Analogues of thiolactomycin as potential antimalarial agents

Article abstract of DOI:10.1021/jm049067d

Analogues of the natural antibiotic thiolactomycin (TLM), an inhibitor of the condensing reactions of type II fatty acid synthase, were synthesized and evaluated for their ability to inhibit the growth of the malaria parasite Plasmodium falciparum. Alkylation of the C4 hydroxyl group led to the most significant increase in growth inhibition (over a 100-fold increase in activity compared to TLM). To investigate the mode of action, the P. falciparum KASIII enzyme was produced for inhibitor assay. A number of TLM derivatives were identified that showed improved inhibition of this enzyme compared to TLM. Structure-activity relationships for enzyme inhibition were identified for some series of TLM analogues, and these also showed weak correlation with inhibition of parasite growth, but this did not hold for other series. On the basis of the lack of a clear correlation between inhibition of pfKASIII activity and parasite growth, we conclude that pfKASIII is not the primary target of TLM analogues. Some of the analogues also inhibited the growth of the parasitic protozoa Trypanosoma cruzi, T. brucei, and Leishmania donovani.

Full text of DOI:10.1021/jm049067d

5932
J. Med. Chem. 2005, 48, 5932-5941
Analogues of Thiolactomycin as Potential Antimalarial Agents
Simon M. Jones,†,‡ Jonathan E. Urch,§,‡ Marcel Kaiser,# Reto Brun,# John L. Harwood,§ Colin Berry,§ and
Ian H. Gilbert*,†
Welsh School of Pharmacy, Cardiff University, Redwood Building, King Edward VII Avenue, Cardiff, CF10 3XF, U.K.,
Cardiff School of Biosciences, Cardiff University, Biomedical Building, Museum Avenue, Cardiff, CF10 3US, U.K., and
Swiss Tropical Institute, Socinstrasse 57, CH-4002 Basel, Switzerland
Received November 18, 2004
Analogues of the natural antibiotic thiolactomycin (TLM), an inhibitor of the condensing
reactions of type II fatty acid synthase, were synthesized and evaluated for their ability to
inhibit the growth of the malaria parasite Plasmodium falciparum. Alkylation of the C4
hydroxyl group led to the most significant increase in growth inhibition (over a 100-fold increase
in activity compared to TLM). To investigate the mode of action, the P. falciparum KASIII
enzyme was produced for inhibitor assay. A number of TLM derivatives were identified that
showed improved inhibition of this enzyme compared to TLM. Structure-activity relationships
for enzyme inhibition were identified for some series of TLM analogues, and these also showed
weak correlation with inhibition of parasite growth, but this did not hold for other series. On
the basis of the lack of a clear correlation between inhibition of pfKASIII activity and parasite
growth, we conclude that pfKASIII is not the primary target of TLM analogues. Some of the
analogues also inhibited the growth of the parasitic protozoa Trypanosoma cruzi, T. brucei,
and Leishmania donovani.
Introduction
geted against the â-ketoacyl acyl-carrier-protein syn-
thases (KAS) and other individual enzymes of the type
II FAS.6,7
Malaria is by far the world’s most important tropical
disease. In many developing countries and in sub-
Saharan Africa especially, malaria exacts an enormous
toll in lives, in medical costs, and in days of labor lost.
At present, at least 300 million people are affected by
malaria globally, and there are between 1 and 1.5
million malaria deaths annually.1,2 Over the past sev-
eral decades, the rapid development of drug-resistant
strains has compounded the already serious health
problems. Of the four known human malaria parasites,
Plasmodium falciparum is the predominant cause of
mortality, with 120 million new cases and 1 million
deaths per year globally. It is this particular species that
has given rise to formidable drug-resistant strains,
resulting in the urgent need for new chemotherapeutic
agents. The search for new agents has recently been
aided with the completion of the P. falciparum genome
sequence.3 Detailed studies4 of this genome have identi-
fied new potential drug and vaccine targets. One such
target appears to be the fatty acid biosynthesis pathway
of P. falciparum.
In plants and bacteria, there appear to be three KAS
enzymes, which are denoted KASI, KASII, and KASIII
in plants (the E. coli equivalents are FabB, FabF, and
FabH, respectively). The initial C2-C4 step of fatty acid
biosynthesis is catalyzed by KASIII; thereafter, KASI
and KASII are involved in chain elongation.8 In most
organisms with a type II fatty acid synthase, KASI and
KASII show very high similarity at the protein level.
Recent discoveries reveal that Plasmodium synthe-
sizes fatty acids in the apicoplast, which is a vestigial
organelle thought to be derived from a chloroplast.9-12
Not surprisingly, Plasmodium fatty acid synthase is a
type II enzyme complex as found in plants and bacteria
and, thus, differs markedly from human type I FAS.
However, analysis of the recently published P. falci-
parum genome3 reveals just two different KAS enzymes,
with the KASI and KASII of typical type II systems
replaced by a single enzyme that we and others have
denoted KAS1/2, and a separate KASIII.8
A known inhibitor of the dissociable type II FAS
enzymes is the naturally occurring thiolactone antibiotic
thiolactomycin (TLM) 113,14 (Figure 1). Because of its
negligible toxicity toward mammals,15 TLM or its
analogues are leads for new drugs for malaria. Further-
more, because TLM and its derivatives target more than
one enzyme (all the KAS enzymes, at least to some
extent),14 resistance due to point mutations should be
less of a problem than for some drugs. Waller et al.16
showed that thiolactomycin inhibits the proliferation of
cultured P. falciparum with an IC50 value of 50 µM, and
the antimalarial activity was attributed to the inhibition
of the FAS condensing enzymes. However, the fact that
there are several enzymatic targets may lead to complex
Fatty acid synthesis is a crucial function of living cells.
The main steps in this process in animals are carried
out by a single, multifunctional polypeptide fatty acid
synthase (type I FAS). In contrast, plants and bacteria
utilize a dissociable multienzyme system (type II FAS).5
The structural differences between these systems are
sufficient for the development of selective agents tar-
* To whom correspondence should be addressed: School of Life
Sciences, University of Dundee, MSI/WTB/CIR Complex, Dow Street,
Dundee, DD1 5EH, Scotland, U.K.; phone +44 (0) 1382 386 240.
† Welsh School of Pharmacy, Cardiff University.
‡ Both authors contributed equally to the work.
§ Cardiff School of Biosciences, Cardiff University.
# Swiss Tropical Institute.
10.1021/jm049067d CCC: $30.25 © 2005 American Chemical Society
Published on Web 08/30/2005

Analogues of Thiolactomycin
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19 5933
we wanted to increase the hydrophilicity of our com-
pounds, which may be possible to achieve by addition
of suitable functionality in the side chain.
(3) Addition of a second substituent to the 3-position
of the thiolactone ring was carried out. As well as
possible new interactions with the enzyme active site,
this should also affect the electronic and steric proper-
ties of the ring, giving a carbonyl at the 4-position and
removing the double bond between the 3 and 4 positions.
Figure 1. Structure of thiolactomycin.
modes of action. Recently, Prigge et al. expressed and
purified the three P. falciparum proteins required to
initiate fatty acid biosynthesis (P. falciparum acyl
carrier protein (pfACP), P. falciparum malonyl-CoA/
ACP acyl transferase (pfMCAT), and pfKASIII) and
revealed thiolactomycin 1 to be a poor inhibitor of the
pfKASIII enzyme with an IC50 value greater than 330
µM.17 Despite the low activity of TLM toward the
enzyme, three derivatives (1,2-dithiole-3-ones) bearing
similarities to the structure of TLM did show improved
inhibition of pfKASIII activity (<10 µM). We were keen
to discover if our TLM analogues (including derivatives
from our earlier studies18) bearing the thiolactone ring
would show improved activity against the pfKASIII
enzyme and if there was any relationship between
antimalarial activity and inhibition of this enzyme.
Previous studies have shown that analogues of TLM,
with variations at the C5 position, have shown improved
inhibition of pea (Pisum sativum) FAS19. Waller et al.
also showed some TLM derivatives with variation at C5
showed encouraging antimalarial activity.20 Indeed,
recently we have shown that the introduction of hydro-
phobic alkyl groups at both the C3 and C5 positions of
the thiolactone ring leads to increased inhibition toward
the malaria parasite.18 The best results were obtained
with 10-carbon alkyl side chains at the C5 position
accompanied by shorter alkyl groups (ethyl or propyl)
(4) Investigation of a substituent at the 4-position was
carried out.
