An on-bead tailing/ligation approach for sequencing resin-bound RNA libraries

Article abstract of DOI:10.1093/nar/gks004

Nucleic acids possess the unique property of being enzymatically amplifiable, and have therefore been a popular choice for the combinatorial selection of functional sequences, such as aptamers or ribozymes. However, amplification typically requires known

Full text of DOI:10.1093/nar/gks004

Published online 31 January 2012
Nucleic Acids Research, 2012, Vol. 40, No. 9 e68
doi:10.1093/nar/gks004
An on-bead tailing/ligation approach for sequencing
resin-bound RNA libraries
¨
Anna Wiesmayr, Pierre Fournier and Andres Jaschke*
Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Im Neuenheimer Feld 364,
Heidelberg 69120, Germany
Received December 22, 2010; Revised October 6, 2011; Accepted December 23, 2011
as binding partners for small molecules or proteins
(aptamers) or to catalyse reactions (ribozymes) (1–3).
A broad range of potential applications in diagnostics,
biotechnology and therapy has stimulated the search for
such active nucleic acids, commonly performed via
SELEX (Systematic Evolution of Ligands by Exponential
Enrichment), where iterative enrichment of nucleic acids
with tight binding properties or high catalytic activity is
achieved over several rounds of selection (4–6). SELEX
has been tremendously successful as it allows working
with libraries of enormous complexity (typically
1014–1015 different sequences), but it has some shortcom-
ings: it is practically impossible to site-specifically incorp-
orate individual chemical modifications; and only very few
physical or chemical properties can be queried by the
selection event.
Over the past years, alternative strategies have been de-
veloped to optimize the isolation process of active nucleic
acids (7–10). One interesting approach exploits the
split-and-mix technique, a well-known procedure from
the field of combinatorial peptide chemistry (11), to
generate OBOC (one-bead one-compound) libraries, in
which each bead carries multiple copies of a single
sequence. Yang et al. were the first to report on-bead
screening of OBOC libraries for the isolation of oligo-
nucleotide aptamers. These authors created on-bead
DNA libraries in which specific phosphodiester groups
were replaced by phosphorothioates and phosphoro-
dithioates, and isolated an efficient aptamer against a
transcription factor (12). Recently, our group reported
the isolation of a fluorescence-enhancing RNA tag out
of an on-bead OBOC RNA library (13). In addition to
the inclusion of chemical modifications, the advantage of
on-bead screening in comparison to SELEX lies in the
possibility for direct read-out: while SELEX selects only
for binding strength or catalytic attachment or detach-
ment to/from a matrix, on-bead screening can directly
report measurable physical properties like a fluorescence,
luminescence or polarization signal. This makes the tech-
nique suitable for high-throughput screening: over a short
period of time one can screen large libraries for a specific
ABSTRACT
Nucleic acids possess the unique property of being
enzymatically amplifiable, and have therefore been a
popular choice for the combinatorial selection of
functional sequences, such as aptamers or ribo-
zymes. However, amplification typically requires
known sequence segments that serve as primer
binding sites, which can be limiting for certain ap-
plications, like the screening of on-bead libraries.
Here, we report a method to amplify and sequence
on-bead RNA libraries that requires not more than
five known nucleotides. A key element is the attach-
ment of the starting nucleoside to the synthesis
resin via the nucleobase, which leaves the 30-OH
group accessible to subsequent enzymatic manipu-
lations. After split-and-mix synthesis of the oligo-
nucleotide library and deprotection, a poly(A)-tail
can be efficiently added to this free 30-hydroxyl
terminus by Escherichia coli poly(A) polymerase
that serves as an anchored primer binding site for
reverse transcription. The cDNA is joined to a DNA
adapter by T4 DNA ligase. PCR amplification yielded
single-band products that could be cloned and
sequenced starting from individual polystyrene
beads. The method described here makes the selec-
tion of functional RNAs from on-bead RNA libraries
more attractive due to increased flexibility in library
design, higher yields of full-length sequence on
bead and robust sequence determination.
INTRODUCTION
Over the past decades, nucleic acids have been shown to
exhibit unique properties that depend on their folding into
3D structures, rather than on the primary sequence infor-
mation. Such functional nucleic acids can either occur nat-
urally, for example, as modulators of transcription or
translation (riboswitches), or have been selected artificially
*To whom correspondence should be addressed. Tel: +49 6221 54 4851; Fax: +49 6221 54 6430; Email: jaeschke@uni-hd.de
ß The Author(s) 2012. Published by Oxford University Press.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

e68 Nucleic Acids Research, 2012, Vol. 40, No. 9
PAGE 2 OF 9
property, e.g. by making use of a FACS instrument.
At lower throughput, even mass-spectrometric or chroma-
tographic screening is possible, allowing for sophisticated
screening criteria (14,15).
was used as a size marker. Absorption measurements were
done with a Spectrophotometer Ultrospec 2100 pro
(Amersham Biosciences). All bead manipulations were
performed with a 2-ml pipette (Abimed) using a Nikon
SMZ 1500 microscope.
However, on-bead screening of OBOC oligonucleotide
libraries, as well as SELEX, is dependent on the presence
of conserved segments flanking the randomized region,
serving as primer binding sites for amplification and se-
quence determination of isolated positive hits. As the total
length of the RNA strands is limited by the coupling effi-
ciency of solid phase synthesis, extended conserved
regions restrict the number of variable nucleotides that
can be incorporated, limit the size and—most import-
antly—bias the structure of the library. Several groups
already described the severe limitations that are imposed
by the introduction of fixed segments in a library
sequence, including biased selection or difficulties with
the truncation of isolated motifs. For example,
Legiewicz et al. (16) showed that a pre-formed stable
stem within fixed flanking sequences had a 5- to 10-fold
negative effect on apparent motif abundance at all lengths
during selection. Furthermore, primer binding sites have
often been found to be involved in target recognition (17).
In the two examples cited (12,13), the constant regions
were even larger in size than the variable ones. Whereas
various approaches have been proposed to shorten or
remove primer binding sites in the context of SELEX
(16,18–21), there is still a need for complementary
methods using on-bead libraries that do not rely on
extended constant regions.
