Biosynthesis of the (2S,3R)-3-methyl glutamate residue of nonribosomal lipopeptides

Article abstract of DOI:10.1021/ja062960c

The calcium-dependent antibiotics (CDAs) and daptomycin are therapeutically relevant nonribosomal lipopeptide antibiotics that contain penultimate C-terminal 3-methyl glutamate (3-MeGlu) residues. Comparison with synthetic standards showed that (2S,3R)-co

Full text of DOI:10.1021/ja062960c

Published on Web 08/03/2006
Biosynthesis of the (2S,3R)-3-Methyl Glutamate Residue of
Nonribosomal Lipopeptides
Claire Milne,† Amanda Powell,† John Jim,‡ Majid Al Nakeeb,† Colin P. Smith,‡,| and
Jason Micklefield*,†,§
Contribution from the School of Chemistry and Department of Biomolecular Sciences,
The UniVersity of Manchester, P.O. Box 88, Manchester M60 1QD, United Kingdom
Received April 28, 2006; E-mail: jason.micklefield@manchester.ac.uk
Abstract: The calcium-dependent antibiotics (CDAs) and daptomycin are therapeutically relevant non-
ribosomal lipopeptide antibiotics that contain penultimate C-terminal 3-methyl glutamate (3-MeGlu) residues.
Comparison with synthetic standards showed that (2S,3R)-configured 3-MeGlu is present in both CDA
and daptomycin. Deletion of a putative methyltransferase gene glmT from the cda biosynthetic gene cluster
abolished the incorporation of 3-MeGlu and resulted in the production of Glu-containing CDA exclusively.
However, the 3-MeGlu chemotype could be re-established through feeding synthetic 3-methyl-2-oxoglutarate
and (2S,3R)-3-MeGlu, but not (2S,3S)-3-MeGlu. This indicates that methylation occurs before peptide
assembly, and that the module 10 A-domain of the CDA peptide synthetase is specific for the (2S,3R)-
stereoisomer. Further mechanistic analyses suggest that GlmT catalyzes the SAM-dependent methylation
of R-ketoglutarate to give (3R)-methyl-2-oxoglutarate, which is transaminated to (2S,3R)-3-MeGlu. These
insights will facilitate future efforts to engineer lipopeptides with modified glutamate residues, which may
have improved bioactivity and/or reduced toxicity.
Introduction
nonribosomal lipopeptide group of antibiotics, including dapto-
mycin, which recently became the first new structural class of
Nonribosomal peptides are complex and diverse secondary
metabolites that display a wide range of biological activities
and include a number of important therapeutic agents.1 Their
structural complexity stems from the wide range of building
blocks, which are utilized in their construction. In addition to
proteinogenic amino acids, nonribosomal peptides can contain
many unusual amino acids, fatty acids, polyketide moieties and
are often glycosylated. By understanding the biosynthetic origins
of these building blocks and their mode of assembly, it is
envisaged that new methods might be developed for engineering
the biosynthesis of new nonribosomal peptides with improved
biological activities.2
naturally derived antimicrobial agents to reach the clinic in over
30 years.4 CDAs and daptomycin, along with the related A54145
lipopeptides,5 all possess N-terminal fatty acid side chains and
share several common amino acids, including acidic residues
Asp, Glu, and 3-methylglutamic acid (3-MeGlu), some of which
are conserved at the same relative positions in the decapeptide
lactone cores. These acidic residues are important for coordinat-
ing calcium ions, which are essential for antimicrobial activity.
CDAs and A54145 are each produced as mixtures of lipopep-
tides, possessing either Glu or 3-MeGlu as the penultimate
C-terminal residue, which are often difficult to separate. In
A541455b and daptomycin,6 the 3-MeGlu-containing variants
are more potent antibiotics than the Glu variants. However,
3-MeGlu-containing peptides have more toxic side effects than
the Glu-containing variants.5b Therefore, it is highly desirable
to develop methods for engineering the biosynthesis of these
antibiotics that control the specificity of incorporation for Glu,
With this in mind, we have been investigating the biosynthesis
of the calcium-dependent antibiotics (CDAs) produced by
Streptomyces coelicolor.3 CDAs (Figure 1) belong to the
† School of Chemistry.
‡ Department of Biomolecular Sciences.
§ Present address: Manchester Interdisciplinary Biocentre, The University
of Manchester, 131 Princess Street, Manchester M1 7ND, UK.
| Present address: School of Biomedical and Molecular Sciences,
University of Surrey, Guildford, Surrey, GU2 7XH, UK.
(1) (a) Sieber, S. A.; Marahiel, M. A. Chem. ReV. 2005, 105, 715-738. (b)
Schwazer, D.; Finking, R.; Marahiel, M. A. Nat. Prod. Rep. 2003, 20, 275-
287. (c) Mootz, H. D.; Schwarzer, D.; Marahiel, M. A. ChemBioChem.
2002, 3, 490-504.
(4) (a) Baltz, R. H.; Miao, V.; Wrigley, S. K. Nat. Prod. Rep. 2005, 22, 717-
741. (b) Raja, A.; LaBonte, J.; Lebbos, J.; Kirkpatrick, P. Nat. ReV. Drug
DiscoVery 2003, 2, 943-944. (c) Steenbergen, J. N.; Alder, J.; Thorne, G.
M.; Tally, F. P. J. Antimicrob. Chemother. 2005, 55, 283-288. (d) Miao,
V.; Coe¨ffet-LeGal, M.-F.; Brian, P.; Brost, R.; Penn, J.; Whiting, A.; Martin,
S.; Ford, R.; Parr, I.; Bouchard, M.; Silva, C. J.; Wrigley, S. K.; Baltz, R.
H. Microbiology 2005, 1511, 507-1523.
(2) (a) Walsh, C. T. Science 2004, 303, 1805-1810. (b) Stevens, B. W.; Joska,
T. M.; Anderson, A. C. Drug DeV. Res. 2006, 66, 9-18. (c) Walsh, C. T.
ChemBioChem. 2002, 3, 124-134. (d) Doekel, S.; Marahiel, M. A. Metab.
Eng. 2001, 3, 64-77.
(3) (a) Hojati, Z.; Milne, C.; Harvey, B.; Gordon, L.; Borg, M.; Flett, F.;
Wilkinson, B.; Sidebottom, P. J.; Rudd, B. A. M.; Hayes, M. A.; Smith,
C. P.; Micklefield, J. Chem. Biol. 2002, 9, 1175-1187. (b) Uguru, G. C.;
Milne, C.; Borg, M.; Flett, F.; Smith, C. P.; Micklefield, J. J. Am. Chem.
Soc. 2004, 126, 5032-5033.
(5) (a) Fukuda, D. S.; Du Bus, R. H.; Baker, P. J.; Berry, D. M.; Mynderse, J.
S. J. Antibiot. 1990, 43, 594-600. (b) Counter, F. T.; Allen, N. E.; Fukuda,
D. S.; Hobbs, J. N.; Ott, J.; Ensminger, P. W.; Mynderse, J. S.; Preston, D.
A.; Wu, C. Y. J. Antibiot. 1990, 43, 616-622. (c) Miao, V.; Brost, R.;
Chapple, J.; She, K.; Coeffet-Le Gal, M.-F.; Baltz, R. H. J. Ind. Microbiol.
Biotechnol. 2006, 33, 66-74.
(6) Gru¨newald, J.; Sieber, S. A.; Mahlert, C.; Linne, U.; Marahiel, M. A. J.
Am. Chem. Soc. 2004, 126, 17025-17031.
9
11250
J. AM. CHEM. SOC. 2006, 128, 11250-11259
10.1021/ja062960c CCC: $33.50 © 2006 American Chemical Society

Biosynthesis of the (2S,3R)-3-Methyl Glutamate Residue
A R T I C L E S
Figure 1. The calcium-dependent antibiotics (CDAs) and daptomycin. The CDA structural variants that are known to be produced by the wild-type S.
coelicolor3a are as follows: CDA1, R9 ) OPO3H2, R10 ) H; CDA2, R9 ) OPO3H2, R10 ) CH3; CDA3, R9 ) OH, R10 ) H; CDA4, R9 ) OH, R10 ) CH3.
In addition the a-series contains Z-∆trp (R11 ) π-bond) and the b-series contains L-Trp (R11 ) H,H) at position 11.
3-MeGlu, or Glu analogues (including stereoisomers); conse-
quently, new therapeutically relevant lipopeptides with increased
activity and reduced toxicity could be biosynthesized. To achieve
this, it is first necessary to elucidate the biogenesis of 3-MeGlu,
within CDAs, and further explore how the adenylation domain
(A-domain) of the nonribosomal peptide synthetase (NRPS)
governs the specificity for Glu and 3-MeGlu.
Previously, we identified gene SCO3215 within the cda
biosynthetic gene cluster, which was tentatively suggested to
encode a glutamate-3-methyltransferase (GlmT)3a based on the
low, but significant, sequence similarity between the SCO3215
gene product and other methyltransferases. Additionally, the
amino acid specificity-conferring code7 for the active site of
the CdaPS3 module 10 A-domain is unlike other Glu-activating
domains, suggesting that this A-domain may have evolved
specificity for 3-MeGlu as well as Glu.3a This alternative
A-domain specificity suggests that methylation of Glu occurs
before peptide assembly. GlmT was thus predicted to catalyze
the direct methylation of Glu to give 3-MeGlu.3a In a model
metabolic flux analysis of CDA production,8 we also considered
the possibility that GlmT may alternatively methylate R-keto-
glutarate, leading to 3-methyl-2-oxoglutarate, which is then
transaminated to 3-MeGlu.
Upon completion of the work described here, the sequence
of the gene clusters of daptomycin from Streptomyces roseo-
sporus4d and A54145 from Streptomyces fradiae5c were pub-
lished, and genes dptI and lptI, which showed similarity to glmT,
were identified. Additionally, the amino acid substrate binding
pockets of the A-domains responsible for activating 3-MeGlu
or Glu in the corresponding penultimate modules of the
daptomycin and A54145 NRPS (DptD and LptD) were shown
to be very similar in sequence to the module 10 A-domain of
CdaPS3. This suggests a common mode of 3-MeGlu biosyn-
thesis and NRPS A-domain activation during the assembly of
the three groups of lipopeptides. In this paper, we sought to
probe the biosynthetic origins of 3-MeGlu in S. coelicolor and
further explore the in vivo specificity of the corresponding
A-domain of module 10 responsible for incorporation of Glu/
3-MeGlu into CDAs.