Using a synthetic strategy similar to that we previ-
ously reported,18 we were able to synthesize a range of
tetronic acid analogues (Scheme 1). Methyl propiony-
lacetate 2 was treated with alkyl halides in the presence
of sodium hydride and butyllithium to provide the
alkylated products 3. Subsequent alkylation at the C2
position with the relevant alkyl and benzyl halides
employing potassium carbonate as base gave the desired
â-ketoesters 4 in good yields. Treatment with pyri-
dinium tribromide in acetic acid resulted in the forma-
tion of the bromides 5. Following a literature proce-
dure,21 the bromides were duly converted into their
respective tetronic acids 6 upon exposure to potassium
hydroxide in water at 0 °C. Isolated yields following
column chromatography were relatively low (9-33%).
With the construction of the carbon skeleton prior to
cyclization, the low-yielding alkylation reaction at the
C5 position was avoided; this was especially important
because the lactone intermediates were considered to
be sensitive to the strong basic conditions required for
alkylation.
The synthesis of the nitrogen analogue was ac-
complished as shown in Scheme 2. Glycine 7 was treated
with thionyl chloride in dry dichloromethane at 0 °C,
resulting in the formation of the methyl ester hydro-
chloride 8 in 89% yield. The ester was subsequently
treated with benzophenone imine to afford the imine 9.
Following a literature procedure,22 the imine was suc-
cessfully alkylated to yield 10 (62%). Hydrolysis with 2
M HCl delivered the free amine 11, which when reacted
with diketene at 0 °C formed the desired cyclization
precursor 12 in good yield (59%). Exposure of the amide
12 to sodium methoxide in refluxing methanol induced
a Dieckman type cyclization,23 resulting in the desired
pyrole 13 in 10% yield.
In our previous studies we described the synthesis of
a number of analogues with variations at the C5
position of the ring.18 Recently, Douglas et al.24 have
reported improved methodology for the low-yielding
alkylation reaction employing lithium bis(trimethylsi-
lyl)amide (LTMSA) as base. Treatment of the thiolac-
tone 14 with LTMSA and bromohexadecane in THF at
-78 °C delivered the desired analogues 15 and 16
(Scheme 3). In a similar fashion, analogues 17 and 18
were also synthesized in 10% and 20% yields, respec-
tively. Deprotection of the silyl ether 18 gave the
primary alcohol 19 in 18% yield.
Derivitization of both the C3 position and the hy-
droxyl group was accomplished as shown in Scheme 4.
Following a literature procedure,24 the alkylated prod-
ucts 21 were obtained in varying yields by treatment
of the thiolactone 20 with sodium hydride and the
relevant halides. In the majority of cases the major
at the C3 position. The most active compound (IC50
)
10 µM) showed a 14-fold improvement in activity
against P. falciparum compared to TLM, which in our
studies exhibited an IC50 of 143 µM.18 Encouraged by
these findings, we have since conducted detailed struc-
ture-activity relationships involving further derivati-
zations at the C3 and C5 positions, a variation in the
type of heterocycle, and alkylation of the hydroxyl group
at the C4 position. In this paper we present synthetic
studies and findings in our attempts to improve the
overall activity of TLM against P. falciparum cultured
in red blood cells. In an attempt to shed more light on
the mechanism of action of these compounds, we also
assayed the compounds against one of the component
enzymes of FAS, a recombinant pfKASIII.
Chemistry
Previously, we have reported the synthesis of a
number of thiolactomycin analogues with variations at
both the C3 and C5 positions of the ring.18 We decided
to undertake a more complete structure-activity rela-
tionship by looking at other positions around the ring.
In particular, we proposed the following variations:
(1) Variation of the heterocyclic ring was carried out,
in particular the change from a sulfur to an oxygen or
nitrogen, which would vary the size and electronic
properties of the ring.
(2) Addition of functionality to the substituents at the
5-position to these side chains was carried out with the
aim of discovering new interactions between the side
chain and the protein to increase potency. In addition,

5934 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19
Jones et al.
Scheme 1a
a Reagents and conditions: (a) NaH (1.2 equiv), BuLi (1.1 equiv), R1I, 0 °C to room temp; (b) R1I, K2CO3 (4 equiv), THF, reflux; (c)
PyBr3, AcOH, room temp; (d) KOH (2.5 equiv), H2O, 0 °C to room temp.
Scheme 2a
Scheme 3a
a Reagents and conditions: (a) LTMSA (2 equiv), bromohexa-
decane, THF, -78 °C to room temp; (b) LTMSA (2 equiv), alkyl
bromide, THF, -78 °C to room temp; (c) LTMSA (2 equiv), alkyl
bromide, THF, -78 °C to room temp; (d) 2 M HCl, MeOH, room
temp.
a Reagents and conditions: (a) SOCl2 (1.5 equiv), MeOH, 0 °C
to room temp; (b) benzophenone imine (1 equiv), CH2Cl2, room
temp; (c) LDA (1.1 equiv), iododecane (1 equiv), THF, -78 °C to
room temp; (d) 2 M HCl, Et2O, room temp; (e) diketene (1.2 equiv),
CHCl3, 0 °C to room temp; (f) NaOMe (1 equiv), MeOH, reflux.
ing enzyme component of FAS (Tables 1-3). Previously
we reported the activity of some thiolactomycin ana-
logues (23a-d, 24a-k, 25a,b, 26a,b, and 27)18 against
P. falciparum in vitro. We have now assayed these
compounds against the MBP-pfKASIII enzyme and
report these data here for the first time to give a more
comprehensive view of their activity against the enzyme
(Table 1). The screening procedures for all assays are
briefly described in the Experimental Section.
Growth Inhibition of P. falciparum. We have
previously reported that analogues of the antibiotic
thiolactomycin with aliphatic substituents at the C3 and
C5 positions of the thiolactone ring have significantly
enhanced activity against P. falciparum in vitro.18 The
best results were obtained with the longer alkyl chains
(over 10 carbons in length) at the C5 position, supple-
mented with a smaller increase in chain length at the
C3 position (two to three carbons). Following on from
these initial structure-activity relationships, a new
series of compounds has been designed. As discussed
in the Introduction, thiolactomycin and its analogues
may target a number of different enzymes, in this case
KAS1/2 and/or KASIII, and possibly other molecular
targets. This may give inhibitors complex modes of
action and complex SARs. In addition, in studies of a
reaction appeared to be the desired alkylation at the
C3 position of the ring, as reported in the literature.
However, it was evident that a side reaction was
occurring during the reaction, in which the hydroxyl
group was also alkylated. Following flash column chro-
matography these compounds 22 were isolated, albeit
in low yields.
Results and Discussion
All compounds were assayed in vitro for their activity
against the malarial parasite P. falciparum and the
trypanosomatid parasites T. brucei, T. cruzi, and L.
donovani (Tables 1-3). Compounds were screened
against the clinically relevant form of the parasites: P.
falciparum cultured in red blood cells, blood stream form
T. brucei rhodesiense, T. cruzi amastigotes cultured
intracellularly, and L. donovani axenic amastigotes.
Furthermore, the production of the recombinant mal-
tose binding protein, P. falciparum KASIII (MBP-
pfKASIII) fusion protein, has enabled us to screen our
derivatives for enzyme inhibition against this condens-

Analogues of Thiolactomycin
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19 5935
Scheme 4a
a Reagents and conditions: (a) NaH, R3X, THF, reflux.