Synthesis of 50-O-(4,40-dimethoxytrityl)-20,30-O-bis-
(t-butyldimethylsilyl)-4-(1,2,4-triazolo)uridine 2
20,30,50-protected uridine 1 (22,23) (300 mg, 388 mmol) and
1,2,4-triazole (428 mg, 6.20 mmol) were suspended in an-
hydrous acetonitrile (3.5 ml) and triethylamine (1.23 ml,
8.91 mmol) under argon, and after stirring for 5 min a
clear, colourless solution was obtained. The flask was
put at 0ꢀC and POCl3 (71.0 ml, 776 mmol) was added
dropwise, whereupon a white solid precipitated. The ice
bath was removed and the reaction mixture stirred over-
night at room temperature. After the TLC control showed
full conversion, ethyl acetate (100 ml) was added and the
reaction mixture was washed with a 5% sodium bicarbon-
ate solution (2 ꢁ 100 ml) and brine (2 ꢁ 100 ml), dried over
anhydrous sodium sulphate and the solvents removed
in vacuo. The raw product was purified by column chro-
matography (ethyl acetate/hexanes/triethylamine 4:6:1)
to yield 295 mg (92%) of the title compound as a colour-
less foam.
1H NMR (300 MHz; CDCl3) d 9.26 (s, 1H), 9.09 (d,
1H), 8.09 (s, 1H), 7.43–7.24 (m, 9H), 6.91–6.85 (m, 4H),
6.50 (d, J = 7.2 Hz, 1H), 5.85 (s, 1H), 4.36–4.19 (m, 3H),
3.94 (dd, J = 2.2 Hz, 11.1 Hz, 1H), 3.83 (s, 6H), 3.45 (dd,
J = 1.4, 11.1 Hz, 1H), 0.94 (s, 9H), 0.75 (s, 9H), 0.34 (s,
3H), 0.19 (s, 3H), 0.00 (s, 3H), ꢂ0.09 (s, 3H). 13C NMR
(75.5 MHz; CDCl3) d 159.13, 158.80, 154.34, 153.76,
147.49, 143.40, 143.02, 134.84, 134.81, 130.36, 130.33,
128.63, 127.86, 113.14, 113.12, 94.41, 92.24, 87.28, 81.81,
75.81, 69.03, 60.16, 55.14, 25.77, 25.62, 17.97, 17.80,
ꢂ4.00, ꢂ4.19, ꢂ5.25, ꢂ5.36. ESI MS: m/z 826.3
[M+H]+ (calculated for [C44H60N5O7Si2]+ 826.4).
Here, we describe a method for sequence determination
of RNA on-bead libraries with the number of required
constant nucleotides reduced down to five, thereby
enabling the synthesis of almost completely unbiased
libraries. This method uses a resin that leaves the 30-OH
group accessible for post-synthetic, post-screening enzym-
atic modifications. On-bead tailing, reverse transcription
and adapter ligation allow amplification and sequence de-
termination from individual resin beads.
Preparation of the pre-loaded resin: coupling of 2 to
amino-functionalized Tentagel
Compound 2 was dissolved in DMSO to a concentration
of 330 mM (stock 2). Ten milligrams (2.2 mmol) of
Tentagel M NH2 (Rapp Polymere; bead size 10 mm,
loading capacity 220 mmol/g, 1.95 ꢁ 109 beads/g) and
Tentagel N NH2 (Rapp Polymere; bead size 90 mm,
loading capacity 220 mmol/g, 2.86 ꢁ 106 beads/g) were
loaded each into one eppendorf tube (1.5 ml) and
swollen in DMF overnight. After spin filtration, the
swollen beads were transferred to stock 2 diluted with
DMSO (final concentration of 2 corresponds to 1, 2 and
10 eq. with respect to the amino groups on the resin) in a
final volume of 100 ml. Addition of DMF to a 6% v/v
concentration allowed for proper suspension of the
beads. The coupling reaction was performed at 40ꢀC for
10 h in a thermoshaker (Eppendorf) at 700 rpm. The beads
were then transferred into a TWIST column (Glen
Research, 1 mmol scale) and washed with 1 ml of following
MATERIALS AND METHODS
All reagents were purchased from Sigma-Aldrich, Roth
or Proligo and used without further purification.
Flash chromatography was carried out on silica gel
40–63 mm from J.T. Baker. NMR spectra were recorded
on a Varian Mercury Plus 300 MHz spectrometer. ESI
mass spectra were recorded on a Bruker micrOTOF-QII.
Oligonucleotide synthesis was performed on an
ExpediteTM 8909 automated synthesizer using standard
reagents and phosphoramidite chemistry [20-O-TBDMS
RNA Phosphoramidites, fast deprotection chemistry
with tert-butylphenoxyacetyl (TAC)] from Sigma Aldrich
Proligo. Deblock solution (3% v/v TCA in dichloro-
methane) was purchased from Roth. Unmodified primer
and adapter oligonucleotides were purchased from IBA
Gottingen. High-resolution agarose (Invitrogen) gels
¨
were stained with ethidium bromide and visualized
by UV illumination using an AlphaImagerTM 2200. The
GeneRuler Ultra Low Range base pair ladder (Fermentas)
solvents (with
a
2-ml syringe): DMSO, DMF,
dichloromethane and acetonitrile. The extensive washing
procedure is performed to quantitatively remove all

PAGE 3 OF 9
Nucleic Acids Research, 2012, Vol. 40, No. 9 e68
unreacted 2. Notably, the 10 mm beads were more prone to
agglomeration than the 90 mm beads and retained the
chemicals more strongly; therefore, the volume of
solvent during the washing procedure had to be doubled
for the smaller beads. The unreacted amino groups were
blocked by performing a capping step (5 min) with tert-
butylphenoxyacetic anhydride (CAP A/CAP B, Proligo)
on the automated synthesizer. The coupling yield of 2 to
the resin was determined by absorption measurement at
498 nm of the cleaved DMT group of 2 after performing a
deblock step (3% TCA in dichloromethane, 5 min).
out at 37ꢀC for 20 min with subsequent heat inactivation
of the enzyme at 65ꢀC for 10 min.
