Stabilisation of a nucleic acid three-way junction by an oligonucleotide containing a single 2′-C to 3′-O-phosphate butylene linkage prepared by a tandem RCM-hydrogenation method

Article abstract of DOI:10.1039/b502720a

A cyclic dinucleotide with a butylene linker between the upper 2′-C position and the 3′-O-phosphate linkage was synthesised from simple nucleoside building blocks via a tandem ring-closing metathesis and hydrogenation procedure. The major of two phosphoru

Full text of DOI:10.1039/b502720a

View Article Online / Journal Homepage / Table of Contents for this issue
A R T I C L E
Stabilisation of a nucleic acid three-way junction by an
oligonucleotide containing a single 2ꢀ-C to 3ꢀ-O-phosphate butylene
linkage prepared by a tandem RCM-hydrogenation method†
Philip Børsting, Katrine E. Nielsen and Poul Nielsen*
Nucleic Acid Center‡, Department of Chemistry, University of Southern Denmark, 5230,
Odense M, Denmark. E-mail: pon@chem.sdu.dk; Fax: 45 66158780; Tel: 45 65502565
Received 23rd February 2005, Accepted 7th April 2005
First published as an Advance Article on the web 6th May 2005
A cyclic dinucleotide with a butylene linker between the upper 2ꢀ-C position and the 3ꢀ-O-phosphate linkage was
synthesised from simple nucleoside building blocks via a tandem ring-closing metathesis and hydrogenation
procedure. The major of two phosphorus epimers was incorporated into an oligodeoxynucleotide, as well as into an
LNA–DNA mixmer oligonucleotide. These were evaluated as parts in three different secondary structures, a duplex,
a bulged duplex and a three-way junction, with both DNA and RNA complements. In the DNA : RNA hybrid
molecule, the oligodeoxynucleotide containing this single 2ꢀ-C to 3ꢀ-O-phosphate butylene linkage was found to
stabilise a three-way junction.
strategy, large ring connections have been made in dinucleotides
Introduction
between the internucleotide phosphate linkage and 5-C of an
The design of synthetic nucleic acid fragments mimicking
adjacent pyrimidine nucleobase,21,22,24 between two adjacent
secondary structures of DNA and RNA has been mostly
pyrimidines,24 between 4ꢀ-C and 5ꢀ-C positions23 and, finally,
concentrated on the stabilisation of A- and B-type duplexes
between the two phosphates in a trinucleotide.21 A large ring
by e.g. conformationally restricted nucleoside building blocks.1–3
connecting the nucleobase and the phosphate with a four carbon
However, cyclic dinucleotides mimicking other secondary struc-
linkage in an allylic phosphortriester moiety was found to be
tures have also been explored. As prime examples, Sekine and
very unstable towards basic conditions.22 However, this was
co-workers have made cyclic dinucleotides with connections
solved by the preparation of a saturated linker by employing
between the 2ꢀ-O position and the pyrimidine 5-C position of
the two adjacent nucleosides and used these in oligonucleotides
the tandem RCM–hydrogenation protocol22 first introduced
by Grubbs and co-workers.27 The synthesis of phosphorus
as artificial models of bend motifs e.g. U-turns in RNA.4,5 For
containing heterocycles via RCM has been recently reviewed.28
similar purposes, the same group also introduced a series of 5ꢀ-
Herein, we describe the synthesis of a new type of cyclic
mononucleotides and corresponding dinucleotides with two or
dinucleotide and its incorporation into oligodeoxynucleotide
three carbon linkages between the pyrimidine 5-C position and
sequences. The synthesis was based on the tandem RCM–
the phosphate moiety.6–8 Furthermore, nucleic acid fragments
hydrogenation protocol with a dinucleotide substrate containing
with intra- or interstrand linkages obtained by disulfide bridges
an allyl phosphortriester linkage and an easily available 2ꢀ-
have been explored.9–12 Also, direct alkyl cross-links between the
N-2 positions of adjacent guanines have been prepared, forming
C-allyl-2ꢀ-deoxyuridine building block. The cyclic moiety was
expected to introduce a bend motif in the oligonucleotides and,
cyclic dinucleotide moieties within oligonucleotide sequences.13
subsequently, to distort the recognition of complementary DNA
We have recently formulated a general strategy for the
and RNA in standard duplex formation. On the other hand, a
synthesis of conformationally restricted nucleic acid fragments
potential stabilisation of other secondary structures like bulges
14–16
based on a ring-closing metathesis (RCM) methodology.§
and three-way junctions was envisioned and studied.
Thus, a series of dinucleotides with terminal double bonds
incorporated in various positions has been prepared and, espe-
cially, Grubbs 2nd generation catalyst§17,18 has subsequently been
Results and discussion
applied in the preparation of a selection of cyclic dinucleotide
structures.19–24 A seven-membered ring connecting the inter-
nucleotide phosphate linkage and the adjacent 5ꢀ-C-position
was our first example of a dinucleotide analogue obtained by
this strategy.19,20 A corresponding six-membered ring was later
obtained using a different strategy by Le Cle´zio et al.,25 who
also very recently introduced other constrained dinucleotides
with six-membered rings involving the phosphates.26 With our
Chemical synthesis
The dinucleotide was constructed on the basis of known method-
ology for preparing 2ꢀ-allyl-2ꢀ-deoxynucleosides.29,30 Hence, the
nucleoside 129 was protected as a 5ꢀ-silyl ether 2 in a high yield
(Scheme 1). The 5ꢀ-O-phosphoramidite 4 was easily prepared
from 3ꢀ-O-tert-butyldimethylsilylthymidine 3 by an allyl phos-
phordiamidite reagent and 1H-tetrazole as the activator. As
an alternative activator, dicyanoimidazole31 afforded the same
yield. The nucleoside building blocks 2 and 4 were coupled
by treatment with 1H-tetrazole followed by oxidation to give,
after purification, the diallylic dinucleotide 5 in a high yield
as a mixture of two phosphorus epimers in an approximately
2 : 1 ratio. This epimeric mixture was subjected to a standard
RCM protocol using Grubbs 2nd generation catalyst§17,18 to give
the two epimers 6R and 6S in 40 and 20% isolated yields,
respectively. The formation of cyclic structures was confirmed
by NMR and MS, demonstrating the loss of terminal double
bonds and the loss of the mass of ethylene. The designation of
† Electronic supplementary information (ESI) available: additional ex-
perimental data. See http://www.rsc.org/suppdata/ob/b5/b502720a/
‡ Nucleic Acid Center is funded by the Danish National Research
Foundation for studies on nucleic acid chemical biology.
§ RCM and metathesis reactions in general have been re-
cently reviewed.14–16 Grubbs 2nd generation catalyst (Mes = 2,4,6-
trimethylphenyl, Cy = cyclohexyl):17,18
T h i s j o u r n a l i s
T h e R o y a l S o c i e t y o f C h e m i s t r y 2 0 0 5
O r g . B i o m o l . C h e m . , 2 0 0 5 , 3 , 2 1 8 3 – 2 1 9 0
2 1 8 3
©

View Article Online
the phosphorus epimers turned out to be impossible and as
approximately the same ratio of epimers was obtained from the
RCM reaction as well as from the RCM-hydrogenation tandem
protocol, the major epimer of 7 was depicted to be of RP-
configuration and the minor of SP-configuration, as elucidated
carefully for the respective epimers of 6 (see below).
Both 7R and 7S were deprotected by an acidic treatment to
give 8R and 8S in high yields. The major product 8R was tested
for its reactivity towards a treatment with 32% aq. ammonia.
MALDI-MS and NMR showed no formation of an ammonia
adduct after 24 h at room temperature. This result encouraged
us to proceed towards incorporation of the two epimeric cyclic
and uncharged dinucleotides into oligonucleotide sequences.
Hence, 8R and 8S were protected as their 5ꢀ-O-dimethoxytrityl
(DMT) ethers, 9R and 9S, by the application of DMT-Cl and
an unusual solvent mixture, DMSO and 2,6-lutidine. This was
applied after the failure of the more standard combination
of DMT-Cl and AgNO3 in pyridine. Using the cyanoethyl
phosphordiamidite reagent, the phosphoramidites 10R and 10S
were synthesised in good yields as equimolar epimeric mixtures
as judged from NMR.