Table 1. Effect of Variation of the Heteroatom and Substituents at C3 and C5 on Parasite Growth and Inhibition of P. falciparum
KASIIIa
P. falc
T. cruzi
T. b. rhod.
IC50 (µM)
L. don. axenic
IC50 (µM)
% inhib
compd
R1
Me
R2
R3
X
IC50 (µM)
IC50 (µM)
pfKASIIIc
1b
Me
Me
Et
Me
Et
Bu
Ac
Pr
Bn
Et
Pr
Pr
isoprenoid
isoprenoid
H
S
143
>95
>351
222
94
>15
63
6
7
>60
37
>427
>142
>633
>424
146
70
153
13
14
195
150
64
>624
568
>522
>408
127
>350
68
256
182
>633
247
62
1ab
6a
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Me
Et
S
O
O
O
O
NH
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
56
30
6b
hexyl
NA
6c
decyl
6d
decyl
13
60
13
decyl
7
3
0.5
2
NA
20
15
hexadecyl
hexadecyl
29
16
32
50
17
-CH2)2O(CH2)2O(CH2)5CH3
119
2
NA
NA
NA
NA
NA
NA
NA
10
18
-(CH2)6OTBS
-(CH2)6OH
H
1
88
19
157
>347
233
>290
195
139
153
40
64
23a
23b
23c
23d
24a
24b
24c
24d
24e
24f
24g
24h
24i
24j
24k
25a
25b
26a
26b
27
Me
Et
Pr
>624
357
288
408
112
194
190
171
62
H
H
Bn
Me
Me
Me
Me
Me
Et
H
hexyl
octyl
10
geranyl
decyl
hexadecyl
hexyl
octyl
decyl
hexadecyl
decyl
decyl
H
H
decyl
hexadecyl
decyl
45
36
68
28
30
25
55
61
195
165
54
71
157
97
47
21
132
>568
6
153
130
8
5
Et
54
NA
40
Et
15
Et
19
43
65
Pr
10
56
55
Bn
Me
Me
Me
Me
Bu
50
64
70
>316
72
>568
164
72
NA
30
decyl
Et
Et
Me
65
15
35
49
77
40
71
60
a NA ) no activity. Data for compounds 23-27 against P. falciparum, T. cruzi, and T. b. rhodesiense were reported previously and
were included for comparative purposes. The inhibition data for 23-27 against pfKASIII are reported here for the first time. b Compound
1 is synthetic thiolactomycin prepared in our laboratories; compound 1a is commercial thiolactomycin purchased from Sigma. c The
percentage inhibition of MBP-pfKASIII at an inhibitor concentration of 100 µM.
whole organism (in this case P. falciparum) there are
further factors that complicate the SAR, such as uptake
of compounds into cells and their metabolism.
of the heteroatom in the TLM ring (Table 1). Interest-
ingly, in the case of the Escherichia coli KAS1 structure,
the sulfur of the thiolactone ring does not appear to
make any specific interactions with the active site.25
Oxygen derivatives with longer alkyl chains at the C5
position lead to an increase in activity (6a-c) as with
the analogous sulfur compounds18 but were less active
than the corresponding sulfur analogues (23b, 24a,
24h).
Owing to synthetic restraints, the synthesis of the
nitrogen heterocycle 13 required the presence of an
acetyl group at the C3 position of the ring. Earlier
studies have shown that C3 acetyl analogues of TLM
There are currently no crystal structures available for
any of the Plasmodium enzymes to assist the design
process. Furthermore, there are no structures currently
available for any KASIII in complex with TLM. How-
ever, there are crystal structures for various plant and
bacterial enzymes, which may give some guidance to the
design process, although of course care must be taken
when interpreting data from these structures.
(a) Variation of the Heteroatom in the Five-
Membered Ring. We decided to investigate variations

5936 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19
Jones et al.
Table 2. Effect of 3,3-Disubstituted Compounds on Parasite Growth and Inhibition of P. falciparum KASIII
P. falc
IC50 (µM)
T. cruzi
IC50 (µM)
T. brucei
IC50 (µM)
L. don. axenic
IC50 (µM)
% inhib
compd
R1
R2
R3
pfKASIIIa
21a
21b
21c
21d
21e
Me
Me
Pr
H
allyl
62
26
19
9
>488
55
79
157
9
no activity
5
no activity
90
no activity
decyl
decyl
H
allyl
allyl
geranyl
geranyl
47
82
12
>66
Pr
21
>66
55
Pr
decyl
77
>200
a The percentage inhibition of MBP-pfKASIII at an inhibitor concentration of 100 µM.
Table 3. Effect of 4-OH Substituted Compound on Parasite Growth and Inhibition of P. falciparum KASIII
P. falc
IC50 (µM)
T. cruzi
IC50 (µM)
T. brucei
IC50 (µM)
L. don. axenic
IC50 (µM)
% inhib
compd
R1
R2
R3
pfKASIIIa
22a
22b
22c
22d
22e
22f
Me
Pr
Pr
Pr
Pr
Pr
decyl
decyl
decyl
H
decyl
decyl
allyl
allyl
Bn
6
1
30
80
167
14
>223
9
149
64
5
66
>74
100
7
no activity
no activity
no activity
10
4
13
Me
45
3
31
359
14
64
-(CH2)6OTBS
-(CH2)6OH
36
5
a The percentage inhibition of MBP-pfKASIII at an inhibitor concentration of 100 µM.
with C5 aryl or alkyl functionality displayed effective
activities against Staphylococcus aureus and Pasteurella
multocida.26 Analogue 13 shows a 2-fold increase in
activity (IC50 ) 63 µM) over TLM 1 (IC50 ) 143 µM)
against P. falciparum in vitro (Table 1).
tions within the active site tunnel and, hence, improve
inhibition of growth if the condensing enzymes were key
targets. Indeed, alkylation of the hydroxyl group (ana-
logues 22a-f) led to an increase in activity against the
malaria parasite compared to TLM (Table 3). Our most
active compounds belong to this series (22b, 22e). A
variety of substituents on the hydroxyl group was
tolerated, but the presence of a hydrophobic substituent
at the 5-position was important.
(e) Activity against Trypanosomatid Parasites.
All our compounds were also assayed in vitro against
the Trypanosoma brucei rhodesiense parasite, which is
the causative agent of human African trypanosomiasis.
Thiolactomycin has been identified as a promising lead
for antitrypanosomal drug development because it
inhibits trypanosomal myristate synthesis in vitro with
a reported IC50 of ∼150 µM.27 Previously, we have
shown that analogues of TLM demonstrated improved
inhibition of the T. brucei parasite with the best
(b) Variation of the C5 Side Chain Functional-
ity. To reduce the lipophilic nature of the analogues,
we decided to increase the number of hydrogen bond
donors/acceptors within the compounds, as either ether
linkages (17) or a hydroxyl group (19), but neither
modification showed advantage over TLM. However, as
found previously, lipophilic substituents at the C5
position gave improved activity over TLM (15, 16, 18).
(c) Addition of a Second Substitutent on the
3-Position. Recently, Douglas et al.24 reported effective
inhibition by 3-alkylated 4-ketothiolactone analogues of
TLM against M. tuberculosis H37Rv. The majority of
our analogues (21a-d) containing the 4-ketothiolactone
ring showed improved inhibition over TLM against the
malaria parasite (Table 2), although a lipophilic sub-
stituent at either the 3- or 5-position was required for
improved activity.
(d) Alkylation of the 4-Hydroxyl Group. The fact
that the 4-ketothiolactones showed reasonable inhibi-
tion toward P. falciparum led us to question the influ-
ence the hydroxyl group has toward activity. Studies
on the interactions of TLM with KAS I from E. coli25
suggest the hydroxyl group at the C4 position binds to
amino acid residues 270 and 305 through water-assisted
hydrogen bonding. The water molecules are positioned
at the base of the active site tunnel that would incor-
porate the malonyl-ACP substrate and the phospho-
pantetheine arm of ACP; similar features may possibly
be found in P. falciparum FAS condensing enzymes such
as the KASIII structure. We hoped that modification
at the C4 hydroxyl group would exploit possible interac-
analogue showing a 42-fold increase in activity (IC50
)
6 µM) compared to TLM (IC50 ) 256 µM in our assays).18
Once again, the majority of our compounds showed
increased growth inhibition of T. brucei parasite com-
pared to TLM (Tables 1-3). Analogue 18 registered the
most notable increase in activity with an IC50 of 2 µM
(Table 1). The most active analogue (22b) against the
malaria parasite also showed improved inhibition against
T. brucei, with an IC50 of 14 µM (Table 3).
Thiolactomycin 1 showed no in vitro activity (IC50
>
427 µM) against the causative organism of Chagas
disease, T. cruzi (Table 1). However, a number of the
analogues did show some improvement in inhibition
toward the parasite. This was especially true for ana-
logues 15 and 22c, both of which showed IC50 values of
13 µM (Tables 1 and 3), a considerable improvement
compared to TLM.