Reverse transcription with anchored poly(T) primer
The RT reaction (Superscript II, Invitrogen) was carried
out in the crude reaction mixture from the polyadeny-
lation after addition of following components to a final
volume of 30 ml: 1.5 ml of anchored poly(T) primer
(50-T23GC-30) (10 mM), 1.5 ml of dNTP mixture (10 mM
each): 65ꢀC, 5 min, quick chill on ice. Addition of 3 ml
first strand buffer (5ꢁ), 3 ml DTT (100 mM): 42ꢀC,
2 min. Addition of 1 ml Superscript II reverse transcriptase
(200 U/ml): 50ꢀC, 60 min. All steps were carried out in a
PTC 100 (Biozym) cycler. The final concentrations of
buffer ingredients in the one-pot reaction were as
follows: Tris–HCl 58.3 mM, KCl 37.5 mM, MgCl2
8.2 mM, DTT 10 mM, NaCl 167 mM. Heat inactivation
of the enzyme was omitted to prevent denaturation of
the RNA/cDNA hybrid. The bead was manually picked
out of the reaction solution and washed several times with
water and transferred in a PCR tube containing 6 ml water.
RNA synthesis on pre-loaded resin
The pre-loaded resin was subjected to RNA synthesis
(1 mmol scale) on an automated synthesizer (Expedite
8909). Since the Tentagel resin is swellable, the synthesis
protocol for automated oligonucleotide synthesis differs
significantly from conventional protocols used for the
rigid beads of CPG or non-swellable polystyrene. The fol-
lowing changes to a conventional RNA synthesis protocol
for CPG have been done: The resin was allowed to swell in
DMF overnight prior to oligonucleotide synthesis. The
amount of acetonitrile for all washing steps was
doubled. The amount of deblock solution was retained
to prevent depurination; however, the exposure time was
increased 1.3-fold. The coupling reaction was per-
formed for 10 min (recommended coupling time by
Proligo when using 5-(3,5-bis(trifluoromethyl)phenyl)-
1H-tetrazole (Activator 42) as an activator: 6 min), the
volume of activator and monomer was increased
1.5-fold. We used two capping steps with an oxidizing
step in between. In total, the volume of capping reagent
was increased 1.4-fold, the exposure time 1.8-fold. The
reaction time for the oxidation step was increased
1.6-fold, the delivered volume 1.2-fold. An additional
washing step with anhydrous DMF was used after the
oxidation step to thoroughly free the resin from remaining
water. We achieved >99% coupling efficiency for a 30-mer
RNA on 10 mm Tentagel beads. However, for 90 mm beads
we had to further optimize the synthesis protocol, due to
longer diffusion times into the larger beads: the volume of
all reagents was retained, but all reaction times were
increased by 10–20%. All coupling efficiencies were
determined by the dimethoxytrityl cation assay (manual
collection of cleaved DMT group after first and last
coupling step and absorption measurement at 498 nm).
Deprotection was carried out in a 3:1 mixture of
concentrated aqueous ammonia and EtOH for 2 h at
room temperature, followed by thorough washing of the
beads with EtOH/acetonitrile/water 3:1:1. The TBDMS
protecting groups were removed by treatment with 1 M
TBAF in THF for 24 h at room temperature, followed
by thorough washing of the beads with EtOH/acetoni-
trile/water 3:1:1. The beads were dried under vacuum.
Adapter ligation
After transferring the bead to a PCR tube containing 6 ml
water, denaturation of the RNA/cDNA hybrid was per-
formed at 90ꢀC for 5 min, followed by a quick chill on ice.
For the adapter ligation, following components were
added to a final volume of 10 ml: 0.1 ml double-stranded
adapter (30-CCCAAATCACTCCCAATTATTCGCCGG
CG-50, 50P-TTTAGTGAGGGTTAATAAGCGGCCGC
GTCGTGACTGGGAGCGC-30) (50 mM), 1 ml T4 DNA
ligase buffer (Fermentas), water, 1 ml T4 DNA ligase
(5 Weiss U/ml, Fermentas). The ligation reaction was per-
formed at 16ꢀC overnight. Alternatively, the ligation can
be carried out within 5 min at 25ꢀC using the NEB Quick
Ligation Kit.
PCR amplification with anchored poly(T) primer and
adapter specific primer
The PCR included following components for a 25 ml
reaction: 18 ml H2O, 2.5 ml PCR buffer (Rapidozym), 1 ml
MgCl2 (50 mM), 0.5 ml dNTP (10 mM each), 1 ml anchored
poly(T) primer (50-T23GC-30)+1 ml adapter specific primer
(50-GCTTATTAACCCTCAC-30) (10 mM), 0.5 ml template
from crude adapter ligation mixture, 0.5 ml Taq DNA
polymerase (5 U/ml, GenTherm Rapidozym). The PCR
was run on a PTC 100 cycler (Biozym) using following
program: 95ꢀC for 3 min (1 cycle); 95ꢀC for 1 min, 51ꢀC
for 1 min, 73ꢀC for 1 min (30 cycles); 73ꢀC for 7 min
(1 cycle).
Blunt end cloning of PCR product
The PCR product was gel purified (2% agarose gel, Gel
extraction kit Quiagen) and blunted following the manual
(Quick Blunting Kit, NEB). The blunted PCR product
was ligated in a blunted pKs (+) vector using the Quick
Ligation Kit (NEB). After transformation in DH5 alpha
bacteria and overnight incubation at 37ꢀC, clones were
analysed by colony PCR using the M13 primer binding
Poly(A)-tailing with Escherichia coli poly(A) polymerase
One single bead (pre-swollen in water for 3 h) was
manually picked and transferred to 20 ml of the Poly(A)-
tailing reaction mixture prepared according to the manu-
facturer (New England Biolabs). The reaction was carried

e68 Nucleic Acids Research, 2012, Vol. 40, No. 9
PAGE 4 OF 9
sites present in the vector (agarose gel, 2%). PCR
products containing the insert were purified by PCR puri-
fication kit (Quiagen). Eighty nanograms of DNA of each
sample were sent for sequencing.
from uridine according to standard protocols (22,23)
(Scheme 1).
