09
and 2.09 (3H each, s’s, 6 × –COCH3).
deg cm2
g
Ϫ1. UV measurements and thermal denaturation
experiments (detection at λ = 260 nm) were carried out on a
JASCO V-530 UV spectrophotometer equipped with a JASCO
ETC-505T temperature controller unit. CD spectra were
obtained on a JASCO 715 circular dichroism spectrophoto-
meter at 20 ЊC in a 0.1 cm pathlength cuvette. Temperature was
13C NMR (50 MHz, CDCl3) δ 171.2, 171.0, 170.3, 170.2,
170.1 and 169.9 (6 × COCH3); 103.8 (C-2 Fru); 90.0 (C-1 Glc);
78.9, 75.6, 74.9, 72.8, 72.2, 70.4 and 69.2 (C-3 Fru, C-4 Fru, C-5
Fru, C-2 Glc, C-3 Glc, C-4 Glc and C-5 Glc); 63.9, 62.8 and
61.8 (C-1 and C-6 Fru, C-6 Glc); 20.6 (COCH3).
O r g . B i o m o l . C h e m . , 2 0 0 4 , 2, 1 8 7 9 – 1 8 8 6
1883

View Article Online
ESI-MS (positive ions): calculated mass for C24H34O17:
594.180; found: m/z 617.30 (M ϩ Na)ϩ; 633.24 (M ϩ K)ϩ.
Compound 3 (450 mg, 0.76 mmol) and DMAP (4.5 mg,
0.038 mmol) were dissolved in 6 mL of anhydrous pyridine. To
the stirred solution, DMTCl (282 mg, 0.83 mmol) and TEA
(120 µL, 0.85 mmol) were sequentially added and the mixture
was left overnight under stirring and then concentrated under
reduced pressure. Silica gel chromatography of the residue
(eluent petroleum ether/ethyl acetate 1 : 1) afforded compound
4 as a white foam (513 mg, yield 75%).
ESI-MS (positive ions): calculated mass for C54H69N2O20P:
1096.418; found m/z 1097.56 (M ϩ H)ϩ; 1120.73 (M ϩ Na)ϩ.
Synthesis of functionalized support 7
Compound 4 (250 mg, 0.28 mmol) and DMAP (68 mg, 0.56
mmol) were dissolved in anhydrous pyridine and succinic
anhydride (50 mg, 0.50 mmol) was added to the resulting
solution. The mixture was kept under stirring for 60 hours at
room temperature and then concentrated. Silica gel chromato-
graphy of the residue (eluent DCM/methanol from 95 : 5 to
9 : 1) afforded 6 as a foam (180 mg, yield 65%). Isolated
compound 6, redissolved in ethyl acetate and injected on an
analytical silica gel HPLC column (Macherey-Nagel Nucleosil
50-7 column, 4.6 × 250 mm, 7 µm) eluted with ethyl acetate,
flow = 0.8 mL minϪ1, detection at λ = 260 nm, gave a sole peak
(retention time 7.15 min).
4 – Rf (ethyl acetate/petroleum ether 3 : 2) 0.70; [α]20D = ϩ38.4
(c 0.2 in CH2Cl2); λmax (CH2Cl2)/nm 274 (ε/dm3 molϪ1 cmϪ1
2667); 1H NMR (200 MHz, CDCl3) δ 7.40–6.80 (13H, complex
signals, aromatic protons); 5.63 (1H, d, J1,2 = 3.6 Hz, H-1 Glc);
5.41 (1H, d, J3,4 = 5.6 Hz, H-3 Fru); 5.37 (1H, t, J2,3 = J3,4 = 10.2
Hz, H-3 Glc); 5.29 (1H, t, J3,4 = J4,5 = 5.6 Hz, H-4 Fru); 4.79
(1H, dd, H-2 Glu); 4.40–4.05 (7H, overlapped signals, H-4 Glc,
H-5 Glc, H2-1 Fru, H-5 Fru and H2-6 Fru); 3.77 (6H, s, 2 ×
OCH3); 3.36 (2H, d, J5,6a = J5,6b = 3.8 Hz, H2-6 Glu); 2.10, 2.10,
2.09, 2.08, 2.08 and 2.01 (3H each, s’s, 6 × COCH3).