NMR study of the epimers of 6 and 8
Due to a significant overlap of 1H NMR signals, especially in the
saturated 2ꢀ-C to phosphate linkage, all attempts of determining
the exact phosphorus configuration of the two epimers of 8 (or 7)
were unsuccessful. However, the determination was successfully
performed on the unsaturated and protected epimers of 6.
All protons in the two phosphorus epimers of compound 6
were assigned with combined use of DQF-COSY and NOESY
spectra. The cross peaks in the 700 ms NOESY spectra have
negative signs relative to the diagonal peaks, indicating rapid
rotational motion of the molecules. In the following, all atom
labelling follows the numbering shown in Scheme 1. At a first
glance the NMR spectra of the two compounds were quite
similar, with the majority of spins differing less than 0.1 ppm
in the two compounds. The largest change in chemical shift was
seen for H-3ꢀ of the uridine, which is shifted 0.36 ppm downfield
in the isomer assigned (vide infra) to be 6R relative to 6S. Addi-
tional effects were observed for the H-9ꢀa and H-9ꢀb protons that
differ by 0.13 and 0.18 ppm, respectively, in the two epimers. A
number of coupling constants were extracted from high quality
1D spectra. The two protons on the double bonded carbons,
H-7ꢀ and H-8ꢀ, display a coupling constant of 10.5 or 10.8 Hz
consistent with the double bond being in the cis configuration.
The 700 ms NOESY experiments revealed a number of
important structural clues regarding the configuration of the
phosphorus in the two dinucleotides. For 6R, cross peaks
between T-CH3 and H-9ꢀa and H-9ꢀb were seen, the cross peaks
between H-8ꢀ and H-9ꢀa/b have the same intensity and no cross
peak can be observed between H-6ꢀ and H-9ꢀ protons. In 6S,
no cross peaks are observed between T and any signal of the
upper nucleoside. The H-8ꢀ-H-9ꢀa cross peak is significantly more
intense than the H-8ꢀ-H-9ꢀb cross peak and a strong cross peak is
found between H-6ꢀb and H-9ꢀb. All the observed NOESY cross
peaks were integrated and converted into distances by utilizing
the isolated spin pair approximation (ISPA). In total 14 and
19 noncovalently fixed distances were obtained for 6R and 6S,
respectively, in addition to four structurally relevant coupling
constants. After several runs of structure calculation and careful
inspection of the resulting structures and the NOESY spectra,
a further eight repulsive restraints were added for both epimers.
For each of the compounds two starting structures were
employed, differing only in the chirality of the phosphorus atom.
A total of 20 separate structure calculations were performed with
each starting structure and the final result was compared with
respect to force field energies, energy penalties due to violation of
the imposed restraints and the violation of restraints. Compound
6R was found to be consistent with the structure having RP
Scheme 1 Reagents and conditions: a) TBDMSCl, AgNO3, pyridine,
=
85%; b) CH2 CHCH2OP(N(iPr)2)2, 1H-tetrazole, CH3CN, 66%; c) i)
1H-tetrazole, CH3CN, ii) tBuOOH, toluene, CH3CN, 85%; d) Grubbs
2nd gen. catalyst,§ CH2Cl2, 40% 6R, 20% 6S, 16% mixture. TBDMS =
t-butyldimethylsilyl.
phosphorus configuration to the two epimers was performed by
more advanced NMR spectroscopy as described in detail below.
The cyclic structure of 6 is based on an allylic phos-
phortriester functionality. A similar entity in another cyclic
dinucleotide was found to be unstable towards weak bases such
as ammonia and pyridine.22 Therefore, the formation of the
saturated and predictably much more stable22 analogues of 6 was
strongly preferred. Hence, the application of the tandem RCM–
hydrogenation protocol22,24,27 with 5 as the substrate afforded
the saturated cyclic dinucleotides 7R and 7S in 48% and 17%
isolated yields, respectively, after a chromatographic separation
(Scheme 2). As the elucidation of the exact configuration of
Scheme 2 Reagents and conditions: a) Grubbs 2nd gen. catalyst,§
CH2Cl2, then 1000 psi H2, 48% 7R, 17% 7S; b) 90% TFA (aq.),
100% (8R), 85% (8S); c) DMTCl, 2,6-lutidine, DMSO, 64% (9R),
53% (9S); d) NC(CH2)2OP(N(iPr)2)2, 4,5-dicyanoimidazole, CH3CN,
81% (10R), 57% (10S); e) incorporation into a duplex, a bulged
duplex and a three-way junction, respectively (see Table 2). [UT]R
reflects the incorporation of 10R (see Table 1 and 2). TBDMS =
t-butyldimethylsilyl, DMT = 4,4ꢀ-dimethoxytrityl.
2 1 8 4
O r g . B i o m o l . C h e m . , 2 0 0 5 , 3 , 2 1 8 3 – 2 1 9 0

View Article Online
Table 1 Prepared oligodeoxynucleotide sequences and their MS-data
configuration around phosphorus as evaluated by an average
forcefield energy 10% lower for the RP configuration, fewer
violations and a much lower energy penalty from constraints.
Similarly, 6S is characterized by having a force field energy
approximately 10% lower when an SP starting structure is
used relative to an RP starting structure and fewer violations
were observed. By inspection of the calculated lowest energy
structures of the two epimers, some of the differences in the
chemical shifts can now be rationalized. The RP configuration
in 6R brings the phosphate oxygen into close proximity of the
H-3ꢀ proton and can explain the downfield shift of 0.36 ppm
relative to 6S. In 6S the O-5ꢀ of the 5ꢀ-neighboring thymidine
was seen to be quite close to H-9ꢀb, which is consistent with the
downfield shift of 0.18 ppm seen in this compound.
ODN sequencesa
MW (found/calcd)b
11
12
13
14
15
16
5ꢀ-GCTCACTTCTCCCA
4135c/4136 [MH]+
4175c/4176 [MH]+
4387c/4388 [MH]+
4423c/4428 [MH]+
4192d/4193 [MNH4]+
4444d/4445 [MNH4]+
5ꢀ-GCTCAC[UT]RCTCCCA
5ꢀ-GCLTCLACLTTCLTCLCCLA
5ꢀ-GCLTCLACL[UT]RCLTCLCCLA
5ꢀ-GCTCAC[UT]SCTCCCA
5ꢀ-GCLTCLACL[UT]SCLTCLCCLA
a [UT]R/S refers to incorporation of 10R or 10S. CL refers to the LNA
5-methylcytidine monomer. b MALDI-MS positive mode. c Only one
major peak. d Also minor signals from the expected [MH]+.
No immediate information about the conformational be-
haviour of 8R and 8S is given from the modelling on 6R and
6S. This is a natural consequence of the introduction of a
saturated linker and hereby more conformational freedom in
8R and 8S. Nevertheless, and despite the overlap of signals
in the 1H NMR spectra of 8R and 8S, some observations
concerning the conformational behaviour of the molecules are
worth mentioning. The same difference in chemical shift for
the uridine H-3ꢀ proton observed for 6R relative to 6S is found
between 8R and 8S. Thus, a similar difference in conformation
between the two epimers as the one found between 6R and 6S
Hybridisation properties of oligonucleotides 11–14 with com-
plementary DNA and RNA sequences were evaluated by ther-
mal stability examinations (Table 2). First, the standard duplexes
formed between 11–14 and their fully matched complements
were examined and large drops in duplex stability were observed.
Comparing 11 and 12, the cyclic dinucleotide induced a drop in
Tm of 15 ◦C in a DNA : DNA duplex compared to a standard
sequence. The same was evident in an LNA-modified (and
therefore A-type)33,34 duplex, which was significantly more stable
2,32,33
due to the LNA-monomers.¶
Also a DNA : RNA duplex
◦
was strongly destabilised, with a drop in Tm of 12.3 C. These
results demonstrate the expected distortion of standard nucleic
acid duplexes by the cyclic dinucleotide structure.
ꢀ
ꢀ
coupling constants (<1 Hz) were
is indicated. Very small JH3
H4
observed for the uridine nucleoside in both epimers 8R and 8S
(as well as 6R and 6S), indicating a strong preference for an S-
type sugar pucker. This was expected due to the 2ꢀ-C-alkyl group
and the cyclic moiety. Finally, in NOESY spectra obtained for
8R and 8S in DMSO-d6, positive signs were observed for most
signals of the uridine nucleoside compared to negative signs for
the signals of the thymidine nucleoside. This indicates a slower
dynamic and, despite the long and saturated linker, a much
stronger conformational stiffness for the uridine part compared
to the less restricted thymidine moiety.