Results and Discussion
Synthesis of (2S,3R)- and (2S,3S)-Methyl Glutamic Acid.
Previous work demonstrated that the 3-MeGlu in CDA was the
L-isomer,9 which is consistent with the absence of an epimer-
ization (E) domain within the CdaPS3 module 10.3a Furthermore,
the stereochemistry of the 3-MeGlu residue of daptomycin was
inferred to be the L-threo- or (2S,3R)-stereoisomer through the
stereospecificity of two enzymes, glutamine synthase and
glutamate decarboxylase.10 The high protein sequence similarity
of the putative methyltransferases (GlmT, DptI, and LptI) and
the corresponding active sites of the A-domains for Glu/3-
MeGlu from the cda, dpt, and lpt gene clusters, respectively, is
strongly suggestive that the 3-MeGlu residues in CDA and the
other lipopeptides will possess identical absolute configuration.
However, it is well established that enzyme stereospecificity
can be completely inverted by as few as two point mutations,11
or in some cases simply by changing the medium surrounding
the enzyme.12 Therefore, an unambiguous stereocontrolled
synthesis of (2S,3R)- and (2S,3S)-3-MeGlu diastereoisomers was
developed for comparison with the natural 3-MeGlu derived
by hydrolytic degradation of CDAs and daptomycin. These
synthetic compounds are also potentially valuable for subsequent
experiments aimed at dissecting 3-MeGlu biosynthesis and the
in vivo specificity of the Glu/3-MeGlu-activating A-domain of
CdaPS3. The synthetic route shown in Scheme 1 was designed
so that all four possible 3-MeGlu stereoisomers might be
prepared with complete stereocontrol, without recourse to
separation of diastereoisomers.
(9) Kempter, C.; Kaiser, D.; Haag, S.; Nicholson, G.; Gnau, V.; Walk, T.;
Gierling, G. H.; Decker, H.; Zahner, H.; Jung, G.; Metzger, J. W. Angew.
Chem., Int. Ed. Engl. 1997, 36, 498-501.
(10) (a) Debono, M.; Barnhart, M.; Carrell, C. B.; Hoffman, J. A.; Occolowitz,
J. L.; Abbott, B. J.; Fukuda, D. S.; Hamill, R. L. J. Antibiot. 1987, 40,
761-777. (b) Kagan, H. M.; Meister, A. Biochemistry 1966, 5, 725-
732.
(11) Ijima, Y.; Matoishi, K.; Terao, Y.; Doi, N.; Yanagawa, H.; Ohta, H.; Chem.
Commun. 2005, 877-879.
(12) Hirose, Y.; Kariya, K.; Sasaki, I.; Kurono, Y.; Ebiikea, H.; Achiwa, K.
Tetrahedron Lett. 1992, 33, 7157-7160.
(7) (a) Stachelhaus, T.; Mootz, H. D.; Marahiel, M. A. Chem. Biol. 1999, 6,
493-505. (b) Challis, G. L.; Ravel, J.; Townsend, C. A. Chem. Biol. 2000,
7, 211-224.
(8) Kim, H. B.; Smith, C. P.; Micklefield, J.; Mavituna, F. Metab. Eng. 2004,
6, 313-325.
9
J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006 11251

A R T I C L E S
Milne et al.
Scheme 1. Synthesis of (2S,3S)- and (2S,3R)-3-Methyl Glutamic
was treated with 4 M HCl in dioxane to remove the Boc group
and reveal the product (2S,3S)-methyl glutamic acid as the HCl
salt 7. The optical rotation of the product was identical to that
reported previously for the same stereoisomer prepared by
alternative routes.13a,c
Acidsa
To prepare the opposite (2S,3R)-methyl glutamic acid, the
intermediate R,â-unsaturated lactam 2 was subjected to a 1,3-
dipolar cycloaddition with diazomethane15 to generate the
pyrazoline 8, as a single diastereoisomer. Thermolysis of the
pyrazoline ring15 under solvent-free conditions gave the â-
methyl-R,â-unsaturated lactam 9. Hydrogenation of 9, at
atmospheric pressure, using PtO2 as a catalyst gave the cis-â-
methyl lactam 10. The absolute configuration of 10 was
confirmed from NOESY NMR, which showed an NOE between
H5 and H4, but no NOE cross-peak was evident between H5
and the â-methyl protons, which is consistent with the cis-
stereochemistry as shown. In the case of the corresponding
trans-â-methyl lactam 3, of known absolute configuration, the
opposite pattern of NOEs is evident with H5, showing an NOE
to the â-methyl protons but not to H4. Furthermore, in the
COSY spectra of trans-â-methyl lactam 3, there is no cross-
peak between H5 and H4, which is consistent with a dihedral
angle (φ) close to 90° as indicated from the crystal structure.14c
On the other hand, the COSY spectra of cis-â-methyl lactam
10 show a clear cross-peak between H4 and H5, due to a smaller
dihedral angle between H4 and H5 of ca. 33°, which is predicted
from energy minimized models of 10 generated using bond
angles and lengths extracted from the crystal structure of the
diastereoisomer 3.14c Desilylation of 10 and oxidation of the
alcohol 11 gave the acid 12, which was hydrolyzed and
subjected to acidolysis, as described above, to give (2S,3R)-
methyl glutamic acid 14 as the HCl salt, which was identical
by optical rotation to the same product produced by independent
routes.13a,c The advantage of this synthetic route over the others
reported13 is that all four stereoisomers of 3-MeGlu can be
produced from the common precursor 2 or its available
enantiomer without the need to separate diastereoisomers. Also
by adding different alkyl cuprate reagents to 2 it is possible to
generate alternative trans-â-alkylated lactams (analogous to 3).
Similarly, synthetic methodology exists which would enable the
transformation of 2 into the opposite cis-â-alkylated lactams
(analogous to 10).16
a Conditions: (a) LDA, PhSeBr; (b) H2O2, CH3CO2H; (c) CH3Li, Cu(I)I;
(d) TBAF, 20% CH3CO2H; (e) NaIO4, RuCl3; (f) LiOH; (g) 4 M HCl in
1,4-dioxane; (h) CH2N2; (i) heat at 120 °C; (j) H2, Pt(IV)O2.
Asymmetric syntheses of 3-MeGlu diastereoisomers have
been reported.13 The first approach utilized an Arndt-Eistert
homologation of (2S,3S)-3-methyl aspartate to generate the
(2S,3R)-3-MeGlu.13a However, this synthesis is not easily
modified to prepare other stereoisomers or â-substituted ana-
logues. The second synthetic strategy utilized a Ni(II) homo-
chiral Shiff base of glycine in a diastereoselective conjugate
addition of ethyl crotonate, but this approach only produced
the (2S,3S)-3-MeGlu, and in low yield.13b During the course of
our investigation, a third approach was reported that also
incorporated a homochiral glycinyl Schiff base in a conjugate
addition with ethyl crotonate to produce both (2S,3R)- and
(2S,3S)-3-MeGlu stereoisomers; unfortunately, the lack of
complete stereocontrol required the tedious separation of
diastereoisomers.13c It was thus apparent that the development
of a new convergent synthesis to all possible stereoisomers of
3-MeGlu was necessary. Ideally, this synthesis should be easily
modifiable allowing for the preparation of a variety of â-sub-
stituted Glu analogues.
Assignment of the Absolute Stereochemistry of 3-MeGlu
in CDA and Daptomycin. With the synthetic (2S,3S)- and
(2S,3R)-3-methyl glutamic acids in hand, it was possible to
establish the configuration of the natural 3-MeGlu derived from
CDA. Accordingly, a pure sample of CDA4a, which is known
to contain 3-MeGlu,3a,9 was hydrolyzed with aqueous 6 M HCl,
and the hydrolysate was derivatized with dabsyl chloride,17
which facilitates improved retention and separation of the amino
acid derivatives on reverse phase HPLC. This allowed identi-
fication of all the dabsylated amino acids from CDA, except
(Z)-dehydrotryptophan, which presumably undergoes further
hydrolysis to indolepyruvate. Conditions for the separation of
the synthetic dabsylated (2S,3S)- and (2S,3R)-3-methyl glutamate
diastereoisomers on reverse phase were then established. This
showed that the (2S,3S)-dabsyl derivative has a retention time
Our synthetic approach begins with the known lactam 1,14
which is derived from L-pyroglutamic acid. Accordingly,
R-phenylselenation of the lactam 1, followed by oxidative
elimination, via the selenoxide, results in the R,â-unsaturated
lactam 2, which is treated with lithium dimethyl cuprate to give
exclusively the trans-â-methyl lactam 3.14 The absolute con-
figuration of 3 was previously confirmed by X-ray crystallog-
raphy.14c Removal of the silyl protecting group and oxidation
of the alcohol 4 gave the acid 5. Hydrolysis of the lactam 5
with aqueous LiOH followed by acidification and extraction
into diethyl ether gave the Boc-protected free acid 6, which
(13) (a) Hartzoulakis, B.; Gani, D. J. Chem. Soc., Perkin Trans. 1 1994, 2525-
2531. (b) Soloshonok, V. A.; Cai, C.; Hruby, V. J.; Meervelt, L. V.;
Mischenko, N. Tetrahedron 1999, 55, 12031-12044. (c) Wehbe, J.;
Rolland, V.; Roumestant, M. L.; Martinez, J. Tetrahedron: Asymmetry
2003, 14, 1123-1126.
(14) (a) Woo, K.-C.; Jones, K. Tetrahedron Lett. 1991, 32, 6949-6952. (b)
Herdeis, C.; Hubmann, H. P. Tetrahedron: Asymmetry 1992, 3, 1213-
1221. (c) Herdeis, C.; Hubmann, H. P.; Lotter, H. Tetrahedron: Asymmetry
1994, 5, 351-354.
(15) (a) Hanessian, S.; Murray, P. J. J. Org. Chem. 1987, 52, 1170-1172. (b)
Tomioka, K.; Sato, F.; Koga, K. Heterocycles 1982, 17, 311-316.
