An efficient synthesis and biological screening of benzofuran and benzo[d]isothiazole derivatives for Mycobacterium tuberculosis DNA GyrB inhibition

Article abstract of DOI:10.1016/j.bmc.2014.10.016

A series of twenty eight molecules of ethyl 5-(piperazin-1-yl)benzofuran-2-carboxylate and 3-(piperazin-1-yl)benzo[d]isothiazole were designed by molecular hybridization of thiazole aminopiperidine core and carbamide side chain in eight steps and were screened for their in vitro Mycobacterium smegmatis (MS) GyrB ATPase assay, Mycobacterium tuberculosis (MTB) DNA gyrase super coiling assay, antitubercular activity, cytotoxicity and protein-inhibitor interaction assay through differential scanning fluorimetry. Also the orientation and the ligand-protein interactions of the top hit molecules with MS DNA gyrase B subunit active site were investigated applying extra precision mode (XP) of Glide. Among the compounds studied, 4-(benzo[d]isothiazol-3-yl)-N-(4-chlorophenyl)piperazine-1-carboxamide (26) was found to be the most promising inhibitor with an MS GyrB IC₅₀ of 1.77 ± 0.23 μM, 0.42 ± 0.23 against MTB DNA gyrase, MTB MIC of 3.64 μM, and was not cytotoxic in eukaryotic cells at 100 μM. Moreover the interaction of protein-ligand complex was stable and showed a positive shift of 3.5 °C in differential scanning fluorimetric evaluations.

Full text of DOI:10.1016/j.bmc.2014.10.016

Bioorganic & Medicinal Chemistry 22 (2014) 6552–6563
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
An efficient synthesis and biological screening of benzofuran
and benzo[d]isothiazole derivatives for Mycobacterium tuberculosis
DNA GyrB inhibition
Kummetha Indrasena Reddy b, Konduri Srihari b, Janupally Renuka a, Komanduri Shruthi Sree a,
Aruna Chuppala b, Variam Ullas Jeankumar a, Jonnalagadda Padma Sridevi a, Kondra Sudhakar Babu b,
,
⇑
Perumal Yogeeswari a, Dharmarajan Sriram a,
⇑
a Department of Pharmacy, Birla Institute of Technology & Science-Pilani, Hyderabad Campus, Jawaharnagar, Shameerpet, Hyderabad 500078, India
b Department of Chemistry, Sri Krishnadevaraya University, Anantapur 515055, India
a r t i c l e i n f o
a b s t r a c t
Article history:
A series of twenty eight molecules of ethyl 5-(piperazin-1-yl)benzofuran-2-carboxylate and 3-(piperazin-
1-yl)benzo[d]isothiazole were designed by molecular hybridization of thiazole aminopiperidine core and
carbamide side chain in eight steps and were screened for their in vitro Mycobacterium smegmatis (MS)
GyrB ATPase assay, Mycobacterium tuberculosis (MTB) DNA gyrase super coiling assay, antitubercular
activity, cytotoxicity and protein–inhibitor interaction assay through differential scanning fluorimetry.
Also the orientation and the ligand–protein interactions of the top hit molecules with MS DNA gyrase
B subunit active site were investigated applying extra precision mode (XP) of Glide. Among the com-
pounds studied, 4-(benzo[d]isothiazol-3-yl)-N-(4-chlorophenyl)piperazine-1-carboxamide (26) was
Received 26 August 2014
Revised 10 October 2014
Accepted 14 October 2014
Available online 18 October 2014
Keywords:
Tuberculosis
Antitubercular
DNA gyrase
found to be the most promising inhibitor with an MS GyrB IC50 of 1.77 0.23
l
M, 0.42 0.23 against
M. Moreover
MTB DNA gyrase, MTB MIC of 3.64 M, and was not cytotoxic in eukaryotic cells at 100
l
l
Benzofuran
the interaction of protein–ligand complex was stable and showed a positive shift of 3.5 °C in differential
scanning fluorimetric evaluations.
Benzo[d]isothiazole
Cytotoxicity
Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction
shows enhanced relaxation, DNA cleavage, and decatenation activ-
ities.6 DNA gyrase is a heterotetramer with two subunits, gyrase A
Tuberculosis continues to be a global threat with highest mor-
bidity and mortality rates worldwide, killing approximately 1.3
million in 2012.1 Mycobacterial infections remain to be the largest
cause of death worldwide.2 Furthermore, rapid emergence of
extensive drug-resistant tuberculosis (XDR-TB) and multidrug-
(GyrA) and gyrase B (GyrB), that together form a functional hetero-
dimer structure A2B2. While the GyrA subunit is primarily
involved in the breakage and reunion of the bacterial DNA, subse-
quently the GyrB subunit possesses an ATP-ase activity.7 While the
GyrA subunit has been well understood with most of the fluoro-
quinolones targeting it but not much has been explored on the
GyrB subunit except one approved antibiotic, novobiocin that has
been withdrawn from the market due to severe safety concern
and poor pharmacological properties.8 Moreover, GyrB has been
genetically demonstrated to be a bactericidal drug target in MTB,
but till date there have not been any effective therapeutics devel-
oped against this target for TB which was why we made an attempt
toward synthesis of a chemical class of molecules targeting the
GyrB subunit.9 In this study we disclose two novel classes of
mycobacterial DNA gyrase B inhibitors developed via molecular
hybridization of earlier reported GyrB leads. The designed mole-
cules were subsequently synthesized and evaluated in vitro for
their ability to inhibit DNA gyrase B enzyme and whole cell MTB
as steps toward the derivation of structure–activity relationship.
resistant tuberculosis (MDR-TB) are
a major concern with
currently used first-line TB drugs which are 40 years old and
second-line drugs possessing variable efficacy and serious side
effects.1 Hence design of new inhibitors with novel mechanisms
of action, greater efficacy against mycobacterial enzymes that aid
in newer combination regimens for treating MDR-TB and XDR-TB
are in urgent need.3,4 In general, bacterial type II topoisomerases
(DNA gyrase and DNA topoisomerase IV) are clinically proven as
antibacterial targets, while Mycobacterium tuberculosis (MTB) is
unusual in that it possess only one type II topoisomerase that is
DNA gyrase.5 Though the main function is to supercoil DNA, it also
⇑
Corresponding authors. Tel.: +91 40663030506; fax: +91 4066303998 (D. S.).
E-mail address: dsriram@hyderabad.bits-pilani.ac.in (D. Sriram).
http://dx.doi.org/10.1016/j.bmc.2014.10.016
0968-0896/Ó 2014 Elsevier Ltd. All rights reserved.