For further elucidation of the secondary structure induced
by the cyclic dinucleotide 8R, we investigated the hybridisation
properties of oligonucleotides 11–14 with bulged DNA and
RNA complements (see also Scheme 2). An additional guano-
sine residue was incorporated in between the two adenosines
opposite the cyclic dinucleotide residue. The subsequent Tm
measurements revealed a smaller but significant drop in stability
of 4.9 to 6.6 ◦C when comparing the modified sequences, 12
and 14, with their unmodified counter parts, 11 and 13. In other
words, the introduction of a bulge in a duplex drops the stability
by 8–12 ◦C, whereas in the distorted duplexes containing 8R the
difference is only 0.5–3.3 ◦C.
Preparation and evaluation of oligonucleotides
The two amidites 10R and 10S were incorporated into four
different oligonucleotides by standard automated solid phase
DNA-synthesis using 10 min coupling time for 10R and 10S
followed by prolonged capping time. For both, the coupling
efficiencies were in the range of 86–98%. The oligonucleotides
prepared for this study are shown in Table 1. Thus, the two
central thymidines of the standard sequence 11 were replaced by
thecyclic dinucleotide8R in 12 and 8S in 15. Also an LNA–DNA
Finally, we examined the stability of a three-way junction
(TWJ) composed of a standard stable stem-loop sequence
with two single stranded regions being complementary to
the oligonucleotides 11–14 with the cyclic dinucleotide in the
branching point (see Scheme 2). The TWJ was in general not
very stable with a Tm of 26.4 ◦C in a complete DNA-context and
◦
36.8 C with a DNA : RNA hybrid, though significantly more
stable with six LNA-monomers (Table 2). A 5 mM concentration
of Mg2+ was in general found to increase the thermal stability
with 6–8 ◦C. A smaller further stabilisation with a 10 mM Mg2+
concentration of 2–3 ◦C was observed. When comparing the
data of 11 with 12, the TWJ was found to be stabilised with the
cyclic dinucleotide, especially with the stem-loop sequence being
RNA with an increase in Tm of 2.2 ◦C rising to 2.7 ◦C with the
addition of Mg2+. In the LNA-containing sequences, the TWJ
is slightly destabilised with a drop in Tm of only 0.3–0.5 ◦C,
although this is amplified by the increase of Mg2+ concentration
in the context of a DNA-complement.
The structural basis for the observed stabilisation of a TWJ
by the artificial bend motif is not immediately deducible from
the hybridisation data. The Mg2+ mediated stabilisation of the
TWJ is more or less uniform and no indications of a different
Mg2+ induced conformational shift with the modified sequences
are indicated. On the other hand, the present results demon-
strate the potential for mimicking and stabilising secondary
structures like TWJs by the introduction of simple artificial
distortions like cyclic dinucleotides. The bend motif induced
in an oligonucleotide by 8R might not be optimal for any of
the secondary structures investigated in this study as, after all,
only a slight stabilisation of the TWJ was seen. On the other
hand, a significant structural stabilisation might be found in
mixmer sequence 13 was studied, securing an overall preference
33,34
for A-type duplex formation for this sequence¶
Replacing
the central TT in this sequence with either 8R or 8S gave 14 and
16, respectively. The constitution of the oligonucleotides was
verified by MALDI-MS (Table 1) in addition to clean HPLC-
profiles showing 11–14 as pure compounds. On the other hand,
MALDI for the two oligonucleotides with the SP-isomer, 15 and
16, demonstrated an ammonia adduct as the primary product as
evidenced by an increase in mass of 17 Daltons. Hence, the two
epimers demonstrate a significantly different stability towards
ammonia and 15 and 16 were excluded from further studies.
Therefore, only the influence of the RP-isomer (the major isomer)
of 8 on secondary nucleic acid structures was examined.
¶ LNA (locked nucleic acid) has been introduced as oligonucleotides
containing the LNA monomers with a bicyclic carbohydrate moiety
locked in an N-type conformation2,32,33 and with the ability of tuning the
overall duplex conformation towards the A-type.33,34 LNA sequences
recognise complementary DNA and RNA with significantly increased
affinity compared to unmodified oligonucleotides.32,33 LNA monomers:
O r g . B i o m o l . C h e m . , 2 0 0 5 , 3 , 2 1 8 3 – 2 1 9 0
2 1 8 5

View Article Online
Table 2 Hybridisation data for the prepared oligonucleotides with DNA/RNA-complementsa
Fully matched complementsb Complements with G-bulgesc
DNA
RNA
DNA
RNA
11
12
13
14
54.1
60.2
42.1
49.7
39.1 (−15.0)
47.9 (−12.3)
>90
79.3 (<−10.7)
36.1 (−6.0)
44.8 (−4.9)
76.3
67.5
82.6
61.7 (−14.6)
61.2 (−6.3)
76.0 (−6.6)
Complements with an intrastrand stem-loopd,e
DNA
RNA
0 mM
5 mM
10 mM
0 mM
5 mM
44.6
10 mM
11
12
13
14
26.4
32.8
35.2
36.8
46.5
27.1 (0.7)
52.2
51.9 (−0.3)
33.4 (0.6)
59.2
58.2 (−1.0)
36.8 (1.6)
62.5
60.0 (−2.5)
39.0 (2.2)
71.3
70.8 (−0.5)
47.2 (2.6)
79.3
78.8 (−0.5)
49.2 (2.7)
80.8
80.7 (−0.l)
a Melting temperatures (Tm values/◦C) obtained from the maxima of the first derivatives of the melting curves (A260 vs. temperature) recorded in a
medium salt buffer (Na2HPO4 (15 mM), NaCl (100 mM), EDTA (0.1 mM), pH 7.0) using 1.0 lM concentrations of each strand. All Tm values are
given as averages of double determinations. DTm values are given in brackets. b DNA 3ꢀ-CGAGTGAAGAGGGT, RNA 3ꢀ-CGAGUGAAGAGGGU.
c DNA 3ꢀ-CGAGTGAGAGAGGGT, RNA 3ꢀ-CGAGUGAGAGAGGGU. d DNA 3ꢀ-CGAGTGACGCGTTTTCGCGAGAGGGT, RNA 3ꢀ-
CGAGUGACGCGUUUUCGCGAGAGGGU, bold sequences are stem-loops. e Increasing concentration of Mg2+ by addition of MgCl2.
a more optimised combination of 8R and a secondary nucleic
acid structure. Powerful stabilisation of secondary structures,
comparable to the stabilisation of duplexes obtained by LNA
and others,1–3 might also be obtained by other dinucleotide
structures prepared by our RCM-based strategy. Thus, other
examples are in progress. For example, cyclic dinucleotides
connecting both furanose moieties directly thereby introducing
a stronger bend motif and, presumably, a stronger effect
on the overall conformational restriction of the secondary
structure, compared to the restriction given by 8R. Therefore,
the appropriate molecular modelling combined with a selection
of cyclic structures can reveal a general tool for the design of
conformationally restricted and stable nucleic acid fragments.
This can play a strong future role in the design of nucleic acid
based architectures for therapeutics and nanoscale engineering.
depicted in Scheme 1. However, compound names for bicyclic
compounds are given according to the von Baeyer nomenclature.
Preparation of 2ꢀ-C-allyl-5ꢀ-O-tert-butyldimethylsilyl-2ꢀ-
deoxyuridine (2)
2ꢀ-C-Allyl-2ꢀ-deoxyuridine 129 (0.510 g, 1.90 mmol) was co-
evaporated twice with anhydrous pyridine (20 cm3) and then
redissolved in anhydrous pyridine (30 cm3). TBDMSCl (0.340 g,
2.26 mmol) and AgNO3 (0.390 g, 2.30 mmol) were added and
the reaction mixture was stirred for 25 h at room temperature.