(16) Matsuo, J.-I.; Aizawa, Y. Chem Commun. 2005, 2399-2401.
(17) Kim, T.-Y.; Kim, H.-J. J. Chromatogr. A 2001, 933, 99-106.
9
11252 J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006

Biosynthesis of the (2S,3R)-3-Methyl Glutamate Residue
A R T I C L E S
Figure 3. LC-MS analysis of the ∆glmT and recomplementation with
synthetic precursors. (A) Chromatogram of extracts from the wild-type strain
MT1110. MS of the peak at 7.1 and 7.2 min gave m/z 1480.8 and 1494.8
corresponding to CDA3a and CDA4a [M + H]+ ions, respectively. The
corresponding sodiated and potassiated molecular ions are present and
consistent with this. (B) LC-MS of the ∆glmT mutant showed only (cross
sign) CDA3a (7.1 min, m/z 1481.2 [M + H]+). (C) Chromatogram obtained
after the exogenous supply of 300 µg/mL (2S,3R)-3-MeGlu to the ∆glmT
mutant. Shows peaks at both 7.1 and 7.2 min consistent with production of
CDA3a and CDA4a. (D) The mass spectra for the peaks (at 7.1 and 7.2
min) obtained from feeding (2S,3R)-3-MeGlu to ∆glmT (chromatogram C)
show expected molecular ions for CDA3a (1481.0 [M + H]+, 1503.0 [M
+ Na]+, 1519.0 [M + K]+) and CDA4a (1495.0 [M + H]+, 1517.0 [M +
Na]+, 1533.0 [M + K]+). (Cross sign) The peak at 6.7 min in ∆glmT (B)
and (C), but also evident to a much lower extent in the wild-type, has m/z
1499.5, which corresponds to the [M + H]+ for a postulated linear form of
CDA3a, which is proposed to arise from hydrolysis of the lactone ring or
failure of the thioesterase domain to effect complete cyclization. Similar
byproducts have been identified during production of daptomycin and other
lipopeptides.4a
Figure 2. Assignment of the absolute stereochemistry of 3-MeGlu in CDA.
(A) LC-MS of the dabsylated amino acid derivatives derived from acidic
hydrolysis of CDA4a. (B) Expansion of the mass extracted chromatogram
identifies the 3-MeGlu derivative with a retention time of 9.8 min. (C)
Extracted mass chromatogram of the synthetic derivatized standards (2S,3S)-
and (2S,3R)-MeGlu. Spiked mixtures show that the natural 3-MeGlu is the
(2S,3R)-diastereoisomer with retention time of 9.8 min as opposed to the
(2S,3S)-diastereoisomer, which has a longer retention time of 10.2 min.
(D) MS of the peak 9.8 min, m/z 449.0, corresponds to [M + H]+ ion of
dabsylated 3-MeGlu. Cross sign is the unassigned degradation side products/
impurities.
at 10.2 min, with the (2S,3R)-diastereoisomer at 9.8 min (Figure
2). Comparing the LC-MS chromatographs of the derivatized
hydrolysate with that of synthetic standards established that the
3-MeGlu residue in CDA4a has (2S,3R)-absolute configuration.
Similar hydrolysis, derivatization, and LC-MS analysis of
daptomycin demonstrated that the same (2S,3R)-3-MeGlu is also
present within daptomycin. This agrees with the earlier assign-
ment that was inferred from the stereospecificity of glutamine
synthase and glutamate decarboxylase10a and further suggests
a common mode of biosynthesis for 3-MeGlu in the S. coelicolor
and S. roseosporus producer strains.
recombination and subsequent screening of second crossover
recombination events,3a resulted in the mutant strain ∆glmT.
The wild-type MT1110 strain was chosen as a host for these
experiments because this strain tends to produce nonphospho-
rylated CDAs,3a which aids LC-MS analysis. In addition, the
MT1110 strain is more easily cultivated than the more widely
used S. coelicolor 2377.
Deletion of the glmT Gene and Recomplementation with
Synthetic (2S,3R)-3-MeGlu. To probe the biosynthetic origins
of (2S,3R)-3-MeGlu in CDAs, a mutant strain of S. coelicolor
(∆glmT) was generated, which contained an in-frame deletion
within the glmT gene. Accordingly, a DNA fragment of ca. 2.0
kb incorporating 396 bp of the downstream end of glmT and
the adjacent SCO3214 (trpE2) gene and a fragment of ca. 1.5
kb including 4 bp of the upstream end of glmT and the flanking
SCO3216 gene were generated by PCR. These fragments were
first ligated into plasmid pMT3000 cloned and then re-isolated
from E. coli. The resulting 3.5 kb in-frame deletion fragment
(missing 615 bp of glmT) was digested from pMT3000 and sub-
cloned into the plasmid pMAH18 (see Supporting Information
for more details). Transformation of S. coelicolor MT111019
protoplasts with the resulting plasmid, followed by homologous
The MT1110 wild-type and ∆glmT mutant strains were grown
in liquid culture under conditions that favored production of
(Z)-dehydrotryptophan-containing CDA. The cells were har-
vested by centrifugation, and the supernatants were analyzed
by LC-MS.3a This showed that the wild-type MT1110 produces,
as the major product, CDA4a that contains 3-MeGlu along with
a minor amount of the Glu variant CDA3a (Figure 3). In
contrast, the mutant ∆glmT produces only the Glu-containing
CDA3a, with no MeGlu-containing CDAs evident. Indeed,
repeated fermentation and analysis of ∆glmT under a variety
of conditions clearly reveals the complete absence of any
3-MeGlu-containing CDAs. While this supports the hypothesis
that the gene product GlmT is a methyltransferase involved in
the biosynthesis of 3-MeGlu residues in CDA, these results do
not reveal any information about the timing of the methylation
per se. To determine the order of the steps on the pathway, the
synthetic (2S,3R)-3-MeGlu natural stereoisomer was fed in
increasing concentrations to the ∆glmT mutant during fermenta-
(18) Bucca, G.; Brassington, A. M. E.; Hotchkiss, G.; Mersinias, V.; Smith, C.
P. Mol. Microbiol. 2003, 50, 153-166.
(19) Hindle, Z.; Smith, C. P. Mol. Microbiol. 1994, 12, 737-745.
9
J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006 11253

A R T I C L E S
Milne et al.
Scheme 2. Synthesis of 3-Methyl-2-oxoglutarate and Racemic
3-Methyl Glutamic Acidsa
a Conditions: (a) DBU; (b) CH3ONa in CH3OH; (c) TiCl3-CH3CO2NH4
and aq. HCl;20 (d) HCl-CH3OH then HCOH-H2O; (e) aq. NaOH; (f)
Raney Ni; (g) (Boc)2O, 4-DMAP, Et3N; (h) LiOH; (i) 4 M HCl in 1,4-
dioxane.
addition to Glu, the enzyme CdaPS3 is able to activate and
incorporate the natural (2S,3R)-3-MeGlu, but not the (2S,3S)-
diastereoisomer, which demonstrates that methylation of Glu,
or its precursor, occurs before peptide assembly. The ability of
the A-domain of CdaPS3 module 10, and to lesser extent the
adjacent condensation (C)-domains, to discriminate between the
diastereoisomers is unlikely to be fortuitous. Indeed, this
selectivity is probably a consequence of the A-domain having
evolved specificity for (2S,3R)-3-MeGlu from an ancestral Glu-
activating A-domain.
By using this knockout strategy and recomplementation with
synthetic (2S,3R)-3-MeGlu, it is now possible to control the
functionality of the penultimate residue in CDAs. To demon-
strate the importance of this biosynthetic control, we isolated
pure samples of CDA3a and CDA4a and subjected them to well-
plate bioassay using Micrococcus luteus as the indicator strain
(Figure 4). The resulting zones of inhibition indicate that, like
daptomycin and A54145, the 3-MeGlu-containing CDA4a
sample is more active than the Glu variant.
Recomplementation of ∆glmT with Racemic 3-MeGlu
Diastereoisomers and 3-Methyl-2-oxoglutarate. While the
results described above show that the GlmT is involved in the
biosynthesis of the 3-MeGlu residue in various CDAs, and that
the methyl group is introduced before peptide assembly, the
nature of the substrate for GlmT is not necessarily apparent.
Either L-Glu is methylated directly to (2S,3R)-3-MeGlu or,
alternatively, the precursor R-ketoglutarate is first methylated
to (3R)-methyl-2-oxoglutarate and then transaminated to (2S,3R)-
3-MeGlu. To explore which of these scenarios is most likely,
we synthesized 3-methyl-2-oxoglutarate (Scheme 2). This
involved the Michael addition of methyl crotonate 15 with the
methyl nitroacetate 16 enolate anion to give 17. A Neff
reaction20 catalyzed with TiCl3 in an aqueous solution of HCl
gave a mixture of the oxime 18 and the ketone 19. Further
selective acidic hydrolysis of the oxime gave more ketone 19,
which was subjected to saponification, resulting in the 3-methyl-
2-oxoglutarate 20 as the disodium salt. Also, using the nitro
intermediate 17, all four possible stereoisomers of 3-MeGlu were
prepared as a mixture by hydrogenation of the nitro group to
the corresponding amine. Boc protection and basic hydrolysis
then gave a racemic mixture of 6/13, which was treated with 4
Figure 4. Comparison of the antimicrobial activities of Glu-containing
CDA3a and 3-MeGlu-containing CDA4a. Bioassays were carried out as
described previously28 using M. luteus as the indicator strain. Equimolar
solutions of CDA3a and CDA4a in deionized water (6.0 µg in 100 µL-1
)
were added to the 5 mm left- and right-hand wells, respectively. (A) In the
presence of Ca2+ (16 mM), zones of inhibitions for CDA3a and CDA4a
are ca. 1.5 and 2.5 cm, respectively. (B) In the absence of Ca2+, no zones
were evident.
tion. LC-MS analysis clearly shows that upon the addition of
as little as 50 µg mL-1 of (2S,3R)-3-MeGlu the mutant ∆glmT
reverts to wild-type phenotype and produces both MeGlu-
containing CDA4a as well as Glu-containing CDA3a (Figure
3). In contrast, the feeding of (2S,3S)-3-MeGlu to the ∆glmT
strain, at relatively high total concentration of 300 µg mL-1
,
had no effect on the production of CDAs; no MeGlu-containing
lipopeptides were evident by LC-MS. This indicates that, in
(20) McMurry, J. E.; Melton, J. J. Org. Chem. 1973, 38, 4367-4373.