A solid support suitable for reaction with 2 should not
only bear a primary amino group, but also be compatible
with solid-phase oligonucleotide synthesis as well as with
on-bead screening procedures. Controlled pore glass
(CPG), the most commonly used support for nucleic
acid synthesis, lacks the mechanical stability and homo-
geneity in size that is required for on-bead screening pro-
cedures (30). In contrast, polystyrene resins are available
in different bead sizes with a uniform particle size distri-
bution and a high mechanical stability. We therefore
opted for the polystyrene-based, swellable Tentagel
resin. This solid support is chemically compatible with
all used reagents, and it is equally swellable in all
solvents used. This type of resin has frequently been
used in the preparation of combinatorial libraries of
peptides (30) and has also been applied to the synthesis
of OBOC DNA libraries (31). The coupling of 2 was per-
formed on Tentagel-NH2 with two different bead sizes: 10
and 90 mm. After allowing the Tentagel-NH2 to pre-swell
in DMF, the beads were suspended in solutions of 2 in
DMSO at various concentrations. Addition of 6% DMF
facilitated a homogeneous suspension of the beads. After
incubation at 40ꢀC overnight and several washing steps,
unreacted amino groups were blocked by capping with
tert-butylphenoxyacetyl acetic anhydride. The coupling
yield of 2 to the resin and the respective loading
capacity of each resin were determined by cleavage of
the dimethoxytrityl (DMT) group and measurement of
its absorption at 498 nm (Figure 1). The 90 mm beads
showed better coupling yields than the 10 mm ones.
Sequencing
Sequencing was done by SeqLab (Gottingen) using the
¨
M13 forward and reverse primer binding sites present in
the PCR product. Due to the extended poly(A)/(T)
segments, polymerase slippage occurs frequently, and
only one sequencing direction (the direction in which the
homopolymeric stretch is at the end of the read) produces
exploitable results.
RESULTS
Synthesis of the pre-loaded resin
We aimed at generating a covalent linkage between the
solid support and the first nucleoside monomer in a way
that the oligonucleotide remains connected to the support
after deprotection, and the 30-OH terminus stays access-
ible for post-synthetic modifications. Since commonly
used solid supports are bound to the first monomer via
this very position, an alternative had to be found. The
4-triazolyl group has often been used as an activating
group to introduce various substituents at the 4-position
of uridine or deoxyuridine (24–26) especially by reaction
with primary amino groups (27–29). Therefore,
4-triazolyluridine was an attractive option to attach a
nucleoside to an amino-functionalized solid phase. The
activated nucleoside 2 was synthesized in three steps
Scheme 1. (A) Synthesis of the activated uridine analogue 2: (i) 1. DMT-Cl, pyridine; 2. TBDMS-Cl, imidazole, DMF; (ii) 1,2,4-triazole, POCl3,
NEt3, acetonitrile. (B) Coupling scheme of protected 4-triazolyluridine (2) to amino-functionalized resin (for conditions, see ‘Materials and Methods’
section). The covalent linkage is formed between the base moiety of 2 and the amino-groups of the resin, thereby leaving the 30-OH accessible for
subsequent modifications.

PAGE 5 OF 9
Nucleic Acids Research, 2012, Vol. 40, No. 9 e68
led to better coupling efficiencies. Furthermore, it was es-
sential to introduce an additional washing step with an-
hydrous DMF after the oxidation step, which uses
aqueous iodine. This procedure removed residual water
still present on the resin, thereby preventing hydrolysis
of the phosphoramidites in the following coupling step.
Compared to standard RNA synthesis on CPG time for
synthesis on Tentagel is increased 1.6-fold and cost
1.8-fold. In our opinion, the advantages of Tentagel,
including the decreased unspecific binding of hydrophobic
substances compared to polystyrene resin and the
increased wettability in aqueous medium exceed the dis-
advantages of increased synthesis time and costs. Using
this optimized protocol, we synthesized five different se-
quences on five pre-loaded resins varying in their loading
capacity and bead size (Table 1). After coupling of the first
monomer (rG), the cleaved DMT fraction was manually
collected. The absorption measurement at 498 nm showed
in all five cases a coupling yield of ꢃ99%, demonstrating
the high accessibility and reactivity of the resin-linked nu-
cleoside. After completion of RNA synthesis, the average
coupling yield was ꢃ99% as determined by the DMT
cation assay. After ammonia treatment and TBAF
deprotection of the 20- and 30-OH, the solid support thus
prepared was ready for post-synthetic modifications.
Figure 1. Loading capacity (mmol/g) of pre-loaded Tentagel resins
(10 and 90 mm bead size) after coupling to 2 as determined by absorp-
tion measurement (498 nm) of cleaved DMT groups. The different
values were obtained by variation of the molar ratio 2/resin amino
groups. The nominal loading capacity of both resins before coupling
was 220 mmol/g.
Post-synthetic introduction of primer binding sites for
amplification and sequencing
By varying the molar ratio of 2 to resin amino groups,
coupling yields could be obtained ranging from 8.3%
(Tentagel 10 mm, 1:1 ratio) to quantitative coupling
(Tentagel 90 mm, 1:10 ratio). It is therefore possible to
adjust the loading capacity of the resin to a desired
value depending on the application. For example, a high
loading capacity may be beneficial for obtaining high
signals during the screening process, while a low loading
capacity can be desirable for preventing misfolding,
improper binding of a target molecule (32) or quenching
of fluorophores (33).
To amplify unknown RNA sequences, it is necessary to
introduce a first primer binding site at the 30-terminus to
enable reverse transcription, and then a second primer
binding site at the 30-end of the respective cDNA to
perform PCR. Our strategy consists of adding
a
homopolymeric tail to the 30-terminus of the resin-bound
RNA sequence by E. coli poly(A) polymerase, to allow for
the use of a poly(T) primer during reverse transcription
(Figure 2A). For the introduction of the second primer
binding site at the 30-end of the respective cDNA, a
specific problem had to be taken into account: solid
phase RNA synthesis always yields incomplete sequences
due to non-quantitative coupling efficiencies. This leads to
beads that carry shorter, abortive sequences next to the
full-length product. To ensure that only the full-length
product is amplified, we introduced three cytidines at the
50-end of the RNA strands, which during RT are con-
verted to three deoxyguanosines at the 30-end of the
cDNA. These deoxyguanosines serve as anchor for the
RNA synthesis on pre-loaded resin
The pre-loaded resin was applied in the solid phase syn-
thesis of RNA. Since the Tentagel resin is swellable, the
synthesis protocol differs considerably from conventional
protocols used for CPG. It was necessary to increase the
reaction times in order to allow the reagents to diffuse
inside the swollen beads. Increasing the volume of
reagents and acetonitrile during the washing steps also
Table 1. List of pre-loaded resins subjected to RNA synthesis
No.