The reaction was quenched by the addition of methanol (3 cm3)
and concentrated under a reduced pressure. The residue was
redissolved in dichloromethane (50 cm3), filtered through celite
and the filtrate was washed with water (50 cm3) and dried
(Na2SO4). The solvent was removed by destillation under a
reduced pressure and the residue was purified by dry column
chromatography (0–6% methanol–EtOAc) to give the product as
a white powder (0.617 g, 85%); Rf 0.60 (10% methanol–EtOAc);
dH (300 MHz; CDCl3; Me4Si) 0.11 (6H, s, SiCH3), 0.92 (9H, s,
C(CH3)3), 2.20–2.30 (2H, m, 2ꢀ-CH2, H-2ꢀ), 2.47 (1H, m, 2ꢀ-
CH2), 3.79 (1H, dd, J 2.0, 11.4 Hz, H-5ꢀa), 3.89 (1H, dd, J 2.4,
11.4 Hz, H-5ꢀb), 4.11 (1H, m, H-4ꢀ), 4.33 (1H, d, J 4.4 Hz, H-3ꢀ),
Conclusions
In conclusion, we have synthesised a cyclic dinucleotide 8R by
a convenient method based on RCM and incorporated this into
oligonucleotides. Hence, an example of an artificial bend nucleic
acid motif has been introduced and found to significantly distort
nucleic acid duplexes but slightly stabilise a three-way junction.
This confirms the value of the general RCM-based strategy for
mimicking and stabilisation of nucleic acid secondary structures.
=
5.05 (1H, dd, J 1.5, 10.1 Hz, CH2 CH), 5.13 (1H, dd, J 1.5,
=
17.1 Hz, CH2 CH), 5.71 (1H, d, J 8.1 Hz, H-5), 5.77 (1H, m,
ꢀ
=
CH2 CH), 6.17 (1H, d, J 8.4 Hz, H-1 ), 7.88 (1H, d, J 8.1 Hz,
H-6), 9.20 (1H, br s, NH); dC (75 MHz; CDCl3; Me4Si) −5.49,
−5.39 (SiCH3), 18.42 (C(CH3)3), 25.98 (C(CH3)3), 28.44 (C-2ꢀ),
Experimental
49.75 (2ꢀ-CH2), 64.28 (C-5ꢀ), 73.90 (C-3ꢀ), 87.15 (C-4ꢀ), 88.20 (C-
All commercial reagents were used as supplied. When necessary,
reactions were performed under an atmosphere of nitrogen.
Column chromatography was carried out on glass columns using
silica gel 60 (0.040–0.063 mm). NMR spectra were recorded
on a Varian Gemini 2000 spectrometer or a Varian UNITY
ꢀ
=
=
1 ), 102.93 (C-5), 117.08 (CH2 CH), 135.30 (CH2 CH), 140.51
(C-6), 150.86 (C-2), 163.38 (C-4); HiRes MALDI FT-MS m/z
(M + Na) found/calc. 405.1818/405.1816.
1
500 spectrometer. H NMR spectra were recorded at 300 or
Preparation of 3ꢀ-O-tert-butyldimethylsilylthymidin-5ꢀ-yl-O-
allyl-N,Nꢀ-diisopropylaminophosphoramidite (4)
500 MHz, 13C NMR spectra were recorded at 62.5 MHz and
31P NMR spectra were recorded at 121.5 MHz. The values for
d are in ppm relative to tetramethylsilane as internal standard
or 85% H3PO4 as external standard. HRMALDI and ESI mass
spectra were recorded on an Ionspec Ultima Fourier Transform
mass spectrometer with a DHB-matrix. Assignments of NMR
spectra are based on 1H, 1H-COSY, 1H, 13C-COSY and/or
DEPT spectra and follow standard carbohydrate and nucleoside
style; i.e. the carbon atom next to a nucleobase is assigned C-1ꢀ.
Carbons in the linker next to C-2ꢀ are assigned C-6ꢀ to C-9ꢀ, as
3ꢀ-O-(tert-Butyldimethylsilyl)thymidin 3 (0.795 g, 2.23 mmol)
was dissolved in CH3CN (4 cm3). Allyloxybis(diisopropyl-
amino)phosphine (0.97 g, 3.35 mmol) was added. A 0.45 M
solution of 1H-tetrazole in CH3CN (7.5 cm3, 3.4 mmol) was
added over a period of 5 min. The reaction mixture was stirred
for 1 h, filtrated and diluted with dichloromethane (40 cm3). The
solution was washed with a saturated aq. solution of NaHCO3
(20 cm3) and brine (4 cm3), dried (Na2SO4) and concentrated
2 1 8 6
O r g . B i o m o l . C h e m . , 2 0 0 5 , 3 , 2 1 8 3 – 2 1 9 0

View Article Online
under a reduced pressure. The residue was purified by dry
column chromatography (0–100% EtOAc–0.5% Et3N–petrol
ether) to give the product as an oily mixture of two phosphorus
epimers (0.800 g, 66%); Rf 0.60 (75% EtOAc–petrol ether); dH
(300 MHz; CDCl3; Me4Si) 0.08 (6H, m, SiCH3), 0.89 (9H,
br s, C(CH3)3), 1.17–1.22 (12H, m, CH(CH3)2), 1.91 (3/2H,
d, J 1.1 Hz, CH3), 1.93 (3/2H, d, J 1.1 Hz, CH3), 1.99–2.14
(1H, m, H-2ꢀa), 2.20–2.29 (1H, m, H-2ꢀb), 3.55–3.69 (2H, m,
CH(CH3)2), 3.75–3.93 (2H, m, H-5ꢀ), 4.00–4.05 (1H, m, H-3ꢀ),
4.11–4.22 (2H, m, POCH2), 4.42–4.47 (1H, m, H-4ꢀ), 5.12–5.32
9ꢀa), 4.47 (1H, dt, J 3.5, 6.7 Hz, T-H-3ꢀ), 4.83 (1H, dt, J 8.8,
12.0 Hz, H-9ꢀb), 4.89 (1H, dd, J 4.9, 9.4 Hz, U-H-3ꢀ), 5.75 (1H,
d, J 8.3 Hz, U-H-5), 5.78 (1H, ddd, J 6.0, 10.8, 12.3 Hz, H-7ꢀ),
5.91 (1H, ddd, J 6.0, 8.8, 10.8 Hz, H-8ꢀ), 6.21 (1H, d, J 9.0 Hz,
U-H-1ꢀ), 6.28 (1H, t, J 6.7 Hz, T-H-1ꢀ), 7.36 (1H, s, T-H-6), 7.87
(1H, d, J 8.3 Hz, U-H-6), 9.07 (1H, s, NH), 9.37 (1H, s, NH).
dP (121.5 MHz; CDCl3; H3PO4) −0.26. HiRes MALDI FT–MS
m/z (M + Na) found/calc. 835.3126/ 835.3141.
6S (0.010 g, 20%). Rf 0.40 (10% methanol–EtOAc); dH
(500 MHz; CDCl3; Me4Si) 0.11–0.12 (12H, m, SiCH3), 0.90
(18H, s, C(CH3)3), 1.96 (3H, s, CH3), 2.06 (1H, m, H-6ꢀa), 2.11
(1H, m, T-H-2ꢀa), 2.30 (1H, ddd, J 3.5, 6.7, 12.0 Hz, T-H-2ꢀb),
2.30 (1H, m, U-H-2ꢀ), 2.86 (1H, q, J 12.3 Hz, H-6ꢀb), 3.71 (1H,
dd, J 2.0, 12.0 Hz, U-H-5ꢀa), 3.81 (1H, dd, J 2.0, 12.0 Hz, U-H-
5ꢀb), 4.01 (1H, dt, J 3.5, 7.0 Hz, T-H-4ꢀ), 4.21 (1H, m, T-H-5ꢀa),
4.24 (1H, m, U-H-4ꢀ), 4.26, (1H, m, H-9ꢀa), 4.29 (1H, m, T-H-3ꢀ),
4.32 (1H, m, T-H-5ꢀb), 4.57 (1H, dd, J 4.4, 10.0 Hz, U-H-3ꢀ),
5.01 (1H, dt, J 10.5, 11.0 Hz, H-9ꢀb), 5.72 (1H, d, J 8.2 Hz,
U-H-5), 5.86 (1H, ddd, J 6.1, 10.5, 12.3 Hz, H-7ꢀ), 5.96 (1H, dt,
J 6.5, 10.5 Hz, H-8ꢀ), 6.19 (1H, d, J 9.7 Hz, U-H-1ꢀ), 6.23 (1H,
t, J 6.7 Hz, T-H-1ꢀ), 7.25 (1H, s, T-H-6), 7.78 (1H, d, J 8.0 Hz,
U-H-6), 8.66 (1H, s, NH), 8.73 (1H, s, NH). dP (121.5 MHz;
CDCl3; H3PO4) −0.52. HiRes MALDI FT-MS m/z (M + Na)
found/calc. 835.3105/835.3141.