Analogues of Thiolactomycin
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19 5937
Figure 3. Incorporation of radiolabel with varying amounts
of MBP-pfKASIII.
Figure 2. Production of MBP-pfKASIII. (A) A sample was
removed from the culture before the addition of 0.4 mM IPTG
(0 h), lane 1, and at 16 h postinduction, lane 2. Soluble (lane
3) and insoluble (lane 4) fractions from this 16 h sample were
prepared by sonication of the cell suspension, followed by
separation of soluble and insoluble fractions by centrifugation
as described in the Experimental Section. The induced MBP-
pfKASIII, expected size of 79 kDa, is indicated. (B) Sample
derived following affinity chromatography. The proteins con-
tained in each sample were separated by SDS-PAGE (12.5%
acrylamide) and visualized by staining with Coomassie blue.
Figure 4. Determination of IC50 for thiolactomycin.
Several compounds were also tested in vitro against
axenic L. donovani amastigotes. Encouragingly, a few
compounds showed good activity against the parasite.
Analogues 13, 16, and 18 all showed IC50 values
between 1 and 3 µM. However, the best compound (15)
with a hexadecyl side chain at the C5 position and a
propyl substituent at C3 registered an IC50 of 0.5 µM
(Table 1).
Preparation of Enzyme. To investigate the mode
of action of TLM analogues further, we decided to isolate
one of the possible target sites for activity, the P.
falciparum KASIII condensing enzyme. We could then
evaluate if there was any correlation between inhibition
of the enzyme and inhibition of the growth of P.
falciparum. The KASIII protein was obtained as a
fusion protein with maltose binding protein (MBP-
pfKASIII) from a clone in E. coli, following a 16 h
induction. The protein was present mainly in the
insoluble fraction of the E. coli cells (Figure 2A).
However, sufficient fusion protein (along with some free
MBP) was obtained from the soluble fraction following
affinity chromatography for subsequent enzyme assay
(Figure 2B).
Attempts to separate the MBP from the pfKASIII
using the vector encoded factor Xa proteinase cut site
located between the two regions proved to be unsuc-
cessful, presumably because of inaccessibility of the
cleavage site. However, assays of the fusion protein
indicated condensing enzyme activity for the MBP-
pfKASIII protein. To determine a suitable concentration
of enzyme for use in inhibition assays, the amount of
MBP-pfKASIII in the assays was varied while keeping
the concentrations of all other components constant
(Figure 3). It can be seen from this experiment that the
incorporation increases in a linear fashion up to about
600 ng of MBP-pfKASIII. Assessment of enzyme activity
at a range of concentrations below 600 ng showed a
range of 74-93 pmol min-1 µg-1 protein. For further
assays, 500 ng of fusion protein was used to ensure
sufficient radioactive incorporation into product without
working outside the linear range of the assay.
The initial inhibitor assay was performed using
racemic thiolactomycin 1a (Sigma, Poole, U.K.) at a
range of concentrations and with a final concentration
of DMSO of 2%. This DMSO concentration was shown
to have no effect on enzyme activity (results not shown).
These experiments indicated an IC50 for the racemic
thiolactomycin under these conditions of approximately
200 µM (Figure 4).
Enzyme Assays. In screening our thiolactomycin
derivatives, inhibitor concentrations of 100 µM (at which
TLM 1a gives approximately 30% inhibition) were used
in order to assess improvements in activity over the
parent compound. A number of the analogues showed
increased inhibition of MBP-pfKASIII activity compared
to commercial TLM 1a (Table 1). Notably, as with the
in vitro results against the malaria parasite, the deriva-
tives containing the longer alkyl groups at the C5
position tended to show improved activity against the
enzyme (Table 1). Analogue 24e, with a hexadecyl side
chain at the C5 position, shows an inhibitory activity
of 55%. Likewise, the geranyl derivative 24c also shows
improved activity (45%) compared to TLM (30%).
From the in vitro results against the malaria parasite
we had observed that increasing the chain length at the
C3 position had a positive effect on efficacy. In the case
of the enzyme assays, when there was a hydrophobic
substituent in the 5-position, hydrophobic substituents
at the 3-position also showed inhibition comparable to
or greater than that of TLM (see compounds 24e, 24i,
15, 16, which have a hexadecyl substituent at the
5-position, and compounds 24h, 24j, 27, 24k, which
have a decyl substituent at the 5-position). For the
benzyl derivative 24k, an IC50 against MBP-PfKASIII
of 50 µM was determined, showing a 4-fold increase in
potency compared to TLM (200 µM). This change in

5938 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19
Jones et al.
activity is similar to that observed against P. falciparum
(IC50 ) 50 µM for analogue 24k; IC50 ) 143 µM for
TLM).
of hydrophilic functionality within the hydrophobic side
chain at the C5 position appeared to diminish activity
relative to compounds bearing saturated aliphatic side
chains. The 4-ketothiolactones showed enhanced inhibi-
tion of the malaria parasite compared to TLM. However,
it was alkylation of the C4 hydroxyl group that brought
about the most significant increases in activity, with the
best compound (22b) showing a 143-fold increase in
activity (IC50 ) 1 µM) compared to TLM.
The inhibitory effects of our compounds against the
first condensing enzyme identified in P. falciparum
(MBP-pfKASIII) are also reported. A number of com-
pounds showed improved inhibition of the enzyme
compared to commercial TLM 1a, which produced 30%
inhibition at 100 µM. As with the in vitro results against
the malaria parasite, generally, compounds bearing the
longer hydrophobic side chains at the C5 position tended
to exhibit increased inhibition of pfKASIII compared to
TLM 1a. The presence of a benzyl moiety at C3
(analogue 24k) has a further positive effect toward
inhibition of the enzyme (70%; IC50 ) 50 µM). Varying
the heteroatom within the ring system resulted in mixed
levels of inhibition, with the tetronic acid 6d showing
60% inhibition but the pyrole derivative 13 exhibiting
no activity against pfKASIII. Most other analogues
showed weak or negligible inhibition of the enzyme. The
4-ketothiolactone 21d proved to be the most effective,
inhibiting 90% of the enzyme activity (IC50 ) 18 µM).
The tetronic acid derivative (6b) showed suppressed
activity against MBP-pfKASIII (Table 1), whereas 6d
with the butyl substituent at C3 inhibited 60% of the
enzyme activity. The nitrogen analogue 13 registered
no activity against the enzyme. No activity was observed
for the analogues in which the long aliphatic side chain
at C5 had been functionalized (analogues 17-19),
implying that the main mode of action of these series
of compounds is not inhibition of MBP-pfKASIII.
Despite showing encouraging inhibition of cultures of
P. falciparum compared to TLM, the 4-ketothiolactones
(21a-e) mainly showed negligible inhibitory effects
against MBP-pfKASIII (Table 2). However, the most
active compound against the malaria parasite (21d, IC50
) 9 µM) for this particular series of analogues also
showed strong (90%) inhibition of the enzyme at 100
µM. For the best compound we have produced against
MBP-PfKASIII, an IC50 for enzyme inhibition was
determined as 18 µM, an increase in potency of ap-
proximately 10-fold compared to TLM (200 µM). In
contrast, the 4-OH substituted compounds (22a-f)
showed negligible inhibition of the enzyme, despite some
of the compounds showing potent inhibition of the
parasite (Table 3). These inhibitors (21a-e and 22a-
f) thus appear to target another enzyme or alternative
pathways.
When the inhibition of the MBP-pfKASIII and the
inhibition of growth of P. falciparum in cell culture are
compared, there is no general direct correlation, al-
though within a certain series of compounds there is
some correlation. This suggests that inhibition of the
MBP-pfKASIII is not the primary mode of action of
these compounds. Indeed, from studies of type II FAS
enzymes from bacteria25 or plants,19 the KASIII com-
ponent is the least sensitive of the condensing enzymes
toward TLM or its analogues.19 Furthermore, the com-
pounds did not show significant inhibition of KAS1/2.
Our data would suggest, therefore, that other enzymes
or other proteins are more important for the activity of
TLM analogues in P. falciparum. It is possible that for
some series of compounds (e.g., those substituted at the
C5 position with long alkyl chains) inhibition of
pfKASIII could contribute to their efficacy. However,
detailed evaluation of modes of action requires identi-
fication of other possible enzyme targets and detailed
studies of the uptake and metabolism of the analogues
in P. falciparum.