Resin (mm)
Loading capacity (mmol/g)
Sequence (50–30)
1
2
3
4
5
Tentagel-C* 10
Tentagel-C* 10
Tentagel-C* 90
Tentagel-C* 90
Tentagel-C* 10
18
110
30
228
35
CCCAUUAGGUCAGUAACUCAGUGC*-SS
CCCAGUAUAGAGGAAGUCAGGUAUAAGUGC*-SS
CCCAAUGGAACCAUAUCUAUACCUGAGUGC*-SS
CCCUGAUAUUCCUUUGUCUGAGUGC*-SS
CCCGUUGAUCCCACAAGUCAUAGGUAAUAGC*-SS
Resins with different bead sizes (10 mm, 90 mm) and different loading capacities were used to synthesize five sequences that only share the conserved
nucleotides (bold). ‘C*’ indicates the cytidine-like nucleoside that is formed after coupling of 2 to the amino-functionalized resin. ‘–SS’ indicates the
covalent linkage of RNA to the solid support.

e68 Nucleic Acids Research, 2012, Vol. 40, No. 9
PAGE 6 OF 9
Figure 2. Post-synthetic introduction of primer binding sites for amplification. (A) Polyadenylation of the 30-terminus of RNA on bead. After
introduction of the poly(A)-tail, reverse transcription can be performed using an anchored poly(T) primer (grey arrow). (B) Adapter ligation to the
30-end of the generated cDNA with T4 DNA ligase. The 30-CCC overhang of the double-stranded adapter (in blue) hybridizes only to full length
product exhibiting three guanosines at the 30-terminus. Subsequent amplification by PCR using an adapter-specific and an anchored poly(T)-primer
(grey arrows) yields a product that can be subjected to blunt end cloning and sequencing.
30-overhang of a double-stranded DNA-adapter which in
turn is ligated by T4 DNA ligase (Figure 2B). Hence, only
the full length sequences will carry the second primer, and
will therefore be amplified. The three additional cytidines
have a double role: to allow for the introduction of the
second primer, and to exclude abortive sequences. The
PCR product obtained by using the two introduced
primers can then be subjected to blunt end cloning and
sequencing.
As analytical monitoring options are limited for
resin-bound RNA, we first optimized the combination of
tailing and reverse transcription in solution using a known
RNA sequence (data not shown). We found that an
anchored primer of 23 thymidines and two constant nu-
cleotides that match the first 2 nt at the 30-end of the oligo-
nucleotide was ideally suited to produce a single-length
reverse transcript starting from the heterogenous poly(A)
tail. Finally, this process was applied to RNA being
attached to Tentagel beads: it remained to be shown
whether both the poly(A) polymerase and the
reverse-transcriptase would tolerate the presence of the
solid phase in close proximity to the RNA to be
modified. To investigate the general applicability of this
methodology, we applied it to the five different RNA se-
quences synthesized on five different pre-loaded resins
(10 and 90 mm, high loading and low loading; Table 1).
One sequence (No. 5) was designed to include a C-triplet
within the variable region, to test if such a triplet would
interfere with the adapter ligation. The following steps
were applied to three to five single beads out of every
sample. Each bead was processed individually since the
sequence determination during on-bead screening
Figure 3. PCR products obtained from different on-bead sequences
(Table 1) after introduction of primer binding sites. M, base pair ladder.
Lane 1, negative control without template. Lane 2, RNA No. 1; Lane
3, RNA No. 2; Lane 4, RNA No. 3; Lane 5, RNA No. 4; Lane 6,
RNA No. 5. All PCR products show the expected length.
procedures has to be carried out from a single bead. A
bead picked under a light microscope was subjected to
polyadenylation and subsequent reverse transcription in
a one-pot reaction. Combining two steps in one reaction
vessel required buffer adjustment but decreased the
number of pipetting steps and thereby reduced the risk
of losing the bead. After isolation, the bead was suspended
in water in a fresh vial and heated to 95ꢀC to denature the
RNA/cDNA hybrid. The adapter ligation was then per-
formed with a ꢃ50-fold excess of double-stranded adapter
over cDNA using T4 DNA ligase. For subsequent ampli-
fication, 5% of the crude ligation mixture was subjected to
PCR using an adapter-specific primer and an anchored
poly(T) primer. Irrespective of sequence, length, bead

PAGE 7 OF 9
Nucleic Acids Research, 2012, Vol. 40, No. 9 e68
Table 2. Sequencing results (A), including template sequence (bold) and introduced primer sequences, in comparison
to synthesized RNA sequences (B)
No.
1
Sequence alignment
A . . .TTGCTTATTAACCCTCACTAAACCCCATTAGGTCAGTAACTCAGTGCAAAAAAAAAAAAAAAAAAAAAAAAA. . .
B
CCCAUUAGGUCAGUAACUCAGUGC
A . . .TTGCTTATTAACCCTCACTAAACCCAGTATAGAGGAAGTCAGGTATAAGTGCAAAAAAAAAAAAAAAAAAAA. . .
CCCAGUAUAGAGGAAGUCAGGUAUAAGUGC
A . . .TTGCTTATTAACCCTCACTAAACCCAATGGAACCATATCTATACCTGAGTGCAAAAAAAAAAAAAAAAAAAA. . .
CCCAAUGGAACCAUAUCUAUACCUGAGUGC
A . . .TTGCTTATTAACCCTCACTAAACCCTGATATTCCTTTGTCTGAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAA. . .
CCCUGAUAUUCCUUUGUCUGAGUGC
A . . .TTGCTTATTAACCCTCACTAAACCCGTTGATCCCACAAGTCATAGGTAATAGCAAAAAAAAAAAAAAAAAAAA. . .
