Synthesis and anticancer activity of new pyrrolocarbazoles and pyrrolo-β-carbolines

Article abstract of DOI:10.1016/j.bmc.2004.12.045

'Bended' 1, 3 or 'linear' 2 pyrrolidino-fused (aza)carbazoles were prepared and screened towards a few cancer-related targets. Whereas 'bended' derivatives 1 and 3 proved to be weakly toxic, several members of the 'linear' family strongly interact with DN

Full text of DOI:10.1016/j.bmc.2004.12.045

Bioorganic & Medicinal Chemistry 13 (2005) 2263–2283
Synthesis and anticancer activity of new pyrrolocarbazoles
and pyrrolo-b-carbolines
a,ꢀ
b
b
b
c
c
M. Laronze,a,* M. Boisbrun, S. Leonce, B. Pfeiffer, P. Renard, O. Lozach, L. Meijer,
´
A. Lansiaux,d C. Bailly,d J. Sapia and J.-Y. Laronzea,*
a
` ´
CNRS FRE 2715 ‘Isolement, Structure, Transformations et Synthese de Produits Naturels’, IFR 53, Faculte de Pharmacie,
51 Rue Cognacq Jay, 51096 Reims cedex, France
bInstitut de Recherches Servier, 125 Chemin de ronde, 78290 Croissy sur Seine, France
cCNRS, Station Biologique, Place G. Teissier, BP 74, 29682 Roscoff, France
dINSERM U-524 et Laboratoire de Pharmacologie Antitumorale du Centre Oscar Lambret, IRCL, 59045 Lille, France
Received 12 October 2004; revised 17 December 2004; accepted 22 December 2004
Available online 19 January 2005
Abstract—ꢁBendedꢂ 1, 3 or ꢁlinearꢂ 2 pyrrolidino-fused (aza)carbazoles were prepared and screened towards a few cancer-related tar-
gets. Whereas ꢁbendedꢂ derivatives 1 and 3 proved to be weakly toxic, several members of the ꢁlinearꢂ family strongly interact with
DNA, especially derivative 28a.
ꢀ 2005 Elsevier Ltd. All rights reserved.
1. Introduction
eases (for example, GSK-3b inhibitors13a–c), viral14 or
fungal15 pathologies.
2,5-Pyrrolidinedione (succinimide) or 2-pyrrolidone
appended polycyclic (hetero)aromatics are of interest
in at least two families of anticancer drugs: (i) inhibitors
of kinases implicated in cell signaling like the PKC
inhibitor staurosporine1a,b or/and in cell-cycle control
like the CDK or CHK inhibitors granulatimide2a,b or
UCN-013 (connections between checkpoint kinases,
cyclin-dependent kinases, p53 and chemosensitization
have been recently reviewed4); (ii) inhibitors of topoiso-
merase I like rebeccamycin.5 Synthetic analogues of
these products have been developed in the field of topo-
isomerase I6 inhibitors, CDK7a,b or CHK8 inhibitors.
Recent reviews cover the staurosporine-like kinase or
phosphatase inhibitors,9 the structure of kinase/inhibi-
tor complexes10a,b and the potential use of pharmaco-
logical inhibitors of CDKs11 and GSK-3.12a,b Such
pyrrolidine(di)ones could be useful in pathologies other
than cancer such as diabetes and neurodegenerative dis-
The succinimide part interacts with the ATP binding
pocket via an hydrogen-bonds network. The nature
and the substitution pattern of the fused heterocycle
provide some selectivity towards specific enzymes. For
anti-topoisomerase agents, the requirement for a five
membered lactam or imide is less obvious16 but it con-
tributes both to the conformational rigidity and to the
DNA binding ability of the inhibitor.
The substitution of the heterocycle alkylamino chain(s)
increases the affinity for DNA, generally by filling up
the DNA minor groove.17
The location of the merging bond between the heterocy-
cle and the pyrrole ring, as well as the bioisosteric
replacement of a carbon atom by nitrogen, allow other
structural variations, which could improve biological
activity.
Keywords: Pyrrolocarbazoles; Pyrrolo-b-carbolines; Cytotoxicity;
DNA-binding.
2. Chemistry
*
Corresponding authors. Tel.: +33 3 2691 3589; fax: +33 3 2691
8025; e-mail addresses: marie.laronze@univ-reims.fr; jy.laronze@
univ-reims.fr
In this work, we describe our chemical approach to-
wards ꢁbendedꢂ (1) or ꢁlinearꢂ (2) 2-pyrrolidone or 2,5-
pyrrolidinedione derivatives fused to carbazole as well
ꢀ
´
Present address: GEVSM, UMR CNRS 7565, Faculte de Pharmacie,
5 Rue Albert Lebrun, 54001 Nancy, France.
0968-0896/$ - see front matter ꢀ 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2004.12.045

2264
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
R1
R1
CN
(O)
R5
N
N
O
N R1
O
R3
CO2Me
O
O
N
CO2Me
R4 CH3
N
N
N
N
7
R4 CH3
R4 R2
R4 CH3
CN
CN
1
3
2
∆
R1
O
[1,5] H
Scheme 1. ꢁBendedꢂ and ꢁlinearꢂ pyrrolo-(aza)carbazoles.
N
N
N
R4
R4
CN
O
6
O
as ꢁbendedꢂ 2-azacarbazoles (b-carbolines) 3: indeed oxy-
genated derivatives of 3 have been shown to present
interesting anti-topoisomerase I activities18a,b (Scheme
1). Their in vitro pharmacological activities are
reported.
N
O
R1
N
R4 CH3
8
(+ 2, 3 or 4 isomers)
Scheme 3. Tandem [1,5]H sigmatropic shift/Diels–Alder reaction of
2-vinylindole 6.
2.1. Carbazole annulated derivatives
Diels–Alder reaction combined with simple functional
group transformations is a frequently selected method
for the preparation of various biologically active carba-
zole alkaloids.19 Thus, pyrrolo[3,4-b]carbazole (ꢁlinearꢂ)
derivatives (type 2) are accessible by Diels–Alder reaction
involving indolo-2,3-quinodimethane intermediates.20a–j
Similarly, towards pyrrolo[3,4-c] counterparts (type
1)(ꢁbendedꢂ pyrrolocarbazoles) Diels–Alder approach
using 2-vinylindoles has been developed21a–h (Scheme
2). However, Caballero et al. have proposed a combined
Diels–Alder reaction–Fischer indolization pathway
affording both ꢁlinearꢂ and ꢁbendedꢂ pyrrolocarbazole
derivatives in varying proportion.22 As the moderate
yield23 and the difficulties of separation excluded this
method to be taken into consideration, we chose our
recently disclosed sigmatropic [1,5]-H shift/Diels–Alder
tandem reaction24 to synthesize both ꢁbendedꢂ carbazoles
1 and ꢁlinearꢂ ones 2, from a common starting material 6.25
performed in order to understand the dramatic role of
the indole nitrogen substituent on the course and the
yield of the reaction.26 Nevertheless it appears that the
SEM chain could mostly account for a better solubility
in the nonpolar solvent used in the reaction.
Pyrrolo[3,4-c]carbazoles were all synthesized from tetra-
hydrocarbazoles 7 (Scheme 4). Aromatization to 9 was
cleanly performed by activated MnO2.27 After purifica-
tion by chromatography on silica gel, regioisomer 10
and further transformed 11 and 12 carbazoles were also
isolated in slight quantities. The cyano group was re-
duced into amine, allowing spontaneous cyclization to
13. The SEM-group was cleaved by aqueous HCl to give
15 but N(lactam) appendage functionalization by di-
methylaminoethyl chain failed: under forced conditions
a mixture of masked imminium species [alkylated 16 or
nonalkylated 17] were obtained in low yields (Scheme 5).
This serendipitous oxidation of the methylene group of
the pyrrolidone moiety adjacent to the nitrogen atom
has already been encountered by us28 and by others.29
Depending on the dienophile, vinylindole 6 led to tetra-
hydrocarbazoles 7 and 8, precursors of 1 and 2 series,
respectively (Scheme 3).
As the best yields were observed for R4 = SEM (SEM:
trimethylsilylethoxymethyl) cycloadducts 7 (R4 = SEM)
and 8 (R4 = SEM) were chosen as intermediates for fur-
ther transformations. Theoretical calculations have been
Imide 19c was synthesized in three steps from cyanoester
9: solvolysis to 18 by concentrated methanolic HCl
caused also the cleavage of the SEM group. Double lac-
tamization of 18 with 2-dimethylaminoethylamine affor-
ded 19c in good yield.
The same type pyrrolo[3,4-c]carbazole derivatives 20
could be obtained in a one step condensation of aro-
matic cyano acid 14 with various primary amines in
the presence of DMTMM30 or isobutylchloroformate.
Acidic cleavage of the imino group afforded the expected
tetracyclic imides 19 (only two examples given in this
work). Imide 21b could be obtained directly from 14
without isolation of 20b.
R5
N
H
N
H
R1
N
R2
R2
R5
O
O
R1
N
O
O
O
N
R1
Linear pyrrolo[3,4-b]carbazoles 22–28 were synthesized
from the common intermediates 8, which were submit-
ted to various aromatization conditions, most of them
giving complex mixtures due to the undesirable indole
protecting group cleavage (Scheme 6). Using TCCA (tri-
chloroisocyanuric acid) resulted in the chlorination of
the activated position of the carbazole and led to
aromatic derivative 22. Fortunately, activated MnO2
N
H
N
H
CN
R2
R2
O
1
2
N
H
6
Scheme 2. Diels–Alder strategies towards 2,5-pyrrolidinedione-appended
carbazoles 1 and 2.

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2265
NH
CN
O
CO2Me
ii
N
N
CN
SEM CH3
SEMCH3
9
13
14
iii
i
CO2Me
R5
CN
N
R7
R6
CO2H
SEMCH3
7
N
N
SEM CH3
SEMCH3
10 R5 = CN; R6 = CO2Me; R7 = H
11 R5 = OH; R6 = H; R7 = CO2Me
12 R5 = H; R6 = H; R7 = CO2Me
Scheme 4. Reagents and conditions: (i) activated MnO2, dry toluene, reflux, 9+10+11+12 (59%); (ii) H2, Raney-Ni, 6 bars, abs EtOH, dry toluene, rt,
94%; (iii) KOH (powdered), t-BuOH, toluene, CH2Cl2, H2O, 80 ꢁC, 86%.
CN
CN
CO2H
CO2Me
vi
N
N
SEMCH3
SEM CH3
14
9
i
iv
R1
N
viii
vii or
viii
HN
NH
CO2Me
O
O
CO2Me
N
H
N
N
SEM
R4 CH3
CH3
CH3
18
a R1 = CH2Ph
13 R4 = SEM
20
b R1 = (CH2)2NMe2
ii
15 R4 = H
v
ii
R1
N
iii
N
O
NH
O
O
N
N
R4 CH3
R4 CH3
19 R4 = H
a R1 = CH2Ph
c R1 = (CH2)2NMe2.HCl
21 R4 = SEM
b R1 = (CH2)2NMe2
16 R4 = (CH2)2NMe2
17 R4 = H
ii
OMe
N
N
O
N
N
OMe
Cl
4-(4,6-dimethoxy-1,3,5-triazin-
2-yl)-4-methylmorpholinium
chloride (DMTMM)
Scheme 5. Reagents and conditions: (i) H2, Raney-Ni, 6 bars, abs EtOH, dry toluene, rt, 94%; (ii) 3 M aq HCl solution, rt, 84–95%; (iii) NaH 50%,
dry DMF, Cl(CH2)2NMe2ÆHCl, rt, 23% (16–17); (iv) 9 M HCl/MeOH, reflux, 71%; (v) H2N(CH2)2NMe2, 100 ꢁC, 59%; (vi) KOH (powdered),
t-BuOH, toluene, CH2Cl2, H2O, 80 ꢁC, 86%; (vii) H2N(CH2)2NMe2, ClCO2-i-Bu, Et3N, CH2Cl2, BuOH, rt, 28% (20b); (viii) R1NH2, DMTMM,
MeOH, rt, 52% (21b)-83% (20a).
worked well giving 23 in good yield without side reac-
tion. The reduction of the cyano group gave the primary
amine 24, whose acylation with N,N-dimethylglycine or
3-dimethylaminopropanoic acid, in the presence of
DMTMM nicely afforded the corresponding amides. It
is important to note that classical peptide synthesis
coupling reagents other than DMTMM proved to be
completely inoperative, with exception of isobutylchlo-
roformiate for n = 1.
Pyrrolo-b-carbolines 34–38 were obtained from a com-
mon intermediate 3132 resulting from our trimolecular
condensation reaction between indole, Meldrumꢂs acid
and N-phthalimidoaminoacetaldehyde (for a recent
review, see33).
Meldrumꢂs acid moiety was transformed into a-amino-
ester 3234 following our procedure35 (i.e., ring opening
of the Meldrumꢂs ring by ethanol, Curtius rearrange-
ment and urethane reductive cleavage). Free base 32
spontaneously reacted with the imide carbonyl group,
resulting in considerable loss of material upon storage.
But fortunately, the hydrochloric acid salt was stable en-
ough. The well-known Pictet–Spengler cyclization of 32
2.2. b-Carboline annulated derivatives (Scheme 7)
The tetrahydropyridine ring of 2931 was aromatized by
TCCA to the target derivative 30.

2266
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
NH2
CN
CN
O
O
O
1 ii
N
R1 iii
N
R1
H
N
R
N
N
N
O
O
O
SEM CH3
SEM CH3
SEM CH3
23
24
8
N
Cl
iv
i
O
O
(CH2)n
N
(CH2)n
O
NH
NH
CN
O
O
Cl
v
R1
N
O
R1
N
O
R1
N
O
N
H
N
N
CH3
SEM CH3
SEM CH3
27 n = 1
28 n = 2
22
25 n = 1
26 n = 2
a
R
1 = Me
R1 = Bn
b
Scheme 6. Reagents and conditions: (i) TCCA, Et3N, dry DMF, rt, 26–36%; (ii) activated MnO2, dry toluene, reflux, 57–69%; (iii) H2, Raney-Ni,
6 bars, abs EtOH, dry toluene, rt, 52–70%; (iv) Me2NCH2CO2H, ClCO2-i-Bu, Et3N, CH2Cl2, BuOH, rt, 57% (25a) and 37% (25b) or
Me2N(CH2)nCO2H, DMTMM, MeOH, rt, 59–75% (25a, 26a and 26b); (v) 3 M aq HCl solution, rt, 68–97%.
Ph
Ph
N
N
O
O
O
O
i
Pht =
N
N
N
H
H
N
H
Ph
Ph
29 (mixture of 2 isomers)
30
NPht
NPht
O
NPht
CO2Et
O
O
iii
O
ii
O
NH3
,
Cl
O
N
H
O
N
H
N
H
O
O
N
31
32
NPht
CO2Et
N
NH
O
O
iv
v
N
N
N
N
H
N
N
R2
CH3
H
R2
H
vi
33
a : R2 = CH3
b : R2 = CH2NPht
35
36
34
a : R2 = CH3
vi
c : R2 = CH2NH3Cl
NH
O
vii
viii
NH
NH
N
N
O
O
CH3
N
N
N
N
H
N
H
O
N
N
H
S
O
NH
38
37
O
Scheme 7. Reagents and conditions: (i) TCCA, Et3N, rt, 83%; (ii) see Ref. 32, 73%; (iii) see Ref. 34, three steps, overall yield 39%; (iv) R2CHO,
˚
CH2Cl2, Et3N, TFA, molecular sieves 4 A, then TCCA, Et3N, rt, 45–57%; (v) 34a: BuNH2, reflux, 90%; 34c: 6 M HCl solution, reflux, 78%; (vi) NaH,
DMF, Cl(CH2)2NMe2ÆHCl, 17% (35) and 26% (36); (vii) Me2NCH2CO2H, Et3N, ClCO2-i-Bu, CH2Cl2, BuOH, 78%; (viii) mesitylenesulfonylchlo-
ride, Et3N, DMF, rt, 71%.
with various aldehydes R2CHO (only two examples are
described in this work: R2 = CH3 and CH2NPht) cleanly
afforded the tetrahydro-b-carboline system, which was
not isolated but directly aromatized into 33 by TCCA.
centrated HCl) proved to be useful to prevent either
side reactions resulting from the created amino group,
or incomplete cleavage of one of the phthalimido groups.
Tetracyclic compound 34 was selectively appended on
either pyrrolidinone nitrogen or indole one, by alkyl-
ation of the dianion (NaH, DMF). Depending on the
conditions of the reaction, lactams 35 or 36 were selec-
tively obtained albeit in low yields.
Pyrrolidone ring formation has not been performed by
the same manner for 33a as for 33b. In the first case,
phthalimido group was classically removed by displace-
ment with butylamine. For 33b harsh conditions (con-

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2267
The introduction of a dimethylaminoalkyl chain or of a
large hydrophobic group on the amino group of 34 was
classically performed by nitrogen acylation giving the
amide 37 and the sulfonamide 38, respectively.
was observed in some cases, in particular with 26a but
this inhibition occurred at a concentration largely
exceeding the IC50 values determined in the above cyto-
toxicity assay. Nevertheless, for this reason we com-
pared the cytotoxicity of those molecules towards P388
and P388CPT5 murine leukemia cells, sensitive and
resistant to camptothecin, respectively. In the case of
camptothecin, which is a reference topoisomerase I
inhibitor,38 the mutation of the top 1 gene in the
P388CPT5 cells39 considerably decreases (by a factor
of 166) the cytotoxic potential of the drug, indicating
thus that topoisomerase I plays a dominant role in
the antiproliferative activity. This is not the case
3. Biology (Tables 1 and 2)
3.1. Cytotoxicity and cell-cycle effects
L1210 murine leukemia cells were used to estimate the
cytotoxic potential of the compounds. IC50 values are
collated in Tables 1 and 2.36 Some of the molecules
showed submicromolar activities, such as 20b and 28a
for example. This latter compound, which is the most
cytotoxic molecule in the series, proved to be a potent
DNA binder (see below). In parallel, the effect of the
most cytotoxic compounds on the cycle of L1210 cells
was investigated (Tables 1 and 2). In general, these com-
pounds (e.g., 28a and 20b) induced a strong accumula-
tion of the cells in the G2 + M phases at 2 lM.
for the compounds tested here. The resistance index
P388
50
(IC5P0388CPT5)/IC ) does not exceed 3.2 with compound
28a. We therefore conclude that topoisomerase I is not
a target for these molecules.
3.3. DNA binding
Several biochemical and biophysical methods were de-
ployed to investigate the interactions of the compounds
with DNA. DNA sequence recognition was studied by
DNase I footprinting40 and a representative polyacryl-
amide gel is shown in Figure 1. Some of the compounds
modify the pattern of DNA cleavage by the enzyme
3.2. Effect on topoisomerase I
A DNA relaxation assay was used to evaluate the inhi-
bition of topoisomerase I.37 A minor inhibitory effect
Table 1. Cytotoxicities (IC50 in lM) of ꢁbendedꢂ pyrrolocarbazoles 13, 15–17, 20b–21b and pyrrolo-b-carbolines 30, 34–38
Compound
L1210
Cell cyclea
P338
P338 CPT5b
GSK3
Camptothecin
13
NT
12.1
11.2
>10
>10
0.77
11.2
6.4
NT
NT
0.024
NT
NT
NT
NT
3.20
NT
5.35
NT
NT
NT
2.58
NT
NT
3.98
NT
NT
NT
NT
2.70
NT
5.28
NT
NT
NT
3.59
NT
NT
NT
>10
>10
NT
NT
>10
>10
>10
>10
5.5
15
16
NT
NT
17
NT
G2M 56% + toxic at 2.5 lM
NT
20b
21b
30
G1 at 50 lM
NT
34a
34c
35
28
>10
>10
2.7
NT
NT
>10
7
36
37
G2M + 8N 87% at 5 lM
NT
NT
>10
>10
8
1.5
38
a 24% of untreated control cells were recovered in the G2+M phases of the cell cycle, 44% in the G1 phase.
b Drug concentration (lM) that inhibits leukemia cell growth by 50% after incubation in liquid medium for 72 h.
Table 2. Cytotoxicities (IC50 in lM) of ꢁlinearꢂ pyrrolocarbazoles 22a, 23a and 24–28
Compound
L1210
Cell cyclea
P338
P338 CPT5b
GSK3
Camptothecin
NT
4.3
>10
3.2
3.8
0.8
8.5
0.5
0.64
1
NT
NS toxic at 20 lM
NT
0.024
NT
NT
3.98
NT
NT
5.60
NT
2.82
NT
3.36
NT
3.23
NT
1.69
NT
NT
22a
23a
24a
24b
25a
25b
26a
26b
27a
27b
28a
28b
>10
>10
>10
>10
>10
>10
>10
>10
>10
>10
>10
>10
G2M 48% at 10 lM
G2M 56% at 10 lM
G2M 38% at 2.5 lM
NS toxic at 50 lM
NS toxic at 2 lM
NS toxic at 5 lM
G2M 76% at 10 lM
NS toxic at 25 lM
G2M 80% at 2 lM
Inactive at 2 lM
5.06
NT
1.41
NT
2.06
NT
3.24
NT
4.2
0.34
0.53
0.52
NT
a 24% of untreated control cells were recovered in the G2+M phases of the cell cycle, 44% in the G1 phase.
b Drug concentration (lM) that inhibits leukemia cell growth by 50% after incubation in liquid medium for 72 h.