In addition to work with P. falciparum, all compounds
were assayed against two other parasitic protozoa, T.
cruzi and T. brucei. Varied activities were found against
the T. brucei and T. cruzi parasites with the best
compounds registering IC50 values in the low-micromo-
lar range. A series was also tested in vitro against L.
donovani, the causative organism of leishmaniasis, of
which analogue 15 showed good activity (IC50 ) 0.5 µM).
Thus, our study has further emphasized the effective-
ness of thiolactomycin 1 analogues as active compounds
against the parasites that cause malaria, African try-
panosomiasis, Chagas disease, and leishmaniasis. We
hope also that the recognition of new inhibitors such as
21d, which shows good activity against both the
pfKASIII enzyme and growth of P. falciparum, will
The lack of general correlation between inhibition of
PfKASIII and inhibition of the growth of P. falciparum
led us to investigate the activity of these compounds
against the P. falciparum KAS1/2. This enzyme was
cloned and overexpressed, and assays were carried out.
None of the compounds showed significant inhibition
of the PfKAS1/2. (The cloning, characterization, and
assay data will be published separately.) This indicates
that the inhibitory activity of these compounds on the
growth of P. falciparum is not due to inhibition of
PfKAS1/2.
Conclusion
Following from our previous SAR studies,18 we have
reported the design and synthesis of further thiolacto-
mycin analogues as agents against P. falciparum, the
causative organism of malaria that produces most
fatalities. The compounds were designed with the inten-
tion of targeting the type II FAS utilized for fatty acid
biosynthesis. Compounds showed complex SAR data
against both the parasite and the recombinant MBP-
pfKASIII enzyme. There was a weak correlation be-
tween antiparasitic activity and enzyme inhibition,
suggesting that inhibition of this enzyme is not the
primary mode of action. Indeed, it can be noted that
effective analogues appeared to be significantly more
potent toward growth of P. falciparum than toward
enzyme inhibition.
When considering inhibition of the parasite growth,
several analogues showed inhibitory effects greater than
thiolactomycin 1. Despite showing increased activity
compared to TLM, a variation of heteroatom within the
ring system did not significantly increase the efficacy
of the compounds compared to analogous sulfur deriva-
tives from previous studies.18 Likewise, the introduction

Analogues of Thiolactomycin
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19 5939
hexanes). Spectral data for compounds 15-18 is provided in
the Supporting Information.
prove to be valuable in designing further chemicals for
controlling malaria.
4-Hydroxy-5-(6-hydroxyhexyl)-5-methyl-3-propyl-2(5H)-
thiophenone (19). Hydrochloric acid (10 M, 1.0 mL, 10.03
mmol) was added dropwise to the silyl ether 18 (0.40 g, 1.03
mmol) in methanol (6 mL) at ambient temperature. The
reaction mixture was stirred vigorously for 1 h, after which
time the solvent was removed in vacuo. The crude residue was
purified using flash column chromatography (0-5% methanol
in dichloromethane) to give the title compound 19 as a pale-
Experimental Section
Melting points were determined using a Gallenkamp melt-
ing point apparatus and are uncorrected. 1H and 13C NMR
spectra were recorded on a Bruker Advance DPX300 spec-
trometer operating at 300 and 75 MHz, respectively, with
tetramethylsilane as internal standard, using deuterated
chloroform purchased from Goss unless stated otherwise. Low-
resolution mass spectra, i.e., electrospray (ES), were recorded
using a Fisons VG Platform II spectrometer. High-resolution
spectra were obtained on a VG ZAB spectrometer from the
EPSRC Mass Spectrometry Service at Swansea University,
U.K. Microanalyses were obtained from the analytical and
chemical consultancy services Medac Ltd. All reactions were
performed in predried apparatus under an atmosphere of
nitrogen unless otherwise stated. Solvents and reagents were
purchased from chemical companies and used without further
purification. Dry solvents were generally purchased in sure
sealed bottles stored over molecular sieves. Thin-layer chro-
matography (TLC) was performed on Merck silica gel 60F254
plates. Column chromatography was carried out using Fisons
matrix silica 60 (35-70 µm).
Cyclization. General Procedure A for Compounds 6a-
d. Potassium hydroxide (2.5 equiv) in water (20 mL) was added
to the bromide 5 (1.0 equiv) at 0 °C. The resulting solution
was then vigorously stirred at ambient temperature for 15 h.
The aqueous layer was washed with diethyl ether (2 × 30 mL)
and acidified to pH 1 with the addition of 2 M HCl (∼20 mL).
The aqueous layer was then extracted with diethyl ether (3 ×
40 mL), and the combined organic solutions were washed with
brine (100 mL), then dried over magnesium sulfate. The
solvent was removed in vacuo. The crude residue was purified
by flash column chromatography (5-30% ethyl acetate in
hexanes). Spectral data for compounds 6a-d are provided in
the Supporting Information.
1-(5-Decyl-4-hydroxy-2-oxo-2,5-dihydro-1H-3-pyrrolyl)-
1-ethanone (13). Amide 12 (0.24 g, 0.76 mmol) dissolved in
methanol (2 mL) was added dropwise to a stirred solution of
sodium methoxide (41 mg, 0.76 mmol) in dry methanol (5 mL)
at ambient temperature. The resulting solution was heated
to reflux and stirred for 15 h. The reaction mixture was allowed
to cool, and the solvent was evaporated. The crude residue was
dissolved in water (∼10 mL), and the aqueous layer was
acidified to pH 1 with 2 M HCl (10 mL). The aqueous layer
was extracted with diethyl ether (3 × 10 mL). The organic
solutions were washed with water (2 × 20 mL) and brine (2 ×
20 mL), then dried and evaporated. Column chromatography
(0-30% ethyl acetate in hexanes) of the crude residue gave
the desired tetramic acid 13 as a colorless solid (20 mg, 10%),
mp 100-102 °C; 1H NMR (CDCl3) δH 0.93 (3H, t, J ) 6.9, 15-
CH3), 1.31 (16H, m, 8 × CH2), 1.59-1.70 (1H, m, CH), 1.85-
1.92 (1H, m, CH), 2.52 (3H, s, CH3), 3.87 (1H, dd, J ) 7.6 and
4.1, 5-CH), and 6.06 (1H, s, NH); 13C NMR δC 14.5 and 19.9
(both CH3), 23.0, 25.6, 29.7, 29.8, 29.9, 29.9, 32.3 (all CH2),
62.8 (5-CH), 101.9 (3-C), 175.6 (4-C), 185.4 (CO), and 196.0
(CO); MS (ES-) m/z 280.0 (M - H,- 100%). Anal. (C16H27O3N)
C, H, N.
Alkylation. General Procedure B for Compounds 15-
18. Lithium bis(trimethylsilyl)amide (1.0 M solution in THF,
2.0 equiv) was added dropwise to a stirred solution of thiolac-
tone 14 (1.0 equiv) in dry THF (6 mL) at -78 °C. After the
mixture was stirred for 0.5 h at -78 °C, the halide (1.0 equiv)
was added dropwise. After being stirred for a further 0.5 h,
the mixture was allowed to warm to ambient temperature and
stirred overnight. The reaction was quenched with the addition
of saturated aqueous ammonium chloride (∼10 mL), and the
organic layer was separated. The aqueous layer was extracted
with diethyl ether (3 × 10 mL). The organic layers were
washed with water (3 × 20 mL) and brine (40 mL) and dried
over anhydrous magnesium sulfate, and the solvent was
removed in vacuo. The crude residue was purified by flash
column chromatography (0-30% gradient of ethyl acetate in
1
yellow oil (50 mg, 18%); H NMR δH 0.83 (3H, t, J ) 7.3, 3′-
CH3), 1.31-1.47 (10H, m, 5 × CH2), 1.62 (3H, s, CH3), 1.82-
1.89 (2H, m, 1′-CH2), 2.15 (2H, t, J ) 7.4, 6-CH2), and 3.51
(2H, t, J ) 6.4, 11-CH2); 13C NMR δC 14.3 (CH3), 22.5 (CH2),
25.4 (CH3), 26.1, 26.8, 27.1, 27.3, 29.6, 33.8, 39.3 (all CH2),
57.9 (5-C), 62.8 (11-CH2), 115.5 (3-C), 180.8 (4-C), and 194.3
(2-CO); MS (ES+) m/z 273.2 (M + H,+ 100%); HRMS (ES+) (M
+ H)+ C14H25O3S requires 273.1519, found 273.1517. Anal.