9
11254 J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006

Biosynthesis of the (2S,3R)-3-Methyl Glutamate Residue
A R T I C L E S
Figure 5. (A) Possible mode of biosynthesis of (2S,3R)-3-methyl glutamic acid in S. coelicolor. (B) (S)-adenosylmethionine-dependent methylation of
indolepyruvate during indolmycin biosynthesis.22b (C) Formation of a Schiff base between Glu and PLP could also facilitate â-methylation of Glu in CDA
biosynthesis. Abbreviations: GlmT, glutamate- or 2-oxoglutarate-3-methyltransferase; AT ) putative aminotransferase enzyme or associated activity; SAM,
(S)-adenosylmethionine; SAH, (S)-adenosylhomocysteine.
M HCl in dioxane to give a racemic mixture of 3-MeGlu
diastereoisomers (rac-7/14).
ubiquinone methyltransferases (UbiE), and other typical SAM-
dependent methyltransferases. Most SAM-dependent methyla-
tion reactions occur with inversion of configuration at the methyl
group, which is consistent with the attack of the SAM methyl
group by a nucleophilic substrate in an SN2-like mechanism.22
The similarity between GlmT and a typical SAM-dependent
methyltransferase would therefore suggest that R-ketoglutarate
is an electronically more plausible substrate. Clearly the
formation of a resonance-stabilized nucleophilic enolate or enol
form of R-ketoglutarate in the active site of GlmT is entirely
feasible (Figure 5A). A mechanistically similar SAM-dependent
methylation of the related R-keto acid, indolepyruvate 21, to
give the â-methyl-R-keto acid 22 is also known to occur during
the biosynthesis of indolmycin (Figure 5B).22b On the other
hand, the direct SAM-dependent â-methylation of Glu, by the
typical mechanism, would require the formation of a highly
unstable â-anion, which is much less likely. There is, however,
a group of unusual methyltransferases from the radical SAM
superfamily23a,b which utilize methylcoblamin23c to transfer
methyl groups to non-nucleophilic sites, possibly by a radical
mechanism.23d Despite this, GlmT shows no sequence similarity
with and lacks the conserved CxxxCxxC motif common to the
proteins in the radical SAM superfamily.23a,b Thus, the evidence
presented here, combined with simple mechanistic consider-
ations based on early work,22,23 suggests that GlmT is likely to
catalyze the SAM-dependent methylation of R-ketoglutarate to
give (3R)-methyl-2-oxoglutarate.
The racemic mixture of 3-MeGlu diastereoisomers (rac-7/14)
was then fed to the ∆glmT mutant strain. As expected, this re-
established the production of CDA4a containing 3-MeGlu.
However, in addition to the identification of CDA3a containing
Glu, a third product with identical molecular weight to CDA4a
(m/z 1495 [M + H]+), but with a slightly different retention
time, was repeatedly observed by LC-MS. This third product
was not present in either feeding experiments with (2S,3R)- or
(2S,3S)-3-MeGlu, which suggests that one of the (2R)-MeGlu
diastereoisomers in the racemic mixture is also incorporated into
the CDA pool, likely to include a CDA4a diastereoisomer (epi-
CDA4a). While the scale of the feeding experiments and
difficulty of HPLC separation prevented the isolation and more
detailed characterization of the purported new product epi-
CDA4a, this finding suggests that future mutasynthesis of CDA
analogues may be viable with D- as well as L-glutamate analogues.
Following this, 3-methyl-2-oxoglutarate 20 was fed to the
∆glmT mutant strain. LC-MS analysis of the culture supernatant,
after 6 days growth, revealed that by feeding increasing amounts
of 20 (between 0.46 and 2.25 mg mL-1) the biosynthesis of
3-MeGlu-containing CDA4a is initiated. The higher concentra-
tions of 3-methyl-2-oxoglutarate 20 compared with that of
(2S,3R)-3-MeGlu required to bring about CDA4a production
could be due to competing metabolism or poorer cellular uptake.
On the other hand, (2S,3R)-3-MeGlu could enter the cell via
specific glutamate or nonspecific amino acid uptake mech-
anisms.21 Despite the higher concentrations of 3-methyl-2-
oxoglutarate required to re-establish CDA4a production, these
results suggest that 3-methyl-2-oxoglutarate is a possible
precursor of the (2S,3R)-3-MeGlu residue in CDAs. Indeed,
analysis of the GlmT protein sequence reveals a putative (S)-
adenosylmethionine (SAM) binding site and similarity to
There are several ways in which (3R)-methyl-2-oxoglutarate
might be subsequently transformed to (2S,3R)-3-MeGlu. First,
a PLP-dependent aminotransferase could transfer the amine
(22) (a) Floss, H. G.; Lee, S. Acc. Chem. Res. 1993, 26, 116-122. (b) Mascaro,
L.; Hoerhammer, R.; Eisenstein, S.; Sellers, L. K.; Mascaro, K.; Floss, H.
G. J. Am. Chem. Soc. 1977, 99, 273-274.
(23) (a) Sofia, H. J.; Chen, G.; Hetzler, B. G.; Reyes-Spindola, J. F.; Miller, N.
E. Nucleic Acids Res. 2001, 29, 1097. (b) Westrich, L.; Heide, L.; Li, S.-
M. ChemBioChem. 2003, 4, 768-773. (c) Seto, H.; Kuzuyama, T. Nat.
Prod. Rep. 1999, 16, 589-596. (d) Mosimann, H.; Kra¨utler, B. Angew.
Chem., Int. Ed. 2000, 39, 393-395.
(21) (a) Gross, W.; Ring, K. Biochim. Biophys. Acta 1971, 233, 652-665. (b)
May, W. S.; Formica, J. V. J. Bacteriol. 1978, 134, 546-554.
9
J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006 11255

A R T I C L E S
Milne et al.
group from an amino acid donor to (3R)-methyl-2-oxoglutarate.
Apart from the specific 4-hydroxyphenylglycine aminotrans-
ferase (HpgT encoded by SCO3227),24 there are no other genes
in the cda biosynthetic gene cluster, which encodes proteins
that are similar to known aminotransferases. There are, however,
numerous PLP-dependent aminotransferases in S. coelicolor
which are predicted to transfer the amine group from various
amino acid donors to R-ketoglutarate to form L-Glu and various
R-keto acids [http://streptomyces.org.uk/]. Any number of these
enzymes could potentially transaminate (3R)-methyl-2-oxoglu-
tarate. Indeed, from the point of view of economy, it is tempting
to suggest that such an aminotransferase activity might utilize
L-Glu as the amino donor, which would replenish the supply of
R-ketoglutarate for subsequent methylation by GlmT (Figure
5A). A similar cyclic pathway is proposed that utilizes tyrosine
as the co-substrate of HpgT in the biosynthesis of 4-hydroxy-
phenylglycine in CDA and other nonribosomal peptide antibiot-
ics.24 In addition to this, the primary metabolic NADPH-
dependent glutamate synthase (SCO1977, SCO2025, SCO2026)
and NADP-specific glutamate dehydrogenase (SCO4683) en-
zymes in S. coelicolor,25 which normally utilize R-ketoglutarate
as a substrate in the biosynthesis of L-Glu, might similarly be
responsible for producing (2S,3R)-3-MeGlu from (3R)-methyl-
2-oxoglutarate.
of Glu- and MeGlu-containing peptides in S. coelicolor. Indeed,
a similar approach might be used to control the functionality
of penultimate residues in daptomycin and A54145. This is
important because we have demonstrated that, like daptomycin
and A54145, the presence of a 3-MeGlu rather than Glu as the
penultimate C-terminal residue of CDA leads to increased
antimicrobial activity.
Interestingly, feeding a racemic mixture of all four 3-MeGlu
stereoisomers led to the production of a new product, which is
predicted to be an epi-CDA4a containing an unnatural D-
configured 3-MeGlu residue. We have also synthesized racemic
3-methyl-2-oxoglutarate and showed that addition of this
compound to the ∆glmT mutant re-establishes the biosynthesis
of 3-MeGlu-containing CDA4a. From this analysis and earlier
mechanistic studies, we suggest that GlmT is likely to be a
SAM-dependent 2-oxoglutarate-3-methyltransferase. The prod-
uct (3R)-methyl-2-oxoglutarate is probably transaminated, or
otherwise transformed, to (2S,3R)-3-MeGlu acid prior to activa-
tion and incorporation into CDAs by CdaPS3.
Currently, we are using the synthetic methodology along with
stereochemical and biosynthetic knowledge generated here in
order to develop new methods for engineering lipopeptides of
this type. For example, by feeding other synthetic 3-alkyl Glu
and 3-alkyl-2-oxoglutarate analogues to ∆glmT,3a combined with
possible active site modification of the corresponding A-domain,3b
it should be possible to generate new lipopeptides with a variety
of modified glutamates at the important penultimate C-terminal
position. It is entirely possible that these new lipopetides could
have improved activity, but lower toxicity, than the current
MeGlu-containing lipopeptides, including daptomycin, which
is now widely used in the clinic.
Finally, while our results point to GlmT functioning as a
2-oxoglutarate methyltransferase, the possibility that GlmT
methylates Glu by first forming a Schiff base with a pyridoxal-
5′-phosphate (PLP) or a functionally related pyruvoyl cofactor
cannot be discounted. Similar to amino acid decarboxylase and
amino acid racemase enzymes, formation of such a Schiff base
(e.g., 23, Figure 5C) followed by tautomerization steps would
facilitate SAM-dependent â-methylation of a nucleophilic
enamine 24 by the standard two-electron mechanism. In this
event, the fact that synthetic 3-methyl-2-oxoglutarate re-
establishes production of CDA containing 3-MeGlu in the
∆glmT mutant could be accounted for through the presence of
a promiscuous aminotransferase within S. coelicolor.