CCCGUUGAUCCCACAAGUCAUAGGUAAUAGC
2
B
3
B
4
B
5
B
The number (1–5) corresponds to the respective RNA sequence, see Table 1.
size and loading capacity, all five reactions yielded a PCR
product of the expected length (Figure 3). No differences
between individual beads that carry the same sequence
could be detected. Even sequence 5, containing an
internal C-triplet, produced a full-length PCR product
and none of the shorter sequences that would have been
expected in case of hybridization of the adapter to the
internal C-triplet. Importantly, the efficiency of the
method is insensitive to the folding of the RNA molecules.
In principle, folding could block sequence segments
involved in tailing and adapter ligation. In spite of differ-
ent folding patterns (prediction by mfold, data not
shown), all five sequences were successfully obtained
after sequencing. Hence, the method described here
seems to be applicable regardless of the folding pattern.
In all PCR reactions (except for RNA 4), a single, faint
by-product has been observed in some cases that might be
caused by adapter amplification. Subsequent gel purifica-
tion of the PCR product, however, quantitatively removed
the by-product, and blunt end cloning and sequencing
yielded in all five cases the expected sequences as shown
in Table 2, thus demonstrating that this strategy is a
reliable and versatile method for the sequencing of
unknown on-bead RNA sequences. It should be noted
that gel purification of the PCR product is mandatory
for a clean sequencing. Omitting this step, e.g. using the
crude PCR product and performing T/A cloning, yielded
several sequences with extended deletions.
affinity (34,35) and that a simple pentanucleotide acceler-
ates an aminoacylation reaction 25-fold (36), OBOC RNA
libraries such as the one described here should allow
searching for a wide variety of functional oligonucleotides.
The small number of nucleotides required for sequence
determination, combined with the highly efficient synthe-
sis, gives more freedom to the rational design of libraries
in comparison to previous studies (12,13); it does so
without compromizing the purity of the library. The
randomized positions do not have to be synthesized as
one contiguous stretch, they can rather be presented in a
precise structural context, e.g. of a bulge, a pseudoknot, a
quadruplex structure or a three-way junction that can be
defined by constant elements designed into the sequence.
Of particular interest is the search for properties that
cannot be selected for by SELEX approaches; e.g.
autofluorescent or fluorescence-enhancing tags which are
urgently needed for RNA cell biology (37). Using
fluorescence-activated cell sorters, a library of 109 beads
can be screened for very specific optical properties in less
than a day. The fact that one bead of the smallest size
(10 mm) with the lowest loading (18 mmol/g) still contains
9 fmol or 5 billion copies of one molecular species consti-
tutes a dramatic advantage over the SELEX situation,
where one relies on the interaction of individual molecules,
and allows for a much wider choice of analytical options.
Compared to other classes of polymers, sequence deter-
mination is highly developed for nucleic acids. Previous
reports on sequence determinations from DNA OBOC
libraries used either Maxam-Gilbert chemistry (31)
(which is indeed suitable for such short oligonucleotides,
but cannot be easily applied when chemical modifications
are incorporated into the library), mass spectrometric
sequencing (38) (requiring cleavable linkers) or Sanger
sequencing using extended primer binding sites included
in the sequence (12). Here, we investigated whether tailing
and adapter ligation strategies developed for the discovery
of non-coding RNAs (39–41) could be adapted to
sequence OBOC libraries without large known regions.
This is not a trivial problem, as many enzymes do not
tolerate the presence of bulky solid particles attached to
their substrates (42). Our strategy requires two on-bead
enzymatic reactions: poly(A)-tailing and reverse
DISCUSSION
Here, we describe a new format of oligonucleotide com-
binatorial libraries for ligand, catalyst and tag discovery.
Split-and-mix synthesis of one-bead one-compound
libraries ensures that each physical entity (bead) contains
multiple copies of one sequence. The Tentagel resins in
combination with the strategy for sequence determination
used here allow for large library sizes; 500 mg of 10 mm
resin contain 109 beads, permitting complete randomiza-
tion of 15 nt (415 & 109), compared to 106 beads or 10
randomized nucleotides reported previously (13).
Considering that 13- and 14-nt aptamers are known to
bind small organic molecules with low micromolar

e68 Nucleic Acids Research, 2012, Vol. 40, No. 9
PAGE 8 OF 9
4. Ellington,A.D. and Szostak,J.W. (1990) In vitro selection of RNA
molecules that bind specific ligands. Nature, 346, 818–822.
5. Tuerk,C. and Gold,L. (1990) Systematic evolution of ligands by
exponential enrichment - RNA ligands to bacteriophage-T4
DNA-polymerase. Science, 249, 505–510.
6. Robertson,D.L. and Joyce,G.F. (1990) Selection in vitro of an
RNA enzyme that specifically cleaves single-stranded DNA.
Nature, 344, 467–468.
7. Blank,M., Weinschenk,T., Priemer,M. and Schluesener,H. (2001)
Systematic evolution of a DNA aptamer binding to rat brain
tumor microvessels - selective targeting of endothelial regulatory
protein pigpen. J. Biol. Chem., 276, 16464–16468.
8. Misono,T.S. and Kumar,P.K.R. (2005) Selection of RNA
aptamers against human influenza virus hemagglutinin using
surface plasmon resonance. Anal. Biochem., 342, 312–317.
9. Mendonsa,S.D. and Bowser,M.T. (2004) In vitro evolution of
functional DNA using capillary electrophoresis. J. Am. Chem.
Soc., 126, 20–21.
transcription. The results demonstrate that E. coli poly(A)
polymerase accepts the 30-hydroxyl group of the RNA
even though the nucleobase of this very nucleotide is
attached to a polystyrene bead, and even though this is
done via the exocyclic amino group that is involved in
Watson–Crick pairing of the complementary nucleotide.
Also, the reverse transcriptase produced in all cases suffi-
cient amounts of cDNA to allow for ligation to the
double-stranded adapter and amplification in a subse-
quent PCR reaction. In comparison to our previously
published study (13), the method presented here decreases
the structural bias of the library and increases flexibility in
library design at the same time. Using the new method for
sequence determination, one can now synthesize and
screen on-bead libraries of dramatically increased diversity
compared to published approaches (12,31) and thereby
increase the probability to isolate oligonucleotides with
the desired characteristics.