(C14H24O3S‚0.05H2O) C, H, N.
Alkylation. General Procedure C for Compounds 21a,
21b/22a, 21c/22b, 21d, 21e, 22c-e. Thiophenone 20 (1.0
equiv) was added portionwise to a stirred suspension of sodium
hydride (1.2 eqiuv) in dry THF (10 mL) at ambient tempera-
ture. After the mixture was stirred for 0.5 h, the halide (1.1
equiv) was added dropwise. The resulting solution was then
heated to reflux and stirred for 15-20 h. The mixture was
allowed to cool, and the reaction was quenched with the
addition of aqueous saturated ammonium chloride (10 mL).
The organic layer was separated, and the aqueous layer was
extracted with diethyl ether (3 × 10 mL). The organic layers
were washed with water (2 × 20 mL) and brine (2 × 20 mL)
and dried over anhydrous magnesium sulfate, and the solvent
was removed in vacuo. The crude residue was purified by flash
column chromatography (0-20% ethyl acetate in hexanes).
Spectral data for compounds 21a, 21b/22a, 21c/22b, 21d, 21e,
22c, 22d, 22e are provided in the Supporting Information.
4-[(6-Hydroxyhexyl)oxy]-5-methyl-3-propyl-2(5H)-
thiophenone (22f). Hydrochloric acid (0.33 mL, 10 M, 3.36
mmol) was added dropwise to a stirred solution of the silyl
ether 22e (0.13 g, 0.33 mmol) in methanol (2 mL) at ambient
temperature. The resulting solution was allowed to stir for 0.5
h. The methanol was then removed in vacuo, and the resulting
residue was dissolved in diethyl ether (∼10 mL). Water (10
mL) was added, and the aqueous layer was extracted with
diethyl ether (3 × 5 mL). The organic solutions were washed
with water (3 × 10 mL) and brine (3 × 10 mL), then dried
and evaporated to give the title compound 22f as a colorless
oil (38 mg, 42%); 1H NMR δH 0.92 (3H, t, J ) 7.0, CH3), 1.37-
1.48 (6H, m, 3 × CH2), 1.54-1.57 (2H, m, CH2), 1.58 (3H, d, J
) 7.1, CH3), 1.68-1.77 (2H, m, CH2), 2.24 (2H, t, J ) 6.9, CH2),
3.65 (2H, t, J ) 7.0, CH2OH), 4.11 (1H, q, J ) 7.1, 5-CH), and
4.17-4.26 (2H, m, OCH2); 13C NMR δC 14.2 (CH3), 20.6, 22.3
(both CH2), 25.8 (CH3), 25.9, 30.2, 32.9, 41.9 (all CH2), 51.1
(5-CH), 63.0 (CH2OH), 71.1 (OCH2), 119.9 (3-C), 179.1 (4-C),
and 196.1 (2-CO); MS (ES+) m/z 295.1 (M + Na,+ 100%); HRMS
(ES+) (M + Na)+ C14H24O3NaS requires 295.1344, found
295.1342. Anal. (C14H24O3S) C, H, N.
Biological Assays. Cloning the pfkasIII Gene. A plas-
mid containing the full length gene encoding pKASIII was
kindly provided by Dr. Sean Prigge (Johns Hopkins School of
Public Health, Baltimore, MD) for use as a PCR template. In
earlier studies, Prigge’s group had demonstrated that when
produced in E. coli as a maltose binding protein (MBP) fusion,
the full-length protein was insoluble whereas a truncated
version of the gene, lacking the sequences encoding the
bipartite signal peptide, was produced in soluble form.28 As a
result, forward (GGTGGTGAATTCCATGTCCGGAGTAA-
AATAATAGGAC) and reverse (GGTGGTGTCGACTTAATATT-
TAAGTATAACGCATCCATATG) oligonucleotide primers (with
EcoRI and SalI restriction sites incorporated, respectively (in
italics)) were used to generate an equivalent truncated form
of the gene. PCR was carried out using the proofreading Pfu
turbo DNA polymerase (Stratagene, Amsterdam, The Neth-
erlands) under the following conditions: 95 °C, 45 s; 55 °C,

5940 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19
Jones et al.
45 s; 65 °C, 2.5 min for 30 cycles followed by a final extension
period of 10 min at 65 °C. To facilitate cloning of the resultant
amplicon (∼1000 base pairs) into the pGEM-T vector (Prome-
ga, Southampton, U.K.), a further two cycles of amplification
were carried out after the addition of Taq polymerase (Sigma,
Poole, U.K.), which, in a template-independent manner, adds
the A overhangs necessary for cloning into this vector. After
ligation into pGEM-T, a colony containing the gene was
identified by PCR screening using M13 forward and reverse
primers. The inserted DNA was sequenced to confirm that no
mutations had occurred, and the insert was subsequently
excised with EcoRI and SalI and recloned into the MBP
expression vector pMALc2x (New England Biolabs, Beverly,
MA) that had previously been cut with the same enzymes and
treated with shrimp alkaline phosphatase (Roche, Basel,
Switzerland). Clones containing the insert in the correct
orientation were identified by DNA sequencing and were
transferred to E. coli BL21 (DE3) codon + RIL cells (Strat-
agene, Amsterdam, The Netherlands) for protein production.
Production of Recombinant MBP-pfKASIII Fusion
Protein. LB medium (2l) containing ampicillin (100 µg/mL)
and chloramphenicol (34 µg/mL) was inoculated with an
overnight culture of the above cells containing the pfkasIII
clone. The MBP-pfKASIII fusion protein was induced es-
sentially as described in Waters et al.,28 by the addition of
isopropyl â-D-thiogalactopyranoside to a final concentration
of 0.4 mM followed by incubation at 20 °C for a further 16 h.
At this stage, cell pellets could be stored at -20 °C until
required, with no adverse effect on the purification of the MBP-
pfKASIII protein. The harvested cells were then resuspended
in 40 mL of column buffer (20 mM Tris-HCl, pH 7.4, 200 mM
NaCl, 1 mM EDTA). Lysis of the cells was achieved by three
rounds of freeze/thawing, and the intracellular contents were
disrupted by sonication (60% amplitude, 30 s) using a Soni-
probe sonicator (Lucas Dawe Ultrasonics Ltd, London, U.K.).
The soluble fraction of the lysed cells was collected by
centrifugation (20000g, 20 min, 4 °C) and filter-sterilized to
remove any remaining intact cells. In an attempt to reduce
the amount of proteolysis, protease inhibitor cocktail (Sigma
Chemicals Ltd., Poole, Dorset, U.K.) was added in accordance
with the manufacturer’s instructions and the sample was
stored on ice prior to further processing. Soluble MBP-
pfKASIII fusion protein was purified by affinity chromatog-
raphy on amylose resin (New England Biolabs, Beverly, MA).
Typically, 1 mg of purified, soluble MBP-pfKASIII protein
suitable for enzymatic studies was produced from each liter
of culture.
Assay of KASIII Enzyme Activity and Inhibitor Stud-
ies. The KASIII condensing enzyme activity was assayed using
a filter disk assay.25,29 The final assay contained 100 mM NaH2-
PO4 buffer, pH 6.6, 25 µM E. coli acyl carrier protein (ACP), 1
mM â-mercaptoethanol, 1 µg of FabD enzyme from E. coli,
65 µM malonyl-CoA, 500 ng of MBP-pfKASIII, and 45 µM
[1-14C]acetyl-CoA in a final 40 µL reaction volume. To ensure
complete reduction of ACP, it was preincubated with the
â-mercaptoethanol and the sodium phosphate buffer at 37 °C
for 30 min. The remaining components were then added to
the reduced ACP mix. Inhibitors were dissolved in 20% DMSO,
and 2 µL was added to the reaction tubes. Control reactions
contained 2% DMSO, which had no detectable effect on enzyme
activity.