2268
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
indicating that they exhibit preferential interactions with
defined sequences. The most pronounced effects were
observed with 28a, which recognizes a subset of
sequences. The differential cleavage plot shown in Fig-
ure 2 indicates that 28a protects some sequences against
DNase I cutting and promotes the activity of the enzyme
at adjacent sites. Both AT- and GC-rich sequences can
provide binding sites for 28a and no clear sequences
preference can be deduced. A more detailed biochemical
study will be needed to better understand the sequence
recognition property of this molecule.
DNA induces significant shifts in the UV–vis spectrum
of the pyrrolo[3,4-b]carbazole 28a (Fig. 4A). Addition
of calf thymus DNA to the compound results in a signifi-
cant decrease in extinction coefficient at the peak wave-
length centred at 290 nm and 380 nm and these two
peaks are shifted to longer wavelengths. The marked
hypochromic and bathochromic effects together with
the occurrence of well defined isosbestic points at 300
and 340 nm reflect the strong interaction with DNA
and a homogeneous type of binding. The exact mode
of interaction with DNA is not precisely known at pres-
ent, but circular dichroism measurements (Fig. 4B) sug-
gest a minor groove binding process. Addition of calf
thymus DNA to a solution of 28a at a fixed concentra-
tion leads to the appearance of a positive CD band in
the drug absorption band around 310 nm. Such a posi-
tive CD is commonly observed with minor groove bind-
ers whereas intercalating drugs generally produce
negative CD (or no CD at all). At this stage, we consider
28a as a DNA minor groove binder. This hypothesis is
consistent with the footprinting measurements but here
again it will be necessary to investigate further the
DNA binding properties of this molecule using high reso-
lution methods to fully validate this hypothesis.
Compound 28a binds strongly to DNA. This is also evi-
dent from melting temperature experiments where it was
observed that the molecule protects DNA from heat
denaturation. The drug-induced increase of the melting
temperature (Tm) of calf thymus DNA (58%AT,
Tm = 63 ꢁC) and poly(dAT)2 (100%AT, Tm = 41 ꢁC) is
proportional to the drug concentration (Fig. 3).
3.4. CDK-1 inhibition
All the derivatives of Tables 1 and 2 were screened
against affinity chromatography purified CDK1/cyclin
B. None of these compounds showed any significant
inhibitory activity at a 10 lM final concentration.
3.5. GSK-3a/b inhibition
Compounds were also tested on affinity chromatogra-
phy purified GSK-3a/b. A few derivatives showed a near
micromolar inhibitory activity in the b-carbolines series.
The most active one was compound 38, which is not sur-
prising, considering the large lipophilic group appended
on the b-carboline moiety, which exists in most potent
GSK-3 inhibitors derived from pyrrolidine(di)ones.
The presence of nitrogen(s) in the aromatic ring(s) (for
example, b-carboline vs carbazole) appears to be a strin-
gent requirement13b,c to develop a GSK-3 inhibitory
activity.
4. Conclusion
Nearly all the derivatives we synthesized showed a
micromolar range activity on L1210 cells. It could be
noticed that the N-substitution of the pyrrolocarbazoles
by the SEM group (vs NH compounds) did not modify
the activity. In the camptothecin family, it has already
been observed that appendage with a lipophilic trialkyl-
silyl chain are not detrimental to the anticancer activ-
ity.41 Some of the molecules tested induce a strong
accumulation of L1210 cells in the G1 or G2+M phases
of the cell cycle probably via a CDK-independent path-
way (no CDK1 inhibition by our compounds was
observed). The exact targets of these cytotoxic
compounds remain unknown at present but it is plausi-
ble that DNA interaction plays a role in the cytotoxic
Figure 1. DNase I footprinting of 28a on a 30-end radiolabelled 176-bp
DNA fragment from pTUC. The products of nuclease digestion were
resolved on an 8% polyacrylamide gel containing 8 M urea. The
concentration in lM of the drug is shown at the top of the appropriate
gel lanes. Control tracks (Cont.) contained no drug. The track labelled
ꢁGꢂ represents dimethylsulfate–piperidine markers specific for
guanines.

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2269
1
0
-1
-2
B
GGCCAGTGAGCGCGCGT AATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGT ATCGAT
90
80
70
60
50
40
30
20
Figure 2. Differential cleavage plots comparing the susceptibility of the 176-bp DNA fragment to DNase I cutting in the presence of 50 lM 28a.
Negative values correspond to a ligand-protected site and positive values represent enhanced cleavage. Vertical scales are in units of ln(fa)ꢀln(fc),
where fa is the fractional cleavage at any bond in the presence of the drug and fc is the fractional cleavage of the same bond in the control, given
closely similar extents of overall digestion. Each line drawn represents a 3-bond running average of individual data points, calculated by averaging
the value of ln(fa)ꢀln(fc) at any bond with those of its two nearest neighbors. Only the region of the restriction fragment analyzed by densitometry is
shown.
30
0.8
(A)
0.6
20
0.4
0.2
10
0.0
250
300
350
400
0
wavelength (nm)
0.0
0.2
0.4
0.6
0.8
1.0
drug/DNA-phosphate ratio
(B)
10
5
Figure 3. Melting temperature variation DTm (Tdrug–DNA
ꢀ
complex
alone
TDNA
in ꢁC) of poly(dAT)2 (d) calf thymus DNA (s) after
0
incubation with 28a. The Tm measurements were performed at
increasing drug/DNA-phosphate ratio with a fixed DNA concentra-
tion (20 lM). Tm measurements were performed in BPE buffer pH 7.1
(6 mM Na2HPO4, 2 mM NaH2PO4, 1 mM EDTA), in 1 cm quartz
cuvettes at 260 nm with a heating rate of 1 ꢁC/min. The Tm values were
obtained from first-derivative plots.
-5
-10
-15
230
250
270
290
310
330
wavelength (nm)
Figure 4. DNA titration of 28a followed by (A) absorption and (B)
circular dichroism spectroscopies. To 1 mL of drug solution at 20 lM
were added aliquots of a concentrated calf thymus DNA solution. The
phosphate-DNA/drug ratio increased from 0 to 20. Measurements
were performed in BPE buffer pH 7.1 (6 mM Na2HPO4, 2 mM
NaH2PO4, 1 mM Na2EDTA). Spectra are referenced against DNA
solutions of exactly the same DNA concentration and were adjusted to
a common baseline.
action because the most cytotoxic molecule 28a was
found to be a potent DNA binder. This compound
stands as an usual sequence selective minor groove bin-
der and it provides novel opportunities to design drugs
acting on DNA and DNA-manipulating enzymes. How-
ever, we cannot exclude the involvement of enzymes
implicated in the cell-cycle control. Whatever the exact
mechanism of action, we have discovered a new class
of antiproliferative agents. Work are in progress in our
laboratories to evaluate their anticancer activities and
develop additional pyrrolocarbazoles.
(300 MHz) and 13C NMR (75 MHz) spectra were ac-
quired on a Bruker AC 300 spectrometer in CDCl3 with
TMS as internal standard, or in DMSO-d6 and chemical
shifts were expressed in ppm (d). Mass spectra were re-
corded with a VG Autospec apparatus. All solvents
were purified by following standard literature methods.
Trimethylsilylethoxymethyl chloride (SEMCl) was pur-
chased from Aldrich and activated MnO2 from Merck.
N,N-Dimethyl-b-alanine hydrochloride42 and 4-(4,6-
dimethoxy[1,3,5]-triazin-2-yl)-4-methyl-morpholinium
chloride (DMTMM)30 were prepared as described in lit-
erature. (1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-acetalde-
hyde was synthesized as described in our previous
work.32 Chromatography was performed on silica gel
5. Experimental
5.1. Materials and methods
Melting points were determined with a Reichert Therm-
ovar hot-stage apparatus and are uncorrected. IR spec-
tra (film or KBr) were measured with a Bomem FTIR
instrument. UV spectra were measured in MeOH, using
a UNICAM 8700 UV–vis spectrophotometer. 1H NMR

2270
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
60 (Merck). Reactions were monitored using Merck
TLC aluminium sheets (Kieselgel 60F254). Elemental
analyses were carried out by the Microanalysis Service
of the University of Reims and their results were found
to be in satisfactory agreement ( 0.5%) with the calcu-
lated values.
hexane/ethyl acetate, 92:8), pure 7 (mixture of two insep-
arable regioisomers ꢁoꢂ and ꢁmꢂ, ratio 3:1) was isolated as
an unstable vivid yellow oil (56%). IR (film): m = 3053,
2953 (br), 2236 (CN), 1738 (s) (C@O), 1464, 1246,
1071 (br) (–CH2–O–CH2–), 837 (TMS) cmꢀ1; UV:
k
max = 222, 270, 280, 290 nm. The relative proportions
of the two regioisomers (ꢁoꢂ/ꢁmꢂ, ratio 3:1) were deter-
1
1
5.2. Synthesis
mined by H NMR spectroscopy; H NMR (CDCl3):
d = ꢀ0.057o,7m (s, 18H), 0.937o,7m (m, 4H), 1.377m (d,
J = 6.9 Hz, 3H), 1.407o (d, J = 7.0 Hz, 3H), 2.147m
(ddd, J = 7.2; 9.4; 13.9 Hz, 1H), 2.357o (ddd, J = 1.5;
2.6; 13.3 Hz, 1H), 2.447o (ddd, J = 5.3; 12.9; 13.3 Hz,
1H), 2.567m (ddd, J = 3.6; 6.0; 13.9 Hz, 1H), 3.187m
(ddd, J = 3.6; 7.2; 9.4 Hz, 1H), 3.247o (ddd, J = 2.6;
5.3; 12.9 Hz, 1H), 3.287m (dq, J = 6.9; 7.2 Hz, 1H),
3.367o (ddq, J = 1.5; 5.3; 7.0 Hz, 1H), 3.577o,7m (m,
4H), 3.837m (s, 3H), 3.917o (s, 3H), 4.517o (d,
J = 5.3 Hz, 1H), 4.527m (dd, J = 6.0; 9.4 Hz, 1H),
5.427o (d, J = 11.2 Hz, 1H), 5.447m (d, J = 10.4 Hz,
1H), 5.477o (d, J = 11.2 Hz, 1H), 5.487m (d,
J = 10.4 Hz, 1H), 7.237o,7m (t, J = 8.0 Hz, 2H),
7.297o,7m (t, J = 8.0 Hz, 2H), 7.447m (d, J = 8.0 Hz,
1H), 7.467o (d, J = 8.0 Hz, 1H), 7.597o (d, J = 8.0 Hz,
1H), 7.817m (d, J = 8.0 Hz, 1H); 13C NMR (CDCl3):
d = ꢀ1.57o,7m, 17.87m, 18.07o, 20.47o, 20.67m, 25.97o,
5.2.1. [1-(2-Trimethylsilanyl-ethoxymethyl)-2-vinyl-1H-
indol-3-yl]-acetonitrile (6, R4 = SEM). A solution of 6
(R4 = H) (6.0 g; 33.0 mmol) in dry THF (60 mL) was
added at 0 ꢁC under N2 atmosphere to a suspension of
NaH 50% (2.84 g; 59.4 mmol) in dry THF (60 mL).
After 30 min stirring at 0 ꢁC, was added dropwise tri-
methylsilylethoxymethyl chloride (SEMCl) (9.92 mL;
56.0 mmol) under N2 atmosphere. The orange suspen-
sion was stirred for 45 min at 0 ꢁC then for 3 h at room
temperature. The mixture was then quenched at 0 ꢁC by
a brine solution (50 mL) and extracted three times with
diethyl ether (3 · 20 mL). The combined organic layers
were first neutralized (pH 6–7) with a 5% aqueous solu-
tion of NaHCO3 (60 mL) then washed with a brine solu-
tion (60 mL). The organic layer was finally dried over
anhydrous MgSO4 and filtered. After concentration
under reduced pressure, the crude brown oil (1.61 g)
was purified by column chromatography (eluent: cyclo-
hexane/ethyl acetate, 95:5) to afford 9.30 g of 6
(R4 = SEM) as a yellow oil (90%). IR (film) = 3055,
2953 (br), 2922 (s), 2895 (s), 2247 (CN), 1626, 1464 (s),
1327, 1248 (s), 1095, 1046 (s) (–CH2–O–CH2–), 860,
26.97m, 27.07o,7m, 29.87o, 34.07m, 38.47o, 43.37m, 52.57m
,
52.67o, 66.07m, 66.17o, 72.27o, 72.87m, 102.97m, 103.67o,
109.67m, 109.87o, 117.67o, 118.57m, 118.67o, 119.87m
,
120.77m, 120.87o, 122.67m, 122.77o, 125.47o,7m, 137.67o,
137.97m, 139.37m, 140.67o, 171.97o, 172.87m; EI-MS (m/
z, %): 398 (M+, 49), 340 (14), 281 (88), 280 (76), 241
(44), 182 (100), 181 (60). HREIMS (C22H30N2O3Si):
calcd 398.2026; found 398.2029.
837 (s) (TMS), 748 cmꢀ1
; UV: kmax = 224, 236,
1
297 nm; H NMR (CDCl3): d = 0.02 (s, 9H), 0.90 (t,
J = 8.6 Hz, 2H), 3.59 (t, J = 8.6 Hz, 2H), 3.90 (s, 2H),
5.50 (s, 2H), 5.77 (d, J = 18.0 Hz, 1H), 5.79 (d,
J = 12.6 Hz, 1H), 6.90 (dd, J = 12.6; 18.0 Hz, 1H), 7.25
(t, J = 8.0 Hz, 1H), 7.35 (t, J = 8.0 Hz, 1H), 7.50 (d,
J = 8.0 Hz, 1H), 7.70 (d, J = 8.0 Hz, 1H); 13C NMR
(CDCl3): d = ꢀ1.50, 13.7, 17.7, 65.8, 72.5, 102.7, 109.7,
117.9, 118.3, 120.8, 122.1, 123.3, 124.8, 126.7, 136.0,
136.9; EI-MS (m/z, %): 312 (M+, 72), 254 (43), 195
(75), 155 (100), 154 (64). HREIMS (C18H24N2OSi):
calcd 312.1658; found 312.1665.
5.2.3. General procedure for the synthesis of the three
isomers (8: major isomer) and (80,800: mixture of two
inseparable isomers) (Scheme 9) (GP). Cycloadduct 8
and 80,800 (mixture of two inseparable isomers) were ob-
tained as described in our previous work24 and purified
by column chromatography.
5.2.3.1. 2,4-Dimethyl-1,3-dioxo-5-(2-trimethylsilanyl-
ethoxymethyl)-1,2,3,3a,4,5,10,10a-octahydro-pyrrolo-[3,4-b]
carbazole-10-carbonitrile ((8a) and (80a,800a), R4 = SEM,
R1 = Me). The purification by column chromatography
afforded: 80a,800a (mixture of two inseparable isomers,
ratio 2:9) as an unstable vivid yellow oil (11%) (eluent:
cyclohexane/ethyl acetate, 90:10) and 8a as an unstable
pale yellow foam (68%) (eluent: ethyl acetate). For
80a,800a: IR (film): m = 3057, 2953 (br), 2238 (CN), 1780
(C@O), 1703 (s) (C@O), 1460, 1439, 1080 (br) (–CH2–
O–CH2), 837 (TMS) cmꢀ1; UV: kmax = 221, 270, 280,
290 nm. The relative proportions of the two isomers
5.2.2.
4-Cyano-1-methyl-9-(2-trimethylsilanyl-ethoxy-
methyl)-2,3,4,9-tetrahydro-1H-carbazole-3-carboxylic acid
methyl ester (7, ꢁortho (o)ꢂ isomer, R4 = SEM) and 4-
cyano-1-methyl-9-(2-trimethylsilanyl-ethoxy-methyl)-2,3,4,-
9-tetrahydro-1H-carbazole-2-carboxylic acid methyl ester
(7, ꢁmeta (m)ꢂ isomer, R4 = SEM) (Scheme 8). Cycload-
duct 7 (mixture of two inseparable regioisomers) was
obtained as described in our previous work.24 After
purification by column chromatography (eluent: cyclo-
CN
CN
CN
CN
CN
O
O
O
CO2Me
N
R1
N
R1
N
R1
N
N
CO2Me
N
N
N
O
O
O
SEM CH3
SEM CH3
SEM CH3
SEM CH3
8"
SEM CH3
7o
7m
8'
8
Scheme 8.
Scheme 9.