Experimental Section
(5S)-3,4-Dihydro-5-tert-butyldiphenylsilyloxymethyl-N-tert-butyl-
oxycarbonylpyrrolidin-2-one (2). LDA (9.98 mL, 7.14 mmol) was
added dropwise over 15 min to (5S)-N-tert-butyloxycarbonyl-5-tert-
butyldiphenylsilyloxymethylpyrrolid-2-one14 (2 g, 4.41 mmol) in
anhydrous THF (25 mL) at -78 °C. The reaction mixture was stirred
at -78 °C for 20 min, allowed to warm to 0 °C for ca. 2 min, and then
re-cooled to -78 °C. A solution of phenylselenenyl bromide (1.25 g,
5.29 mmol) in anhydrous THF (5 mL) was added rapidly, and stirring
was continued at -78 °C. After 1.5 h, the reaction was allowed to
warm to room temperature, water (75 mL) was then added, and the
mixture was extracted with CH2Cl2 (3 × 50 mL). The organic extracts
were washed with saturated aqueous NaHCO3 (50 mL) and saturated
aqueous NaCl (50 mL) and then dried over MgSO4, filtered, and
evaporated under reduced pressure. Purification by flash chromatog-
raphy (80:20 hexane/EtOAc) provided R-phenylselenenyl derivative as
a white solid (1.74 g, 60% yield). A portion of this (1.1 g, 1.8 mmol)
was dissolved in THF (8 mL) with glacial acetic acid (0.23 mL). After
cooling to 0 °C, aqueous hydrogen peroxide (0.95 mL, 27% w/v) was
added and the reaction stirred for 30 min. Following this, cold saturated
aqueous NaHCO3 (80 mL) was added and the resulting mixture was
extracted with diethyl ether (3 × 80 mL). The combined organic extracts
were washed with saturated aqueous NaCl (80 mL), dried over MgSO4,
filtered, concentrated, and purified by flash chromatography (75:25
hexane/EtOAc) to give 2 (0.7 g, 86%) as a pale yellow solid: Rf 0.15
(80:20 hexane/EtOAc); mp 93-95 °C; [R]D ) -125.6° (c ) 1.0,
CHCl3); 1H NMR (400 MHz, CDCl3) δ 1.05 (9H, s, SiC(CH3)3), 1.46
(9H, s, CO2C(CH3)3), 3.85 (1H, dd, J ) 6.5, 10.0 Hz, CHaHbO), 4.14
(1H, dd, J ) 3.5, 10.0 Hz, CHaHbO), 4.66-4.70 (1H, m, CHCH2O),
6.20 (1H, dd, J ) 2.0, 6.5 Hz, COCHCH), 7.30 (1H, dd, J ) 2.0, 6.0
Hz, COCHCH), 7.39-7.65 (10H, m, Ar-H); 13C NMR (100.6 MHz,
Conclusions
Under typical fermentation conditions, the wild-type S.
coelicolor produces a mixture of Glu and 3-MeGlu-containing
CDAs, which are difficult to separate. We have shown that, by
deleting the putative methyltransferase encoding gene, glmT,
from the cda biosynthetic gene cluster, the resulting mutant
∆glmT produces exclusively Glu-containing CDA. We have also
developed a stereocontrolled synthesis of (2S,3R)- and (2S,3S)-
methylglutamic acids, which showed that 3-MeGlu in CDAs
and daptomycin possesses the same (2S,3R)-absolute configu-
ration. Feeding experiments with the ∆glmT strain revealed that
the A-domain of CdaPS3 module 10, and probably to a lesser
extent the adjacent C-domains, is able to discriminate between
the synthetic 3-methylglutamates and only the (2S,3R)-isomer
is incorporated into the CDAs. Using the ∆glmT mutant strain
and supplementing the medium with synthetic (2S,3R)-3-
methylglutamic acid, it is thus possible to control the distribution
(24) (a) Hubbard, B. K.; Thomas, M. G.; Walsh, C. T. Chem. Biol. 2000, 7,
931-942. (b) Chiu, H.-T.; Hubbard, B. K.; Shah, A. N.; Eide, J.;
Fredenburg, R. A.; Walsh, C. T.; Khosla, C. Proc. Natl. Acad. Sci. U.S.A.
2001, 98, 8548-8553. (c) Choroba, O. W.; Williams, D. H.; Spencer, J.
B. J. Am. Chem. Soc. 2000, 122, 5389-5390.
(25) Fisher, S. H. J. Bacteriol. 1989, 171, 2372-2377.
9
11256 J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006

Biosynthesis of the (2S,3R)-3-Methyl Glutamate Residue
A R T I C L E S
CDCl3) δ 19.7 (SiC(CH3)3), 27.1 (SiC(CH3)3), 28.4 (OC(CH3)3), 63.4
(CHCH2O), 63.9 (CHCH2O), 83.3 (OC(CH3)3), 127.8 (COCHCH),
128.2 (Ar-C3/5), 130.4 (Ar-C4), 133.3 (Ar-C1), 135.9 (Ar-C2/6),
149.6 (CO2CH), 149.8 (COCHCH), 170.0 (CO2C(CH3)3); LRMS-ESI
(m/z): 925 ([2M + Na]+, 100%), 352 ([M - C5H7O2]+, 60%), 475
([M + Na]+, 10%). HRMS-ESI (m/z): [M + Na]+ calcd for C26H33-
NO4SiNa, 474.2077. Found, 474.2060. Anal. Calcd for C26H33NO4Si:
C, 69.14; H, 7.36; N, 3.10. Found: C, 69.1; H, 7.5; N, 3.0. IR (neat):
reduced pressure. Purification by flash chromatography (20:80 hexane/
EtOAc with 0.1% HCO2H) gave 5 (49.5 mg, 93%) as a white solid:
mp 154-156 °C; [R]D ) -8.6° (c ) 1.0, CHCl3); 1H NMR (300 MHz,
CDCl3) δ 1.21 (3H, d, J ) 6.5 Hz, CHCH3), 1.43 (9H, s, C(CH3)3),
2.12 (1H, dd, J ) 4.5, 17.0 Hz, CHaHbCHCH3), 2.37-2.47 (1H, m,
CH2CHCH3), 2.75 (1H, dd, J ) 8.5, 17.0 Hz, CHaHbCHCH3), 4.15
(1H, d, J ) 3.5 Hz, CHCH2OH); 13C NMR (75.5 MHz, CDCl3) δ 20.8
(CH3), 28.2 (C(CH3)3), 30.1 (CHCH3), 39.8 (CH2CHCH3), 66.0
(CHCO2H), 84.4 (C(CH3)3), 149.8 (NCO2), 173.0 (COCH2), 176.5
(CHCO2H). LRMS-ESI (m/z): 509.2 ([2M + Na]+, 100%), 266.1 ([M
+ Na]+, 4%). HRMS-ESI (m/z): [2M + Na]+ calcd for C22H34N2O10-
Na, 509.2111. Found, 509.2104.
ν 1778 (CdO), 1704 (CdO) cm-1
.
(4S,5S)-5-tert-Butyldiphenylsilyloxymethyl-N-tert-butyloxycar-
bonyl-4-methylpyrrolidin-2-one (3).14b Methyllithium (2.13 mL, 3.41
mmol, 1.6 M solution in diethyl ether) was added to a suspension of
Cu(I)I (0.35 g, 1.86 mmol) in anhydrous toluene (20 mL) under N2 at
-78 °C and stirred for 30 min. This mixture was allowed to warm to
-40 °C with stirring for 30 min and then cooled to -78 °C, resulting
in a solution of (CH3)2CuLi. R,â-Unsaturated lactam 2 (0.70 g, 1.55
mmol) in anhydrous toluene (10 mL) was added to the cuprate solution
at -78 °C under N2. The reaction mixture was allowed to warm to
-40 °C and stirred for 15 min. Saturated aqueous NH4Cl (50 mL) was
added, and the mixture was extracted with diethyl ether (3 × 50 mL).
The combined organic extracts were repeatedly washed with H2O (until
no blue color persisted), dried over MgSO4, filtered, and evaporated
under reduced pressure. Purification by flash chromatography (100:20
hexane/EtOAc) provided 3 (0.45 g, 62%) as a white solid: Rf 0.40
(70:30 hexane/EtOAc); mp 70-72 °C, [R]D ) -23.0° (c ) 1.0, CHCl3);
1H NMR (300 MHz, CDCl3) δ 0.96 (9H, s, SiC(CH3)3), 1.08 (3H, d,
J ) 7.0 Hz, CHCH3), 1.36 (9H, s, OC(CH3)3), 2.01 (1H, dd, J ) 2.0,
17.0 Hz, COHaHbCH), 2.32-2.42 (1H, m, CH2CHCH3), 2.91 (1H, dd,
J ) 8.5, 17.0 Hz, COCHaHbCH), 3.66 (1H, m, CHCH2O), 3.67 (1H,
dd, J ) 2.0, 13.0 Hz, CHCHaHbO), 3.78 (1H, dd, J ) 3.0, 12.0 Hz,
CHCHaHbO), 7.25-7.37 (10H, m, Ar-H); 13C NMR (75.5 MHz,
CDCl3) δ 19.5 (SiC(CH3)3), 21.8 (CHCH3), 27.2 (SiC(CH3)3), 28.4 (OC-
(CH3)3), 28.6 (CH2CHCH3), 40.8 (COCH2), 64.8 (CHCH2O), 66.6
(CHCH2O), 83.1 (OC(CH3)3), 128.2 (Ar-C3/5), 130.2 (Ar-C4), 133.1
(Ar-C1), 133.5 (Ar-C1), 135.9 (Ar-C2/6), 150.4 (NCO2), 174.8
(COCH2). LRMS-ESI (m/z): 957.6 ([2M + Na]+, 100%), 490.2 ([M
+ Na]+, 9%), 368.2 ([M - C5H7O2]+, 60%). HRMS-ESI (m/z): [M +
Na]+ calcd for C27H37NO4SiNa, 490.2390. Found, 490.2390. Anal.
Calcd for C27H37NO4Si: C, 69.34; H, 7.97; N, 2.99. Found: C, 69.5;
H, 7.9; N, 2.7.