6 – Rf (DCM/methanol 95 : 5) 0.40; [α]20 = ϩ48.7 (c 0.1 in
D
1
CH2Cl2); λmax (CH2Cl2)/nm 273 (ε/dm3 molϪ1 cmϪ1 2449); H
NMR (200 MHz, CDCl3) δ 7.40–6.85 (13H, complex signals,
aromatic protons); 5.75 (1H, d, J1,2 = 3.6 Hz, H-1 Glc); 5.50–
5.26 (4H, overlapped signals, H-3 Fru, H-4 Fru, H-3 Glc and
H-4 Glc); 4.92 (1H, dd, J2,3 = 9.4 Hz, H-2 Glc); 4.40–4.10 (6H,
overlapped signals, H-5 Glc, H2-1 Fru, H-5 Fru and H2-6 Fru);
3.75 (6H, s, 2 × OCH3); 3.34 (1H, br d, J6a,6b = 10.6 Hz, Ha-6
Glc); 2.98 (1H, dd, J5,6b = 3.0 Hz, Hb-6 Glc); 2.60–2.30 (4H, m,
two CH2 succinic group); 2.10, 2.10, 2.10, 2.07, 2.00 and 1.97
(3H each, s’s, 6 × COCH3).
13C NMR (50 MHz, CDCl3) δ 170.8, 170.6, 170.4, 170.0,
170.0 and 169.7 (6 × COCH3); 158.4, 144.5, 135.6 (aromatic C
DMT group); 129.9, 129.0, 128.0, 127.7, 126.6 and 113.0
(aromatic CH DMT group); 104.2 (C-2 Fru); 90.4 (C-1 Glc);
86.2 (non aromatic quaternary carbon of DMT group); 79.3,
75.6, 75.2, 71.9, 71.3, 70.6 and 70.0 (C-3 Fru, C-4 Fru, C-5 Fru,
C-2 Glc, C-3 Glc, C-4 Glc and C-5 Glc); 63.9, 62.7 and 62.4
(C-1 and C-6 Fru, C-6 Glc); 55.0 (OCH3 of DMT group); 20.6
(COCH3).
13C NMR (50 MHz, CDCl3) δ 174.6, 170.5, 170.4, 170.3,
170.3, 170.2, 169.7 and 169.7 (6 × COCH3 and ester succinic
CO); 158.3, 144.5, 136.7 (aromatic quaternary C DMT group);
130.0, 128.2, 127.6, 126.6 and 113.0 (aromatic CH DMT
group); 104.2 (C-2 Fru); 90.2 (C-1 Glc); 85.8 (non aromatic
quaternary carbon of DMT); 79.2, 75.6, 75.2, 70.6, 69.8, 69.7
and 68.4 (C-3 Fru, C-4 Fru, C-5 Fru, C-2 Glc, C-3 Glc, C-4 Glc
and C-5 Glc); 63.7, 62.7 and 60.9 (C-1 and C-6 Fru, C-6 Glc);
55.0 (-OCH3); 28.9 and 28.8 (succinic CH2); 20.6 (COCH3).
ESI-MS (negative ions): calculated mass for C49H56O22:
996.326; found: m/z 995.37 (M Ϫ H)Ϫ.
ESI-MS (positive ions): calculated mass for C45H52O19:
896.310; found: m/z 919.41 (M ϩ Na)ϩ; 935.40 (M ϩ K)ϩ.
To 255 mg of compound 4 (0.28 mmol), dissolved in 3 mL of
anhydrous dichloromethane, was added DIPEA (150 mL, 0.87
mmol) and 2-cyanoethyl-N,N-diisopropylamino-chlorophos-
phoramidite (95 µL, 0.42 mmol) under argon. After 30 minutes
the solution was diluted with ethyl acetate and the organic
phase was washed twice with brine and then concentrated.
Silica gel chromatography of the residue (eluent petroleum
ether/ethyl acetate from 3 : 2 to 2 : 3) afforded compound 5 as a
mixture (ca. 1 : 1, as evaluated on the basis of 1H and 31P NMR
spectra) of diastereomers (266 mg, yield 87%). Injected on an
analytical silica gel HPLC column (Macherey-Nagel Nucleosil
50-7 column, 4.6 × 250 mm, 7 µm) eluted with 35% ethyl acetate
in cyclohexane, flow = 0.8 mL minϪ1, detection at λ = 260 nm,
a sole, sharp peak (retention time 7.45 min) was found.