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2271
0
0
1
(80a/800a, ratio 2:9) were determined by 00H NMR
6.808 b (d, J = 7.0 Hz, 4H), 6.948 b (t, J0= 7.0 Hz, 4H),
0
00
spectroscopy; H NMR (CDCl3): d = ꢀ0.058 a (s, 9H),
7.098 b (t, J = 7.0 Hz, 2H), 7.17–7.448 b,8 b (m, 4H),
0 00
1
0
0
00
0
ꢀ0.018 a. (s, 9H), 0.908 a,8 a (m, 4H), 1.058 a (d, J 0=0
7.468 b (d, J = 8.0 Hz, 1H), 7.518 b (d, J = 8.0 Hz, 1H),
00 0
00
7.0 Hz, 3H), 1.668 a (d, J = 7.3 Hz, 3H), 2.888 a
7.588 b (d, J = 8.0 Hz, 1H), 8.0280 b (d, J = 8.0 Hz, 1H);
00 0 00
0
00
(s, 3H), 3.128 a 0 (s, 3H), 3.428 a (dd, J = 1.0; 9.1 Hz,
13C NMR (CDCl3): d = ꢀ1.68 b,8 b, 15.38 b00, 17.78 b
,
,
,
,
,
,
,
,
00
0
0
00
0
00
0
0
1H), 3.45–3.608 a,8 a (m, 4H), 3.538 a (dd, J = 3.8;
17.98 b, 21.48 b, 23.0800b, 24.08 b, 27.18 b, 28.68 b, 42.68 b
00 00 0 0 00
80b
0
00
9.5 Hz, 1H), 3.708 a (dd, J = 6.8; 9.5 Hz, 1H), 3.828 a
42.78 b, 43.58 0b0 , 46.38 b,0 43.68 b, 44.18 b, 66.08 b, 66.2
00 0
80b
0
00
(dd, J = 0.9; 9.1 Hz, 1H), 3.848 a (dq, J = 3.8; 7.0 Hz,
71.7 , 71.98 b, 101.38 b, 101.78 b00, 109.58 b0 , 109.98 b
00
0
00
0
00
80b
1H), 3.988 a (dq, J = 1.0; 7.3 Hz, 1H), 4.478 a (d,
117.58 b, 118.3 , 119.38 b, 120.28 b, 120.98 b, 121.08 b
0 00 0 00 0 00
00
00
J = 6.8 Hz, 1H), 4.888 a0 (d, J = 0.9 Hz, 1H), 5.388 a (d,
122.68 b, 122.98 b, 124.78 b, 125.08 b, 126.98 b, 127.18 b
0 00 0 00 00 0
0
J = 11.4 Hz, 1H), 5.438 a (d, 00 J = 11.4 Hz, 1H), 5.528 a
127.68 b, 127.78 b, 128.38 b, 128.48 b, 134.48 b, 135.08 b
00 0 0 00 00 0
(d, J = 11.4 0H0 z, 1H), 5.538 a 00 (d, J = 11.4 Hz, 1H),
136.88 b, 137.18 b, 138.68 b, 139.38 b, 176.08 b, 176.38 b
00 0
0
7.19–7.388 a,8 a (m, 6H), 7.608 a (d, J = 8.0 Hz, 1H),
177.48 b, 177.68 b; EI-MS (m/z, %): 499 (M+, 47), 441
(24), 382 (43), 342 (36), 181 (100). HREIMS
(C29H33N3O3Si): calcd 499.2291; found 499.2267. For
8b: IR (film): m = 3063, 3034, 2953 (br), 2247 (CN),
1779 (C@O), 1707 (s) (C@O), 1400, 1078 (br) (–CH2–
O–CH2–), 837 (TMS) cmꢀ1; UV: kmax = 222, 272, 280,
289 nm; 1H NMR (CDCl3): d = ꢀ0.20 (s, 9H), 0.87
(m, 2H), 1.39 (d, J = 7.3 Hz, 3H), 3.28 (dd, J = 1.0;
8.5 Hz, 1H), 3.44 (m, 2H), 3.72 (dd, J = 6.2; 8.5
Hz, 1H), 3.93 (dq, J = 1.0; 7.3 Hz, 1H), 4.46
(d, J = 14.5 Hz, 1H), 4.55 (d, J = 6.2 Hz, 1H), 4.56 (d,
J = 14.5 Hz, 1H), 5.30 (d, J = 11.4 Hz, 1H), 5.47 (d,
J = 11.4 Hz, 1H), 6.79 (d, J = 7.0 Hz, 2H), 6.89
(t, J = 7.0 Hz, 2H), 7.08 (t, J = 7.0 Hz, 1H), 7.22 (t,
J = 8.0 Hz, 1H), 7.30 (t, J = 8.0 Hz, 1H), 7.47 (d,
J = 8.0 Hz, 1H), 8.20 (d, J = 8.0 Hz, 1H); 13C NMR
(CDCl3): d = ꢀ1.5, 17.8, 19.6, 25.4, 28.6, 42.0, 42.6,
46.8, 66.0, 71.9, 100.7, 109.7, 117.2, 118.5, 121.1,
122.6, 124.8, 127.4, 127.5, 128.3, 134.6, 136.8, 137.6,
174.6, 177.0; EI-MS (m/z, %): 499 (M+, 73), 441 (39),
382 (59), 342 (100), 181 (74). HREIMS (C29H33N3O3Si):
calcd 499.2291; found 499.2286.
0
8.058 a (d, 00 J = 8.0 0Hz, 1H); 13C NMR (CDCl3):
0
00
0
00
0
d = ꢀ1.58 a,8 a0 , 15.88 a00 , 17.28 0a, 17.8800a, 22.08 a, 23.18 a
,
,
,
,
,
00
00
80a
23.98 a, 24.98 a, 25.78 0a, 27.08 a, 28.28 a, 43.38 a, 43.8
0
00
00
0
00
0
00
44.48 a, 46.38 a,00 66.28 a,8 0a0 , 72.08 a,0 72.18 a, 101.68 a,8 a
0
0
00
109.68 a, 110.08 a, 117.78 a, 118.78 a, 119.48 a, 120.38 a
0
00
0
00
0
00
0
00
121.18 a,8 a, 123.08 a,8 a, 125.18 a, 125.28 a, 137.08 a,8 a
0
00
0
00
0
00
138.58 a, 139.38 a 176.38 a,8 a, 177.88 a,8 a; EI-MS (m/z,
%): 423 (M+, 23), 365 (22), 306 (52), 266 (71), 181
(100). HREIMS (C23H29N3O3Si): calcd 423.1978; found
423.1991. For 8a: IR (film): m = 3053, 2953 (br), 2247
(CN), 1780 (C@O), 1709 (s) (C@O), 1460, 1439, 1078
(br) (–CH2–O–CH2–), 837 (TMS) cmꢀ1
;
UV:
k
max = 221, 272, 281, 290 nm. 1H NMR (CDCl3):
d = ꢀ0.02 (s, 9H), 0.91 (m, 2H), 1.40 (d, J = 7.3 Hz,
3 H), 2.88 (s, 3H), 3.31 (dd, J = 0.5; 8.7 Hz, 1H), 3.48
(m, 2H), 3.75 (dd, J = 6.8; 8.7 Hz, 1H), 3.98 (dq,
J = 0.5; 7.3 Hz, 1H), 4.56 (d, J = 6.8 Hz, 1H), 5.40 (d,
J = 11.4 Hz, 1H), 5.57 (d, J = 11.4 Hz, 1H), 7.22
(t, J = 8.0 Hz, 1H), 7.28 (t, J = 8.0 Hz, 1H), 7.46 (d,
J = 8.0 Hz, 1H), 8.19 (d, J = 8.0 Hz, 1H); 13C NMR
(CDCl3): d = ꢀ1.5, 17.9, 25.1, 25.5, 27.8, 41.4, 46.7,
66.0, 72.0, 100.4, 109.7, 117.0, 118.5, 121.0, 122.6,
124.9, 136.9, 137.7, 174.9, 177.4; EI-MS (m/z, %): 423
(M+, 48), 365 (37), 306 (68), 266 (100), 181 (80). HRE-
IMS (C23H29N3O3Si): calcd 423.1978; found 423.1991.
5.2.4. General procedure for the aromatization of car-
bazoles 7 and 8 (GP). Cycloadducts 7 (mixture of 2
inseparable regioisomers) or 8 (major isomer) and acti-
vated MnO2 were refluxed for 8 h in dry toluene under
N2 atmosphere. After filtration on Celite, followed by
concentration under reduced pressure, the crude solid
was purified either by column chromatography or by
crystallization from MeOH/diethyl ether (90:10).
5.2.3.2. 2-Benzyl-4-methyl-1,3-dioxo-5-(2-trimethyl-
silanyl-ethoxymethyl)-1,2,3,3a,4,5,10,10a-octahydro-pyr-
rolo[3,4-b]carbazole-10-carbonitrile ((8b) and (80b,800b),
R4 = SEM, R1 = Bn). The purification by column chro-
matography afforded: 80b,800b (mixture of two insepara-
ble isomers, ratio 1:8) as an unstable vivid yellow oil
(9%) (eluent: cyclohexane/ethyl acetate, 85:15) and 8b
as an unstable pale orange foam (59%) (eluent: cyclo-
hexane/ethyl acetate, 70:30). For 8b,800b: IR (film):
m = 3063, 3034, 2951 (br), 2241 (CN), 1460, 1780
5.2.4.1. 4-Cyano-1-methyl-9-(2-trimethylsilanyl-ethoxy-
methyl)-9H-carbazole-3-carboxylic acid methyl ester (9),
4-cyano-1-methyl-9-(2-trimethylsilanyl-ethoxymethyl)-9H-
carbazole-2-carboxylic acid methyl ester (10), 4-hydroxy-
1-methyl-9-(2-trimethylsilanyl-ethoxymethyl)-9H-carba-
zole-3-carboxylic acid methyl ester (11), 1-methyl-9-(2-
trimethylsilanyl-ethoxy-methyl)-9H-carbazole-3-carboxy-
lic acid methyl ester (12). These compounds were synthe-
sized from 7 according to GP: cycloadducts 7 (1.13 g,
2.85 mmol) and activated MnO2 (3.72 g, 48.2 mmol)
were refluxed in dry toluene (20 mL). After filtration,
concentration the purification by column chromatogra-
phy afforded: 59.0 mg of 11 as a white powder (5%) (elu-
ent: cyclohexane/ethyl acetate, 85:15), 7.6 mg of 12 as an
orange oil (1%) (eluent: cyclohexane/ethyl acetate,
80:20), 34.0 mg of 10 as a dark yellow amorphous solid
(3%) (eluent: cyclohexane/ethyl acetate, 60:40) and
561.5 mg of 9 as a white powder (50%) (eluent: cyclohex-
ane/ethyl acetate, 50:50). For 9: mp 144–146 ꢁC; IR
(C@O), 1076 (br) (–CH2–O–CH2–), 837 (TMS) cmꢀ1
;
UV: kmax = 221, 270, 280, 290 nm. The relative propor-
tions of the two isomers (80b/800b, ratio 1:8) were deter-
1
1
mined by H00 NMR spectroscopy; H NMR (CDCl3):
(d, J = 7.1 Hz, 3H),
0
80b
d = ꢀ0.0180 b,8 b (s, 18H), 0.86
00
00
0.88–0.938 b,8 b (m, 4H), 1.698 b (d, J = 7.4 Hz, 3H),
0
00
3.348 b (dd, J = 3.9; 10.3 Hz, 1H), 3.398 b (dd, J = 1.0;
0
00
0
8.9 Hz, 1H), 3.42–3.528 b,8 (m, 4H), 3.528 b (dd,
00
J = 7.0; 10.3 Hz, 1H), 3.778 b (dd, J = 1.0; 8.9 Hz, 1H),
0
00
3.798 b (dq, J = 3.9; 7.1 Hz, 1H), 3.988 b (dq, J = 1.0;
0
00
7.4 Hz, 1H), 4.388 b (d, J = 7.0 Hz, 1H), 4.498 b (s,00 2H),
0
00
4.778 b (s, 2H), 4.898 b (d, J = 1.0 Hz, 1H), 5.348 b (d,
0
00
J = 11.4 Hz, 1H), 5.398 b (d, 0 J = 11.6 Hz, 1H), 5.478 b
(d, J = 11.4 Hz, 1H), 5.488 b (d, J = 11.6 Hz, 1H),

2272
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
(KBr): m = 3090, 2949 (br), 2218 (CN), 1721 (s) (CO),
1584, 1572 (s), 1464, 1456, 1439, 1250 (br), 1072,5 (br)
(–CH2–O–CH2–), 833 (TMS) cmꢀ1; UV: kmax = 228,
253, 262, 289, 342 nm; 1H NMR (CDCl3): d = ꢀ0.10
(s, 9H), 0.89 (m, 2H), 2.90 (s, 3H), 3.54 (m, 2H), 4.03
(s, 3H), 5.79 (s, 2H), 7.34 (t, J = 8.0 Hz, 1H), 7.51 (d,
J = 8.0 Hz, 1H), 7.56 (t, J = 8.0 Hz, 1H), 7.88 (s, 1H),
8.79 (d, J = 8.0 Hz, 1H); 13C NMR (CDCl3): d = ꢀ1.5,
17.8, 19.9, 52.4, 66.2, 72.9, 102.4, 109.1, 117.4, 121.0,
121.4, 122.4, 124.3, 125.6, 125.7, 128.1, 130.9, 140.9,
142.5, 165.3; EI-MS (m/z, %): 394 (M+, 45), 363 (14),
336 (92), 277 (82), 232 (100). HREIMS (C22H26N2O3Si):
calcd 394.1713; found 394.1721. Anal. Calcd for
C22H26N2O3Si: C, 66.97; H, 6.64; N, 7.10. Found: C,
66.95; H, 6.21; N, 6.83. For 10: IR (film): m = 3065,
2951 (br), 2224 (CN), 1616 (s), 1458, 1248 (br), 1072
(br), 837 (TMS) cmꢀ1; UV: kmax = 223, 255, 269, 320,
tration, concentration the purification by crystallization
afforded:70.0 mg of 23a as a grey powder (69%). Mp
215 ꢁC; IR (KBr): m = 3026, 2951, 2228 (CN), 1767 (s)
(CO), 1705 (s) (CO), 1614, 1599, 1462, 1439 (s), 1381,
1352, 1055 (br) (–CH2–O–CH2–), 841 (TMS) cmꢀ1; UV:
k
max = 232, 253, 267, 304, 359, 378 nm; 1H NMR (CDCl3):
d = ꢀ0.05 (s, 9H), 0.92 (m, 2H), 3.13 (s, 3H), 3.20 (s, 3H),
3.59 (m, 2H), 5.83 (s, 2H), 7.17 (t, J = 8.0 Hz, 1H), 7.46 (d,
J = 8.0 Hz, 1H), 7.49 (t, J = 8.0 Hz, 1H), 8.18 (d,
J = 8.0 Hz, 1H); 13C NMR (CDCl3): d = ꢀ1.8, 12.8,
17.7, 23.6, 66.3, 73.2, 95.5, 109.8, 114.2, 119.8, 121.5,
121.8, 125.1, 126.0, 126.1, 127.9, 129.0, 141.3, 142.7,
165.0, 167.4; EI-MS (m/z, %): 419 (M+, 20), 361 (100),
302 (61). HREIMS (C23H25N3O3Si): calcd 419.1665;
found 419.1673. Anal. Calcd for C23H25N3O3Si: C,
65.84; H, 6.00; N, 10.02. Found: C, 65.30; H, 5.68; N, 9.62.
1
355 nm; H NMR (CDCl3): d = ꢀ1.5 (s, 9H), 0.95 (m,
5.2.4.3. 2-Benzyl-4-methyl-1,3-dioxo-5-(2-trimethyl-
silanyl-ethoxymethyl)-1,2,3,5-tetrahydro-pyrrolo[3,4-b]-
carbazole-10-carbonitrile (23b, R1 = Bn). Tetracyclic
compound 23b was synthesized from 8b (R1 = Bn)
according to GP: 8b (1.14 g, 4.29 mmol) and activated
MnO2 (2.98 g, 34.0 mmol) were refluxed in dry toluene
(60 mL). After filtration, concentration the purification
by crystallization afforded: 1.21 g of 23b as a yellow
powder (57%). Mp 211–213 ꢁC; IR (KBr): m = 3034,
2951 (br), 2226 (CN), 1761 (s) (CO), 1709 (s) (CO),
1614, 1431, 1400, 1342, 1074 (br) (–CH2–O–CH2–),
835 (TMS) cmꢀ1; UV: kmax = 232, 253, 266, 306, 362,
380 nm; 1H NMR (CDCl3): d = ꢀ0.07 (s, 9H), 0.92
(m, 2H), 3.29 (s, 3H), 3.58 (m, 2H), 4.83 (s, 2H), 5.92
(s, 2H), 7.23 (t, J = 8.0 Hz, 1H), 7.28–7.52 (m, 5 H),
7.57 (d, J = 7.0 Hz, 2H), 8.48 (d, J = 8.0 Hz, 1H); 13C
NMR (CDCl3): d = ꢀ1.5, 13.1, 17.8, 41.8, 66.5, 73.3,
95.5, 109.7, 114.7, 120.2, 122.0, 122.1, 125.6, 126.4,
126.7, 128.0, 128.1, 128.7, 129.2, 129.4, 136.2, 141.7,
143.0, 165.0, 167.4; EI-MS (m/z, %): 495 (M+, 21), 437
(100), 378 (36). HREIMS (C29H29N3O3Si): calcd
495.1978; found 495.1977. Anal. Calcd for C29H29N3O3-
Si: C, 70.27; H, 5.90; N, 8.48. Found: C, 69.83; H,
5.72; N, 8.11.
2H), 3.11 (s, 3H), 3.62 (m, 2H), 3.99 (s, 3H), 5.87 (s,
2H), 7.41 (t, J = 8.0 Hz, 1H), 7.61 (t, J = 8.0 Hz, 1H),
7.64 (d, J = 8.0 Hz, 1H), 8.07 (s, 1H), 8.69 (d,
J = 8.0 Hz, 1H); 13C NMR (CDCl3): d = ꢀ1.5, 16.4,
17.9, 52.5, 66.2, 73.9, 101.3, 109.6, 118.2, 120.5, 121.4,
122.4, 126.3, 127.5, 128.8, 129.3, 129.5, 139.8, 143.6,
167.6; EI-MS (m/z, %): 394 (M+, 32), 363 (9), 336 (81),
277 (90), 232 (100), 205 (84). HREIMS (C22H26N2O3Si):
calcd 394.1713; found 394.1722. For 11: mp 106–107 ꢁC;
IR (KBr): m = 2955 (br), 2851, 1674 (s) (C@O), 1628,
1447, 1350, 1213 (br), 1055 (br) (–CH2–O–CH2–), 835
(TMS) cmꢀ1; UV: kmax = 232, 253, 263, 292, 302, 328,
341 nm; 1H NMR (CDCl3): d = ꢀ0.05 (s, 9H), 0.89
(m, 2H), 2.76 (s, 3H), 3.58 (m, 2H), 4.00 (s, 3H), 5.75
(s, 2H), 7.35 (t, J = 8.0 Hz, 1H), 7.41–7.51 (m, 2H),
7.62 (s, 1H), 8.45 (d, J = 8.0 Hz, 1H), 11.53 (s, 1H);
13C NMR (CDCl3): d = ꢀ1.5, 17.9, 19.1, 51.8, 65.9,
72.9, 103.4, 108.7, 112.3, 112.7, 121.1, 122.8, 123.2,
125.2, 129.2, 140.8, 143.7, 157.8, 171.2; EI-MS (m/z,
%): 385 (M+, 70), 296 (36), 295 (100), 268 (53), 236
(38), 180 (29). HREIMS (C21H27NO4Si): calcd
385.1709; found 385.1705. Anal. Calcd for C21H27NO4-
Si: C, 65.42; H, 7.06; N, 3.63. Found: C, 65.39; H,
7.00; N, 3.41. For 12: IR (film): m = 3053, 2949 (br),
1717 (s) (C@O), 1601, 1485, 1456, 1435, 1252 (br), 837
(TMS) cmꢀ1; UV: kmax = 215, 235, 244, 264, 277, 306,
319, 333 nm; 1H NMR (CDCl3): d = ꢀ0.08 (s, 9H),
0.89 (m, 2H), 2.88 (s, 3H), 3.58 (m, 2H), 3.99 (s, 3H),
5.83 (s, 2H), 7.31 (t, J = 8.0 Hz, 1H), 7.48–7.59 (m,
2H), 7.96 (s, 1H), 8.12 (d, J = 8.0 Hz, 1H), 8.67 (s,
1H); 13C NMR (CDCl3): d = ꢀ1.5, 17.9, 19.6, 51.9,
65.9, 73.2, 109.3, 120.3, 120.4, 120.7, 121.1, 121.8,
123.4, 124.2, 126.4, 130.2, 141.8, 142.1, 167.8; EI-MS
(m/z, %): 369 (M+, 48), 338 (9), 311 (27), 252 (97), 208
(50), 207 (100), 192 (55), 180 (54), 179 (60). HREIMS
(C21H27NO3Si): calcd 369.1760; found 369.1772.
5.2.5. 5-Methyl-6-(2-trimethylsilanyl-ethoxymethyl)-1,2-
dihydro-6H-pyrrolo[3,4-c]carbazol-3-one (13). Nitrile-
ester 9 (128.0 mg, 0.325 mmol) and Raney-Nickel
(1.30 g) were stirred for 51 h in dry toluene/absolute eth-
anol (4 mL:10 mL) under pressure atmosphere of hydro-
gen (6 bars, autoclave). After filtration on Celite and
concentration under reduced pressure, 112.0 mg of 13
were obtained as a white powder (94%). Mp 234–
235 ꢁC; IR (KBr): m = 3206 (br), 3078, 3063, 2953 (br),
1697 (s) (CO), 1628, 1608, 1452 (s), 1358, 1074 (br)
(–CH2–O–CH2–), 835 (TMS) cmꢀ1; UV: kmax = 238, 244,
261, 270, 284, 321, 334, 306 nm; 1H NMR (DMSO-
d6): d = ꢀ0.12 (s, 9H), 0.85 (m, 2H), 2.91 (s, 3H), 3.56
(m, 2H), 4.81 (s, 2H), 5.97 (s, 2H), 7.33 (t, J = 8.0 Hz,
1H), 7.54 (s, 1H), 7.55 (t, J = 8.0 Hz, 1H), 7.91 (d,
J = 8.0 Hz, 1H), 7.99 (d, J = 8.0 Hz, 1H), 8.50 (s, 1H);
13C NMR (DMSO-d6): d = ꢀ1.2, 17.5, 19.4, 44.5, 65.3,
72.9, 110.3, 118.4, 120.8, 121.4, 121.7, 121.9, 122.8,
125.0, 126.4, 136.8, 140.4, 141.9, 170.9; EI-MS (m/z,
5.2.4.2. 2,4-Dimethyl-1,3-dioxo-5-(2-trimethylsilanyl-
ethoxymethyl)-1,2,3,5-tetrahydro-pyrrolo[3,4-b]-carbazole-
10-carbonitrile (23a, R1 = Me). Tetracyclic compound 23a
was synthesized from 8a (R1 = Me) according to GP: 8a
(103.0 mg, 0.24 mmol) and activated MnO2 (169.0 mg,
1.95 mmol) were refluxed in dry toluene (10 mL). After fil-