=
=
(2H, m, CH2 CH), 5.87–5.97 (1H, m, CH2 CH), 6.31–6.37
(1H, m, H-1ꢀ), 7.58 (1 H, 7.58, d, J 1.1 Hz, H-6), 7.75 (12 H, d,
J 1.1 Hz, H-6), 8.10 2(1H, br s, NH); dP (121.5 MHz; CDCl3;
H3PO4) 148.92, 149.06. ESI MS m/z (M2 + Na) 1109.
Preparation of allyl (2ꢀ-C-allyl-5ꢀ-O-tert-butyldimethylsilyl-2ꢀ-
deoxyuridin-3-yl) (3ꢀ-O-tert-butyldimethylsilyl thymidin-5ꢀ-yl)
phosphate (5)
Compound 2 (0.610 g, 1.59 mmol) and compound 4 (1.12 g,
2.07 mmol) were mixed and coevaporated with anhydrous
CH3CN (20 cm3). The mixture was redissolved in anhydrous
CH3CN (24 cm3) and a 0.45 M solution of 1H-tetrazole in
CH3CN (4.3 cm3, 1.9 mmol) was added over a period of
10 min. The reaction mixture was stirred for 2.5 h generating
the intermediate phosphite (Rf 0.60 (75% EtOAc–petrol ether)).
Then, a 3 M solution of t-BuOOH in toluene (2.6 cm3, 7.8 mmol)
was added and the reaction mixture was stirred for 40 min. The
reaction was quenched by the addition of methanol (3 cm3).
The mixture was concentrated under a reduced pressure and the
residue was purified by dry column chromatography (0–100%
EtOAc–Petrol ether) to give the product as a mixture of two
phosphorus epimers as a white foam (1.14 g, 85%); Rf 0.44
(75% EtOAc–Petrol ether); dH (300 MHz; CDCl3; Me4Si) 0.10–
0.12 (12H, m, CH3), 0.89–0.91 (18H, m, C(CH3)3), 1.93–1.95
(3H, m, T-CH3), 2.09–2.50 (5H, m, T-H-2ꢀ, U-H-2ꢀ, 2ꢀ-CH2),
3.83–3.90 (2H, m, U-H-5ꢀ), 4.00–4.05 (1H, m, T-H-4ꢀ), 4.18–
4.31 (2H, m, T-H-5ꢀ), 4.33–4.45 (2H, U-H-4ꢀ, T-H-3ꢀ), 4.55–4.64
Preparation of 3R- and 3S-(1S,9R,10R,12R)-3-(3(S)-(tert-
butyldimethylsilyl)oxy-5(R)-(thymin-1-yl)tetrahydrofuran-2(R)-
yl)methoxy)-3-oxo-12-(tert-butyldimethylsilyl)oxymethyl-10-
(thymin-1-yl)-2,4,11-trioxa-3-phosphabicyclo[7.3.0]dodecane
(7R and 7S)
Compound
5 (0.199 g, 0.236 mmol) was dissolved in
dichloromethane (23 cm3). Grubbs 2nd gen. catalyst§ (10 mg,
12 lmol) was added and the reaction mixture was refluxed for
48 h. The reaction mixture was transferred to a Parr-bomb
and subjected to 1000 psi H2 at 50 ◦C for 12 h. The mixture
was concentrated under a reduced pressure and the residue
was purified by column chromatography (60–100% EtOAc–
petrol ether followed by 2–5% methanol–EtOAc) to give the
two phosphorus epimers 7R and 7S as isolated products:
7R (0.092 g, 48%). Rf 0.60 (10% methanol–EtOAc); dH
(300 MHz; CDCl3; Me4Si) 0.10–0.14 (12H, m, SiCH3), 0.90–
0.93 (18H, m, C(CH3)3), 1.60–1.75 (2H, m, H-8ꢀ), 1.80–1.95 (4H,
m, H-6ꢀ, H-7ꢀ) 1.95 (3H, s, CH3), 2.15 (1H, m, T-H-2ꢀa), 2.25–
2.35 (2H, m, U-H-2ꢀ, T-H-2ꢀb), 3.89 (2H, br s, U-H-5ꢀ), 4.03
(1H, m, T-H-4ꢀ), 4.18–4.32 (4H, T-H-5ꢀ, H-9ꢀa, U-H-4ꢀ), 4.38–
4.51 (2H, m, T-H-3ꢀ, H-9ꢀb), 5.21 (1H, m, U-H-3ꢀ), 5.73 (1H,
d, J 8.1 Hz, H-5), 6.07 (1H, d, J 8.3 Hz, U-H-1ꢀ), 6.31 (1H, t,
J 6.6 Hz, T-H-1ꢀ), 7.41 (1H, s, T-H-6), 7.84 (1H, d, J 8.1 Hz,
U-H-6), 9.06 (1H, s, NH), 9.31 (1H, s, NH). dP (121.5 MHz;
CDCl3; H3PO4) 0.44. HiRes MALDI FT-MS m/z (M + Na)
found/calc. 837.3323/837.3298.
(2H, m, POCH2), 4.88–4.95 (1H, m, U-H-3ꢀ), 4.98–5.13 (2H,
ꢀ
=
=
m, 2 -CH2CH CH2), 5.28–5.43 (2H, m, POCH2CH CH2),
ꢀ
=
5.62–5.78 (2H, m, 2 -CH2CH CH2, U-H-5), 5.87–6.01 (1H,
ꢀ
=
m, POCH2CH CH2), 6.13–6.17 (1H, m, U-H-1 ), 6.24–6.30
(1H, m, T-H-1ꢀ), 7.33–7.40 (1H, m, T-H-6), 7.79–7.84 (1H, m,
U-H-6), 9.12–9.37 (2H, m, 2 × NH); dP (121.5 MHz; CDCl3;
H3PO4) −0.22, −0.09; HiRes MALDI FT-MS m/z (M + Na)
found/calc. 863.3372/863.3460.
Preparation 3R- and 3S-(1S,9R,10R,12R)-3-(3(S)-(tert-
butyldimethylsilyl)oxy-5(R)-(thymin-1-yl)tetrahydrofuran-2(R)-
yl)methoxy)-3-oxo-12-(tert-butyldimethylsilyl)oxymethyl-10-
(thymin-1-yl)-2,4,11-trioxa-3-phosphabicyclo[7.3.0]dodec-6-ene
(6R and 6S)
7S (0.032 g, 17%). Rf 0.47 (10% methanol–EtOAc); dH
(300 MHz; CDCl3; Me4Si) 0.10–0.12 (12H, m, SiCH3), 0.90–
0.92 (18H, m, C(CH3)3), 1.55–1.90 (6H, m, H-6ꢀ, H-7ꢀ, H-8ꢀ),
1.96 (3H, s, CH3), 2.00–2.35 (3H, m, T-H-2ꢀ, U-H-2ꢀ), 3.73–3.87
(2H, m, U-H-5ꢀ), 4.04 (1H, m, T-H-4ꢀ), 4.17–4.33 (5H, T-H-5ꢀ,
U-H-4ꢀ, T-H-3ꢀ, H-9ꢀa), 4.51 (1H, m, H-9ꢀb), 4.83 (1H, dd, J 4.8,
9.6 Hz, U-H-3ꢀ), 5.71 (1H, dd, J 1.8, 8.1 Hz, H-5), 6.04 (1H, d, J
9.1 Hz, U-H-1ꢀ), 6.25 (1H, m, T-H-1ꢀ), 7.28 (1H, d, J 1.0 Hz, T-H-
6), 7.78 (1H, d, J 8.1 Hz, U-H-6), 8.48 (1H, s, NH), 8.51 (1H, s,
NH). dP (121.5 MHz; CDCl3; H3PO4) −1.62. HiRes MALDI
FT-MS m/z (M + Na) found/calc. 837.3262/837.3298.