5 – Glassy solid. Rf (ethyl acetate/petroleum ether 1 : 1) 0.45;
1H NMR (500 MHz, CDCl3) δ 7.49–7.79 (26H, complex
signals, aromatic protons); 5.73 (2H, d, J1,2 = 4.5 Hz, H-1 Glc);
5.50–5.40 (4H, overlapped signals, H-3 Glc and H-3 Fru);
5.35–5.21 (2H, two apparent t’s, J = 5.2 and 4.8 Hz, H-4 Fru);
4.88–4.78 (2H, two dd’s, H-2 Glc); 4.35–3.93 (16H, overlapped
signals, H2-1, H-5 and H2-6 Fru, H-4 and H2-6 Glc); 3.77 (12H,
s, OCH3 of DMT group); 3.77–3.51 [6H, overlapped signals,
H-5 Glc and two CH(CH3)2]; 3.38 and 3.22 (2H each, t’s, two –
OCH2CH2CN); 2.53 and 2.25 (2H each, t’s, two –OCH2-
CH2CN); 2.11, 2.10, 2.09, 2.07, 2.00 and 1.98 (36H, s’s, six
COCH3); 1.04, 0.97 and 0.87 (24H, three d’s, J = 8.5 Hz, four
CH(CH3)2].
To a solution of compound 6 (170 mg, 0.17 mmol) in 2 mL of
anhydrous pyridine was added DCCI (144 mg, 0.70 mmol).
After 5 min the mixture was cannulated to a vessel containing
amino-functionalized CPG resin (240 mg). The mixture was left
under gentle vascular stirring for three days and then the resin
was filtered and repeatedly washed with dichloromethane and
methanol. Treatment of 5 mg of dried resin 7 with perchloric
acid/ethanol 3 : 2 and colorimetric assay of the released
dimethoxytrytyl cation allowed the determination of the
functionalization of the resin, which was 0.07 mmol gϪ1
.
Synthesis of hybrids 8, 9, 10 and 11. General procedure
The syntheses of hybrids 8, 9, 10 and 11 have been carried out
on an automated DNA synthesizer following standard phos-
phoramidite chemistry,29 using for the amidite unit (both
standard nucleosides 3Ј- phosphoramidite and phosphor-
amidite 5) a 40 mg mLϪ1 solution in anhydrous CH3CN. 50 mg
(3.5 µmol) of support 7 or 50 mg of the appropriate DMT-
nucleoside supported CPG (ca. 5 µmol) were used as the start-
ing solid support for each synthesis. In all the experiments,
incorporation of the sucrose-phosphate residue at the 5Ј-end or
within the chain occurred with yields in the range 96–98% (by
DMT test). Once the desired ODN sequence was completed,
the solid supports were treated with the DCA solution for the
final DMT removal and, after exhaustive washings with DCM
and CH3CN, left in contact overnight with a conc. aq. ammonia
solution at 55 ЊC. The filtered solutions and two washings with
H2O were concentrated under reduced pressure and then – for
compounds 8–10 – purified by HPLC on a Nucleosil 100-5 C18
column (4.6 × 250 mm, 7 µm) eluted with a linear gradient from
0 to 25% in 30 min of CH3CN in TEAB buffer (0.1 M, pH 7.0),
13C NMR (125 MHz, CDCl3) δ 170.4, 170.3, 170.0, 169.9 and
169.6 (COCH3); 158.2, 144.9, 136.0, 135.9, 135.7, 130.2, 130.1,
128.2, 127.4, 126.5 and 112.7 (aromatic carbons DMT group);
117.4 (CN); 104.3 and 104.2 (C-2 Fru); 90.1 (C-1 Glc); 85.7
(quaternary C of DMT group); 79.4 (C-5 Fru); 75.8, 75.7 and
75.6 (C-3 Fru, C-4 Fru and C-3 Glc); 71.8, 71.6, 70.7 and 70.2
(C-2 Glc, C-4 Glc and C-5 Glc); 63.8, 63.6 and 62.5 (C-1 Fru,
C-6 Fru and C-6 Glc); 58.6 and 58.1 (OCH2CH2CN); 55.0
(OCH3 DMT group); 42.9 and 42.6 [CH(CH3)2]; 24.3 and 24.2
[CH(CH3)2]; 21.3, 21.0, 20.5, 20.3, 20.0 and 19.9 (COCH3 and
OCH2CH2CN).