(2S,3S)-3-Methylglutamic Acid Hydrochloride Salt (7). LiOH
(23.6 mg, 0.56 mmol) in H2O (0.5 mL) was added to lactam 5 (45.6
mg, 0.19 mmol) in THF (2 mL). The mixture was stirred for 18 h at
room temperature and evaporated under reduced pressure. H2O (5 mL)
was added to the residue, and the solution was adjusted to pH 4.0 with
CH3COOH and extracted with diethyl ether (3 × 50 mL). The combined
ethereal extracts were dried over MgSO4, filtered, and evaporated under
reduced pressure to give N-Boc-MeGlu 6 (0.041 g, 84%). A fraction
of 6 (26.0 mg, 0.010 mmol) was treated with a solution of 4 M HCl in
1,4-dioxane (2 mL), and the mixture was stirred at room temperature
under N2 for 18 h. The reaction mixture was then evaporated under
reduced pressure, H2O (10 mL) was added, and the mixture was washed
with CH2Cl2 (3 × 10 mL). The aqueous extract was evaporated under
reduced pressure, and the resulting solid was triturated with toluene to
give (2S,3S)-3-MeGlu‚HCl 7 (15.2 mg, 94%) as a white hygroscopic
solid: [R]D ) +36.7° (c ) 1.05, 6 N HCl) lit.13a,c ) +36.8 (c ) 1.03,
6 N HCl); 1H NMR (400 MHz, D2O) δ 0.78 (3H, d, J ) 6.5 Hz, CH3),
2.23 (1H, dd, J ) 7.5, 15.0 Hz, CHaHbCO2H), 2.29-2.35 (1H, m,
CHCH3), 2.41 (1H, dd, J ) 5.8, 15.0 Hz, CHaHbCO2H), 3.82 (1H, d,
J ) 2.6 Hz, CHNH2); 13C NMR (75.5 MHz, D2O) δ 14.4 (CH3), 31.1
(CHCH3), 37.5 (CH2CO2H), 57.0 (CHNH2), 171.4 (CH2CO2H), 176.3
(CHCO2H). LRMS-ESI (m/z): 162.0 ([M + H]+, 100%), 323 ([2M +
H]+, 4%). HRMS-ESI (m/z): [M + H]+ calcd for C6H12NO4, 162.0766.
Found, 162.0768.
(3R,4R,5S)-5-tert-Butyldiphenylsilyloxymethyl-N-tert-butyloxy-
carbonyl-3,4-pyrazolinepyrrolidin-2-one (8). An ethereal solution of
diazomethane (ca. 18.7 mmol in 10 mL) was added to the R,â-
unsaturated lactam 2 (0.60 g, 1.33 mmol), and the mixture was left to
stir at room temperature for 72 h. The solvent was then evaporated
under reduced pressure, and the residue was purified by flash chro-
matography (80:20 hexane/EtOAc) to give 8 (0.45 g, 68%) as a pale
(4S,5S)-N-tert-Butyloxycarbonyl-5-hydroxymethyl-4-methylpyr-
rolidin-2-one (4). A solution of tetrabutylammonium fluoride in THF
(36 mL, 1.0 M, 35.78 mmol) was added to lactam 3 (2.0 g, 4.28 mmol)
in a mixture of THF (2 mL) and 20% aqueous CH3CO2H (2.8 mL) at
0 °C. The reaction mixture was allowed to warm to room temperature
and stirred for 24 h. EtOAc (50 mL) and aqueous NH4Cl (50 mL, 20%
w/v) were added, and the organic layer was then extracted, dried over
MgSO4, filtered, and evaporated under reduced pressure. Purification
by flash chromatography (50:50 hexane/EtOAc) gave 4 (0.66 g, 67%)
as a white solid: Rf 0.19 (50:50 hexane/EtOAc); [R]D ) -46.2° (c )
yellow solid: Rf 0.21 (80:20 hexane/EtOAc); mp 53-55 °C; [R]D
)
1
-208.1° (c ) 1.0, CHCl3); H NMR (400 MHz, CDCl3) δ 1.09 (9H,
s, SiC(CH3)3), 1.47 (9H, s, OC(CH3)3), 2.58-2.64 (1H, m, COCHCH),
3.67 (1H, dd, J ) 2.0, 10.5 Hz, CHCHaHb), 3.95 (1H, m, CHCH2O),
3.98 (1H, dd, J ) 2.5, 10.5 Hz, CHCHaHb), 4.49 (1H, ddd, J ) 2.5,
5.5, 18.5 Hz, NNCHaHb), 5.16 (1H, dd, J ) 10.0, 18.5 Hz, NNCHaHb),
5.87 (1H, dd, J ) 2.5, 9.0 Hz, COCHCH), 7.39-7.65 (10H, m, Ar-
H); 13C NMR (100.6 MHz, CDCl3) δ 19.6 (SiC(CH3)3), 27.2 (SiC-
(CH3)3), 28.3 (CO2C(CH3)3), 31.1 (COCHCH), 63.4 (CHCH2O), 64.9
(CHCH2O), 83.3 (CO2C(CH3)3), 86.9 (NNCH2), 96.7 (COCHCH), 128.4
(Ar-C3/5), 130.5 (Ar-C/4), 132.5 (Ar-C1), 133.0 (Ar-C1), 135.9
(Ar-C2/6), 149.8 (COCHCH), 165.0 (CO2C(CH3)3). LRMS-ESI (m/
z): 516.0 ([M + Na]+, 100%). HRMS-ESI (m/z): [M + Na]+ calcd
for C27H35N3O4SiNa, 516.2295. Found, 516.2280. Anal. Calcd for
C27H35N3O4Si: C, 65.69; H, 7.15; N, 8.51. Found: C, 65.8; H, 7.3; N,
1
1.0, CHCl3); H NMR (300 MHz, CDCl3) δ 1.18 (3H, d, J ) 7.0 Hz,
CHCH3), 1.56 (9H, s, OC(CH3)3), 2.05 (1H, dd, J ) 3.5, 17.5 Hz,
CHaHbCHCH3), 2.23-2.28 (1H, m, CH2CHCH3), 2.79-2.88 (1H, dd,
J ) 8.5, 17.5 Hz, CHaHbCHCH3), 3.73-3.88 (3H, m, CHCH2OH);
13C NMR (75.5 MHz, CDCl3) δ 20.9 (CH3), 28.4 (C(CH3)3), 28.6
(CHCH3), 40.4 (CH2CHCH3), 64.6 (CHCH2OH), 67.2 (CHCH2OH),
83.9 (C(CH3)3), 151.6 (NCO2), 174.3 (COCH2). LRMS-ESI (m/z):
481.2 ([2M + Na]+, 100%), 252 ([M + Na]+, 2%). HRMS-ESI (m/z):
[2M + Na]+ calcd for C22H38N2O8Na, 481.2526. Found, 481.2520.
8.2. IR (neat): ν 1783 (CdO), 1712 (CdO) cm-1
.
(2S,3S)-N-tert-Butyloxycarbonyl-3-methylpyroglutamic Acid (5).
RuCl3 (1 mg, 0.005 mmol) was added to a solution of lactam 4 (50.0
mg, 0.22 mmol) in a mixture of CH3CN/CCl4/H2O (2:2:3, 1.5 mL)
with NaIO4 (0.146 g, 0.64 mmol). The reaction mixture was stirred for
3 h at room temperature. Saturated aqueous NaCl was added (10 mL),
and the mixture was extracted with CH2Cl2 (3 × 20 mL). The combined
organic extracts were dried over MgSO4, filtered, and evaporated under
(5S)-3,4-Dihydro-5-tert-butyldiphenylsilyloxymethyl-N-tert-butyl-
oxycarbonyl-4-methylpyrrolidin-2-one (9). Pyrazoline 8 (0.40 g, 0.81
mmol) was heated, under solvent-free conditions, at 120 °C for 3 h.
The residue was then purified by flash chromatography (80:20 hexane/
EtOAc) to give 9 (0.16 g, 42%) as a white solid: Rf 0.29 (80:20 hexane/
EtOAc); mp 114-117 °C; [R]D ) -80.1° (c ) 1.0, CHCl3); 1H NMR
(400 MHz, CDCl3) δ 1.01 (9H, s, SiC(CH3)3), 1.46 (9H, s, OC(CH3)3),
9
J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006 11257

A R T I C L E S
Milne et al.
2.04 (3H, s, CHCCH3), 3.92 (1H, dd, J ) 2.0, 11.0 Hz, CHCHaHbO),
4.23 (1H, dd, J ) 3.5, 11.0 Hz, CHCHaHbO), 4.42 (1H, br, CHCH2O),
5.94 (1H, br, CHCCH3), 7.38-7.64 (10H, m, Ar-H); 13C NMR (100.6
MHz, CDCl3) δ 15.5 (CHCCH3), 19.9 (SiC(CH3)3), 27.3 (SiC(CH3)3),
28.7 (OC(CH3)3), 61.3 (CHCH2O), 66.5 (CHCH2O), 84.0 (OC(CH3)3),
124.1 (CHCCH3), 128.5 (Ar-C3/5), 130.5 (Ar-C4), 133.3 (Ar-C1),
133.7 (Ar-C1), 136.2 (Ar-C2/6), 149.9 (CHCCH3), 161.1 (NCO2),
170.4 (COCHC). LRMS-ESI (m/z): 953.0 ([2M + Na]+, 100%), 488
([M + Na]+, 80%). HRMS-ESI (m/z): [M + Na]+ calcd for
C27H35N3O4SiNa, 488.2233. Found, 488.2216. Anal. Calcd for C27H35-
NO4Si: C, 69.94; H, 7.58; N, 3.01. Found: C, 69.7; H, 7.6; N, 2.9. IR
CHNH); 13C NMR (100.6 MHz, D2O) δ 14.3 (CHCH3), 27.8 (C(CH3)3),
31.9 (CHCH3), 37.9 (CH2CH), 57.1 (CHNH), 81.7 (C(CH3)3), 158.2
(NHCO), 176.0 and 177.0 (both CO2H). LRMS-ESI (m/z): 284 ([M
+ Na]+,100%), 545 ([2M + Na]+, 40%). HRMS-ESI (m/z): [M +
Na]+ calcd for C11H19NO6Na, 284.1110. Found, 284.1119. IR (neat):
ν 3321 (OH), 1708 (CdO) cm-1
.