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2273
%): 366 (M+, 38), 308 (100), 249 (62). HREIMS
(C21H26N2O2Si): calcd 366.1763; found 366.1752. Anal.
Calcd for C21H26N2O2Si: C, 68.81; H, 7.15; N, 7.64.
Found: C, 68.35; H, 7.10; N, 7.45.
5.2.8.
1-Dimethylamino-6-(2-dimethylaminoethyl)-5-
methyl-1,2-dihydro-6H-pyrrolo[3,4-c]carbazol-3-one (16)
and 1-dimethylamino-5-methyl-1,2-dihydro-6H-pyrrolo[3,
4-c]carbazol-3-one (17). To a solution of 15 (220.0 mg,
0.93 mmol) in dry DMF (10 mL) was added at 0 ꢁC
(ice bath), NaH 50% (134. 0 mg, 2.80 mmol). After
45 min stirring at 0 ꢁC, the chlorhydrate of the 2-di-
methylaminoethylchloride (148.0 mg, 1.025 mmol) was
added. The suspension was stirred for 72 h at room tem-
perature under N2 atmosphere. Then the mixture was
diluted with water (4 mL) and distilled under reduced
pressure. The residue was purified by column chroma-
tography to afford 27.0 mg of 16 as a yellow powder
(eluent: CH2Cl2/acetone, 60:40) (10%) and 43.0 mg of
17 as a yellow powder (eluent: acetone) (13%). For 16:
mp 189–191 ꢁC; IR (KBr): m = 3408, 3225 (br), 3073,
2962, 2931, 2861, 2820, 2780, 1683 (s) (CO), 1648,
5.2.6.
4-Cyano-1-methyl-9-(2-trimethylsilanyl-ethoxy-
methyl)-9H-carbazole-3-carboxylic acid (14). Distilled
water (2 mL) and powdered potassium hydroxide
(175.0 mg, 3.12 mmol) were successively added to a solu-
tion of 9 (410.0 mg, 1.04 mmol) in t-BuOH/toluene/
CH2Cl2 (30 mL:7 mL:3 mL) and were heated for 4 h at
80 ꢁC under N2 atmosphere. After concentration under
reduced pressure, the residue was diluted with a 5%
aqueous solution of hydrochloric acid (6.24 mL) at
0 ꢁC (ice bath) and extracted with ethyl acetate
(10 mL · 2). The combined organic layers were washed
with water (8 mL · 2), dried over anhydrous magnesium
sulfate, filtered and concentrated under reduced pres-
sure. After crystallization in diethyl ether (4 mL),
339.0 mg of 14 as a white powder were isolated (86%).
Mp 179 ꢁC; IR (KBr): m = 3187–3005 (br), 2953 (s),
2899, 2861, 2808, 2220 (CN), 1690 (s) (CO), 1614,
1566 (s), 1454, 1406, 1395, 1369, 1331 (s), 1281, 1248
(s), 1238 (s), 1096, 1080 (s) (–CH2–O–CH2–), 858 (br),
842 (br) (TMS), 746, 727 cmꢀ1; UV: kmax = 227, 252,
261, 284, 323, 339 nm; 1H NMR (DMSO-d6):
d = ꢀ0.10 (s, 9H), 0.87 (t, J = 7.8 Hz, 2H), 3.58 (t,
J = 7.8 Hz, 2H), 3.92 (s, 3H), 5.98 (s, 2H), 7.43 (t,
J = 8.0 Hz, 1H), 7.67 (t, J = 8.0 Hz, 1H), 7.97 (d,
J = 8.0 Hz, 1H), 8.00 (s, 1H), 8.69 (d, J = 8.0 Hz, 1H);
13C NMR (DMSO-d6): d = ꢀ1.3, 17.4, 19.4, 65.5, 72.8,
101.7, 110.8, 117.5, 120.2, 121.2, 121.4, 124.8, 125.6,
126.7, 128.5, 131.0, 140.5, 142.8, 165.9; EI-MS
(m/z, %): 380 (M+, 42), 322 (93), 263 (100), 232 (92).
HREIMS (C21H24N2O3Si): calcd 380.1556; found
380.1568.
1642, 1602, 1451, 1381, 1361, 1326, 1044, 1014 cmꢀ1
;
UV: kmax = 222, 239, 246, 269, 277, 310, 328, 344 nm;
1H NMR (DMSO-d6): d = 2.20 (s, 6H), 2.29 (s, 6H),
2.63 (t, J = 7.5 Hz, 2H), 2.94 (s, 3H), 4.74 (t,
J = 7.5 Hz, 2H), 5.81 (s, 1H), 7.28 (t, J = 8.0 Hz, 1H),
7.49 (s, 1H), 7.53 (t, J = 8.0 Hz, 1H), 7.67 (d,
J = 8.0 Hz, 1H), 8.45 (d, J = 8.0 Hz, 1H), 8.67 (s, 1H);
13C NMR (DMSO-d6): d = 20.1, 39.0, 43.0, 45.7, 58.6,
75.2, 109.4, 118.6, 119.7, 121.1, 121.3, 122.3, 124.3,
124.6, 126.2, 137.9, 140.7, 141.3, 170.4; EI-MS (m/z,
%): 350 (M+, 94), 306 (89), 292 (22), 261 (33), 248
(100), 247 (75), 235 (51), 219 (95), 205 (58), 193 (76),
192 (80), 178 (49), 165 (39), 151 (30). HREIMS
(C21H26N4O): calcd 350.2107; found 350.2131. For 17:
mp > 350 ꢁC; IR (KBr) = 3397, 3215 (br), 3053, 2932,
2861, 2820, 2780, 1673 (s) (CO), 1623, 1602, 1451,
1421, 1376, 1351, 1331, 1024, 732 cmꢀ1; UV: kmax = 219,
237, 246, 265, 275, 310, 325, 338 nm; 1H NMR (DMSO-
d6): d = 2.20 (s, 6H), 2.67 (s, 3H), 5.80 (s, 1H), 7.24 (t,
J = 8.0 Hz, 1H), 7.46 (t, J = 8.0 Hz, 1H), 7.50 (s, 1H),
7.60 (d, J = 8.0 Hz, 1H), 8.39 (d, J = 8.0 Hz, 1H), 8.60
(s, 1H), 11.67 (s, 1H); 13C NMR (DMSO-d6): d = 17.4,
39.0, 75.4, 111.3, 117.5, 119.5, 119.7, 121.4, 121.9,
124.1, 124.6, 126.1, 137.9, 140.6, 141.8, 171.0; EI-MS
(m/z, %): 279 (M+, 8), 236 (56), 235 (99), 207 (100),
192 (49), 179 (18). HREIMS (C17H17N3O): calcd
279.1372; found 279.1382.
5.2.7. 5-Methyl-1,2-dihydro-6H-pyrrolo[3,4-c]carbazol-3-
one (15). N-Protected compound 13 (252.0 mg,
0.69 mmol) was stirred for 7 h under N2 atmosphere at
room temperature in a 3 M solution of hydrochloric acid
(concentrated aqueous solution of HCl/ethanol/tolu-
ene, 40:34:26) (13.5 mL). After concentration under re-
duced pressure, the beige solid was diluted in water
(10 mL), decanted, washed with water (10 mL), filtered
under reduced pressure and finally washed with CH2Cl2
(5 mL · 3). After filtration, 154.0 mg of 15 were isolated
as a white powder (95%). Mp 272 ꢁC; IR (KBr):
m = 3352–3119 (br), 2930, 2911, 2852, 1667 (s) (CO),
1626 (s), 1610 (s), 1501, 1451, 1424, 1337, 1298, 1232
(s), 1209, 1059, 873, 781, 737 (s) cmꢀ1; UV: kmax = 220,
5.2.9.
1-Methyl-9H-carbazole-3,4-dicarboxylic
acid
dimethyl ester (18). A suspension of 9 (158.0 mg,
0.40 mmol) in a 9 M methanolic solution of hydrochlo-
ric acid (85 mL) was refluxed for 120 h under N2 atmo-
sphere. After concentration under reduced pressure, the
pale yellow residue was crystallized and recrystallized in
diethyl ether/methanol (80:20) (5 mL · 2) to afford
84.0 mg of 18 as a white crystalline powder (71%). Mp
199 ꢁC; IR (KBr): m = 3395 (br), 3005, 2951, 1726 (s)
(CO), 1684 (s) (CO), 1587, 1456, 1429, 1339, 1271 (s),
1244 (s), 1215, 1192, 1165, 1132, 1103, 1049, 997, 797,
772, 746, 737 cmꢀ1; UV: kmax = 229, 245, 264, 279,
312, 326, 336 nm; 1H NMR (DMSO-d6): d = 2.68 (s,
3H), 3.91 (s, 3H), 4.05 (s, 3H), 7.27 (t, J = 8.0 Hz,
1H), 7.52 (t, J = 8.0 Hz, 1H), 7.64 (d, J = 8.0 Hz, 1H),
7.81 (d, J = 8.0 Hz, 1H), 7.89 (s, 1H), 11.3 (s, 1H); 13C
1
238, 245, 263, 271, 285, 305.5, 321, 335 nm; H NMR
(DMSO-d6): d = 2.68 (s, 3H), 4.81 (s, 2H), 7.29 (t,
J = 8.0 Hz, 1H), 7.49 (t, J = 8.0 Hz, 1H), 7.52 (s, 1H),
7.63 (d, J = 8.0 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H),
8.38 (s, 1H); 13C NMR (DMSO-d6): d = 17.3, 44.5,
111.7, 119.7, 116.6, 120.1, 120.4, 121.8, 121.9, 123.8,
126.0, 136.8, 140.3, 141.3, 171.5; EI-MS (m/z, %): 236
(M+, 100), 221 (58), 206 (33), 207 (52), 180 (27).
HREIMS (C15H12N2O): calcd 236.0950; found
236.0949.

2274
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
NMR (DMSO-d6): d = 17.0, 52.4, 52.9, 112.1, 117.1,
118.3, 120.2, 120.9, 121.1, 121.7, 126.9, 127.1, 127.5,
140.9, 141.9, 166.4, 169.5; EI-MS (m/z, %): 297 (M+,
78), 266 (100), 179 (30). HREIMS (C17H15NO4): calcd
297.1001; found 297.1010.
and extracted with a saturated solution of potassium
carbonate (5 mL). The organic layer was acidified with
a 5% aqueous citric acid solution (5 mL), washed with
water (5 mL · 2), dried over anhydrous magnesium sul-
fate, filtered and concentrated under reduced pressure.
The residue (566.0 mg) was purified by column chroma-
tography (eluent: cyclohexane/CH2Cl2, 40:60) to afford
54.0 mg of 20a (overall yield:83%). Mp 92 ꢁC; IR
(KBr): m = 3288, 3061, 3036, 2951, 2922, 2905, 2876,
1728 (s) (CO), 1647 (s) (CO), 1604, 1460, 1454, 1410
(s), 1352, 1331, 1223, 1067 (s) (–CH2–O–CH2–), 1040,
858, 835 (s) (TMS), 752, 729, 698 cmꢀ1; UV: kmax = 229,
262, 272, 299, 305, 352 nm; 1H NMR (DMSO-d6):
d = ꢀ0.15 (s, 9H), 0.82 (t, J = 7.8 Hz, 2H), 2.98 (s,
3H), 3.56 (t, J = 7.8 Hz, 2H), 5.07 (s, 2H), 5.99 (s,
2H), 7.25 (t, J = 7.0 Hz, 1H), 7.29 (t, J = 8.0 Hz, 1H),
7.31–7.40 (m, 4H), 7.60 (t, J = 8.0 Hz, 1H), 7.72 (s,
1H), 7.91 (d, J = 8.0 Hz, 1H), 9.59 (d, J = 8.0 Hz, 1H),
9.76 (s, 1H); 13C NMR (DMSO-d6): d = ꢀ1.2, 17.5,
19.8, 40.3, 65.4, 72.9, 110.0, 119.8, 120.7, 120.9, 122.7,
124.2, 126.1, 126.7, 127.3, 127.5, 127.9, 128.2, 128.8,
137.5, 142.3, 142.9, 156.5, 167.8; EI-MS (m/z, %): 469
(M+, 73), 411 (100), 352 (56). HREIMS (C28H31N3O2-
Si): calcd 469.2186; found 469.2160.
5.2.10. Dimethyl-[2-(5-methyl-1,3-dioxo-3,6-dihydro-1H-
pyrrolo[3,4-c]carbazol-2-yl)-ethyl]-ammonium
chloride
(19c)ꢃ. Salt 19c was obtained by following the proce-
dure described in the literature21g with pyrido[2,3-b]in-
doles:115.0 mg of 18 (0.39 mmol) were heated at
100 ꢁC for 5 days in unsym-dimethylethylenediamine
(1 mL). The purification was led as followed: the crude
mixture was diluted in CH2Cl2 (3 mL) and extracted
with a 10% aqueous solution of hydrochloric acid
(2 mL). The orange aqueous layer was washed with
ethyl acetate (3 mL) to get rid of the unreacted 18.
The resultant aqueous layer was diluted in CH2Cl2
(7 mL) and alkalized with a saturated aqueous solution
of potassium carbonate (3 mL). The aqueous layer was
washed with ethyl acetate (6 mL) and the organic layers
(CH2Cl2 and ethyl acetate) were washed with water
(4 mL · 2), combined, dried over anhydrous magnesium
sulfate, filtered and concentrated under reduced pres-
sure. The residue was diluted in a 9 M methanolic solu-
tion of hydrochloric acid (3 mL) and stirred for 1 h at
room temperature. After concentration under reduced
pressure, the crude solid was purified by crystallization
in diethyl ether/methanol (5:1) to afford 81.6 mg of 19c
as a vivid yellow solid (59%). Mp 286 ꢁC; IR (KBr):
m = 3296 (s), 3053, 3033, 2962, 2942, 1748 (CO), 1683
(s) (CO), 1612, 1597, 1492, 1446, 1426 (s), 1406, 1386,
1346, 1331, 1245, 1290, 742 (s), 732, 646, 626,
616 cmꢀ1; UV: kmax = 228, 230, 252, 273, 286, 309,
5.2.12. 2-(2-Dimethylaminoethyl)-1-imino-5-methyl-6-(2-
trimethylsilanyl-ethoxymethyl)-1,2-dihydro-6H-pyrrolo[3,
4-c]carbazol-3-one (20b). To a solution of 14 (74.0 mg,
0.195 mmol) in CH2Cl2 (4 mL) were successively added
under N2 atmosphere, triethylamine (0.124 mL,
0.88 mmol) at room temperature and isobutylchloro-
formiate at ꢀ26 ꢁC. After 2 h stirring at ꢀ26 ꢁC,
unsym-dimethylethylenediamine (0.066 mL, 0.60 mmol)
was added at ꢀ26 ꢁC to the mixture. The yellow solution
was stirred 70 h at room temperature and concentrated
under reduced pressure. The yellow residue (343.0 mg)
was diluted in CH2Cl2 (6 mL) and washed successively
with brine (4 mL) and water (4 mL). The organic layer
was dried over anhydrous magnesium sulfate, filtered
and concentrated under reduced pressure to afford a
dark yellow oil (152.0 mg), which was purified by pre-
parative TLC (eluent: CH2Cl2/methanol, 95:5) to give
23.0 mg of 20b as a yellow amorphous solid (26%).
Unreacted starting material 14 (13.0 mg; 17.5%). Mp
80–82 ꢁC; IR (KBr): m = 3262, 2951, 2895, 2859, 2822,
2772, 1721 (s) (CO), 1647 (s) (CO), 1458, 1454, 1414,
1331, 1223, 1072 (s) (–CH2–O–CH2–), 858, 835 (s)
(TMS), 752, 733 cmꢀ1; UV: kmax = 229, 262, 270, 299,
1
362 nm; H NMR (DMSO-d6): d = 2.73 (s, 3H), 2.86
(s, 6H), 3.45 (t, J = 5.6 Hz, 2H), 4.01 (t, J = 5.6 Hz,
2H), 7.33 (t, J = 8.0 Hz, 1H), 7.60 (t, J = 8.0 Hz, 1H),
7.67 (d, J = 8.0 Hz, 1H), 7.71 (s, 1H), 8.81 (d,
J = 8.0 Hz, 1H), 12.19 (s, 1H); 13C NMR (DMSO-d6):
d = 17.8, 33.1, 42.6, 55.0, 112.1, 118.1, 120.1, 120.4,
120.5, 123.6, 124.0, 124.7, 126.6, 128.4, 141.9, 143.4,
169.3, 169.4; EI-MS (m/z, %): 321 (M+ ꢀ HCl, 100),
276 (13), 263 (39), 250 (28), 205 (17), 192 (11), 180
(45), 179 (57), 178 (34), 152 (21). HREIMS
(C19H19N3O2): calcd 321.1477; found 321.1485.
5.2.11. 2-Benzyl-1-imino-5-methyl-6-(2-trimethylsilanyl-
ethoxy-methyl)-1,2-dihydro-6H-pyrrolo[3,4-c]carbazol-3-
one (20a). Benzylamine (0.498 mL, 4.57 mmol) was
added at 0 ꢁC (ice bath) to a white suspension of 14
(204.0 mg, 0.54 mmol) in methanol (20 mL). After
15 min stirring at room temperature under N2 atmo-
sphere, DMTMM (772.0 mg, 2.81 mmol) was added at
0 ꢁC to the solution and the mixture was stirred for
45 h at room temperature under N2 atmosphere until
the disappearance of 14 (TLC monitoring). The suspen-
sion was filtered under reduced pressure to afford
156.0 mg of 20a. The mother liquors was concentrated
under reduced pressure, diluted in CH2Cl2 (19 mL)
1
304, 352 nm; H NMR (CDCl3): d = ꢀ0.1 (s, 9H), 0.88
(m, 2H), 2.60 (t, J = 6.3 Hz, 2H), 2.92 (s, 3H), 3.56
(m, 2H), 3.88 (t, J = 6.3 Hz, 2H), 5.80 (s, 2H), 7.37
(t, J = 8.0 Hz, 1H), 7.52 (d, J = 8.0 Hz, 1H), 7.57 (t,
J = 8.0 Hz, 1H), 7.64 (s, 1H), 9.10 (s, 1H), 9.58 (d,
J = 8.0 Hz, 1H); 13C NMR (CDCl3): d = ꢀ1.5, 17.9,
20.3, 36.4, 45.6, 58.0, 66.0, 73.1, 108.7, 120.4, 121.0,
121.7, 122.9, 124.5, 125.2, 126.9, 127.4, 142.6, 142.8,
158.8, 168.5; EI-MS (m/z, %): 450 (M+, 8), 380 (100),
333 (39), 218 (40). HREIMS (C25H34N4O2Si): calcd
450.2451; found 450.2413.
5.2.13. 2-(2-Dimethylaminoethyl)-5-methyl-6-(2-tri-meth-
ylsilanyl-ethoxymethyl)-6H-pyrrolo[3,4-c]-carba-zole-3-
dione (21b). Unsym-dimethylethylenediamine (0.093 mL,
ꢃ Derivative 19c prepared by an independent way is claimed in a
patent.43