31P NMR (161.98 MHz, CDCl3) δ 153.0 and 152.3.
O r g . B i o m o l . C h e m . , 2 0 0 4 , 2, 1 8 7 9 – 1 8 8 6
1884

View Article Online
flow = 0.8 mL minϪ1. The final products were lyophilized several
times to remove the triethylammonium bicarbonate salt and
characterized by NMR and MS data. Crude 11 was purified by
HPLC on a Nucleogel SAX column (Macherey-Nagel, 1000-8/
46), using a linear gradient from 0 to 100% B in 30 min, flow
rate 0.8 mL minϪ1, of buffer A: 20 mM KH2PO4 aq. solution,
pH 7.0, containing 20% (v/v) CH3CN, in H2O, and successively
desalted by gel filtration on a Sephadex G25 column eluted with
H2O/EtOH 4 : 1 (v/v).
mated DNA synthesizer following a standard phosphoramidite
protocol with final DMT removal.29 Two G-rich sequences were
assembled (12 and 13), observing in all cases coupling yields
greater than 97%, on average, as evaluated by DMT test. The
oligomers were detached from the support and deprotected by
conc. aq. ammonia treatment as described for hybrids 8–11.
The supernatant was filtered and the support washed with H2O.
The combined filtrates and washings were concentrated under
reduced pressure, redissolved in H2O and analyzed and purified
by HPLC on a Nucleogel SAX column (Macherey-Nagel,
1000-8/46); buffer A: 20 mM KH2PO4 aq. solution, pH 7.0,
containing 20% (v/v) CH3CN; buffer B 1 M KCl, 20 mM
KH2PO4 aq. solution, pH 7.0, containing 20% (v/v) CH3CN; a
linear gradient from 0 to 100% B in 20 min, flow rate 0.8 mL
minϪ1, for 12, and in 40 min for 13 was used. The isolated
oligomers, having the following retention times: 12 = 10.45 min;
13 = 16.62 min, were collected and successively desalted by gel
filtration on a Sephadex G25 column eluted with H2O/EtOH 4 :
1 (v/v). By HPLC analysis on a Nucleosil 100-5 C18 analytical
column (4.6 × 250 mm, 7 µm), the isolated oligomers were
determined to be more than 98% pure. In the HLPC profile on
the SAX column of both crudes, two main peaks were found,
respectively at 10.45 and 15.30 min for 12, and at 16.62 min
and 27.16 min for 13, which were all collected and desalted. As
also reported by others for similar G-rich sequences,33 in all
the purification attempts by HPLC, the faster eluting peak,
attributed to the single stranded 5-mer or 6-mer, was always
accompanied by a major peak, having a higher retention time.
This additional peak was attributed to a G-quadruplex
structure generated under HPLC elution conditions. In fact, by
re-injecting on HPLC the isolated and desalted faster eluting
peak, the slower eluting peak was always observed; in addition,
the two isolated peaks for each crude, analyzed by ESI-MS in
several conditions, showed the same m/z ion pattern. On the
basis of this evidence, the peak at higher retention time has
been attributed to a non-covalent adduct obtained by self-
assembly of the monomeric oligomer. After lyophilization, the
isolated compounds were characterized by ESI-MS data.
Compound 12: ESI-MS: calculated mass: 1938; found
1938.28.
Compound 8: retention time 10.44 min; 1H NMR (400 MHz,
D2O), δ 7.86 (1H, d, J = 7.6 Hz, H-6 C); 6.30 (1H, dd, J = 6.4
and 6.6 Hz, H-1Ј); 6.08 (1H, d, J = 7.6 Hz, H-5 C); 5.44 (1H, d,
J = 4.0 Hz, H-1 Glc); 4.47 (1H, m, H-3Ј); 4.22 (4H, overlapped
signals, H-4Ј, H2-5Ј C and H-4 Glc); 4.11 (1H, m, H-3 Fru);
4.08–3.77 (8H, overlapped signals, H-3, H-5, H2-6 Glc and H-4,
H-5 and H2-6 Fru); 3.71 (2H, s, H2-1 Fru); 3.62 (1H, m, H-2
Glc); 2.31 (2H, m, H2-2Ј).