Compound
5 (0.052 g, 0.062 mmol) was dissolved in
dichloromethane (6 cm3). Grubbs 2nd gen. catalyst§ (2.6 mg,
3 lmol) was added and the reaction mixture was refluxed
for 24 h. An additional amount of Grubbs 2nd gen. catalyst
(2.0 mg, 2 lmol) was added and the reaction mixture was
refluxed for another 24 h. The mixture was concentrated under
a reduced pressure and the residue was purified by column
chromatography (66–100% EtOAc–petrol ether followed by 5%
methanol–EtOAc) to give the two phosphorus epimers 6R and
6S as isolated products, as well as a 6R/S mixture (0.008 g, 16%,
approx. 7 : 3 ratio):
6R (0.020 g, 40%). Rf 0.56 (10% methanol–EtOAc); dH
(500 MHz; CDCl3; Me4Si) 0.11–0.12 (12H, m, SiCH3), 0.90–
0.91 (18H, m, C(CH3)3), 1.95 (3H, s, CH3), 2.08 (1H, m, H-6ꢀa),
2.16 (1H, dt, J 6.7, 12.0 Hz, T-H-2ꢀa), 2.31 (1H, ddd, J 3.5, 6.7,
12.0 Hz, T-H-2ꢀb), 2.41 (1H, m, U-H-2ꢀ), 2.88 (1H, q, J 12.3 Hz,
U-H-6ꢀb), 3.87 (2H, m, U-H-5ꢀ), 4.05 (1H, m, T-H-4ꢀ), 4.22–4.31
(3H, T-H-5ꢀ, U-H-4ꢀ), 4.39 (1H, ddd, J 6.0, 12.0, 16.2 Hz, H-
Preparation of (1S,3R,9R,10R,12R)-3-(3(S)-hydroxy-5(R)-
(thymin-1-yl)tetrahydrofuran-2(R)-yl)methoxy)-3-oxo-12-
hydroxymethyl-10-(thymin-1-yl)-2,4,11-trioxa-3-
phosphabicyclo[7.3.0]dodecan (8R)
Compound 7R (0.088 g, 0.108 mmol) was dissolved in a 90% aq.
solution of TFA (2 cm3). The mixture was stirred for 90 min,
O r g . B i o m o l . C h e m . , 2 0 0 5 , 3 , 2 1 8 3 – 2 1 9 0
2 1 8 7

View Article Online
an additional amount of 90% TFA solution added (1 cm3)
and stirred for another 200 min. The reaction mixture was
concentrated under a reduced pressure and the residue was
coevaporated with absolute ethanol and purified by column
chromatography (10–30% ethanol–EtOAc) to give the product
as a white powder (0.064 g, 100%). Rf 0.20 (20% ethanol–
EtOAc); dH (300 MHz; DMSO-d6; Me4Si) 1.45–1.85 (6H, m,
H-6ꢀ, H-7ꢀ, H-8ꢀ), 1.80 (3H, s, CH3), 2.08–2.16 (2H, m, T-H-2ꢀ),
2.36 (1H, m, U-H-2ꢀ), 3.56–3.63 (2H, m, U-H-5ꢀ), 3.93 (1H, m,
T-H-4ꢀ), 4.09–4.28 (6H, m, U-H-4ꢀ, T-H-5ꢀ, H-9ꢀ, T-H-3ꢀ), 5.15
(1H, dd, J 5.2 Hz, J 9.5 Hz, U-H-3ꢀ), 5.32 (1H, t, J 5.1 Hz,
5ꢀ-OH), 5.47 (1H, d, J 4.3 Hz, 3ꢀ-OH), 5.71 (1H, dd, J 2.2 Hz,
J 8.1 Hz, U-H-5), 5.82 (1H, d, J 9.4 Hz, U-H-1ꢀ), 6.20 (1H, t,
J 6.8 Hz, T-H-1ꢀ), 7.49 (1H, d, J 1.1 Hz, T-H-5), 7.86 (1H, d, J
8.1 Hz, U-H-6), 11.31 (1H, s, T-NH), 11.38 (1H, d, J 2.2 Hz, U-
NH); dP (121.5 MHz; DMSO-d6; H3PO4) 0.80; HiRes MALDI
FT-MS m/z (M + Na) found/calc. 609.1556/ 609.1568.
(121.5 MHz; CDCl3; H3PO4) 0.52; HiRes ESI FT-MS m/z (M +
Li) found/calc. 895.3126/895.3137.
Preparation of (1S,3S,9R,10R,12R)-3-(3(S)-hydroxy-5(R)-
(thymin-1-yl)tetrahydrofuran-2(R)-yl)methoxy)-3-oxo-12-(4,4ꢀ-
dimethoxytrityl)oxymethyl-10-(thymin-1-yl)-2,4,11-trioxa-3-
phosphabicyclo[7.3.0]dodecan (9S)
The same procedure as in the preparation of 9R was used with
8S (0.125 g, 0.213 mmol) to give the product as a white foam
(100 mg, 53%). Rf 0.40 (20% ethanol–EtOAc); dH (300 MHz;
CDCl3; Me4Si) 1.45–2.00 (6H, m, H-6ꢀ, H-7ꢀ, H-8ꢀ), 1.85 (3H, s,
CH3), 2.10–2.20 (1H, m, T-H-2ꢀa), 2.30–2.45 (2H, m, T-H-2ꢀb,
U-H-2ꢀ), 3.43–3.50 (2H, m, U-H-5ꢀ), 3.79 (6H, s, OCH3), 3.90–
3.96 (2H, m, T-H-5ꢀ), 4.10–4.40 (4H, m, T-H-4ꢀ, U-H-4ꢀ, T-H-3ꢀ,
H-9ꢀa), 4.53 (1H, m, H-9ꢀb), 4.89 (1H, m, U-H-3ꢀ), 5.47 (1H, d,
J 8.3 Hz, U-H-5), 5.99 (1H, d, J 8.9 Hz, U-H-1ꢀ), 6.07 (1H, t,
J 6.6 Hz, T-H-1ꢀ), 6.82–6.87 (4H, m, Ph), 7.19–7.35 (10H, m, T-
H-6, Ph), 7.59 (1H, d, J 8.3 Hz, U-H-6), 9.33 (1H, s, T-NH), 9.40
(1H, s, U-NH); dP (121.5 MHz; CDCl3; H3PO4) −1.24; HiRes
ESI FT-MS m/z (M + Li) found/calc. 895.3167/895.3137.
Preparation of (1S,3S,9R,10R,12R)-3-(3(S)-hydroxy-5(R)-
(thymin-1-yl)tetrahydrofuran-2(R)-yl)methoxy)-3-oxo-12-
hydroxymethyl-10-(thymin-1-yl)-2,4,11-trioxa-3-
phosphabicyclo[7.3.0]dodecan (8S)
Preparation of the 3ꢀ-O-phosphoramidite of 9R (10R)
Compound 7S (0.220 g, 0.271 mmol) was dissolved in a 90% aq.
solution of TFA (10 cm3) and the mixture was stirred for 3 h at
room temperature and at 60 ◦C for 1 h, an additional amount of
90% TFA solution added (2 cm3) and stirred for another 4 h. The
reaction mixture was concentrated under a reduced pressure and
the residue was coevaporated with absolute ethanol and purified
by column chromatography (0–20% ethanol–EtOAc) to give the
product as a white powder (0.135 g, 85%). Rf 0.23 (20% ethanol–
EtOAc); dH (300 MHz; DMSO-d6; Me4Si) 1.40–1.88 (6H, m, H-
6ꢀ, H-7ꢀ, H-8ꢀ), 1.80 (3H, s, CH3) 2.08–2.16 (2H, m, T-H-2ꢀ), 2.38
(1H, m, U-H-2ꢀ), 3.44–3.62 (2H, m, U-H-5ꢀ), 3.94 (1H, m, T-H-
4ꢀ), 4.01–4.42 (6H, m, T-H-5ꢀ, U-H-4ꢀ, T-H-3ꢀ, H-9ꢀ), 4.88 (1H,
m, U-H-3ꢀ), 5.28 (1H, t, J 5.0 Hz, 5ꢀ-OH), 5.43 (1H, d, J 4.0 Hz,
3ꢀ-OH), 5.70 (1H, d, J 8.3, U-H-5), 5.82 (1H, d, J 9.7 Hz, U-1ꢀ),
6.21 (1H, m, T-H-1ꢀ), 7.50 (1H, s, T-H-5), 7.83 (1H, d, J 8.3 Hz,
U-H-6), 11.33 (1H, s, NH), 11.38 (1H, s, NH); dP (121.5 MHz;
DMSO-d6; H3PO4) −1.44; HiRes MALDI FT-MS m/z (M +
Na) found/calc. 609.1564/609.1568.
Compound 9R (0.076 g, 0.086 mmol) was coevaporated with
anhydrous pyridine and dissolved in dichloromethane (1 cm3).