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2275
0.845 mmol) was added at 0 ꢁC (ice bath) to a white sus-
pension of 14 (214.0 mg, 0.56 mmol) in methanol
(20 mL). After 15 min stirring at room temperature
under N2 atmosphere, DMTMM (459.0 mg, 1.66 mmol)
was added at 0 ꢁC to the solution and the mixture was
stirred for 7h at room temperature under N2 atmosphere
until the disappearance of 14 (TLC monitoring). After
concentration under reduced pressure, the crude residue
(1.01 g) was diluted in CH2Cl2 (9 mL) and extracted
with a saturated potassium carbonate solution (5 mL).
The organic layer was acidified with a 5% aqueous citric
acid solution (5 mL), washed with water (5 mL · 3),
dried over anhydrous magnesium sulfate, filtered and
concentrated under reduced pressure. The yellow resi-
due (1.53 g) was purified by column chromatography
(eluent: CH2Cl2/methanol, 90:10) to afford 132.0 mg of
21b as a vivid yellow foam (52%). IR (film): m = 3491–
3368 (br), 3239, 3053, 2951 (s), 2895, 2868, 2824, 2793,
1759 (s) (CO), 1705 (s) (CO), 1603, 1456, 1410, 1383,
1356, 1331, 1248, 1229, 1092, 1072 (s) (–CH2–O–CH2–),
858, 837 (s) (TMS), 750 cmꢀ1; UV: kmax = 230, 247,
266, 273, 307, 337, 358 nm; 1H NMR (CDCl3):
d = ꢀ0.05 (s, 9H), 0.89 (m, 2H), 2.41 (s, 6H), 2.72 (t,
J = 6.5 Hz, 2H), 2.92 (s, 3H), 3.54 (m, 2H), 3.89 (t,
J = 6.5 Hz, 2H), 5.81 (s, 2H), 7.39 (t, J = 8.0 Hz, 1H),
7.57 (t, J = 8.0 Hz, 1H), 7.59 (d, J = 8.0 Hz, 1H), 7.65
(s, 1H), 9.11 (d, J = 8.0 Hz, 1H); 13C NMR (CDCl3):
d = ꢀ1.5, 17.9, 20.3, 35.2, 45.0, 56.9, 66.1, 73.1, 109.0,
121.1, 121.3, 121.4, 123.1, 124.2, 124.9, 126.0, 127.0,
128.3, 142.9, 143.2, 169.2, 169.4; EI-MS (m/z, %): 451
(M+, 73), 334 (100), 193 (58). HREIMS (C25H33N3O3-
Si): calcd 451.2291; found 451.2308.
8.80 (d, J = 8.0 Hz, 1H), 12.01 (s, 1H); 13C NMR
(DMSO-d6): d = 17.6, 40.9, 112.0, 118.1, 120.2, 120.4,
120.5, 123.2, 123.6, 124.7, 126.6, 127.5, 127.6, 128.3,
128.8, 137.4, 141.8, 143.4, 169.0, 169.1; EI-MS (m/z,
%): 340 (M+, 100), 208 (36), 207 (35), 180 (28). HRE-
IMS (C22H16N2O2): calcd 340.1212; found 340.1248.
5.2.14.2.
Dimethyl-[2-(5-methyl-1,3-dioxo-3,6-di-
hydro-1H-pyrrolo[3,4-c]carbazol-2-yl)-ethyl]-ammonium
chloride (19c). Imide 19c was synthesized from 21b
according to GP: 21b (90.0 mg, 0.20 mmol) was stirred
for 3.5 h in 12 mL of a 3 M HCl solution (concd aq
HCl/ethanol/CH2Cl2, 3.1 mL:6.9 mL:2.0 mL). After fil-
tration, 50.0 mg of 19c were obtained as a vivid yellow
powder. By recrystallization of the filtrate in diethyl
ether/methanol (5:1) further 17.0 mg of 19c were
obtained. (overall yield: 94%).
5.2.15. General procedure for the preparation of com-
pounds (22) (GP). To a stirred solution of 8 in dry DMF
was added at ꢀ25 ꢁC under N2 atmosphere, a solution
of trichloroisocyanuric acid (TCCA) in dry DMF. After
10 min of stirring at ꢀ25ꢁC, triethylamine was added
and the solution was stirred at room temperature until
disappearance of 8 (TLC monitoring). After concentra-
tion under reduced pressure, the residue was purified by
column chromatography (eluent: CH2Cl2) to afford 22.
5.2.15.1.
8-Chloro-2,4-dimethyl-1,3-dioxo-5-(2-tri-
methylsilanyl-ethoxymethyl)-1,2,3,5-tetrahydro-pyrrolo-
[3,4-b]carbazole-10-carbonitrile (22a, R1 = Me). Nitrile
22a was synthesized from 8a according to GP: to
125.0 mg (0.30 mmol) of 8a in 4.5 mL of dry DMF were
added at ꢀ25 ꢁC 206.0 mg (0.89 mmol) of TCCA in
4.5 mL of dry DMF and 0.399 mL (2.86 mmol) of trieth-
ylamine. The solution was stirred for 3.5 h at room tem-
perature, concentrated and purified to afford 49.0 mg of
22a, as a yellow powder (36%). Mp 191–193 ꢁC; IR
(KBr): m = 3073, 2953 (br), 2230 (CN), 1769 (s) (CO),
1713 (s) (CO), 1600, 1460, 1439, 1379, 1292, 1078, 1069
(br) (–CH2–O–CH2–), 837 (TMS), 750 cmꢀ1; UV:
5.2.14. General procedure for the N-SEM cleavage of
(20a) and (21b) (GP). Compound 20a or 21b were stirred
at room temperature in a 3 M solution of hydrochloric
acid (concentrated aqueous HCl/ethanol/CH2Cl2,
26:74). The suspension was filtered under reduced pres-
sure to afford 19 as a solid. The filtrate was concentrated
under reduced pressure and recrystallized in diethyl
ether/methanol several times to isolate the further 19.
k
max = 212, 238, 256, 270, 304, 325, 366, 380 nm; 1H
5.2.14.1. 2-Benzyl-5-methyl-6H-pyrrolo[3,4-c]-carba-
zole-1,3-dione (19a)§. Imide 19a was synthesized
from 20a according to GP: 20a (74.0 mg, 0.16 mmol)
was stirred for 7 h in 10 mL of a 3 M HCl solution
(concd aq HCl/ethanol/CH2Cl2, 2.6 mL:6.4 mL:1.0 mL).
After filtration, 45.0 mg of 19a were obtained as a vivid
yellow powder. By recrystallization of the filtrate in
diethyl ether/methanol (3:1) further 10.0 mg of 19a were
obtained. (overall yield: 84%). Mp 245–246 ꢁC; IR
(KBr): m = 3428 (br), 3205 (s), 3175 (s), 3104, 3063,
2952, 2911, 1748 (s) (CO), 1693 (s) (CO), 1612, 1597,
1497, 1461, 1441 (s), 1411, 1391, 1381 (s), 1356, 1336,
1195, 1009, 747 (s), 727, 646, 621 cmꢀ1; UV: kmax = 229,
255, 273, 287, 308, 361 nm; 1H NMR (DMSO-d6):
d = 2.69 (s, 3H), 4.81 (s, 2H), 7.29 (t, J = 7.0 Hz, 1H),
7.31 (t, J = 8.0 Hz, 1H), 7.35–7.39 (m, 4H), 7.58 (t,
J = 8.0 Hz, 1H), 7.64 (d, J = 8.0 Hz, 1H), 7.71 (s, 1H),
NMR (DMSO-d6): d = ꢀ0.09 (s, 9H), 0.83 (m, 2H),
3.05 (s, 3H), 3.22 (s, 3H), 3.57 (m, 2H), 5.95 (s, 2H),
7.65 (dd, J = 1.0; 8.0 Hz, 1H), 8.00 (d, J = 8.0 Hz, 1H),
8.26 (d, J = 1.0 Hz, 1H); 13C NMR (DMSO-d6):
d = ꢀ1.4, 12.6, 17.5, 24.0, 65.8, 73.2, 95.9, 112.9, 114.4,
120.1, 120.7, 124.5, 126.1, 126.6, 126.8, 128.5, 129.3,
141.6, 141.7, 164.9, 167.4; EI-MS (m/z, %): 455 (M+,
7), 453 (M+, 18), 431 (33), 429 (47), 397 (39), 395 (100),
370 (24), 338 (18), 336 (55). HREIMS (C23H24N3O3-
SiCl35): calcd 453.1275; found 453.1301. HREIMS
(C23H24N3O3SiCl37): calcd 455.1246; found 455.1363.
5.2.15.2. 2-Benzyl-8-chloro-4-methyl-1,3-dioxo-5-(2-
trimethylsilanyl-ethoxymethyl)-1,2,3,5-tetrahydro-pyrrolo[3,
4-b]carbazole-10-carbonitrile (22b, R1 = Bn). Nitrile 22b
was synthesized from 8b according to GP: to 138.0 mg
(0.30 mmol) of 8b in 6 mL of dry DMF were added at
ꢀ25 ꢁC 193.0 mg (0.83 mmol) of TCCA in 6 mL of dry
DMF and 0.432 mL (3.10 mmol) of triethylamine. The
solution was stirred for 4.5 h at room temperature,
concentrated and purified to afford 39.0 mg of 22b, as
§ Derivative 19a prepared by an independent way is claimed in a
patent.43

2276
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
a pale yellow powder (26%). Mp 219 ꢁC; IR (KBr):
m = 3069, 3032, 2949 (br), 2228 (CN), 1765 (s) (CO),
1713 (s) (CO), 1601, 1458, 1435, 1400 (s), 1339, 1072
J = 7.0 Hz, 2H), 7.51–7.61 (m, 2H), 8.24 (d,
J = 8.0 Hz, 1H); 13C NMR (CDCl3): d = ꢀ1.5, 12.7,
17.8, 38.0, 41.2, 66.1, 73.1, 109.7, 120.1, 121.7, 122.0,
122.7, 123.0, 125.7, 126.2, 127.3, 127.5, 128.4,
128.5, 136.1, 137.1, 142.7, 142.9, 168.4, 169.0; EI-MS
(m/z, %): 499 (M+, 100), 441 (32), 382 (45), 352 (55).
HREIMS (C29H33N3O3Si): calcd 499.2291; found
499.2262.
(–CH2–O–CH2–), 837 (TMS), 748 cmꢀ1
;
max = 211, 238, 257, 270, 305, 364, 383 nm; H NMR
UV:
1
k
(CDCl3): d = ꢀ0.01 (s, 9H), 0.98 (m, 2H), 3.29 (s, 3H),
3.63 (m, 2H), 4.96 (s, 2H), 5.98 (s, 2H), 7.35–7.52 (m,
5 H), 7.62 (d, J = 7.0 Hz, 2H), 8.41 (d, J = 1.7 Hz,
1H); 13C NMR (CDCl3): d = ꢀ1.7, 13.0, 17.7, 41.7,
66.5, 73.4, 96.6, 110.8, 114.0, 121.0, 121.1, 125.3,
125.7, 126.8, 127.7, 127.9, 128.5, 128.9, 129.0, 129.4,
135.9, 141.1, 141.9, 164.6, 167.0; EI-MS (m/z, %): 531
(M+, 9), 529 (M+, 20), 473 (41), 471 (100), 414 (12),
412 (34). HREIMS (C29H28N3O3SiCl35): calcd
529.1588; found 529.1531. HREIMS (C29H28N3O3-
SiCl37): calcd 531.1559; found 531.1521.
5.2.17. General procedures for the acylation of the amines
(24). General procedure A (GPA): To a solution of 24 in
methanol was added at 0 ꢁC (ice bath) the dimethyl-
amino acid. After 1 h stirring at 0 ꢁC under N2 atmo-
sphere, DMTMM was added to the solution. The mix-
ture was stirred at room temperature until the disap-
pearance of 24 (TLC monitoring) and then concentrated
under reduced pressure. The crude product was diluted
with CH2Cl2 and extracted with a saturated aqueous
solution of potassium carbonate. The organic layer
was extracted with a 5% aqueous citric acid solution,
the resultant organic layer was extracted with water
three times, dried over anhydrous magnesium sulfate,
filtered and concentrated under reduced pressure. The
crude solid was purified by column chromatography
(eluent: CH2Cl2/methanol) to afford 25 or 26. General
procedure B (GPB): triethylamine was added at room
temperature to a solution of N,N-dimethylglycine in
CH2Cl2/n-butanol. After 30 min stirring at room tem-
perature under N2 atmosphere, isobutylchloroformiate
was added at ꢀ15 ꢁC to the solution and stirred for
2 h at ꢀ15 ꢁC. Then a solution of 24 in CH2Cl2 was
added at ꢀ15 ꢁC to the mixture. The solution was stirred
at room temperature under N2 atmosphere and concen-
trated under reduced pressure. The crude product was
diluted with CH2Cl2 and extracted twice with brine.
The combined organic layers were washed with water,
dried over anhydrous magnesium sulfate and filtered.
After concentration under reduced pressure, the residue
was crystallized in diethyl ether to afford 25.
5.2.16. General procedure for the synthesis of the amines
(24). Nitrile 23 and Raney-Nickel were stirred in dry
toluene/absolute ethanol under pressure of hydrogen
(6 bars) in an autoclave. After filtration on Celite and
concentration under reduced pressure, the crude prod-
uct was crystallized in methanol/diethyl ether (90:10)
to obtain 24, as a solid.
5.2.16.1. 10-Aminoethyl-2,4-dimethyl-5-(2-trimethyl-
silanyl-ethoxymethyl)-5H-pyrrolo[3,4-b]carbazole-1,3-dione
(24a, R1 = Me). Amine 24a was synthesized from 23a
according to GP: 23a (500.0 mg, 1.19 mmol) and Raney-
Nickel (5.20 g) were stirred for 26 h in dry toluene/
absolute ethanol (39 mL:15 mL) under H2 atmosphere.
After filtration, the concentrated residue was crystallized
in 8 mL of methanol/diethyl ether to obtain 353.0 mg of
24a, as a pale yellow powder (70%). Mp 151ꢁC; IR
(KBr): m = 3370 (br), 3059, 2951 (br), 1744 (s) (CO),
1694 (s) (CO), 1613, 1587, 1437, 1379, 1354, 1074 (br)
(–CH2–O–CH2–), 835 (TMS) cmꢀ1; UV: kmax = 227,
251, 288, 372 nm; 1H NMR (CDCl3): d = ꢀ0.05 (s,
9H), 0.92 (m, 2H), 2.04 (s, 2H), 3.13 (s, 3H), 3.20 (s,
3H), 3.59 (m, 2H), 4.81 (s, 2H), 5.83 (s, 2H), 7.38 (t,
J = 8.0 Hz, 1H), 7.52–7.66 (m, 2H), 8.29 (d,
J = 8.0 Hz, 1H); 13C NMR (CDCl3): d = ꢀ1.5, 12.8,
17.9, 26.6, 38.0, 66.2, 73.2, 109.7, 120.4, 121.8, 122.1,
122.5, 123.1, 125.6, 126.9, 127.3, 136.0, 142.4, 142.8,
169.0, 169.5; EI-MS (m/z, %): 423 (M+, 64), 365 (33),
306 (53), 276 (100). HREIMS (C23H29N3O3Si): calcd
423.1978; found 423.1972.
5.2.17.1.
2-Dimethylamino-N-[2,4-dimethyl-1,3-di-
oxo-5-(2-trimethylsilanyl-ethoxymethyl)-1,2,3,5-tetra-hydro-
pyrrolo[3,4-b]carbazol-10-ylmethyl]-acetamide (25a, R1 =
Me). From 24a according to GPA: to 24a (58.0 mg,
0.14 mmol) in methanol (10 mL) was added N,N-di-
methyl glycine (35.0 mg, 0.34 mmol) and after 1 h stir-
ring, DMTMM (113.0 mg, 0.41 mmol). The mixture
was stirred for 22 h and the concentrated product was
diluted with CH2Cl2 (10 mL), extracted with saturated
aqueous K2CO3 (7 mL). The organic layer was extracted
successively with 5% aqueous citric acid (7 mL), with
saturated aqueous K2CO3 (7 mL), with water
(9 mL · 3), dried, filtered and concentrated. After puri-
fication by column chromatography (eluent: CH2Cl2/
methanol, 99:1), 41.0 mg of 25a were obtained as a beige
powder (59%). From 24a according to GPB: triethyl-
amine (0.581 mL, 4.14 mmol) was added to N,N-dimeth-
ylglycine (256.0 mg, 2.48 mmol) in CH2Cl2/n-butanol
(15 mL:5 mL). After 30 min stirring, isobutylchloro-
formiate (0.429 mL, 3.31 mmol) was added to the solu-
tion and stirred for 2 h. After addition of 24a
(560.0 mg, 1.65 mmol) in CH2Cl2 (19 mL), the mixture
was stirred for 13 h at room temperature and concen-
5.2.16.2.
10-Aminoethyl-2-benzyl-4-methyl-5-(2-tri-
methylsilanyl-ethoxymethyl)-5H-pyrrolo[3,4-b]-carbazole-
1,3-dione (24b, R1 = Bn). Amine 24b was synthesized
from 23b according to GP: 23b (300.0 mg, 0.61 mmol)
and Raney-Nickel (2.60 g) were stirred for 91 h in dry
toluene/absolute ethanol (7 mL:17 mL) under H2 atmo-
sphere. After filtration, the concentrated residue was
crystallized in 6 mL of methanol/diethyl ether to obtain
156.0 mg of 24b, as a vivid yellow powder (52%). Mp
135ꢁC; IR (KBr): m = 3482 (br), 3069, 2951, 1749 (s)
(CO), 1694 (s) (CO), 1611, 1429, 1400, 1350, 1072, 835
(TMS) cmꢀ1; UV: kmax = 226, 253, 290, 322, 374 nm;
1H NMR (CDCl3): d = ꢀ0.05 (s, 9H), 0.92 (m, 2H),
1.90 (s, 2H), 3.20 (s, 3H), 3.58 (m, 2H), 4.79 (s, 2H),
4.81 (s, 2H), 5.81 (s, 2H), 7.18–7.40 (m, 4H), 7.49 (d,