31P NMR (161.98 MHz, D2O), δ 2.02.
ESI-MS: calculated mass for C21H34N3O17P: 631.481; found:
m/z 630.17 (M Ϫ H)Ϫ.
Compound 9: retention time 15.20 min; 1H NMR (500 MHz,
D2O), δ 7.97 (1H, d, J = 7.5 Hz, H-6 C); 7.67 (1H, s, H-6 T); 6.27
(2H, dd, J = 6.2 and 6.2 Hz, overlapped H-1Ј T and C); 6.11
(1H, d, J = 7.5 Hz, H-5 C); 5.43 (1H, d, J = 3.5 Hz, H-1 Glc);
H-3Ј of T residue is buried under the residual HDO solvent
signal; 4.57 (1H, m, H-3Ј of C); 4.27–4.13 (7H, overlapped
signals, 2 H-4Ј, H2-5Ј of C, H-4 and H2-6 Glc); 4.10 (1H, m, H-3
Fru); 4.02–3.78 (8H, overlapped H-3 and H-5 Glc, H-4, H-5
and H2-6 Fru and H2-5Ј of T); 3.67 (3H, overlapped signals,
H-2 Glc and H2-1 Fru); 2.62–2.23 (4H, m, H2-2Ј T and C); 1.90
(3H, s, CH3 T).
31P NMR (161.98 MHz, D2O), δ 2.89 and 2.35.
ESI-MS: calculated mass for C31H47N5O24P2: 935.675; found:
m/z 934.37 (M Ϫ H)Ϫ.
Compound 10: retention time 16.27 min; 1H NMR (400
MHz, D2O), δ 8.48 (1H, s, H-2 A); 8.20 (1H, s, H-8 A); 7.53
(1H, d, J = 8.0 Hz, H-6 C); 6.48 (1H, dd, J = 6.0 and 6.0 Hz,
H-1Ј A); 6.02 (1H, dd, J = 6.2 and 6.2 Hz, H-1Ј C); 5.92 (1H, d,
J = 8.0 Hz, H-5 C); 5.27 (1H, d, J = 3.5 Hz, H-1 Glc); 5.01 (1H,
m, H-3Ј A); 4.76 (1H, m, H-3Ј C); 4.48 (1H, m, H-4Ј A);
4.22–3.95 (7H, overlapped signals, H-4 and H2-6 Glc, H-3 Fru,
H-4Ј C and H2-5Ј A); 3.88–3.50 (11H, overlapped signals, H2-5Ј
C, H-2, H-3 and H-5 Glc and H2-1, H-4, H-5 and H2-6 Fru);
2.78 (2H, m’s, H2-2Ј A); 2.27 (2H, m’s, H2-2Ј C).
Compound 13: ESI-MS: calculated mass: 2276; found
2276.50.
For comparison, 5ЈTGGGT3Ј and 5ЈTGGGAG3Ј were
synthesized following standard solid phase protocols,29 on a 5
µmol scale. Deprotection and HPLC purification of the
oligomers were carried out as described above for 12 and 13.
The pure, isolated peaks were characterized by ESI MS,
showing masses in accordance with the calculated values.
31P NMR (161.98 MHz, D2O), δ 2.55 and 2.01;
ESI-MS: calculated mass for C31H46N8O22P2: 944.689; found:
943.44 (M Ϫ H)Ϫ.