A 1 M solution of 4,5-dicyanoimidazole in CH3CN (0.1 cm3)
and 2-cyanoethyl-N,N,Nꢀ,Nꢀ-tetraisopropylphosphordiamidite
(0.035 g, 0.116 mmol) were added and the reaction mix-
ture was stirred for 30 min. The mixture was diluted with
dichloromethane (10 cm3) and washed with a saturated aq.
solution of NaHCO3 and brine (10 cm3), dried (Na2SO4) and
concentrated under a reduced pressure. The residue was purified
by dry column chromatography (50–100% EtOAc–1% pyridine–
petrol ether) to give the product as an off-white foam and a
mixture of two epimers (75 mg, 81%); Rf 0.55 (10% methanol–
1% pyridine–EtOAc); dP (121.5 MHz; CDCl3; H3PO4) 0.37, 0.42,
149.95, 150.40; HiRes ESI FT-MS m/z (M + Li) found/calc.
1095.4247/1095.4216.
Preparation of the 3ꢀ-O-phosphoramidite of 9S (10S)
The same procedure as in the preparation of 10R was used with
9S (0.072 g, 0.081 mmol) to give the product as a white foam
(50 mg, 57%); Rf 0.53 (20% ethanol–EtOAc); dP (121.5 MHz;
CDCl3; H3PO4) −1.53, −1.47, 150.23, 150.29.
Preparation of (1S,3R,9R,10R,12R)-3-(3(S)-hydroxy-5(R)-
(thymin-1-yl)tetrahydrofuran-2(R)-yl)methoxy)-3-oxo-12-(4,4ꢀ-
dimethoxytrityl)oxymethyl-10-(thymin-1-yl)-2,4,11-trioxa-3-
phosphabicyclo[7.3.0]dodecan (9R)
NMR analysis of compounds 6R and 6S. All NMR exper-
iments were performed on a Varian UNITY 500 spectrometer
Compound 8R (0.080 g, 0.136 mmol) was coevapo-
rated three times with anhydrous pyridine. 4,4ꢀ-Dimethoxy-
tritylchloride (DMT-Cl) (0.052 g, 0.153 mmol), DMSO (0.6 cm3)
and 2,6-lutidine (0.7 cm3) were added and the reaction mixture
was stirred at room temperature for 46 h. An additional amount
of DMT-Cl (0.007 g, 0.02 mmol) was added and the reaction
mixture was stirred for another 2 h. The reaction was quenched
by the addition of water (10 cm3) and the mixture was extracted
with dichloromethane (3 × 15 cm3). The combined organic
phases were washed with a saturated aq. solution of NaHCO3
(30 cm3) and brine (30 cm3), dried (Na2SO4) and concentrated
under a reduced pressure. The residue was purified by dry
column chromatography (0–8% methanol–1% pyridine–EtOAc)
to give the product as a white foam (78 mg, 64%). Rf 0.43 (20%
ethanol–EtOAc); dH (300 MHz; CDCl3; Me4Si) 1.45–2.00 (6H,
m, H-6ꢀ, H-7ꢀ, H-8ꢀ), 1.90 (3H, s, CH3), 2.16 (1H, m, T-H-2ꢀa),
2.36–2.40 (2H, m, T-H-2ꢀb, U-H-2ꢀ), 3.43–3.56 (2H, m, U-H-5ꢀ),
3.78 (6H, s, OCH3), 4.09 (1H, m, T-H-4ꢀ), 4.20–4.35 (4H, m,
T-H-5ꢀ, U-H-4ꢀ, H-9ꢀa), 4.41 (1H, m, H-9ꢀb), 4.51 (1H, m, T-H-
3ꢀ), 5.30 (1H, m, U-H-3ꢀ), 5.39 (1H, d, J 8.3 Hz, U-H-5), 6.03
(1H, d, J 9.3 Hz, U-H-1ꢀ), 6.32 (1H, t, J 6.6 Hz, T-H-1ꢀ), 6.81–
6.86 (4H, m, Ph), 7.18–7.39 (10 H, m, T-H-6, Ph), 7.53 (1H, d,
J 8.3 Hz, U-H-6), 9.71 (1H, s, T-NH), 9.92 (1H, s, U-NH); dP
◦
1
at 25 C in CDCl3. 1D H NMR spectra of 6R and 6S were
recorded with 22 208 points and a spectral width of 5500 Hz.
Phase sensitive NOESY spectra with a mixing time of 700 ms
were recorded for 6R and 6S with 2 K points in the t2-dimension
using spectral widths of 5500 Hz in both dimensions and 16
transients for each of the 680 t1-experiments. Phase sensitive
DQF-COSY spectra were recorded with 4 K points sampled
in F2, 5500 Hz spectral widths in both dimensions and 640
t1-experiments, each recorded with 16 transients. All spectra
were processed using NMRpipe.35 Cross peak intensities were
measured using the program SPARKY.36
Restrained molecular dynamics simulations. All MD cal-
culations were performed using the AMBER 6.0 program
package37 on an SGI/O2 workstation. Due to the lack of suitable
angular parameters in the AMBER 6.0 forcefield to describe
the modifications at the phosphorus atom, a series of ab initio
calculations were performed using the Gaussian 98 program38
and the 3–21G and 6–31G(d,p) basis sets. These ab initio energy
optimised structures were used to measure ideal angles to be
included in the force field calculations. Atomic charges around
the modified phosphorus were calculated using the restrained
electrostatic potential (RESP) procedure.39
2 1 8 8
O r g . B i o m o l . C h e m . , 2 0 0 5 , 3 , 2 1 8 3 – 2 1 9 0

View Article Online
Distance restraints were derived from the NOESY spectra
using the ISPA approach. After carefully evaluating the pre-
liminary energy minimized structures, additional restraints were
later included in form of broad repulsive restraints. All distance
restraints were incorporated into the refinement as distance
absorbance at 260 nm as a function of time was recorded while
the temperature was increased linearly from 10 to 90 ◦C at a
◦
rate of 1.0 C min−1. The melting temperature was determined
as the local maximum of the first derivatives of the absorbance
versus temperature curve. All melting curves were found to be
reversible. For melting experiments with Mg2+ concentrations of
5 or 10 mM, MgCl2 (1.0 lL and 2.0 lL, respectively, of a 5.0 M
solution) was added to the samples.
˚
bounds with bounds of the calculated ISPA value 0.5 A. Two
torsional restraints were included to ensure cis configuration of
the double bond. In addition, six chirality restraints at the chiral
atoms in the two deoxyribose sugar rings were included in each
calculation.
A simulated annealing protocol was utilized to obtain average
structures of the four compounds. For each compound, two
different starting structures, differing only in the configuration
at the phosphorus atom, were used. Each structure was then
initially energy minimized before being subjected to 80 ps of
molecular dynamics in time-steps of 1 fs : 4 ps at 800 K, followed
by cooling to 200 K over 76 ps. Finally, a restrained energy
Acknowledgements
The Danish National Research Foundation is thanked for
financial support. Dr Kenneth B. Jensen, Mrs Birthe Haack,
Suzy W. Lena and Kirsten Østergaard are thanked for technical
assistance.
References
minimization was performed for each structure. For all distance
2
restraints the force constant used was K = 20 kcal mol−1 A and
˚
1 P. Herdewijn, Biochim. Biophys. Acta, 1999, 1489, 167.
2 M. Meldgaard and J. Wengel, J. Chem. Soc., Perkin Trans. 1, 2000,
3539.
3 C. J. Leumann, Bioorg. Med. Chem., 2002, 10, 841.
4 K. Seio, T. Wada, K. Sakamoto, S. Yokoyama and M. Sekine, J. Org.
Chem., 1998, 63, 1429.
5 K. Seio, T. Wada and M. Sekine, Helv. Chim. Acta, 2000, 83, 162.
6 M. Sekine, O. Kurasawa, K. Shohda, K. Seio and T. Wada, J. Org.
Chem., 2000, 65, 3571.
for coupling constants the force constant was 10 kcal mol−1 Hz2.
A distance dependent dielectric constant, e = 4r, was used and
˚
the non-bonded cut-off was 20 A.