(2S,3R)-3-Methylglutamic Acid Hydrochloride Salt (14). Aci-
dolysis of 13 (20 mg, 0.076 mmol) as described above (6 f 7) gave
(2S,3R)-3-MeGlu‚HCl 14 (9.3 mg, 75%) as a hygroscopic white solid:
[R]D ) +22.1° (c ) 1.01, 6 N HCl) lit.13a,c ) +22.6 (c ) 1.03, 6 N
1
HCl); H NMR (400 MHz, D2O) δ 0.93 (3H, d, J ) 6.8 Hz, CH3),
(neat): ν 1781 (CdO), 1708 (CdO) cm-1
.
2.30-2.35 (1H, m, CHaHbCH), 2.46-2.57 (2H, m, CHaHbCH), 3.90
(1H, d, J ) 4.2 Hz, CHCO2H); 13C NMR (100.6 MHz, D2O) 14.9 (CH3)
31.0 (CH2CH), 37.5 (CH2COOH), 58.0 (CHN) 172.3 (CH2CO2H), 176.3
(CHCO2H). LRMS-ESI (m/z): 162.1 ([M - Cl]+, 38%), 184.1 ([M -
HCl + Na]+, 18%). HRMS-ESI (m/z): [M - Cl]+ calcd for C6H12-
NO4, 162.0761. Found, 162.0760. IR (neat): ν 2937 (OH), 1718 (Cd
(4R,5S)-5-tert-Butyldiphenylsilyloxymethyl-N-tert-butyloxycar-
bonyl-4-methylpyrrolidin-2-one (10). Platinum(IV) oxide (40 mg) was
added to a solution of R,â-unsaturated lactam 9 (0.36 g, 0.77 mmol) in
EtOAc (30 mL). The reaction mixture was stirred at room temperature
under an atmosphere of H2 for 18 h, filtered through Celite, and then
evaporated under reduced pressure and purified by flash chromatog-
raphy (1:1 hexane/EtOAc) to give 10 (0.28 g, 80%) as a white solid:
Rf 0.29 (80:20 hexane/EtOAc); mp 126-128 °C; [R]D ) -25.3° (c )
O) cm-1
.
3-Methyl-2-nitropentanedioic Acid Dimethyl Ester (17). 1,8-
Diazabicyclo[5.4.0]undeca-7-ene (DBU) (1.25 mL, 8.39 mmol) was
added to a mixture of methyl crotonate 15 (6.23 mL, 58.78 mmol) and
methyl nitroacetate 16 (1.0 g, 8.39 mmol) in anhydrous THF (10 mL)
under N2 at room temperature and stirred in the absence of light for 72
h. Aqueous HCl (1.2 M, 100 mL) was then added, and the mixture
was extracted with diethyl ether (3 × 50 mL), dried over MgSO4,
filtered, and evaporated under reduced pressure. Purification by flash
chromatography (90:10 toluene/EtOAc) gave 17 (1.4 g, 76%) as a
1
1.0, CHCl3); H NMR (400 MHz, CDCl3) δ 0.96 (9H, s, SiC(CH3)3),
0.18 (3H, dd, J ) 5.5, CHCH3), 1.33 (9H, s, OC(CH3)3), 2.40-2.53
(2H, m, CHaHbCHCH3 and CHaHbCHCH3), 2.64 (1H, dd, J ) 11.0,
15.0 Hz, CHaHbCHCH3), 3.68 (1H, dd, J ) 2.5, 12.0 Hz, CHCHaHbO),
3.90-3.92 (2H, m, CHCHaHbO and CHCH2O), 7.28-7.60 (10H, m,
Ar-H); 13C NMR (100.6 MHz, CDCl3) δ 14.6 (CHCH3), 19.4
(SiC(CH3)3), 27.2 (SiC(CH3)3), 28.4 (CO2C(CH3)3), 30.5 (CHCH3), 41.2
(CH2CHCH3), 62.4 (CHCH2O), 62.4 (CHCH2O), 83.8 (OC(CH3)3),
128.2 (Ar-C3/5), 130.2 (Ar-C4), 132.7 (Ar-C1), 133.3 (Ar-C1),
136.0 (Ar-C2/6), 150.1 (NCO2), 175.3 (COCH2). LRMS-ESI (m/z):
957 ([2M + Na]+, 100%), 490 ([M + Na]+, 15%). HRMS-ESI (m/z):
[M + Na]+ calcd for C27H37NO4SiNa, 490.2390. Found, 490.2393.
Anal. Calcd for C27H37NO4Si: C, 69.34; H, 7.97; N, 2.99. Found: C,
1
colorless oil: Rf 0.13 (toluene); H NMR (300 MHz, CDCl3) δ 1.09
(3H, d, J ) 6.5 Hz, CHCH3), 2.40-2.50 (2H, m, CH2CO2CH3), 2.85-
2.98 (1H, m, CHCH3), 3.63 (3H, s, CH2CO2CH3), 3.77 (3H, s,
CHCO2CH3), 5.24 (1H, dd, J ) 6.5, 15.0 Hz, CHNO2); 13C NMR (75.5
MHz, CDCl3) δ 16.4 (CHCH3), 31.8 (CHCH3), 37.0 (CHCH2CO2CH3),
52.2 (CHCO2CH3), 53.8 (CH2CO2CH3), 91.0 (CHNO2), 164.4 (CH2CO2),
171.9 (CHCO2). LRMS-ESI (m/z): 242.1 ([M + Na]+, 100%). HRMS-
ESI (m/z): [M + Na]+ calcd for C8H13NO6Na, 242.0641. Found,
242.0648.
69.5; H, 8.2; N, 3.1. IR (neat): ν 1784 (CdO), 1710 (CdO) cm-1
.
(4R,5S)-N-tert-Butyloxycarbonyl-5-hydroxymethyl-4-methylpyr-
rolidin-2-one (11). Lactam 10 (100 mg, 0.22 mmol) was deprotected
with tetrabutylammonium fluoride as described above (3 f 4).
Purification by flash chromatography (35:65 hexane/EtOAc) gave 11
(37 mg, 73% yield) as a white solid: Rf 0.17 (50:50 hexane/EtOAc);
mp 120-122 °C; 1H NMR (400 MHz, CDCl3) δ 1.21 (3H, dd, J ) 6.5
Hz, CHCH3), 1.54 (9H, s, C(CH3)3), 2.40-2.61 (3H, m, CH2CHCH3),
3.80 (1H, dd, J ) 2.5, 11.5 Hz, CHCHaHbOH), 4.02-4.07 (2H, m,
CHCHaHbOH); 13C NMR (100.6 MHz, CDCl3) δ 14.7 (CHCH3), 28.5
(C(CH3)3), 30.4 (CHCH3), 40.9 (CH2CHCH3), 61.4 (CHCH2OH), 62.8
(CHCH2OH), 83.5 (C(CH3)3), 150.9 (NCO2), 175.4 (COCH2). LRMS-
ESI (m/z): 481 ([2M + Na]+, 100%), 252 ([M + Na]+, 25%). HRMS-
ESI (m/z): [M + Na]+ calcd for C11H19NO4Na, 252.1212. Found,
3-Methyl-2-oxopentanedioic Acid Dimethyl Ester (19). 2-Nitro-
pentanedioate derivative 17 (1.0 g, 4.28 mmol) was dissolved in
methanol (8.57 mL) and treated with NaOCH3 in CH3OH (0.77 mL,
4.29 mmol, 30% w/v) under N2 at room temperature with stirring. A
solution of ammonium acetate (7.93 g, 12.8 mmol) in H2O (15 mL)
was then added to the Ti(III)Cl in 2 M aqueous HCl (8.82 mL, 17.15
mmol, 30% w/v). The resulting TiCl3-NH4CH3CO2 solution was then
added in one portion to the reaction mixture containing the anion 17.
After stirring for 1.5 h, the reaction mixture was extracted with diethyl
ether (4 × 50 mL), and the combined organic extracts were dried over
MgSO4, filtered, and evaporated under reduced pressure. Purification
by flash chromatography (10:1 toluene/EtOAc) gave the ketone 19 (0.23
g, 26%) and the corresponding oxime 18 (0.35 g, 38%) as oils. The
oxime 18 (0.23 g, 1.13 mmol) was then dissolved in methanol (15 mL)
with concentrated HCl (5 mL). Aqueous HCOH (10 mL, 37% w/v)
was then added, and the mixture was stirred at room temperature for
18 h. H2O (100 mL) was then added, and the mixture was extracted
with diethyl ether (3 × 100 mL). The combined organic extracts were
dried over MgSO4, filtered, and evaporated under reduced pressure.
Purification by flash chromatography (10:1 toluene/EtOAc) gave the
further ketone 19 (total 410 mg, 51%): 1H NMR (400 MHz, CDCl3)
δ 1.22 (3H, d, J ) 7.5 Hz, CH3), 2.50-2.56 (1H, dd, J ) 5, 16.5 Hz,
CHaHbCO2CH3), 2.83-2.89 (1H, dd, J ) 9, 16.5 Hz, CHaHbCO2CH3),
3.68-3.7 (1H, m, CHCH3), 3.68 (3H, s, CO2CH3), 3.92 (3H, s,
COCO2CH3); 13C NMR (100.6 MHz, CDCl3) δ 16.3 (CH3), 37.2 (CH2),
38.6 (CHCH3), 52.4 (CH2CO2CH3), 53.4 (COCO2CH3), 161.6 (CH2CO2-
CH3), 172.6 (COCO2CH3), 196.3 (COCO2CH3). LRMS-EI/CI (m/z):
206 ([M + NH4]+, 100%). HRMS-ESI (m/z): [M + NH4]+ calcd for
C8H16NO5, 206.1023. Found, 206.1024. IR (neat): ν 1729 (CdO), 1801
252.1217. IR (neat): ν 3425 (OH), 1774 (CdO) cm-1
.
(2S,3R)-N-tert-Butyloxycarbonyl-3-methylpyroglutamic Acid (12).