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2277
trated. The crude residue was diluted with CH2Cl2
(30 mL) and extracted with brine (26 mL). The organic
layer was washed with water (30 mL · 2), dried, filtered
and concentrated. After crystallization in diethyl ether
(6 mL), 380.0 mg of 25a were isolated as a beige powder
(57%). Mp 156–158 ꢁC; IR (KBr): m = 3437–3285 (br),
3074, 2949 (br), 2897, 2778, 1751 (s) (CO), 1697 (s)
(CO), 1668 (s) (CO), 1613, 1508, 1468, 1439, 1381,
1354, 1250, 1078 (s) (–CH2–O–CH2–), 1011, 860 (s),
837 (s) (TMS), 756 cmꢀ1; UV: kmax = 226, 251, 288,
371 nm; 1H NMR (CDCl3): d = ꢀ0.05 (s, 9H), 0.93
(m, 2H), 2.27 (s, 6H), 3.11 (s, 2H), 3.18 (s, 3H), 3.22
(s, 3H), 3.61 (m, 2H), 5.43 (d, J = 5.0 Hz, 2H), 5.84 (s,
2H), 7.39 (t, J = 8.0 Hz, 1H), 7.55 (t, J = 8.0 Hz, 1H),
7.59 (d, J = 8.0 Hz, 1H), 7.81 (s, 1H), 8.50 (d,
J = 8.0 Hz, 1H); 13C NMR (CDCl3): d = ꢀ1.5, 12.9,
17.9, 23.8, 36.0, 45.5, 62.4, 66.3, 73.3, 109.5, 122.0,
122.2 (·2), 123.4, 124.0, 126.4, 126.8, 127.6, 129.6,
142.5, 143.0, 169.0 (·2), 169.4; EI-MS (m/z, %): 508
(M+, 100), 465 (30), 391 (63), 291 (78), 290 (57), 289
(50), 276 (41). HREIMS (C27H36N4O4Si): calcd
508.2506; found 508.2521.
the chlorhydrate of N,N-dimethylaminopropanoic acid
(50.0 mg, 0.33 mmol) and after 1 h stirring, DMTMM
(123.0 mg, 0.445 mmol). The mixture was stirred 9 h
and the concentrated product was diluted with CH2Cl2
(10 mL), extracted with saturated aqueous K2CO3
(7 mL). The organic layer was extracted with 5% aque-
ous citric acid (7 mL) and the resultant organic layer
was extracted successively with saturated aqueous
K2CO3 (7 mL), with water (9 mL · 3), dried, filtered
and concentrated. After purification by column chroma-
tography (eluent: CH2Cl2/methanol, 90:10), 60.0 mg of
26a were obtained as a pale yellow powder (75%). Mp
163–165 ꢁC; IR (KBr) = 3306 (s), 3053, 2942 (s), 2891,
2820, 2769, 1748 (s) (CO), 1693 (s) (CO), 1633 (s)
(CO), 1532 (s), 1466, 1431 (s), 1376 (s), 1351 (s), 1295,
1250 (s), 1240 (s), 1079 (s) (–CH2–O–CH2–), 1009 (s),
858 (s), 842 (s) (TMS), 747 cmꢀ1; UV: kmax = 226, 251,
288, 369 nm; 1H NMR (CDCl3): d = ꢀ0.05 (s, 9H),
0.92 (m, 2H), 2.00 (s, 6H), 2.29–2.40 (m, 2H), 2.40–
2.55 (m, 2H), 3.17 (s, 3H), 3.26 (s, 3H), 3.60 (m, 2H),
5.43 (d, J = 5.1 Hz, 2H), 5.88 (s, 2H), 7.40 (t,
J = 8.0 Hz, 1H), 7.48–7.68 (m, 2H), 8.57 (d,
J = 8.0 Hz, 1H), 8.77 (s, 1H); 13C NMR (CDCl3):
d = ꢀ1.5, 12.9, 18.0, 23.7, 33.3, 36.1, 44.4, 55.0, 66.2,
73.3, 109.4, 121.9, 122.3, 123.0, 124.3, 126.3, 126.9,
127.5, 130.8, 142.6, 143.0, 168.9, 169.6, 172.4; EI-MS
(m/z, %): 522 (M+, 86), 422 (47), 405 (33), 306 (38),
292 (63), 291 (89), 277 (52), 276 (100). HREIMS
(C28H38N4O4Si): calcd 522.2662; found 522.2648.
5.2.17.2.
N-[2-Benzyl-4-methyl-1,3-dioxo-5-(2-tri-
methylsilanyl-ethoxymethyl)-1,2,3,5-tetrahydro-pyrrolo[3,
4-b]carbazol-10-ylmethyl]-2-dimethylamino-acetamide (25b,
R1 = Bn). From 24b according to GPB:triethylamine
(0.106 mL, 0.75 mmol) was added to N,N-dimethylgly-
cine (46.0 mg, 0.45 mmol) in CH2Cl2/n-butanol
(4.5 mL:1.5 mL). After 30 min stirring, isobutylchloro-
formiate (0.078 mL, 0.60 mmol) was added to the solu-
tion and stirred for 2 h. After addition of 24b
(150.0 mg, 0.30 mmol) in CH2Cl2 (10 mL), the mixture
was stirred for 17 h at room temperature and concen-
trated. The crude residue was diluted with CH2Cl2
(10 mL) and extracted with brine (5 mL). The organic
layer was washed with water (10 mL · 2), dried, filtered
and concentrated. After crystallization in diethyl ether
(2.5 mL), 64.0 mg of 25b were isolated as a pale yellow
powder (37%). Mp 95–97 ꢁC; IR (KBr): m = 3526–3217
(br), 3073, 2951 (br), 2895, 2826, 2778, 1749 (s) (CO),
1697 (s) (CO), 1660 (s) (CO), 1613, 1504, 1438, 1387,
1348, 1250, 1072 (s) (–CH2–O–CH2–), 860 (s), 837 (s)
(TMS), 748 cmꢀ1; UV: kmax = 226, 253, 289, 375 nm;
1H NMR (CDCl3): d = ꢀ0.03 (s, 9H), 0.93 (m, 2H),
2.19 (s, 6H), 3.05 (s, 2H), 3.29 (s, 3H), 3.61 (m, 2H),
4.89 (s, 2H), 5.48 (d, J = 5.3 Hz, 2H), 5.89 (s, 2H),
7.30 (t, J = 7.0 Hz, 1H), 7.35 (t, J = 7.0 Hz, 2H), 7.38
(t, J = 8.0 Hz, 1H), 7.50 (d, J = 7.0 Hz, 2H), 7.55 (t,
J = 8.0 Hz, 1H), 7.60 (d, J = 8.0 Hz, 1H), 7.83 (s, 1H),
8.57 (d, J = 8.0 Hz, 1H); 13C NMR (CDCl3): d = ꢀ1.5,
12.9, 18.0, 36.0, 41.4, 45.6, 62.7, 66.3, 73.3, 109.5,
121.9, 122.0, 122.2, 123.5, 124.2, 126.5, 126.8, 127.6,
127.7, 128.6, 128.7, 130.1, 136.8, 142.7, 143.0, 168.6,
169.1 (·2); EI-MS (m/z, %): 584 (M+, 48), 540 (44),
367 (48), 365 (50), 206 (53), 192 (86), 191 (100). HRE-
IMS (C33H40N4O4Si): calcd 584.2819; found 584.2780.
5.2.17.4.
N-[2-Benzyl-4-methyl-1,3-dioxo-5-(2-tri-
methyl-silanyl-ethoxymethyl)-1,2,3,5-tetrahydro-pyrrolo[3,
4-b]carbazol-10-ylmethyl]-3-dimethylamino-propionamide
(26b, R1 = Bn). From 24b according to GPA: to 24b
(75.0 mg, 0.15 mmol) in methanol (10 mL) was added
the chlorhydrate of N,N-dimethylaminopropanoic acid
(52.0 mg, 0.34 mmol) and after 1 h stirring, DMTMM
(148.0 mg, 0.54 mmol). The mixture was stirred 30 h
and the concentrated product was diluted with CH2Cl2
(10 mL), extracted with saturated aqueous K2CO3
(7 mL). The organic layer was extracted successively
with 5% aqueous citric acid (7 mL), with saturated aque-
ous K2CO3 (7 mL), with water (9 mL · 3), dried, filtered
and concentrated. After purification by column chroma-
tography (eluent: CH2Cl2/methanol, 95:5), 59.0 mg of
26b were obtained as a pale yellow powder (66%). Mp
149–150 ꢁC; IR (KBr): m = 3367, 3266 (br), 3053, 3023,
2942 (s), 2891, 2810, 2759, 1748 (s) (CO), 1693 (s)
(CO), 1668 (s) (CO), 1612, 1527 (br), 1462, 1426, 1386
(s), 1346 (s), 1295, 1250 (br), 1069 (s) (–CH2–O–CH2–),
858, 832 (s) (TMS), 747, 697 cmꢀ1; UV: kmax = 225,
252, 289, 369 nm; 1H NMR (CDCl3): d = ꢀ1.01 (s,
9H), 0.89 (m, 2H), 1.93 (s, 6H), 2.28–2.38 (m, 2H),
2.38–2.49 (m, 2H), 3.21 (s, 3H), 3.57 (m, 2H), 4.84 (s,
2H), 5.39 (d, J = 5.3 Hz, 2H), 5.84 (s, 2H), 7.26 (t,
J = 7.0 Hz, 1H), 7.29 (t, J = 7.0 Hz, 2H), 7.33 (t,
J = 8.0 Hz, 1H), 7.46 (d, J = 7.0 Hz, 2H), 7.48–7.58
(m, 2H), 8.59 (d, J = 8.0 Hz, 1H), 8.68 (s, 1H); 13C
NMR (CDCl3): d = ꢀ1.5, 12.9, 18.0, 33.1, 36.2, 41.4,
44.3, 55.0, 66.2, 73.3, 109.4, 121.6, 121.9, 122.3, 123.2,
124.4, 126.4, 126.8, 127.5, 127.6, 128.6, 131.0, 136.9,
142.6, 143.0, 168.5, 169.2, 172.3; EI-MS (m/z, %): 598
(M+, 100), 498 (35), 481 (39), 367 (65), 352 (34), 115
5.2.17.3.
3-Dimethylamino-N-[2,4-dimethyl-1,3-di-
oxo-5-(2-trimethylsilanyl-ethoxymethyl)-1,2,3,5-tetra-hydro-
pyrrolo[3,4-b]carbazol-10-ylmethyl]-propionamide (26a,
R1 = Me). From 24a according to GPA: to 24a
(65.0 mg, 0.15 mmol) in methanol (10 mL) was added

2278
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
(88). HREIMS (C34H42N4O4Si): calcd 598.2975; found
598.2979.
salt 28a was synthesized from 26a according to GP: 26a
(700.0 mg, 1.34 mmol) was stirred for 4 h30 in an aque-
ous 3 M solution of HCl (50.0 mL). After concentration,
followed by crystallization in methanol/diethyl ether/
water (10:10:1) (6 mL), 344.0 mg of 28a were obtained
as a pale yellow crystalline powder (60%). Mp 332 ꢁC;
IR (KBr): m = 3572–3397 (br), 3185 (br), 2942, 1743 (s)
(CO), 1688 (s) (CO), 1663 (s) (CO), 1542, 1532, 1451,
1431, 1381, 1361, 1245, 1230, 998, 757 cmꢀ1; UV:
5.2.18. General procedure for the N-SEM cleavage of
compounds (25) and (26). Protected compounds 25 or 26
was stirred at room temperature under N2 atmosphere
in a 3 M solution of hydrochloric acid (concentrated
aqueous HCl/ethanol/toluene, 40:34:26). After concen-
tration under reduced pressure, the residue was either
crystallized in methanol/water (97:3) or in methanol/
diethyl ether/water to afford 27 or 28.
k
max = 227, 251, 290, 372 nm; 1H NMR (DMSO-d6):
d = 2.63 (t, J = 7.5 Hz, 2H), 2.68 (s, 6H), 2.86 (s,
3H), 2.95 (s, 3H), 3.10 (t, J = 7.5 Hz, 2H), 5.18
(d, J = 4.0 Hz, 2H), 7.21 (t, J = 8.0 Hz, 1H), 7.51 (t,
J = 8.0 Hz, 1H), 7.64 (d, J = 8.0 Hz, 1H), 8.02 (d,
J = 8.0 Hz, 1H), 8.38 (m, 1H), 10.60 (s, 1H), 12.30 (s,
1H); 13C NMR (DMSO-d6): d = 12.2, 23.4, 29.7, 35.9,
42.1, 52.8, 112.2, 119.8, 120.5, 121.0, 122.0, 122.8,
123.7, 124.7, 127.0, 129.0, 141.2, 142.4, 168.5, 169.1;
EI-MS (m/z, %): 392 (M+ꢀ HCl, 12), 347 (16), 293
(27), 292 (100), 277 (13). HREIMS (C22H24N4O3): calcd
392.1848; found 392.1879.
5.2.18.1.
{[(2,4-Dimethyl-1,3-dioxo-1,2,3,5-tetra-
hydro-pyrrolo[3,4-b]carbazol-10-ylmethyl)-carbamoyl]-
methyl}-dimethyl-ammonium chloride (27a, R1 = Me).
Deprotected salt 27a was synthesized from 25a accord-
ing to GP: 25a (389.0 mg, 0.77 mmol) was stirred for
5 h in an aqueous 3 M solution of HCl (33.6 mL). After
concentration, followed by crystallization in methanol/
water (4 mL), 308.0 mg of 27a were obtained as a pale
yellow crystalline powder (97%). Mp 285 ꢁC; IR
(KBr): m = 3572–3340 (br), 3198 (br), 3051, 2803, 1748
(s) (CO), 1697 (s) (CO), 1674 (s) (CO), 1620, 1551,
1460, 1439, 1383 (s), 1362, 1233, 1011, 758 cmꢀ1 ; UV:
5.2.18.4. {2-[(2-Benzyl-4-methyl-1,3-dioxo-1,2,3,5-tet-
rahydro-pyrrolo[3,4-b]carbazol-10-ylmethyl)-carbamoyl]-
ethyl}-dimethyl-ammonium chloride (28b, R1 = Bn).
Deprotected salt 28b was synthesized from 26b accord-
ing to GP: 26b (81.0 mg, 0.135 mmol) was stirred for
7 h in an aqueous 3 M solution of HCl (10 mL). After
concentration, followed by crystallization in methanol/
diethyl ether/water (3:2:0.1) (2 mL), 39.0 mg of 28b were
obtained as a yellow crystalline powder (57%). Mp
300 ꢁC; IR (KBr): m = 3418 (br), 3205 (br), 3043, 2931,
1748 (CO), 1693 (s) (CO), 1663 (s) (CO), 1617, 1537,
k
max = 226, 252, 290, 372 nm; 1H NMR (DMSO-d6):
d = 2.70 (s, 6H), 2.90 (s, 3H), 3.01 (s, 3H), 3.70 (s,
2H), 5.25 (s, 2H), 7.25 (t, J = 8.0 Hz, 1H), 7.52 (t,
J = 8.0 Hz, 1H), 7.69 (d, J = 8.0 Hz, 1H), 8.11 (d,
J = 8.0 Hz, 1H), 8.69 (s, 1H), 12.45 (s, 1H); 13C NMR
(DMSO-d6): d = 12.3, 35.8, 43.6, 58.3, 109.5, 119.9,
120.5, 121.3, 122.0, 122.8, 123.7, 124.9, 127.1, 128.6,
141.3, 142.5, 165.5, 168.6; EI-MS (m/z, %): 378
(M+ ꢀ HCl, 100), 335 (45), 278 (41), 277 (85). HREIMS
(C21H22N4O3): calcd 378.1692; found 378.1705.
1456, 1431, 1391 (s), 1351, 1235, 1124, 752, 732 cmꢀ1
;
1
5.2.18.2. {[(2-Benzyl-4-methyl-1,3-dioxo-1,2,3,5-tetra-
hydro-pyrrolo[3,4-b]carbazol-10-ylmethyl)-carbamoyl]-
methyl}-dimethyl-ammonium chloride (27b, R1 = Bn).
Deprotected salt 27b was synthesized from 25b
according to GP: 25b (650.0 mg, 1.11 mmol) was stir-
red for 19 h in an aqueous 3 M solution of HCl
(56.2 mL). After concentration, followed by crystalli-
zation in methanol/water (5 mL), 370.0 mg of 27b
were obtained as a beige crystalline powder (68%).
Mp 237 ꢁC; IR (KBr): m = 3578–3354 (br), 3237–3198
(s), 3057, 2936 (s), 1749 (s) (CO), 1697 (s) (CO),
1674 (s) (CO), 1622, 1541, 1458, 1433, 1393 (s),
1346, 1234, 1068, 750 cmꢀ1; UV: kmax = 225, 253,
UV: kmax = 227, 253, 292, 372 nm; H NMR (DMSO-
d6): d = 2.60 (t, J = 7.3 Hz, 2H), 2.71 (s, 6H), 2.89 (s,
3H), 3.30 (t, J = 7.3 Hz, 2H), 4.75 (s, 2H), 5.27 (d,
J = 4.1 Hz, 2H), 7.27 (t, J = 8.0 Hz, 1H), 7.28–7.37 (m,
3H), 7.38 (d, J = 7.0 Hz, 2H), 7.52 (t, J = 8.0 Hz, 1H),
7.68 (d, J = 8.0 Hz, 1H), 8.09 (d, J = 8.0 Hz, 1H), 8.45
(t, J = 4.1 Hz, 1H), 10.23 (s, 1H), 12.35 (s, 1H); 13C
NMR (DMSO-d6): d = 12.3, 29.8, 36.0, 40.7, 42.3,
52.9, 112.3, 119.7, 120.7, 121.6, 122.1, 122.9, 124.2,
124.6, 127.2, 127.6, 127.8, 128.7, 129.5, 137.3, 141.3,
142.6, 168.3, 168.4, 169.2; EI-MS (m/z, %): 468
(M+ ꢀ HCl, 13), 423 (18), 369 (28), 368 (100). HREIMS
(C28H28N4O3): calcd 468.2161; found 468.2263.
1
292, 374 nm; H NMR (DMSO-d6): d = 2.79 (s, 6H),
2.93 (s, 3H), 3.89 (s, 2H), 4.77 (s, 2H), 5.31 (d,
J = 3.8 Hz, 2H), 7.27 (t, J = 8.0 Hz, 1H), 7.29 (t,
J = 7.0 Hz, 1H), 7.32–7.42 (m, 4H), 7.52 (t,
J = 8.0 Hz, 1H), 7.69 (d, J = 8.0 Hz, 1H), 8.09 (d,
J = 8.0 Hz, 1H), 8.89 (s, 1H), 12.48 (s, 1H); 13C
NMR (DMSO-d6): d = 12.4, 36.0, 40.7, 43.3, 57.4,
112.4, 119.7, 120.7, 121.8, 122.0, 122.8, 124.0, 124.6,
127.3, 127.6, 127.9, 128.7, 128.8, 137.3, 141.4, 142.7,
164.5, 168.3, 168.4; EI-MS (m/z, %): 454 (M+ ꢀ HCl,
13), 411(34), 239 (62), 149 (54), 133 (100). HREIMS
(C27H26N4O3): calcd 454.2005; found 454.1985.
5.2.19. 2-Benzyl-5-phenyl-1,2-dihydro-6H-2,4,6-triaza-
cyclopenta[c]fluoren-3-one (30). Triethylamine (0.320
mL, 2.3 mL) was added at room temperature to a
solution of 29 (mixture of two isomers) (74.0 mg,
0.19 mmol) in DMF (20 mL). To the cooled mixture
(ꢀ20 ꢁC) was added dropwise a solution of trichloro-
isocyanuric acid (114.0 mg, 0.49 mmol) in DMF
(20 mL). After 24 h stirring at room temperature under
N2 atmosphere, the solution was concentrated under re-
duced pressure. The residue was diluted in CH2Cl2
(50 mL) and washed with water (40 mL · 2). The organ-
ic layer was dried over sodium sulfate, filtered and con-
centrated under reduced pressure. The residue was
purified by column chromatography (eluent: CH2Cl2/
5.2.18.3. {2-[(2-Dimethyl-1,3-dioxo-1,2,3,5-tetra-hydro-
pyrrolo[3,4-b]carbazol-10-ylmethyl)-carbamoyl]-ethyl}-di-
methyl-ammonium chloride (28a, R1 = Me). Deprotected