10. Lou,X.H., Qian,J.R., Xiao,Y., Viel,L., Gerdon,A.E., Lagally,E.T.,
Atzberger,P., Tarasow,T.M., Heeger,A.J. and Soh,H.T. (2009)
Micromagnetic selection of aptamers in microfluidic channels.
Proc. Natl. Acad. Sci., 106, 2989–2994.
11. Lam,K.S., Salmon,S.E., Hersh,E.M., Hruby,V.J.,
Kazmierski,W.M. and Knapp,R.J. (1991) A new type of synthetic
peptide library for identifying ligand-binding activity. Nature, 354,
82–84.
12. Yang,X., Bassett,S.E., Li,X., Luxon,B.A., Herzog,N.K.,
Shope,R.E., Aronson,J., Prow,T.W., Leary,J.F., Kirby,R. et al.
(2002) Construction and selection of bead-bound combinatorial
oligonucleoside phosphorothioate and phosphorodithioate
aptamer libraries designed for rapid PCR-based sequencing.
Nucleic Acids Res., 30, e132/131–e132/138.
13. Wiesmayr,A. and Jaschke,A. (2011) Isolation and characterization
¨
of fluorescence-enhancing RNA tags. Bioorg. Med. Chem., 19,
1041–1047.
14. Trapp,O. (2008) Gas chromatographic high-throughput screening
techniques in catalysis. J. Chromatogr. A, 1184, 160–190.
15. Reetz,M.T. (2001) Combinatorial and evolution-based methods in
the creation of enantioselective catalysts. Angew. Chem. Int. Ed.,
40, 284–310.
The presence of an enzymatically and chemically access-
ible 30-end in immobilized oligonucleotides prepared
by standard 30 ! 50 phosphoramidite synthesis may be
attractive for many other applications, from labelling
(43–46) to microarrays (47,48) and genotyping (49).
It should be noted that the overall structure of the
RNA-bound beads after tailing bears a strong resem-
blance to the clonally clustered amplicons that are
generated in deep sequencing (50,51): multiple copies of
one unknown sequence attached to a bead or to a
localized surface area, each with a known primer
binding site at its 30-end. It is therefore conceivable that
the OBOC RNA libraries described here can be directly
sequenced (52) with next-generation sequencing instru-
mentation, without any PCR, cloning and Sanger
sequencing. The combination of high-throughput FACS
sorting with next generation sequencing would provide an
attractive pipeline for the discovery of functional RNAs.
16. Legiewicz,M., Lozupone,C., Knight,R. and Yarus,M. (2005)
Size, constant sequences, and optimal selection. RNA, 11,
1701–1709.
17. Seelig,B. and Jaschke,A. (1999) A small catalytic RNA motif
¨
with Diels-Alderase activity. Chem. Biol., 6, 167–176.
18. Shtatland,T., Gill,S.C., Javornik,B.E., Johansson,H.E.,
Singer,B.S., Uhlenbeck,O.C., Zichi,D.A. and Gold,L. (2000)
Interactions of Escherichia coli RNA with bacteriophage MS2
coat protein: genomic SELEX. Nucleic Acids Res., 28, e93.
19. Jarosch,F., Buchner,K. and Klussmann,S. (2006) In vitro
selection using a dual RNA library that allows primerless
selection. Nucleic Acids Res., 34, e86.
ACKNOWLEDGEMENTS
The authors thank Dr A. Nierth and M.-L. Winz for
helpful discussions and B. Bachmann for experimental
support.
20. Wen,J.-D. and Gray,D.M. (2004) Selection of genomic sequences
that bind tightly to Ff gene 5 protein: primer-free genomic
SELEX. Nucleic Acids Res., 32, e182.
21. Pan,W., Xin,P. and Clawson,G.A. (2008) Minimal primer and
primer-free SELEX protocols for selection of aptamers from
random DNA libraries. Biotechniques, 44, 351–360.
22. Chirakul,P. and Sigurdsson,S.T. (2003) Stereospecific syntheses
of 30-deuterated pyrimidine nucleosides and their site-specific
incorporation into DNA. Org. Lett., 5, 917–919.
FUNDING
Funding for open access charge: Institutional budget.
Conflict of interest statement. None declared.
23. Sheu,C., Kang,P., Khan,S. and Foote,C.S. (2002)
Low-temperature photosensitized oxidation of a guanosine
derivative and formation of an imidazole ring-opened product.
J. Am. Chem. Soc., 124, 3905–3913.
24. Reese,C.B. and Skone,P.A. (1984) The protection of thymine
and guanine residues in oligodeoxyribonucleotide synthesis.
J. Chem. Soc., Perkin Trans, 1, 1263–1271.
25. Xu,Y.Z., Zheng,Q. and Swann,P.F. (1992) Synthesis of DNA
containing modified bases by post-synthetic substitution.
Synthesis of oligomers containing 4-substituted thymine:
O4-alkylthymine, 5-methylcytosine, N4-dimethylamino-
5-methylcytosine, and 4-thiothymine. J. Org. Chem., 57,
3839–3845.
REFERENCES
1. Famulok,M., Hartig,J.S. and Mayer,G. (2007) Functional
aptamers and aptazymes in biotechnology, diagnostics, and
therapy. Chem. Rev., 107, 3715–3743.
2. Joyce,G.F. (2007) Forty years of in vitro evolution. Angew.
Chem. Int. Ed., 46, 6420–6436.
3. Weigand,B.S., Zerressen,A., Schlatterer,J.C., Helm,M. and
Jaschke,A. (2006) Catalytically active RNA molecules: tools
¨
in organic chemistry. In: Klussmann,S. (ed.), The Aptamer
Handbook - Functional Oligonucleotides and Their Applications.
Wiley-VCH, Weinheim, Germany, pp. 211–227.

PAGE 9 OF 9
Nucleic Acids Research, 2012, Vol. 40, No. 9 e68
26. MacMillan,A.M. and Verdine,G.L. (1990) Synthesis of
functionally tethered oligodeoxynucleotides by the convertible
nucleoside approach. J. Org. Chem., 55, 5931–5933.