The reaction was started by the addition of 2 µL of MBP-
pfKASIII, followed by incubation at 37 °C for 15 min. To stop
the reaction, 35 µL of the assay was spotted onto a Whatman
21 mm filter disk. Each filter disk was washed with gentle
shaking in 20 mL of successive solutions of 10% trichloroacetic
acid (TCA), 5% TCA, and 1% TCA at 4 °C for 20 min each. To
establish the total number of counts added to each tube, a
control reaction was spotted onto a filter disk but was not
washed in TCA. Filter disks were dried and placed in scintil-
lation vials containing 3 mL of scintillation cocktail (Fisher,
Loughborough, U.K.). The decays per minute were measured
using a Beckman 1209 Rackbeta liquid scintillation counter
(EG&G Wallac, Milton Keynes, U.K.).
Growth of Organisms (Parasites). Plasmodium falci-
parum. In vitro activity against erythrocytic stages of P.
falciparum was determined using a [3H]hypoxanthine incor-
poration assay,30,31 using the chloroquine and pyrimethamine
resistant K1 strain and the standard drugs chloroquine (Sigma
C6628) and artemisinin (arteannuin, qinghaosu; Sigma 36,-
159-3). Compounds were dissolved in DMSO at 10 mg/mL and
added to parasite cultures incubated in RPMI 1640 medium
without hypoxanthine, supplemented with HEPES (5.94 g/L),
NaHCO3 (2.1 g/L), neomycin (100 U/mL), AlbuMAX (5 g/L),
and washed human red cells A+ at 2.5% hematocrit (0.3%
parasitemia). Serial doubling dilutions of each drug were
prepared in 96-well microtiter plates and incubated in a
humidified atmosphere at 37°C; 4% CO2, 3% O2, 93% N2.
After 48 h, 50 µL of [3H]hypoxanthine ()0.5 µCi) in medium
was added to each well of the plate. The plates were incubated
for a further 24 h under the same conditions. The plates were
then harvested with a Betaplate cell harvester (Wallac, Zurich,
Switzerland), and the red blood cells were transferred onto a
glass fiber filter and then washed with distilled water. The
dried filters were inserted into a plastic foil with 10 mL of
scintillation fluid and counted in a Betaplate liquid scintilla-
tion counter (Wallac, Zurich, Switzerland). IC50 values were
calculated from sigmoidal inhibition curves using Microsoft
Excel.
Trypanosoma cruzi. Rat skeletal myoblasts (L-6 cells)
were seeded in 96-well microtiter plates at 2000 (cells/well)/
100 µL in RPMI 1640 medium with 10% FBS and 2 mM
L-glutamine. After 24 h, 5000 trypomastigotes of T. cruzi
(Tulahuen strain C2C4 containing the â-galactosidase (Lac Z)
gene) were added in 100 µL per well with 2× of a serial drug
dilution. The plates were incubated at 37 °C in 5% CO2 for 4
days. Then the substrate CPRG/Nonidet was added to the
wells. The color reaction, which developed during the following
2-4 h, was read photometrically at 540 nm. From the
sigmoidal inhibition curve, IC50 values were calculated.
Trypanosoma brucei rhodesiense. Minimum Essential
Medium (50 µL) supplemented according to Baltz et al.32 with
2-mercaptoethanol and 15% heat-inactivated horse serum was
added to each well of a 96-well microtiter plate. Serial drug
dilutions were added to the wells. Then 50 µL of trypanosome
suspension (T. b. rhodesiense STIB 900) was added to each
well and the plate was incubated at 37 °C under a 5% CO2
atmosphere for 72 h. Resazurin (12.5 mg in 100 mL of distilled
water) was then added to each well, and incubation was
continued for a further 2-4 h (Raz et al.33). The plates are
read in a microplate fluorescence scanner (Spectramax Gemini
XS by Molecular Devices) using an excitation wavelength of
536 nm and an emission wavelength of 588 nm. From the
sigmoidal inhibition curve, IC50 values were calculated.
L. donovani. Amastigotes of Leishmania donovani strain
MHOM/ET/67/L82 were grown in axenic culture at 37 °C in
SM medium34 at pH 5.4 supplemented with 10% heat-
inactivated fetal bovine serum under an atmosphere of 5% CO2
in air. An amount of 100 µL of culture medium with 105
amastigotes from axenic culture with or without a serial drug
dilution was seeded in 96-well microtiter plates. Seven 3-fold
dilutions were used covering a range from 30 to 0.041 µg/mL.
Each drug was tested in duplicate, and each assay was
repeated at least once. After 72 h of incubation, the plates were
inspected under an inverted microscope to ensure growth of
the controls and sterile conditions. An amount of 10 µL of
Alamar Blue (12.5 mg of resazurin dissolved in 100 mL of
distilled water) was then added to each well, and the plates
were incubated for another 2 h. Then the plates were read
with a Spectramax Gemini XS microplate fluorometer (Mo-
lecular Devices Cooperation, Sunnyvale, CA) using an excita-
tion wavelength of 536 nm and an emission wavelength of 588
nm. Data were analyzed using the software Softmax Pro
(Molecular Devices Cooperation, Sunnyvale, CA). Decrease of
fluorescence ()inhibition) was expressed as percentage of the
fluorescence of control cultures and plotted against the drug
concentrations. From the sigmoidal inhibition curves, the IC50
values were calculated.

Analogues of Thiolactomycin
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 19 5941
(17) Prigge, S. T.; He, X.; Gerena, L.; Waters, N. C.; Reynolds, K. A.
The Initiating Steps of a Type II Fatty Acid Synthase in
Plasmodium falciparum Are Catalyzed by pfACP, pfMCAT, and
pfKASIII. Biochemistry 2003, 42, 1160-1169.
(18) Jones, S. M.; Urch, J. E.; Brun, R.; Harwood, J. L.; Berry, C.;
Gilbert, I. H. Analogues of Thiolactomycin as Potential Anti-
malarial and Anti-trypanosomal Agents. Bioorg. Med. Chem.
2004, 12, 683-692.
(19) Jones, A. L.; Herbert, D.; Rutter, A. J.; Dancer, J. E.; Harwood,
J. L. Novel Inhibitors of the Condensing Enzymes of the Type
II Fatty Acid Synthase of Pea (Pisum sativum). Biochem. J.
2000, 347, 205-209.
Acknowledgment. This investigation received fi-
nancial support from the Cardiff Partnership Fund. We
also acknowledge Dr. Sean Prigge (Johns Hopkins
School of Public Health, Baltimore, MD), for provision
of a full-length clone of pfKASIII, and Dr. Roland Lange
(Morphochem AG Basel, Basel, Switzerland), who pro-
vided the EcFabD plasmid, and finally, the EPSRC
National Mass Spectrometry Service Centre Swansea
for accurate mass spectrometry results.
(20) Waller, R. F.; Ralph, S. A.; Reed, M. B.; Su, V.; Douglas, J. D.;
Minnikin, D. E.; Cowman, A. F.; Besra, G. S.; McFadden, G. I.
A Type II Pathway for Fatty Acid Biosynthesis Presents Drug
Targets in Plasmodium falciparum. Antimicrob. Agents Chemoth-
er. 2003, 47, 297-301.
Supporting Information Available: Spectral data for
compounds 6a-d, 15-18, 21a-e, 22a-e and results from
elemental analysis. This material is available free of charge
via the Internet at http://pubs.acs.org.
(21) Svendsen, A. Boll, P. M. Halogenated â-Keto Esters as Starting
Materials for the Synthesis of Tetronic Acids. Tetrahedron. 1973,
29, 4251-4258.
(22) O’Donnell, M. J.; Polt, R. L. A Mild and Efficient Route to Schiff-
Base Derivatives of Amino-acids. J. Org. Chem. 1982, 47, 2663-
2666.
(23) Poncet, J.; Jouin, P.; Castro, B.; Nicolas, L.; Boutar, M.;
Gaudemer, A. Tetramic Acid Chemistry. 1. Reinvestigation of
Racemization during the Synthesis of Tetramic Acids via Dieck-
mann Cyclisation. J. Chem. Soc., Perkin Trans. 1 1990, 3, 611-
616.
(24) Douglas, J. D.; Senior, S. J.; Morehouse, C.; Phetsukiri, B.;
Campbell, I. B.; Besra, G. S.; Minnikin, D. E. Analogues of
Thiolactomycin: Potential Drugs with Enhanced Anti-mycobac-
terial Activity. Microbiology 2002, 148, 3101-3109.