Alcohol 11 (100 mg, 0.22 mmol) was oxidized with RuO4, and the
product was purified as described above (4 f 5), resulting in 12 (37
mg, 70% yield) as a white solid: 1H NMR (300 MHz, CDCl3) δ 1.16
(3H, d, J ) 6.5 Hz, CHCH3), 1.49 (9H, s, C(CH3)3), 2.38 (1H, dd, J )
11.5, 16.5 Hz, CHaHbCHCH3), 2.56-2.78 (2H, m, CHaHbCHCH3), 4.58
(1H, d, J ) 8.5 Hz, CHCO2H); 13C NMR (75.5 MHz, CDCl3) δ 14.1
(CHCH3), 26.8 (C(CH3)3), 27.4 (CHCH3), 37.9 (CH2CHCH3), 62.3
(CHCO2H), 83.0 (C(CH3)3), 148.2 (NCO2), 172.4 (COCH2), 174.2
(CHCO2H). LRMS-ESI (m/z): 509 ([2M + Na]+, 100%), 282 ([M +
K]+, 20%), 266 ([M + Na]+, 5%). HRMS-ESI (m/z): [M + Na]+ calcd
for C11H17NO5Na, 266.1004. Found, 266.0993. IR (neat): ν 3215 (OH),
1783 (CdO) cm-1
.
(2S,3R)-N-tert-Butoxycarbonyl-3-methylglutamic Acid (13). The
lactam 12 (29 mg, 0.12 mmol) was hydrolyzed with LiOH as described
above (5 f 6) to give 13 (21.5 mg, 69%) as a white solid: 1H NMR
(300 MHz, D2O) δ 0.77 (3H, d, J ) 7.0 Hz, CHCH3), 1.28 (9H, s,
C(CH3)3), 2.16-2.49 (3H, m, CH2CH), 4.15 (1H, d, J ) 4.0 Hz,
(CdO) cm-1
.
9
11258 J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006

Biosynthesis of the (2S,3R)-3-Methyl Glutamate Residue
A R T I C L E S
(()-3-Methyl-2-oxoglutarate Disodium Salt (20). The ketone 19
(100 mg 0.463 mmol) in 1,4-dioxane (5 mL) was treated with aqueous
NaOH solution (5 mL, 0.28 M, 1.40 mmol) at room temperature and
stirred for 18 h. The mixture was then evaporated under reduced
pressure and concentrated in vacuo to provide 20 (72 mg, 77%) as a
white solid: 1H NMR (400 MHz, D2O) δ 1.02 (3H, d, J ) 7.0 Hz,
CH3), 2.06 (1H, dd, J ) 8.5, 15.0 Hz, CHaHbCH), 2.45-2.49 (1H, dd,
J ) 6.0, 15.0 Hz, CHaHbCH), 3.18-3.20 (1H, m, CHCH3); 13C NMR
(75.5 MHz, D2O) δ 14.8 (CH3), 39.6 (CH2), 40.3 (CH), 171.5
(CH2CO2), 181.0 (COCO2), 209.3 (COCO2). LRMS-ESI- (m/z): 159.0
([M - 2Na + H]-, 100%). HRMS-ESI- (m/z): [M - 2Na + H]-
calcd for C6H7O5, 159.0299. Found, 159.0300.
Production and Purification of CDA4a and CDA3a: Sterile SV23a
liquid media (5 L) was inoculated with agar plugs of S. coelicolor
MT1110 from a 3 day R5 plate.26 The cultures were then incubated
at 28 °C and 180 rpm for 5 days. The cells were harvested by
centrifugation. The resulting supernatants were acidified to pH 2.0 by
the addition of aqueous HCl (0.5 M), and the crude CDA was extracted
using Varian C-18 Bond Elute SPE cartridges (2 g). The cartridges
were washed with H2O (120 mL), eluted with CH3OH (60 mL), and
the eluant was evaporated under reduced pressure. Purification of the
crude extracts was achieved by repeated preparative and semipreparative
reversed phase HPLC: Phenomenex C-18 10 µm, 250 × 21.2 mm,
and 5 µm, 250 × 10 mm columns; solvent A was H2O with 0.1%
HCO2H, and solvent B was acetonitrile with 0.1% HCO2H. The flow
rate was 20 and 5 mL min-1, respectively, with a starting gradient of
0% B and 100% A, increasing to 100% B over 30 min and then held
for a further 5 min. Separate fractions for CDA3a and CDA4a (retention
time ) ca. 16.0 and 16.2 min, respectively) were pooled and evaporated
under reduced pressure to give pure CDA4a (11 mg L-1) and CDA3a
(2 mg L-1), which were identical to samples isolated and characterized
previously.3a,9
Hydrolysis, Derivatization, and LC-MS Analysis of 3-MeGlu
from Daptomycin and CDA4a. Daptomycin or CDA4a (10 mg) was
heated at reflux in 6 M aqueous HCl (40 mL) under oxygen-free
conditions for 24 h. The aqueous solution was extracted with ethyl
acetate (20 mL) and lyophilized under reduced pressure. Dabsyl chloride
(15 mM) in acetone (400 µL) was added to a solution of the amino
acid hydrolysate in aqueous NaHCO3 (400 µL, 0.15 M, pH 9.0).17 The
mixture was heated at 70 °C for 20 min and diluted with EtOH (total
2 mL), centrifuged at 5000 g for 5 min, and the supernatant analyzed
by LC-MS. Synthetic (2S,3R)- and (2S,3S)-3-MeGlu standards (1-2
mg) were similarly dabsylated and analyzed.
LC-MS analysis was carried out on a Micromass LCT orthogonal
acceleration time-of-flight mass spectrometer, equipped with an
electrospray ionization source run in positive mode (scanning from 100
to 1000 m/z) combined with a Waters 2790 separation module. Gradient
elution was carried out using a reversed phase C-18 column, 3 µm
150 × 4.6 mm (Phenomenex). Solvent A was H2O with 1% acetonitrile
and 0.1% HCO2H, and solvent B was acetonitrile with 1% H2O and
0.1% HCO2H. The flow rate was 1 mL min-1 with a gradient of 20%
B and 80% A, increasing to 70% B over 10 min and then increasing
to 100% B over the next minute and then held for a further 4 min.
Deletion of glmT from S. coelicolor MT1110. A standard “double
cross over” gene replacement strategy3a was used to delete glmT
(SCO3215) from the chromosome of the S. coelicolor MT1110 wild-
type strain. A delivery plasmid was generated by cloning into E. coli
plasmid pMT3000, using host strain E. coli XL1 BLUE, two fragments
A and B that flank the chromosomal sequence to be deleted. The
upstream fragment A was generated by PCR using StE8 cosmid DNA27
as the template with the forward primer (5′-AAGAATTCTCGAT-
CACCGCGACCCGTGGC, encompassing the nucleotide coordinates
3523243 to 3523263 and an EcoRI site underlined) and reverse primer
(5′-AATCTAGATCACGGTGGGTCCGCTCGTCT encompassing the
nucleotide coordinates 3525205 to 3525224 and a XbaI site). The
downstream fragment B was similarly generated using the same cosmid
as the template with the forward primer (5′-AATCTAGATCACG-
GTGGGTCCGCTCGTCT, encompassing the nucleotide coordinates
3525840 to 3525860 and a XbaI site) and reverse primer (5′-
AAGAAGCTTCAGCATCGTGTCCGGTGCCCC, encompassing the
nucleotide coordinates 3527324 to 3527344 and a HinDIII site). The
cloned deletion fragment A+B was extracted from the plasmid by
restriction digestion, with BglII, purified, and then used in a ligation
reaction with BamHI restriction digested pMAH vector18 (via a BamHI:
BglII ligation). The ligation mix was in turn used to transform E. coli
XL1 BLUE competent cells from which the pMAH vector containing
the deletion construct was re-isolated and similarly used to transform
E. coli strain ET12567. The resulting nonmethylated plasmid was then
used to transform protoplasts of S. coelicolor MT1110. Spores were
prepared from hygromycin-resistant colonies, and Hyg-sensitive col-
onies (putative deletants) were identified following two rounds of
nonselective subculturing. Total DNA extraction26 followed by PCR
analysis confirmed the loss of ca. 615 bp from within glmT (see
Supporting Information).
Recomplementation of S. coelicolor ∆glmT with 3-Methyl-
glutamates and 3-Methyl-2-oxoglutarate. Small-scale liquid feeding
experiments were carried out in SV23a media (7 mL) inoculated with
one 5 mm plug from a 3 day R5 agar plate of ∆glmT. The cultures
were then incubated at 28 °C, 180 rpm, for 2 days. Filter-sterilized
aqueous solutions of substrates 7, 14, and rac-7/14 were then added to
give final concentrations of 50, 100, 200, and 300 µg mL-1 (of each
stereoisomer). The substrate 3-methyl-2-oxoglutarate 20 was similarly
fed at the following final concentrations of 0.5, 1.06, 1.37, and 2.25
mg mL-1. After a total of 6 days fermentation, the cultures were
harvested by centrifugation, and the supernatants were adjusted to pH
2.0, extracted on Varian C-18 Bond Elute SPE cartridges (0.5 g), eluted
with MeOH (2 mL), and evaporated in vacuo. Extracts were then
analyzed by LC-MS (as above except scanning from 700 to 1700 m/z).
Acknowledgment. This work was supported by the BBSRC
through research grants (36/B12126 and BB/C503662) and
through studentships to C.M., A.P., and J.J. Biotica Technology
Ltd. and GlaxoSmithKline are also acknowledged for CASE
awards and support to A.P. and C.M., respectively. We also
thank Drs. Barrie Wilkinson and Fiona Flett for helpful advice
and discussion, and the EPSRC National Mass Spectrometry
Centre (University of Wales, Swansea).
Supporting Information Available: LC-MS data from feed-
ing synthetic precursors along with further results and experi-
mental details. This material is available free of charge via the
Internet at http://pubs.acs.org.
JA062960C
(27) Redenbach, M.; Kieser, H. M.; Denapaite, D.; Eicher, A.; Cullumn, J.;
Kinashi, H.; Hopwood, D. A. Mol. Microbiol. 1996, 21, 77-96.
(28) Lakey, J. H.; Lea, E. J. A.; Rudd, B. A. M.; Wright, H. M.; Hopwood, D.
A. J. Gen. Microbiol. 1983, 129, 3565-3573.
(26) Kieser, T.; Bibb, M. J.; Buttner, M. J.; Chater, K. F.; Hopwood, D. A.
Practical Streptomyces Genetics: A Laboratory Manual; The John Innes
Foundation: Norwich, U.K., 2000.
9
J. AM. CHEM. SOC. VOL. 128, NO. 34, 2006 11259