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2279
ethyl acetate, 80:20) to afford 61.0 mg of 30 as a white
crystalline powder (83%). Mp 251 ꢁC; IR (KBr) =
3455, 3218, 1686, 1603, 1497, 1462, 1417, 1406, 1242,
1026, 737, 698 cmꢀ1; UV: kmax = 206, 235, 260, 280,
dol-2-yl)-acetaldehyde32 (2.65 g, 14.04 mmol) in CH2Cl2
(140 mL) were added at room temperature triethylamine
(1.95 mL, 14.04 mmol), 32 (3.00 g, 7.02 mmol) and
˚
molecular sieves (4 A). After 2 h refluxing under N2
1
361 nm; H NMR (DMSO-d6): d = 4.90 (s, 2H, CH2),
atmosphere, the solution was cooled to room tempera-
ture then trifluoroacetic acid (1.62 mL, 21.06 mmol)
was added and then refluxed for 12 h. The mixture
was extracted with a 5% aqueous solution of sodium
bicarbonate (100 mL · 3) and washed with brine
(100 mL · 2). The organic layer (CH2Cl2) was dried over
sodium sulfate, filtered and concentrated under reduced
pressure. To the solution of the pale orange foam
(3.67 g) in DMF (50 mL) was added triethylamine
(3.18 mL, 22.86 mmol). To the cooled (ꢀ20 ꢁC) mixture
was added dropwise a solution of trichloroisocyanuric
acid (1.79 g, 7.72 mmol) in DMF (50 mL) under N2
atmosphere. The solution was stirred for 12 h at room
temperature. After concentration under reduced pres-
sure, the residue was diluted in CH2Cl2 (150 mL) and
washed with water (100 mL · 3). The organic layer
was dried over sodium sulfate, filtered and concentrated
under reduced pressure. The residue was purified by a
column chromatography on silica gel (eluent: CH2Cl2/
ethyl acetate, 95:5) to afford 1.75 g of 33b, as a transpar-
ent crystalline powder (45%). Mp 218 ꢁC; IR (KBr):
m = 3322, 2926, 1773, 1715, 1393, 1339, 1279, 1209,
1071, 949, 714 cmꢀ1; UV: kmax = 204, 220, 238, 268,
289, 349 nm; 1H NMR (CDCl3): d = 1.35 (t,
J = 7.1 Hz, 3H), 4.41 (q, J = 7.1 Hz, 2H), 5.39 (s, 2H),
5.79 (s, 2H), 7.30 (t, J = 8.0 Hz, 1H), 7.57 (t,
J = 8.0 Hz, 1H), 7.65 (m, 3H), 7.71 (m, 4H), 7.86 (m,
2H), 8.38 (d, J = 8.0 Hz, 1H), 10.12 (s, 1H); 13C NMR
(CDCl3): d = 14.2, 37.2, 41.1, 61.8, 112.4, 120.9, 121.6,
123.2, 123.7, 125.7, 128.7, 129.7, 131.9, 133.9, 134.3,
135.1, 137.1, 139.7, 140.9, 167.9, 168.7; EI-MS (m/z,
%): 558 (M+, 90), 529 (40), 512 (75), 487 (55), 457
(30), 413 (95), 402 (100), 356 (40), 339 (38), 327 (60),
267 (34), 209 (40). HREIMS (C32H22N4O6): calcd
558.1539; found 558.1550.
4.95 (s, 2H, CH2), 7.30–8.20 (m, 14H, Harom), 11.95 (s,
1H, NH); 13C NMR (DMSO-d6): d = 46.1 (CH2), 46.8
(CH2), 113.0, 119.8, 120.6, 123.0, 123.9, 127.5, 127.8,
128.7, 128.9, 129.0, 129.1, 129.3, 133.9, 137.9, 138.0,
139.5, 141.5, 143.7, 167.0; EI-MS (m/z, %): 389 (M+,
80), 284 (30), 256 (100), 195 (10), 143 (40). HREIMS
(C26H19N3O): calcd 389.1528; found 389.1595.
5.2.20. 3-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-1-ethoxy-
carbonyl-2-(1H-indol-3-yl)-propyl-ammonium chloride
(32). This compound was prepared from 31 in three
steps as described in our previous unpublished work.34
5.2.21. 4-(1,3-Dioxo-1,3-dihydro-isoindol-2-ylmethyl)-1-
methyl-9H-b-carboline-3-carboxylic acid ethyl ester
(33a). To a suspension of 32 (2.62 g, 6.13 mmol) in
CH2Cl2 (200 mL) were added at room temperature tri-
ethylamine (1.70 mL, 12.26 mmol), acetaldehyde
˚
(0.685 mL, 12.26 mmol) and molecular sieves (4 A).
After 1h refluxing under N2 atmosphere, the solution
was cooled to room temperature then trifluoroacetic acid
(1.42 mL, 18.40 mmol) was added and then refluxed for
12 h. The mixture was extracted with a 5% aqueous solu-
tion of sodium bicarbonate (100 mL · 3) and washed
with brine (100 mL · 2). The organic layer (CH2Cl2)
was dried over sodium sulfate, filtered and concentrated
under reduced pressure. To the solution of the residue in
DMF (50 mL) was added triethylamine (5.97 mL,
42.90 mmol). To the cooled (ꢀ20 ꢁC) mixture was added
dropwise a solution of trichloroisocyanuric acid (2.14 g,
9.20 mmol) in DMF (50 mL) under N2 atmosphere. The
solution was stirred for 12 h at room temperature. After
concentration under reduced pressure, the residue was
diluted in CH2Cl2 (120 mL) and washed with water
(50 mL · 3). The organic layer was dried over sodium
sulfate, filtered and concentrated under reduced pres-
sure. The residue was purified by column chromatogra-
phy (eluent: cyclohexane/ethyl acetate, 50:50) to afford
a brown solid. After crystallization in ethyl acetate/meth-
anol (30:70), 1.44 g of 33a were obtained as a transparent
crystalline powder (57%). Mp 196 ꢁC; IR (KBr):
m = 3200, 1773, 1717, 1618, 1393, 1339, 1264, 1207,
1071, 739, 716 cmꢀ1; UV: kmax = 205, 219, 232, 239,
269, 289, 337 nm; 1H NMR (CDCl3): d = 1.20 (t,
J = 7.3 Hz, 3H), 2.45 (s, 3H), 4.30 (q, J = 7.3 Hz, 2H),
5.74 (s, 2H), 7.19 (t, J = 8.0 Hz, 1H), 7.30 (m, 2H), 7.55
(m, 2H), 7.68 (m, 2H), 8.25 (d, J = 8.0 Hz, 1H), 9,90 (s,
1H); 13C NMR (CDCl3): d = 14.1, 19.6, 37.5, 61.8,
112.1, 120.6, 121.6, 123.2, 123.7, 123.8, 127.7, 128.1,
131.8, 133.9, 135.3, 138.8, 140.7, 141.3, 167.5, 168.1;
EI-MS (m/z, %): 413 (M+, 50), 384 (18), 367 (20), 339
(18), 311 (20), 284 (20), 274 (20), 211 (15), 182 (18), 159
(100), 144 (28), 130 (65). HREIMS (C24H19N3O4): calcd
413.1376; found 413.1393.
5.2.23. 5-Methyl-1,2-dihydro-6H-2,4,6-triaza-cyclopenta
[c]fluoren-3-one (34a). A solution of 33a (900.0 mg,
2.18 mmol) in butylamine (25 mL) was refluxed for
12 h under N2 atmosphere. The mixture was concen-
trated under reduced pressure and the residue was sus-
pended in ethyl acetate (20 mL). After filtration under
reduced pressure, the precipitate was washed with
diethyl ether (5 mL · 3) to afford 468.0 mg of 34a, as a
white powder (90%). Mp 325 ꢁC; IR (KBr): m = 3453,
1667, 1593, 1497, 1433, 1364, 1258, 1233, 1111,
739 cmꢀ1; UV: kmax = 198, 215, 239, 261, 268, 285,
1
336, 349 nm; H NMR (DMSO-d6): d = 2.86 (s, 3H),
4.81 (s, 2H), 7.32 (t, J = 8.0 Hz, 1H), 7.61 (t,
J = 8.0 Hz, 1H), 7.69 (d, J = 8.0 Hz, 1H), 8.68 (s, 1H),
12.00 (s, 1H); 13C NMR (DMSO-d6): d = 20.7, 42.2,
112.5, 120.2, 120.3, 122.0, 123.1, 128.3, 130.8, 135.2,
139.2, 140.7, 143.4, 169.7; FAB-MS (m/z): 244
(M++Li, 100).
5.2.24.
5-Aminomethyl-1,2-dihydro-6H-2,4,6-triaza-
5.2.22.
1,4-Bis-(1,3-dioxo-1,3-dihydro-isoindol-2-yl-
cyclopenta[c]fluoren-3-one (34c). Concentrated aqueous
solution of hydrochloric acid (15 mL) was added to a
suspension of 33b (100.0 mg, 0.18 mmol) in ethanol
methyl)-9H-b-carboline-3-carboxylic acid ethyl ester
(33b). To a suspension of 1,3-dioxo-1,3-dihydro-isoin-

2280
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
(10 mL). The mixture was refluxed for 12 h. After
concentration under reduced pressure, the residue was
suspended in ethanol (10 mL). After filtration under re-
duced pressure, the precipitate was washed successively
with CH2Cl2 (3 mL · 2) and diethyl ether (3 mL · 2) to
afford 41.0 mg of 34c, as a yellow powder (78%). Mp
> 300 ꢁC; IR (KBr): m = 3459, 3190, 3034, 2764, 1692,
1632, 1512, 1474, 1447, 1337, 1282, 1234, 1043, 907,
761, 741, 691 cmꢀ1; UV: kmax = 216, 239, 262, 268,
287, 347 nm; 1H NMR (DMSO-d6): d = 4.72 (d,
J = 4.6 Hz, 2H), 4.92 (s, 2H), 7.41 (t, J = 8.0 Hz, 1H),
7.70 (t, J = 8.0 Hz, 1H), 7.78 (d, J = 8.0 Hz, 1H), 8.20
(d, J = 8.0 Hz, 1H), 8.80 (bs, 3H), 8.88 (s, 1H), 12.86
(s, 1H); 13C NMR (DMSO-d6): d = 40.2, 42.4, 112.7,
119.7, 120.8, 123.3, 123.4, 129.0, 132.5, 133.9, 138.6,
138.8, 141.1, 168.9; EI-MS (m/z, %): 252 (M+, 100),
237 (50), 223 (43), 207 (35), 194 (22), 179 (25), 166
(15), 152 (12), 140 (20).
13C NMR (DMSO-d6): d = 23.7, 39.7, 42.3, 42.4, 54.1,
111.3, 119.9, 121.5, 123.3, 123.9, 129.1, 130.9, 134.9,
139.6, 141.3, 142.7, 169.0; EI-MS (m/z, %): 308 (M+,
27), 250 (27), 161 (64), 144 (100), 130 (20), 116 (35).
HREIMS (C18H20N4O): calcd 308.1637; found
308.1681.
5.2.27.
2-Dimethylamino-N-(3-oxo-1,2,3,6-tetrahydro-
2,4,6-triaza-cyclopenta[c]fluoren-5-ylmethyl)-acetamide
(37). Triethylamine (0.328 mL, 2.36 mmol) was added to
a solution of N,N-dimethylglycine (81.0 mg, 0.79 mmol)
in CH2Cl2/n-butanol (15 mL:5 mL). Then isobutyl-chlo-
roformiate (0.153 mL, 1.18 mmol) was added at ꢀ15 ꢁC
to the solution. The mixture was stirred for 1 h at ꢀ15ꢁC
under N2 atmosphere and a solution of 34c (227.0 mg,
0.79 mmol) in methanol (2 mL) was added. After 12 h
stirring at room temperature, the mixture was concen-
trated under reduced pressure. The residue was purified
by column chromatography (eluent: CH2Cl2/methanol,
100:1 then gradient to methanol 100%) to afford a white
amorphous solid, which was suspended in water
(10 mL). After filtration under reduced pressure and
washing with water (3 mL · 3), the solid was dried to
afford 210.0 mg of 37, as a white powder (78%). Mp
> 340 ꢁC; IR (KBr): m = 3430, 3231, 1692, 1678, 1532,
1449, 1358, 1234, 784 cmꢀ1; UV: kmax = 200, 215, 239,
261, 268, 284, 334, 347 nm; 1H NMR (DMSO-d6):
d = 2.38 (s, 6H), 3.20 (s, 2H), 4.85 (s, 2H), 4.92
(d, J = 5.6 Hz, 2H), 7.35 (t, J = 8.0 Hz, 1H), 7.65 (t,
J = 8.0 Hz, 1H), 7.75 (d, J = 8.0 Hz, 1H), 8.12 (d,
J = 8.0 Hz, 1H), 8.80 (s, 2H), 12.40 (s, 1H); 13C NMR
(DMSO-d6): d = 42.5, 45.5, 45.6, 62.1, 112.8, 120.1,
120.7, 123.1, 123.3, 128.8, 131.9, 134.3, 139.1, 141.1,
142.9, 169.5, 169.7; EI-MS (m/z, %): 337 (M+, 92), 294
(10), 379 (100), 251 (25), 237 (45), 210 (30), 181 (35),
153 (45), 143 (30), 131 (46), 105 (54). HREIMS
(C18H19N5O2): calcd 337.1539; found 337.1537.
5.2.25. 2-(2-Dimethylaminoethyl)-5-methyl-1,2-di-hydro-
6H-2,4,6-triaza-cyclopenta[c]fluoren-3-one (35). NaH
50% (61.0 mg, 1.26 mmol) was added at 0 ꢁC (ice bath)
to a solution of 34a (100.0 mg, 0.42 mmol) in DMF
(8 mL). After 45 min stirring at 0 ꢁC, the chlorhydrate
of 2-dimethylaminoethylchloride (61.0 mg, 0.42 mmol)
was added to the suspension and the mixture was stirred
for 12 h at room temperature. The suspension was di-
luted in water (1 mL) and the solvent was concentrated
under reduced pressure. The residue was purified by a
column chromatography on silica gel (eluent: CH2Cl2/
methanol, 99:1 then gradient to methanol 100%) to
afford 22.0 mg of 35 as a white foam (17%). IR (KBr):
m = 3416, 3217, 2959, 2932, 1667, 1595, 1454, 1346,
1246, 1117, 737 cmꢀ1; UV: kmax = 200, 217, 238, 263,
270, 337, 351 nm; 1H NMR (DMSO-d6): d = 2.35 (s,
6H), 2.78 (t, J = 6.3 Hz, 2H), 2.88 (s, 3H), 3.78 (t,
J = 6.3 Hz, 2H), 4.95 (s, 2H), 7.35 (t, J = 8,0 Hz, 1H),
7.62 (t, J = 8.0 Hz, 1H), 7.75 (d, J = 8.0 Hz, 1H), 8.11
(d, J = 8.0 Hz, 1H), 12.40 (s, 1H); 13C NMR (DMSO-
d6): d = 20.8, 39.5, 44.7, 47.0, 56.6, 112.7, 120.0, 120.3,
121.6, 122.9, 128.3, 128.8, 135.3, 138.8, 140.9, 143.5,
167.2; EI-MS (m/z, %): 293 (8), 199 (75), 150 (100),
143 (98), 128 (45), 115 (44).
5.2.28.
2,4,6-Trimethyl-N-(3-oxo-1,2,3,6-tetrahydro-
2,4,6-triaza-cyclopenta[c]fluoren-5-ylmethyl)-benzene-sul-
fonamide (38). Triethylamine (0.740 mL, 5.30 mmol)
and methylenesulfonylchloride (464.0 mg, 2.12 mmol)
were added to
a suspension of 34c (612.0 mg,
2.12 mmol). After 12 h stirring at room temperature un-
der N2 atmosphere, the mixture was concentrated under
reduced pressure and the residue was diluted in CH2Cl2
(30 mL). The organic layer was successively extracted
with a 5% aqueous sodium bicarbonate solution
5.2.26. 6-(2-Dimethylaminoethyl)-5-methyl-1,2-di-hydro-
6H-2,4,6-triaza-cyclopenta[c]fluoren-3-one (36). The
chlorhydrate of 2-dimethylaminoethylchloride (61.0
mg, 0.42 mmol) and NaH 50% (61.0 mg, 1.26 mmol)
were successively added to a solution of 34a (100.0 mg,
0.42 mmol) in DMF (8 mL). After 24 h stirring at room
temperature under N2 atmosphere, water (1 mL) was
added to the suspension and the solvent was concen-
trated under reduced pressure. The residue was purified
by column chromatography (eluent: CH2Cl2/methanol,
99:1 then gradient to methanol 100%) to afford
33.0 mg of 36, as a white powder (26%). Mp 225 ꢁC;
IR (KBr): m = 3416, 3225, 2926, 2629, 1697, 1607,
(20 mL · 3),
a
5% aqueous citric acid solution
(30 mL · 3) and brine (30 mL · 3). The organic layer
was dried over sodium sulfate, filtered and concentrated
under reduced pressure. The residue was purified by
crystallization (CH2Cl2/methanol, 1:1) to afford
653.0 mg of 38, as a pale yellow crystalline powder
(71%). Mp > 300 ꢁC; IR (KBr): m = 3455, 3322, 3148,
1686, 1603, 1458, 1337, 1317, 1246, 1157, 1094, 752,
1
654 cmꢀ1; UV: kmax = 206, 237, 270, 350 nm; H NMR
1435, 1358, 1238, 1117, 1063, 750, 729 cmꢀ1; UV:
(DMSO-d6): d = 1.99 (s, 3H), 2.45 (s, 6H), 4.67 (d,
J = 6.0 Hz, 2H), 4.74 (s, 2H), 6.43 (s, 2H), 7.34
(t, J = 8.0 Hz, 1H), 7.64 (t, J = 8.0 Hz, 1H), 7.70 (d,
J = 8.0 Hz, 1H), 7.90 (t, J = 6.0 Hz, 1H), 8.07 (d,
J = 8.0 Hz, 1H), 8.53 (s, 1H), 11.89 (s, 1H); 13C NMR
(DMSO-d6): d = 20.4, 22.6, 42.3, 44.9, 112.3, 119.9,
1
max = 198, 239, 261, 267, 283, 339, 351 nm; H NMR
k
(DMSO-d6): d = 2.95 (s, 6H), 3.18 (s, 3H), 3.50 (t, J =
8.0 Hz, 2H), 4.85 (s, 2H), 5.20 (t, J = 8.0 Hz, 2H), 7.47
(t, J = 8.0 Hz, 1H), 7.78 (t, J = 8.0 Hz, 1H), 8.12 (d,
J = 8.0 Hz, 1H), 8.18 (d, J = 8.0 Hz, 1H); 8.80 (s, 1H);