Preparation of oligodeoxynuclotides
Oligonucleotide synthesis was carried out by using an
ExpediteTM 8900 Nucleic acid synthesis system from PerSeptive
Biosystems Inc. following the phosphoramidite approach. Syn-
thesis of oligonucleotides 11–16 was performed on a 0.2 lmol
scale by using 2-cyanoethyl phosphoramidites of standard 2ꢀ-
deoxynucleosides as well as the LNA–meC monomer in combi-
nation with the modified phosphoramidites 10R and 10S. The
synthesis followed the regular protocol emploing standard CPG
supports. However, for the LNA monomer a prolonged coupling
time of 4 min was used and for 10R and 10S a manual coupling
in 10 min, followed by 2 × 45 s capping. Coupling yields for
10R and 10S were in the range of 86–98%. The 5ꢀ-O-DMT–
ON oligonucleotides were removed from the solid support by
treatment with concentrated aq. ammonia at room temperature
for 48 h, which also removed the protecting groups. Purification
using reversed-phase HPLC was performed on a Waters Prep
LC 4000 system using a Xterra prep MS C18; 10 lm; 7.8 × 300 mm
column; A buffer: 3800 mL 0.1 M NH4HCO3 and 200 mL
CH3CN; B buffer: 750 mL CH3CN and 250 mL NH4HCO3; 0–
4 min. 100% A, 4–15 min. linear gradient 0–100% B, 15–20 min.
100% B, 20–22 min. 0–100% A, 22–25 min. 100% A. All fractions
containing 5ꢀ-O-DMT protected oligonucleotide (retention time
14–17 min) were collected, concentrated and diluted with water
(1 mL). The oligonucleotides were precipitated by treatment with
100 lL 80% CH3COOH for 30 min, followed by the addition of
100 lL UHQ water, 50 lL 3 M CH3COONa (aq.) and 600 lL
99.9% ethanol. The mixture was left at −18 ◦C for 1 h followed
by centrifugation for 20 min at 4 ◦C. The supernatant was
removed and the oligonucleotide was washed with cold 99.9%
ethanol, dried and dissolved in water. MALDI MS m/z (M +
H) found/calcd: 11 4135/4136; 12 4175/4176; 13 4387/4338;
14 4423/4428. For 15–16, for which 10S was employed, ring-
opened ammonia-adducts were found. MALDI MS m/z (M +
NH4) found/calcd: 15 4192/4193; 16 4444/4445.
7 M. Sekine, O. Kurasawa, K. Shohda, K. Seio and T. Wada, J. Org.
Chem., 2000, 65, 6515.
8 M. Sekine, O. Kurasawa, K. Shohda, K. Seio and T. Wada,
Eur. J. Org. Chem., 2001, 1989.
9 C. R. Allerson and G. L. Verdine, Chem. Biol., 1995, 2, 667.
10 J. T. Goodwin, S. E. Osborne, E. J. Scholle and G. D. Glick, J. Am.
Chem. Soc., 1996, 118, 5207.
11 S. E. Osborne, R. J. Cain and G. D. Glick, J. Am. Chem. Soc., 1997,
119, 1171.
12 S. Alefelder and S. T. Siggurdsson, Bioorg. Med. Chem., 2000,
8, 269.
13 A. Kowalczyk, J. R. Carmical, Y. Zou, B. Van Houten, R. S. Lloyd,
C. M. Harris and T. M. Harris, Biochemistry, 2002, 41, 3109.
14 A. Fu¨rstner, Angew. Chem., Int. Ed., 2000, 39, 3012.
15 R. R. Schrock and A. H. Hoveyda, Angew. Chem., Int. Ed., 2003, 42,
4592.
16 R. H. Grubbs, Tetrahedron, 2004, 60, 7117.
17 M. Scholl, S. Ding, C. W. Lee and R. H. Grubbs, Org. Lett., 1999, 1,
953.
18 T. M. Trnka and R. H. Grubbs, Acc. Chem. Res., 2001, 34, 18.
19 A. M. Sørensen and P. Nielsen, Org. Lett., 2000, 2, 4217.
20 A. M. Sørensen, K. E. Nielsen, B. Vogg, J. P. Jacobsen and P. Nielsen,
Tetrahedron, 2001, 57, 10191.
21 P. Børsting, A. M. Sørensen and P. Nielsen, Synthesis, 2002, 797.
22 P. Børsting and P. Nielsen, Chem. Commun., 2002, 2140.
23 C. Kirchhoff and P. Nielsen, Tetrahedron Lett., 2003, 44, 6475.
24 P. Børsting, M. Freitag and P. Nielsen, Tetrahedron, 2004, 60, 10955.
25 I. Le Cle´zio, J.-M. Escudier and A. Vigroux, A., Org. Lett., 2003, 5,
161.
26 I. Le Cle´zio, H. Gornitzka, J.-M. Escudier and A. Vigroux, A., J. Org.
Chem., 2005, 70, 1620.
27 J. Louie, C. W. Bielawski and R. H. Grubbs, J. Am. Chem. Soc., 2001,
123, 11312.
28 M. D. Reynolds, J. M. Dougherty and P. R. Hanson, Chem. Rev.,
2004, 104, 2239.
29 D. O. Cicero, P. J. S. Neuner, O. Franzese, C. D’Onofrio and A. M.
Iribarren, Bioorg. Med. Chem. Lett., 1994, 4, 861.
30 M. Groetli and K. Undheim, Acta Chem. Scand., 1995, 49, 217.
31 C. Vargeese, J. Carter, J. Yegge, S. Krivjansky, A. Settle, E. Kropp,
K. Peterson and W. Pieken, Nucleic Acids Res., 1998, 26, 1046.
32 S. K. Singh, P. Nielsen, A. A. Koshkin and J. Wengel, Chem.
Commun., 1998, 455.
33 M. Petersen and J. Wengel, Trends Biotechnol., 2003, 21, 74.
34 K. Bondensgaard, M. Petersen, S. K. Singh, V. K. Rajwanshi, R.
Kumar, J. Wengel and J. P. Jacobsen, Chem. Eur. J., 2000, 6, 2687.
35 F. Delaglio, S. Grzesiek, G. W. Vuister, G. Zhu, J. Pfeifer and A. Bax,
J. Biomol. NMR, 1995, 6, 277.
Melting experiments
UV melting experiments were carried out on a Perkin-Elmer
Lambda 35 UV/VIS spectrometer with a PTP-6 Peltier system
and data were processed with Templab version 2.00 and UV
WINLAB version 2.85.04. Samples were dissolved in a medium
salt buffer containing Na2HPO4 (15 mM), NaCl (100 mM)
and EDTA (0.1 mM), pH 7.0 with 1 lM concentrations of
the two complementary sequences. The extinction coefficients
were calculated assuming the extinction coefficients for the
dinucleotide 8R to equal two thymidines. The increase in
36 T. D. Goddard and D. G. Kneller, SPARKY 3, University of
California, San Francisco (http://www.cgl.ucsf.edu/home/sparky).
37 D. A. Case, D. A. Pearlman, J. W. Caldwell, T. E. Cheatham III, W. S.
Ross, C. L. Simmerling, T. A. Darden, K. M. Merz, R. V. Stanton,
O r g . B i o m o l . C h e m . , 2 0 0 5 , 3 , 2 1 8 3 – 2 1 9 0
2 1 8 9

View Article Online
A. L. Cheng, J. J. Vincent, M. Crowley, V. Tsui, R. J. Radmer, Y. Duan,
J. Pitera, I. Massova, G. L. Seibel, U. C. Singh, P. K. Weiner and P. A.
Kollman, AMBER 6, University of California, San Francisco, 1999.
38 M. J. Frisch, G. W. Trucks, H. B. Schlegel, P. M. W. Gill, B. G.
Johnson, M. A. Robb, J. R. Cheeseman, T. A. Keith, G. A. Petersson,
J. A. Montgomery, K. Raghavachari, M. A. Al-Laham, V. G.
Zakrewski, J. V. Ortiz, J. B. Foresman, J. Cioslowski, B. B. Stefanov,
A. Nanayakkara, M. Challacombe, C. Y. Peng, P. Y. Ayala, W. Chen,
M. W. Wong, J. L. Andres, E. S. Replogle, R. Comperts, R. L. Martin,
D. J. Fox, J. S. Binkley, D. J. Defrees, J. Baker, J. P. Stewart, M.
Head-Gordon, C. Gonzalez and J. A. Pople, Gaussian94 (Rev D.3),
Gaussian Inc, Pittsburg, PA, 1995.
39 C. I. Bayly, P. Cieplak, W. D. Cornell and P. A. Kollman, J. Phys.
Chem., 1993, 97, 10269.
2 1 9 0
O r g . B i o m o l . C h e m . , 2 0 0 5 , 3 , 2 1 8 3 – 2 1 9 0