(25) Price, A. C.; Choi, K. H.; Heath, R. J.; Li, Z. M.; White, S. W.;
Rock, C. O. Inhibition of Beta-Ketoacyl-acyl Carrier Protein
Syntheses by Thiolactomycin and Cerulenin. Structure and
Mechanism. J. Biol. Chem. 2001, 276, 6551-6559.
(26) Sakya, S. M.; Suarez-Contreras, M.; Dirlam, J. P.; O’Connell,
T. N.; Hayashi, S. F.; Santoro, S. L.; Kamicker, B. J.; George,
D. M.; Ziegler, C. B. Synthesis and Structure-Activity Relation-
ships of Thiotetronic Acid Analogues of Thiolactomycin. Bioorg.
Med. Chem. Lett. 2001, 11, 2751-2754.
(27) Morita, Y. S.; Paul, K. S.; Englund, P. T. Specialized Fatty Acid
Synthesis in African Trypanosomes: Myristate for CPI Anchors.
Science 2000, 288, 140-143.
(28) Waters, N. C.; Kopydlowski, K. M.; Guszczynski, T.; Wei, L.;
Sellers, P.; Ferlan, J. T.; Lee, P. J.; Li, Z.; Woodard, C. L.;
Shallom, S.; Gardner, M. J.; Prigge S. T. Functional Character-
ization of the Acyl Carrier Protein (PfACP) and Beta-Ketoacyl
ACP Synthase III (PfKASIII) from Plasmodium falciparum. Mol.
Biochem. Parasitol. 2002, 123 (2), 85-94.
(29) Tsay, J. T.; Oh, W.; Larson, T. J.; Jackowski, S.; Rock, C. O.
Isolation and Characterization of the Beta-Ketoacyl-acyl Carrier
Protein Synthase-III Gene (FABH) from Escherichia-coli K-12.
J. Biol. Chem. 1992, 267 (10), 6807-6814.
(30) Desjardins, R. E.; Canfield, C. J.; Haynes, D.; Chulay, J.
Quantitative Assesment of Anti-malarial Activity in Vitro by a
Semiautomated Microdilution Technique. Antimicrob. Agents
Chemother. 1979, 16, 710-718.
(31) Matile, H.; Pink, J. R. L. Plasmodium falciparum Malaria
Parasite Cultures and Their Use in Immunology. Immunological
Methods; Academic Press: San Diego, CA, 1990; pp 221-234.
(32) Baltz, T.; Baltz, D.; Giroud, C.; Crockett, J. Cultivation in a Semi-
Defined Medium of Animal Infective Forms of Trypanosoma-
brucei, Trypanosoma-equiperdum, Trypanosoma-evansi, Trypa-
nosoma-rhodesiense and T-gambiense. EMBO J. 1985, 4, 1273-
1277.
(33) Raz, B.; Iten, M.; Grether-Buhler, Y.; Kaminski, R.; Brun, R.
The Alamar Blue(R) Assay To Determine Drug Sensitivity of
African Trypanosomes (T-b-rhodesiense and T-b-gambiense) in
Vitro. Acta Trop. 1997, 68, 139-147.
References
(1) WHO. Weekly Epidemiol. Rep. 1997, 72, 269.
(2) White, N. J. Why is it that antimalarial drug treatments do not
always work? Ann. Trop. Med. Parasitol. 1998, 92, 449-458.
(3) Gardner, M. J.; Hall, N.; Fung, E.; White, O.; Berriman, M.;
Hyman, R. W.; Carlton, J. M.; Pain, A.; Nelson, K. E.; Bowman,
S.; Paulsen, I. T.; James, K.; Eisen, J. A.; Rutherford, K.;
Salzberg, S. L.; Craig, A.; Kyes, S.; Chan, M. S.; Nene, V.;
Shallom, S. J.; Suh, B.; Peterson, J.; Angiuoli, S.; Pertea, M.;
Allen, J.; Selengut, J.; Haft, D.; Mather, M. W.; Vaidya, A. B.;
Martin, D. M. A.; Fairlamb, A. H.; Fraunholz, M. J.; Roos, D.
S.; Ralph, S. A.; McFadden, G. I.; Cummings, L. M.; Subrama-
nian, G. M.; Mungall, C.; Venter, J. C.; Carucci, D. J.; Hoffman,
S. L.; Newbold, C.; Davis, R. W.; Fraser, C. M.; Barrell, B.
Genome Sequence of the Human Malaria Parasite Plasmodium
falciparum. Nature 2002, 419, 498-511.
(4) Florens, L.; Washburn, M. P.; Raine, J. D.; Anthony, R. M.;
Grainger, M.; Haynes, J. D.; Moch, J. K.; Muster, N.; Sacci, J.
B.; Tabb, D. L.; Witney, A. A.; Wolters, D.; Wu, Y. M.; Gardner,
M. J.; Holder, A. A.; Sinden, R. E.; Yates, J. R.; Carucci, D. J. A
Proteomic View of the Plasmodium falciparum life cycle. Nature
2002, 419, 520-526.
(5) Harwood, J. L. Recent Advances in the Biosynthesis of Plant
Fatty Acids. Biochim. Biophys. Acta 1996, 1301, 7-56.
(6) Clough, B.; Rangachari, K.; Strath, M.; Preiser, P. R.; Wilson,
R. Antibiotic Inhibitors of Organellar Protein Synthesis in
Plasmodium falciparum. Protist 1999, 150, 189-195.
(7) Ralph, S. A.; D’Ombrain, M. C.; McFadden, G. I. The Apicoplast
as an Antimalarial Drug Target. Drug Resist. Updates 2001, 4,
145-151.
(8) Jackowski, S. Rock, C. O. Acetoacetyl-acyl Carrier Protein
Synthase, a Potential Regulator of Fatty-Acid Biosynthesis in
Bacteria. J. Biol. Chem. 1987, 262, 7927-7931.
(9) Kohler, S.; Delwiche, C. F.; Denny, P. W.; Tilney, L. G.; Webster,
P.; Wilson, R. J. M.; Palmer, J. D.; Roos, D. S. A Plastid of
Probable Green Algal Origin in Apicomplexan Parasites. Science
1997, 275, 1485-1489.
(10) McFadden, G. I.; Reith, M. E.; Munholland, J.; LangUnnasch,
N. Plastid in Human Parasites. Nature 1996, 381, 482-482.
(11) McFadden, G. I. Waller, R. F. Plastids in Parasites of Humans.
BioEssays 1997, 19, 1033-1040.
(12) Wilson, R. J. M.; Denny, P. W.; Preiser, P. R.; Rangachari, K.;
Roberts, K.; Roy, A.; Whyte, A.; Strath, M.; Moore, D. J.; Moore,
P. W.; Williamson, D. H. Complete Gene Map of the Plastid-
like DNA of the Malaria Parasite Plasmodium falciparum. J.
Mol. Biol. 1996, 261, 155-172.
(13) Nishida, I.; Kawaguchi, A.; Yamada, M. Effect of Thiolactomycin
on the Individual Enzymes of the Fatty-Acid Synthase System
in Escherichia-coli. J. Biochem. (Tokyo) 1986, 99, 1447-1454.
(14) Jackowski, S.; Murphy, C. M.; Cronan, J. E.; Rock, C. O.
Acetoacetyl-acyl Carrier Protein SynthasesA Target for the
Antibiotic Thiolactomycin. J. Biol. Chem. 1989, 264, 7624-7629.
(15) Oishi, H.; Noto, T.; Sasaki, H.; Suzuki, K.; Hayashi, T.; Okazaki,
H.; Ando, K.; Sawada, M. Thiolactomycin, a New Antibiotic. 1.
Taxonomy of the Prodrug Organism, Fermentation and Biologi-
cal Properties. J. Antibiot. 1982, 35, 391-395.
(34) Cunningham, I. New Culture Medium for Maintenance of Tsetse
Tissues and Growth of Trypanosomatids. J. Protozool. 1977, 24,
325-329.
(16) Waller, R. F.; Keeling, P. J.; Donald, R. G.; Striepen, B.;
Handman, E.; Lang-Unnasch, N.; Cowman, A. F.; Besra, G. S.;
Roos, D. S.; McFadden, G. I. Nuclear-Encoded Proteins Target
to the Plastid in Toxoplasma gondii and Plasmodium falci-
parum. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 12352-12357.
JM049067D