Compound 11: retention time 8.89 min; 1H NMR (400 MHz,
D2O), δ 8.49 (1H, s, H-2 A); 8.23 (1H, s, H-8 A); 7.65 (1H, s,
H-6 T); 7.58 (1H, d, J = 7.6 Hz, H-6 C); 6.48 (1H, dd, J = 6.0
and 6.0 Hz, H-1Ј A); 6.30 (1H, dd, J = 6.0 and 5.8 Hz, H-1Ј T);
6.10 (1H, dd, J = 6.0 and 6.0 Hz, H-1Ј C); 6.02 (1H, d, J = 7.6
Hz, H-5 C); 5.44 (1H, d, J = 4.0 Hz, H-1 Glc at the 5Ј-end); 5.33
(1H, d, J = 3.6 Hz, H-1 Glc at the 3Ј-end); 5.09 (1H, m, H-3Ј A);
H-3Ј C residue and H-3Ј T residue are submerged by the
residual HDO solvent signal; 4.49 and 4.34 (1H each, m, two H-
4Ј); 4.24–3.53 (20H, overlapped signals, one H-4Ј and three H2-
5Ј A,C,T residues, H-2, H-3, H-4, H-5 and H2-6 Glc, H2-1, H-3,
H-4, H-5 and H2-6 Fru); 2.83, 2.45 and 2.29 (2H each, m’s, H2-
2Ј); 1.93 (3H, s, CH3 T).
Circular dichroism studies
The concentration of the conjugated ODNs was determined
spectrophotometrically at λ = 260 nm and at 90 ЊC, using the
molar extinction coefficient calculated for the unstacked
oligonucleotides using the following extinction coefficients:
15400 (A), 11700 (G) and 8800 (T) cmϪ1 MϪ1 36
, assuming the
contribution of the sugar residues to the absorbance at λ = 260
nm to be negligible. Compound 12 and 5-mer 5ЈTGGGT3Ј were
dissolved at c = 1.0 × 10Ϫ4 M, while 13 and the parent 6-mer
5ЈTGGGAG3Ј were dissolved at c = 3.3 × 10Ϫ5 M in the buffer 10
mM KH2PO4, 1.00 M KCl and 0.1 mM EDTA. All the samples
were first taken to 90 ЊC for 10 min, then slowly cooled to rt and
kept at 5 ЊC overnight. CD spectra were then registered at 20 ЊC
in a 0.1 cm pathlength cuvette. The wavelength was varied from
200 to 340 nm at 5 nm minϪ1. CD spectra were recorded with
a response of 16 s, at 2.0 nm bandwidth and normalised by
subtraction of the background scan with buffer. The molar
ellipticity was calculated from the equation [ϑ] = ϑ/cl where ϑ is
the relative intensity, c the concentration of the oligonucleotide
and l is the pathlength of the cell in cm.
31P NMR (161.98 MHz, D2O), δ 2.86, 2.54, 2.20 and 1.89.
ESI-MS: calculated mass for C53H80N10O42P4: 1652.338;
found: 1652.94.
Synthesis of conjugates 12 and 13 and of the parent
oligonucleotides
ODN chain assembly was performed on 50 mg (3.5 µmol) of
support 7 for 12, and on 50 mg of DMT-G-supported CPG
(Millipore, High Loading, ca. 0.1 meq/g) for 13, on an auto-
O r g . B i o m o l . C h e m . , 2 0 0 4 , 2, 1 8 7 9 – 1 8 8 6
1885

View Article Online
Synthesis of conjugates 14 and 15 and of the parent
oligonucleotides
(CIMCF), Università di Napoli “Federico II”, for the NMR
and MS facilities.
ODN chain assembly was performed on 50 mg (3.5 µmol) of
support 7 for 14 and on 50 mg of DMT-C-supported CPG
(Millipore, High Loading, ca. 0.1 meq/g) for 15. The syntheses
were carried out on an automated DNA synthesizer following a
standard phosphoramidite protocol with final DMT removal.29
Two successive coupling cycles (30 min each) with phos-
phoramidite 5 were carried out as the last step of the assembly
of 15. The oligomers were detached from the support and
deprotected by conc. aq. ammonia treatment as described for
hybrids 8–13. The supernatant was filtered and the support
washed with H2O. The combined filtrates and washings were
concentrated under reduced pressure, redissolved in H2O and
analyzed and purified by HPLC on a Nucleogel SAX column
(Macherey-Nagel, 1000-8/46); buffer A: 20 mM KH2PO4 aq.
solution, pH 7.0, containing 20% (v/v) CH3CN; buffer B 1 M
KCl, 20 mM KH2PO4 aq. solution, pH 7.0, containing 20% (v/v)
CH3CN; a linear gradient from 0 to 100% B in 30 min, flow
rate 0.8 mL minϪ1, was used. The isolated oligomers, having the
following retention times: 14 = 21.14 min; 15 = 22.65 min, were
collected and successively desalted by gel filtration on a
Sephadex G25 column eluted with H2O. By HPLC analysis on a
Nucleosil 100-5 C18 analytical column (4.6 × 250 mm, 7 µm),
the isolated oligomers were determined to be more than 98%
pure.