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2281
120.3, 122.7, 122.8, 128.5, 130.8, 131.7, 133.8, 134.3,
137.8, 138.7, 140.6, 140.7, 141.2, 169.2; EI-MS (m/z,
%): 341 (20), 251 (75), 223 (75), 194 (30), 184 (40), 168
(20), 140 (20).
GSK-3a/b was purified from porcine brain by affinity
chromatography on immobilized axin.46 It was assayed,
following a 1/100 dilution in 1 mg BSA/mL 10 mM
DTT, with 5 lL 40 lM GS-1 peptide as a substrate, in
buffer A (10 mM MgCl2, 1 mM EGTA, 1 mM DTT,
25 mM Tris–HCl pH 7.5, 50 lg heparin/mL), in the
presence of 15 lM [c-[33] P] ATP (3000 Ci/mmol;
1 mCi/mL) in a final volume of 30 lL. After 30 min
incubation at 30 ꢁC, 25 lL aliquots of supernatant were
spotted onto 2.5 · 3 cm pieces of Whatman P81 phos-
phocellulose paper, and, 20 s later, the filters were
washed five times (for at least 5 min each time) in a solu-
tion of 10 mL phosphoric acid/liter of water. The wet fil-
ters were counted in the presence of 1 mL ACS
(Amersham) scintillation fluid.
5.3. Growth inhibition assays
Tumour cells were obtained from the American Type
Culture Collection (Frederick, MD, USA). They were
cultivated in RPMI 1640 medium (Life Science Technol-
ogies, Cergy-Pontoise, France) supplemented with 10%
foetal calf serum, 2 mM L-glutamine, 100 units/mL peni-
cillin, 100 lg/mL streptomycin and 10 mM HEPES
buffer (pH 7.4). Cytotoxicity was measured by the
microculture tetrazolium assay as described.36 Cells
were continuously exposed to graded concentrations
of the compounds for four doubling times, then 15 lL
of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-
tetra-zolium bromide were added to each well and the
plates were incubated for 4 h at 37 ꢁC. The medium
was then aspirated and the formazan solubilized by
100 lL of DMSO. The results are expressed as IC50, that
is, the concentration, which reduced by 50% the optical
density of treated cells with respect to untreated
controls.
CDK1/cyclin B was extracted from M phase starfish oo-
cytes and purified by affinity chromatography on
p9CKShs1-sepharose beads as previously described.47
The kinase activity was assayed in buffer C (60 mM b-
glycerophosphate, 15 mM p-nitrophenylphosphate,
25 mM Mops (pH 7.2), 5 mM EGTA, 15 mM MgCl2,
1 mM DTT, 1 mM sodium vanadate, 1 mM phenyl-
phosphate), with 1 mg histone H1/mL, in the presence
of 15 lM [c-[33] P] ATP (3000 Ci/mmol; 1 mCi/mL) in
a final volume of 30 lL. After 10 min incubation at
30 ꢁC, 25 lL aliquots of supernatant were spotted onto
P81 phosphocellulose papers and treated as described
above.
5.4. Cell-cycle analysis
For cell-cycle analysis, L1210 cells (2.5 · 105 cells/mL)
were incubated for 21 h with various concentrations of
the compounds, then fixed by 70% ethanol (v/v), washed
and incubated in PBS containing 100 lg/mL RNAse and
25 lg/mL propidium iodide for 30 min at 20 ꢁC. For each
sample, 104 cells were analyzed on a XL/MCL flow cytom-
eter (Beckman Coulter). The fluorescence of propidium
iodide was recorded through a 615 nm long-pass filter.
Acknowledgements
We acknowledge the Groupe Servier and the Centre Na-
tional de la Recherche Scientifique (C.N.R.S.) for finan-
cial support and grants for M.L. and M.B. This research
`
was also supported by the Ministere de la Recherche/IN-
´
´
SERM/CNRS ꢁMolecules et Cibles Therapeutiquesꢂ
Programme (L. Meijer). C.B. and A.L. thank the Ligue
5.5. Topoisomerase I inhibition
´
Nationale Franc¸aise contre le Cancer (comite du Nord)
and the Institut de Recherches sur le Cancer de Lille
(IRCL) for a financial support.
The complete protocol to measure topoisomerase I inhi-
bition by a relaxation assay has been previously
detailed.37
References and notes
5.6. DNA interaction
1. (a) Davis, P. D.; Hill, C. H.; Lawton, G.; Nixon, J. S.;
Wilkinson, S. E.; Hurst, S. A.; Keech, E.; Turner, S. E. J.
Med. Chem. 1992, 35, 177; (b) Davis, P. D.; Elliott, L. H.;
Harris, W.; Hill, C. H.; Hurst, S. A.; Keech, E.; Hari
Kumar, M. K.; Lawton, G.; Nixon, J. S.; Wilkinson, S. E.
J. Med. Chem. 1992, 35, 994.
Sequence recognition was determined by DNase I foot-
printing using a protocol recently described in details.44
Similarly, the biophysical methods to examine the bind-
ing to DNA have been described earlier.45a,b
2. (a) Berlinck, R. G. S.; Britton, R.; Piers, E.; Lim, L.;
Roberge, M.; Moreira da Rocha, R.; Andersen, R. J. J.
Org. Chem. 1998, 63, 9850; (b) Andersen, R. J.; Roberge,
M.; Sanghera, J.; Leung, D. PCT Int. Appl. WO 9947522,
1999; Chem. Abstr. 1999, 131, 243451a.
3. Jackson, J. R.; Gilmartin, A.; Imburgia, C.; Winkler, J.
D.; Marshall, L. A.; Roshak, A. Cancer Res. 2000, 60, 566.
4. Zhou, B.-B. S.; Bartek, J. Nature Rev. 2004, 4, 1.
5. Moreau, P.; Gaillard, N.; Marminon, C.; Anizon, F.;
5.7. Kinase inhibition assays
Kinase activities were assayed in Buffer A or C, at 30 ꢁC,
at a final ATP concentration of 15 lM. Blank values
were subtracted and activities calculated as pmoles of
phosphate incorporated for a 10 min. incubation. The
activities are usually expressed in % of the maximal
activity, that is in the absence of inhibitors. Controls
were performed with appropriate dilutions of
dimethylsulfoxide.
´
Dias, N.; Baldeyrou, B.; Bailly, C.; Pierre, A.; Hickman,
J.; Pfeiffer, B.; Renard, P.; Prudhomme, M. Bioorg. Med.
Chem. 2003, 11, 4871.

2282
M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
´
´
´
6. Marminon, C.; Pierre, A.; Pfeiffer, B.; Perez, V.; Leonce,
S.; Renard, P.; Prudhomme, M. Bioorg. Med. Chem. 2003,
11, 679.
A. J. Org. Chem. 1996, 61, 6166; (i) Ko, C.-W.;
Chou, T.-S. J. Org. Chem. 1998, 63, 4645; (j) Diker, K.;
´
Do¨e De Maindreville, M.; Royer, D.; Le Provost, F.;
Levy, J. Tetrahedron Lett. 1999, 40, 7463.
´
7. (a) Kanai, F.; Murakata, C.; Tsujita,T.; Yamashita, Y.;
Mizukami, T.; Akinaga, S. PCT Int. Appl. WO 0351883,
2003; Chem. Abstr. 2003, 139, 69289g; (b) Sanchez-
Martinez, C.; Shih, C.; Faul, M. M.; Zhu, G.; Paal, M.;
Somoza, C.; Li, T.; Kumrich, C. A.; Winneroski, L. L.;
Xun, Z.; Brooks, H. B.; Patel, B. K. R.; Schultz, R. M.;
DeHahn, T. B.; Spencer, C. D.; Watkins, S. A.; Considine,
E.; Dempsey, J. A.; Ogg, C. A.; Campbell, R. M.;
Anderson, B. A.; Wagner, J. Bioorg. Med. Chem. Lett.
2003, 13, 3835.
8. Booth, R. J.; Denny, W. A.; Dobrusin, E. M.; Kraker, A.
J.; Mitchell, L. H.; Smaill, J. B.; Thompson, A. M.; Lee,
H. H.; McCarthy, F. O. J.; Palmer, B. D. PCT Int. Appl.
WO 0391255, 2003; Chem. Abstr. 2003, 139, 381469d.
9. Prudhomme, M. Curr. Med. Chem. 2000, 7, 1189.
10. (a) Ahn, N. Chem. Rev. 2001, 101, 2207; (b) Noble, M. E.;
Endicott, J. A.; Johnson, L. N. Science 2004, 303, 1800.
11. Knockaert, M.; Greengard, P.; Meijer, L. Trends Phar-
macol. Sci. 2002, 23, 417.
21. (a) Magnus, P. D.; Sear, N. L. Tetrahedron 1983, 39, 2795;
(b) Moody, C. J.; Rahimtoola, K. F. J. Org. Chem. 1992,
57, 2105; (c) Pindur, U.; Otto, C. Tetrahedron 1992, 48,
3515; (d) Balasubramanian, T.; Balasubramanian, K. K.
J. Chem. Soc., Chem. Commun. 1994, 1237; (e) McCort,
G.; Duclos, O.; Cadilhac, C.; Guilpain, E. Tetrahedron
Lett. 1999, 40, 6211; (f) Ciganek, E.; Schubert, E. M.
J. Org. Chem. 1995, 60, 4629; (g) Joseph, B.; Da Costa, H.;
´
´
Merour, J.-Y.; Leonce, S. Tetrahedron 2000, 56, 3189;
(h) Nomak, R.; Snyder, J. K. Tetrahedron Lett. 2001,
42, 7929.
´
22. Caballero, E.; Adeva, M.; Calderon, S.; Sahagun, H.;
Tome, F.; Medarde, M.; Fernandez, J. L.; Lopez-Lazaro,
´
´
´
´
´
M.; Ayuso, M. J. Bioorg. Med. Chem. 2003, 11, 3413.
´
´
23. Caballero, E.; Garcıa, F.; Gravalos, D. G.; Medarde, M.;
Sahagu´n, H.; Tome, F. Bioorg. Med. Chem. Lett. 1996, 6,
´
2459.
24. Laronze, M.; Sapi, J. Tetrahedron Lett. 2002, 43, 7925.
´ ´
25. Sapi, J.; Grebille, Y.; Laronze, J.-Y.; Levy, J. Synthesis
12. (a) Cohen, P.; Goedert, M. Nature Rev. 2004, 3, 479; (b)
Meijer, L.; Flajolet, M.; Greengard, P. Trends Pharmacol.
Sci., in press.
1992, 383.
´
26. Auge, F.; Sapi, J.; Laronze, J.-Y. Tetrahedron 2004, 60,
6005.
13. (a) Zhang, H.-C.; White, K. B.; Ye, H.; McComsey, D. F.;
Derian, C. K.; Addo, M. F.; Andrade-Gordon, P.;
Eckardt, A. J.; Conway, B. R.; Westover, L.; Xu, J. Z.;
Look, R.; Demarest, K. T.; Emanuel, S.; Maryanoff, B. E.
Bioorg. Med. Chem.Lett. 2003, 13, 3049; (b) Zhang, H.-C.;
Kuo, G.-H.; Maryanoff, B. E.; Ye, H.; OꢂNeill, D.; Shen,
L.; Demarest, K.; Conway, B.; McComsey, D. F. PCT Int.
Appl. WO 0395452, 2003; Chem. Abstr. 2003, 139,
395805x; (c) Clayton, J. R.; Dienfenbacher, C. G.; Engler,
T. A.; Furness, K. W.; Henry, J. R.; Malhotra, S.;
Marquart, A. L.; Mclean, J. A.; Mendel, D.; Burkholder,
T. P.; Li, Y.; Reel, J. K. PCT Int. Appl. WO 0376442,
2003; Chem. Abstr. 2003, 139, 261331f.
27. Rebek, J.; Tai, D. F.; Shue, Y.-K. J. Am. Chem. Soc. 1984,
106, 1813.
´
28. Laronze, M. Ph.D. Thesis, Universite de Reims Cham-
pagne-Ardenne, 2000.
29. Feng, S.; Panetta, C. A.; Graves, D. E. J. Org. Chem.
2001, 66, 612.
30. Kunishima, M.; Kawachi, C.; Morita, J.; Terao, K.;
Iwasaki, F.; Tani, S. Tetrahedron 1999, 55, 13159.
31. Boisbrun, M.; Jeannin, L.; Toupet, L.; Laronze, J.-Y. Eur.
J. Org. Chem. 2000, 3051.
32. Boisbrun, M.; Vassileva, E.; Raoul, M.; Laronze, J.-Y.;
Sapi, J. Monatsh. Chem. 2003, 134, 1641.
33. Jeannin, L.; Boisbrun, M.; Nemes, C.; Cochard, F.;
14. Slater, M. J.; Baxter, R.; Bonser, R. W.; Cockerill, S.;
Gohil, K.; Parry, N.; Robinson, E.; Randall, R.; Yeates,
C.; Snowden, W.; Walters, A. Bioorg. Med. Chem. Lett.
2001, 11, 1993.
´
Laronze, M.; Dardennes, E.; Kovacs-Kulyassa, A.; Sapi,
J.; Laronze, J.-Y. C.R. Chimie 2003, 6, 517.
´
34. Boisbrun, M. Ph. D. Thesis, Universite de Reims Cham-
pagne-Ardenne, 2000.
35. Nemes, C.; Jeannin, L.; Sapi, J.; Laronze, M.; Seghir, H.;
15. Voldoire, A.; Moreau, P.; Sancelme, M.; Matulova, M.;
´
´
Leonce, S.; Pierre, A.; Hickman, J.; Pfeiffer, B.; Renard,
P.; Dias, N.; Bailly, C.; Prudhomme, M. Bioorg. Med.
Chem. 2004, 12, 1955.
´
Auge, F.; Laronze, J.-Y. Tetrahedron 2000, 56, 5479.
´
´
`
36. Leonce, S.; Perez, V.; Casabianca-Pignede, M. R.; Anstett,
M.; Bisagni, E.; Atassi, G. Invest. New Drugs 1996, 14,
169.
16. Bailly, C.; Qu, X.; Anizon, F.; Prudhomme, M.; Riou,
J.-F.; Chaires, J. Mol. Pharmacol. 1999, 55, 377.
17. Bailly, C. Targeting DNA and Topoisomerase I with
Indolocarbazole Antitumor Agents. In Small Molecule
DNA and RNA Binders; Demeunynck, M., Bailly, C.,
Wilson, W. D., Eds.; Wiley-VCH: Chichester (UK), 2003;
Vol. 2, p 538.
18. (a) Mahboohi, S.; Eluwa, S.; Koller, M.; Boehmer, F.-D.;
Uecker, A.; Teller, S. Ger. Patent 19744257, 1999; Chem.
Abstr. 1999, 130, 282064a; (b) Mahboohi, S.; Eluwa, S.;
Kumar, S. K. C.; Koller, M.; Sto¨rl, K. Arch. Pharm.
Pharm. Med. Chem. 1999, 332, 249.
37. Bailly, C. Methods Enzymol. 2001, 340, 610.
38. Bailly, C. Curr. Med. Chem. 2000, 7, 39.
´
39. Pilch, B.; Allemand, E.; Facompre, M.; Bailly, C.; Riou, J.
F.; Soret, J.; Tazi, J. Cancer Res. 2001, 61, 6876.
40. Bailly, C.; Waring, M. J. J. Biomol. Struct. Dyn. 1995, 12,
869.
41. Bom, D.; Curran, D. P.; Kruszewski, S.; Zimmer, S. G.;
Strode, T. J.; Kohlhagen, G.; Du, W.; Chavan, A. J.;
Fraley, K. A.; Bingcang, A. L.; Latus, L. J.; Pommier, Y.;
Burke, T. G. J. Med. Chem. 2000, 43, 3970.
19. Kno¨lker, H.-J.; Reddy, K. R. Chem. Rev. 2002, 102, 4303.
20. (a) Plieninger, H.; Muller, W.; Weinerth, K. Chem. Ber.
1964, 667; (b) Marinelli, E. R. Tetrahedron Lett. 1982, 23,
2745; (c) Sha, C.-K.; Chuang, K.-S.; Young, J.-J. J. Chem.
Soc., Chem. Commun. 1984, 1552; (d) Haber, M.; Pindur,
U. Tetrahedron 1991, 47, 1925; (e) Pindur, U.; Haber, M.;
Erfanian-Abdoust, H. Heterocycles 1992, 34, 781; (f)
Gribble, G. W.; Keavy, D. J.; Davis, A.; Saulnier, M. G.;
Pelcman, B.; Barden, T. C.; Sibi, M. P.; Olson, E. R.;
Belbruno, J. J. J. Org. Chem. 1992, 57, 5878; (g) Miki, Y.;
Hachiken, H. Synlett 1993, 333; (h) Kappe, C. O.; Padwa,
42. Olomucki, M. Bull. Soc. Chim. Fr. 1963, 2067.
43. Nagai, T.; Myokan, I.; Keishi, F.; Ohta, K.; Taya, N.;
Miyabara, S.; Shibata, M.; Mikami, H.; Hori, T. Ger.
Patent 4034687, 1991; Chem. Abstr. 1991, 115, 279992m.
44. Bailly, C.; Kluza, J.; Ellis, T.; Waring, M. J. DNase I
Footprinting of Small Molecule Binding Sites on DNA. In
DNA Synthesis: Methods and Protocols. Methods in
Molecular Biology; Herdewijn, P., Ed.; Humana Press:
Totowa, NJ (USA), 2004.
45. (a) Goossens, J. F.; Bouey-Bencteux, E.; Houssin, R.;
´
Henichart, J. P.; Colson, P.; Houssier, C.; Laine, W.;

M. Laronze et al. / Bioorg. Med. Chem. 13 (2005) 2263–2283
2283
Baldeyrou, B.; Bailly, C. Biochemistry 2001, 40, 4663; (b)
Bailly, C.; Michaux, C.; Colson, P.; Houssier, C.; Sun, J.
46. Borgne, A.; Meijer, L. J. Biol. Chem. 1996, 271, 27847.
47. Primot, A.; Baratte, B.; Gompel, M.; Borgne, A.; Liabeuf,
S.; Romette, J. L.; Costantini, F.; Meijer, L. Protein
Expres. Purif. 2000, 20, 394.
´ `
S.; Garestier, T.; Helene, C.; Henichart, J. P.; Rivalle, C.;
Bisagni, E.; Waring, M. J. Biochemistry 1994, 33, 15348.
´