27. Pochet,S., Huynh-Dinh,T. and Igolen,J. (1985) Synthese
´ ´
d’oligonucleotides lies de facon covalente a un support solide.
40. Lau,N.C., Lim,L.P., Weinstein,E.G. and Bartel,D.P. (2001)
An abundant class of tiny RNAs with probable
regulatory roles in Caenorhabditis elegans. Science, 294,
858–862.
41. Huttenhofer,A., Brosius,J. and Bachellerie,J.-P. (2002) RNomics:
¨
Tetrahedron Lett., 26, 627–630.
28. Caprioara,M., Fiammengo,R., Engeser,M. and Jaschke,A. (2007)
¨
identification and function of small, non-messenger RNAs.
Curr. Opin. Chem. Biol., 6, 835–843.
DNA-based phosphane ligands. Chem. Eur. J., 13, 2089–2095.
29. Fournier,P., Fiammengo,R. and Jaschke,A. (2009) Allylic
¨
42. Kress,J., Zanaletti,R., Amour,A., Ladlow,M., Frey,J.G. and
Bradley,M. (2002) Enzyme accessibility and solid supports:
Which molecular weight enzymes can be used on solid supports?
An investigation using confocal Raman microscopy. Chem. Eur.
J., 8, 3769–3772.
43. Schmitz,G.G., Walter,T., Seibl,R. and Kessler,C. (1991)
Nonradioactive labeling of oligonucleotides in vitro with
the hapten digoxigenin by tailing with terminal transferase.
Anal. Biochem., 192, 222–231.
44. Igloi,G.L. (1996) Substrate properties of fluorescent
ribonucleotides in the terminal transferase-catalyzed labeling of
DNA sequencing primers. Biotechniques, 21, 1084–1092.
45. Martin,G. and Keller,W. (1998) Tailing and 30-end labeling of
RNA with yeast poly(A) polymerase and various nucleotides.
RNA, 4, 226–230.
46. Paredes,E. and Das,S.R. (2011) Click chemistry for rapid labeling
and ligation of RNA. Chembiochem, 12, 125–131.
47. Kurg,A., Tonisson,N., Georgiou,I., Shumaker,J., Tollett,J. and
Metspalu,A. (2000) Arrayed primer extension: Solid-phase
four-color DNA resequencing and mutation detection technology.
Genet. Test., 4, 1–7.
48. Pullat,J., Kusnezow,W., Jaakson,K., Beier,M., Hoheisel,J.D. and
Metspalu,A. (2008) Arrayed primer extension on in situ
synthesized 50 –> 30 oligonucleotides in microchannels. New
Biotechnol., 25, 133–141.
49. Steemers,F.J., Chang,W., Lee,G., Barker,D.L., Shen,R. and
Gunderson,K.L. (2006) Whole-genome genotyping with the
single-base extension assay. Nat. Methods, 3, 31–33.
50. Margulies,M., Egholm,M., Altman,W.E., Attiya,S., Bader,J.S.,
Bemben,L.A., Berka,J., Braverman,M.S., Chen,Y.-J., Chen,Z.
et al. (2005) Genome sequencing in microfabricated high-density
picolitre reactors. Nature, 437, 376–380.
51. Shendure,J. and Ji,H. (2008) Next-generation DNA sequencing.
Nat. Biotechnol., 26, 1135–1145.
52. Ozsolak,F., Platt,A.R., Jones,D.R., Reifenberger,J.G., Sass,L.E.,
McInerney,P., Thompson,J.F., Bowers,J., Jarosz,M. and
Milos,P.M. (2009) Direct RNA sequencing. Nature, 461, 814–818.
amination by a DNA–diene–iridium(I) hybrid catalyst. Angew.
Chem. Int. Ed., 48, 4426–4429.
30. Lam,K.S., Lebl,M. and Krchnak,V. (1997) The ‘‘one-bead-one-
compound’’ combinatorial library method. Chem. Rev., 97,
411–448.
31. Seliger,H., Bader,R., Hinz,M., Rotte,B., Astriab,A.,
Markiewicz,M. and Markiewicz,W.T. (1997) Synthetic
oligonucleotide combinatorial libraries - tools for studying
nucleic acid interactions. Nucleosides Nucleotides, 16,
703–710.
32. Chen,X., Tan,P.H., Zhang,Y. and Pei,D. (2009) On-bead
screening of combinatorial libraries: reduction of nonspecific
binding by decreasing surface ligand density. J. Comb. Chem., 11,
604–611.
33. Yan,B., Martin,P.C. and Lee,J. (1998) Single-bead fluorescence
microspectroscopy: detection of self-quenching in
fluorescence-labeled resin beads. J. Comb. Chem., 1, 78–81.
34. Anderson,P.C. and Mecozzi,S. (2005) Identification of a 14mer
RNA that recognizes and binds flavin mononucleotide with high
affinity. Nucleic Acids Res., 33, 6992–6999.
35. Anderson,P.C. and Mecozzi,S. (2005) Unusually short RNA
sequences: design of a 13-mer RNA that selectively binds
and recognizes theophylline. J. Am. Chem. Soc., 127,
5290–5291.
36. Turk,R.M., Chumachenko,N.V. and Yarus,M. (2010) Multiple
translational products from a five-nucleotide ribozyme.
Proc. Natl. Acad. Sci., 107, 4585–4589.
37. Darzacq,X., Yao,J., Larson,D.R., Causse,S.Z., Bosanac,L., de
Turris,V., Ruda,V.M., Lionnet,T., Zenklusen,D., Guglielmi,B.
et al. (2009) Imaging transcription in living cells. Annu. Rev.
Biophys., 38, 173–196.
38. Rulka,A. and Markiewicz,W.T. (2010) IRT 2010 - XIX
International Round Table on Nucleosides, Nucleotides and Nucleic
Acids. Lyon, France.
39. Hafner,M., Landgraf,P., Ludwig,J., Rice,A., Ojo,T., Lin,C.,
Holoch,D., Lim,C. and Tuschl,T. (2008) Identification of
microRNAs and other small regulatory RNAs using cDNA
library sequencing. Methods, 44, 3–12.