References
1 E. Uhlmann and A. Peyman, Chem. Rev., 1990, 90, 543–584.
2 N. T. Thuong and C. Hélène, Angew. Chem., Int. Ed. Engl., 1993, 32,
666–690.
3 M. Famulok, G. Mayer and M. Blind, Acc. Chem. Res., 2000, 33,
591–599.
4 Y. S. Sanghvi, in Carbohydrate Modifications in Antisense Research,
ed. P. Dan Cook, ACS Symposium Series, Washington, USA,
1994.
5 S. L. Beaucage and R. P. Iyer, Tetrahedron, 1993, 49, 1925–1963.
6 P. Virta, J. Katajisto, T. Niittymaki and H. Lonnberg, Tetrahedron,
2003, 59, 5137–5174.
7 C. F. Brewer, M. C. Miceli and L. G. Baum, Curr. Opin. Struct. Biol.,
2002, 12, 616–623.
8 M. W. Turner, Mol. Immunol., 2003, 40, 423–429.
9 H. Kunz, Angew. Chem., Int. Ed. Engl., 1987, 26, 294–308.
10 H. Paulsen, Angew. Chem., Int. Ed. Engl., 1990, 29, 823–938.
11 B. G. Davis, Chem. Rev., 2002, 102, 579–601.
12 S. Akhtar, A. Roudledge, R. Patel and J. M. Gardiner, Tetrahedron
Lett., 1995, 36, 7333–7336.
13 T. Ren and D. Liu, Tetrahedron Lett., 1999, 40, 7621–7625.
14 T. L. Sheppard, C.-H. Wong and G. F. Joyce, Angew. Chem. Int. Ed.,
2000, 39, 3660–3663.
15 D. Forget, R. Renaudet, E. Defrancq and P. Dumy, Tetrahedron
Lett., 2001, 42, 7829–7832.
16 M. A. Maier, C. G. Yannopoulos, N. Mohamed, A. Roland,
H. Fritz, V. Mohan, G. Just and M. Manoharan, Bioconjugate
Chem., 2003, 14, 18–29.
Compound 14 MALDI-TOF MS (negative mode): found:
m/z 5827.95 (M Ϫ H)Ϫ.
17 M. Dubber and J. M. J. Frechet, Bioconjugate Chem., 2003, 14,
239–246.
Compound 15 MALDI-TOF MS (negative mode): found:
m/z 5828.42 (M Ϫ H)Ϫ.
18 Y. Wang and T. L. Sheppard, Bioconjugate Chem., 2003, 14,
For comparison, d(5ЈGCGTGCCTCCTCACTGGC3Ј) and
d(5ЈTTGCCAGTGAGGAGGCACGCAT3Ј) were synthesized
on a 5 µmol scale, following standard solid phase protocols.29
Deprotection and HPLC purification of the oligomers were
carried out as described above for 14 and 15. The pure, isolated
peaks were characterized by MALDI-TOF mass spectrometry,
showing masses in accordance with the calculated values.
1314–1322.
19 K. Matsuura, M. Hibino, M. Kataoka, Y. Hayakawa and
K. Kobayashi, Tetrahedron Lett., 2000, 41, 7529–7533.
20 K. Matsuura, M. Hibino, Y. Yamada and K. Kobayashi, J. Am.
Chem. Soc., 2001, 123, 357–358.
21 S. Sando, K. Matsui, Y. Niinomi, N. Sato and Y. Aoyama, Bioorg.
Med. Chem. Lett., 2003, 13, 2633–2636.
22 K. Matsuura, M. Hibino, T. Ikeda, Y. Yamada and K. Kobayashi,
Chem. Eur. J., 2004, 10, 352–359.
Thermal denaturation experiments
23 B. G. Davis, J. Chem. Soc., Perkin Trans. 1, 2000, 2137–2160.
24 P. H. Seeberger and W. Haase, Chem. Rev., 2000, 100, 4349–4394.
25 M. Adinolfi, G. Barone, L. De Napoli, L. Guariniello, A. Iadonisi
and G. Piccialli, Tetrahedron Lett., 1999, 40, 2607–2610.
26 M. Adinolfi, L. De Napoli, G. Di Fabio, L. Guariniello,
A. Iadonisi, A. Messere, D. Montesarchio and G. Piccialli, Synlett,
2001, 6, 745–748.
The concentration of the synthesized ODNs was determined
spectrophotometrically at λ = 260 nm and at 85 ЊC, using the
molar extinction coefficient calculated for the unstacked oligo-
nucleotide using the following extinction coefficients: 15400
(A); 11700 (G); 7300 (C); 8800 (T) cmϪ1 MϪ1 36
. For oligomers
27 M. Adinolfi, L. De Napoli, G. Di Fabio, A. Iadonisi,
D. Montesarchio and G. Piccialli, Tetrahedron, 2002, 58, 6697–6704.
28 N. Murakami, S. Tamura, E. Iwata, S. Aoki, S. Akiyama and
M. Kobayashi, Bioorg. Med. Chem. Lett., 2002, 12, 3267–3270.
14 and 15, the contribution of the carbohydrate residues to the
absorbance at λ = 260 nm was considered negligible. A 100 mM
NaCl, 10 mM NaH2PO4, aq solution at pH = 7.0 was used for
the melting experiments. Melting curves were recorded using a
concentration of approximately 1 µM for each strand in 1 mL
of the tested solution in Teflon stoppered quartz cuvettes of
1 cm optical path length. The resulting solutions were then
allowed to heat at 85 ЊC for 10 min, then slowly cooled and kept
at 5 ЊC for 30 min. After thermal equilibration at 10 ЊC, UV
absorption at λ = 260 nm was monitored as a function of the
temperature, increased at a rate of 0.5 ЊC/min, in the range
20–80 ЊC. The melting temperatures, determined as the maxima
of the first derivative of absorbance vs. temperature plots, are
the average values of three independent melting experiments.
For all the studied cases, both the modified duplexes and the
unmodified one, within the experimental error evaluated as
0.5 ЊC, exhibited a melting temperature value of 60 ЊC.
29 Oligonucleotides and Analogues:
a Practical Approach, ed.
F. Eckstein, IRL Press, Oxford, 1991.
30 S. M. Kerwin, Curr. Pharm. Des., 2000, 6, 441–471.
31 M. A. Keniry, Biopolymers, 2001, 56, 123–146.
32 R. Jin, B. L. Gaffney, C. Wang, R. A. Jones and K. J. Breslauer,
Proc. Natl. Acad. Sci. USA, 1992, 89, 8832–8836.
33 H. Hotoda, M. Koizumi, R. Koga, M. Kaneko, K. Momota,
T. Ohmine, H. Furukawa, T. Agatsuma, T. Nishigaki, J. Sone,
S. Tsutsumi, T. Kosaka, K. Abe, S. Kimura and K. Shimada, J. Med.
Chem., 1998, 41, 3655–3663.
34 This ODN sequence is complementary to a tract of mRNA of
protein kinase A type 1 (PKA1), subunit RIα, overexpressed in the
majority of human cancers and well recognized as a relevant
target for therapeutic intervention against neoplasia; therefore
several modifications of this sequence have been designed for
antisense experiments and are currently under clinical trial. See for
example: G. Tortora, R. Bianco, V. Damiano, G. Fontanini, S. De
Placido, R. Bianco and F. Ciardiello, Clin. Cancer Res., 2000, 6,
2506–2512.
Acknowledgements
35 R. Khan, Carbohydr. Res., 1974, 32, 375–379.
We thank MIUR (PRIN) for grants in support of this
investigation and Centro di Metodologie Chimico-Fisiche
36 Handbook of Biochemistry and Molecular Biology, Volume I,
Nucleic Acids, ed. G. D. Fasman, 3rd edn., CRC Press, 1975, p. 589.
O r g . B i o m o l . C h e m . , 2 0 0 4 , 2, 1 8 7 9 – 1 8 8 6
1886