K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
6553
The thermal stability of the protein with the most potent ligand
was also ascertained biophysically through differential scanning
fluorimetry experiment.
enhance the hydrophobicity of the lead molecule to facilitate the
affinity toward the GyrB domain was attempted. On the right hand
core, various urea and thiourea derivatives were introduced in
both the series to increase stability and also to explore the steric
and electronic effects on the antimycobacterial potency. An
additional optimization strategy was the replacement of the
N-linked aminopiperidine between the LHS and the RHS groups
with a piperazine core. Thus a set of twelve compounds in each
series were designed and synthesized and as presented in Tables
1 and 2.
The designed ligands (Series 1 and 2) were constructed by a sim-
ple and straightforward strategy as shown in Schemes 1 and 2. To
prepare benzofuran based leads (compounds 9–22), the ligands
were assembled by following the protocol depicted in Scheme 1.
Scaffold ethyl 5-(piperazin-1-yl)benzofuran-2-carboxylate (8) was
prepared by reported procedure,10 in brief synthesis began by
nitrating the salicylaldehyde (4). The so obtained 2-hydroxy-
5-nitrobenzaldehyde (4) on subsequent treatment with ethyl
bromoacetate in presence of sodium carbonate in N-methyl pyrrol-
idine gave ethyl 5-nitrobenzofuran-2-carboxylate in good yields
and purity. Subsequent reduction of the nitro group at the 5th
position of the benzofuran core gave the corresponding ethyl
5-aminobenzofuran-2-carboxylate (7) in excellent yields. This (7)
on further alkylation with bis-(2-chloroethyl)amine using sodium
carbonate as base in 1-propanol gave the scaffold 8. The final
library (9–22) was then assembled by coupling the so obtained
ethyl 5-(piperazin-1-yl)benzofuran-2-carboxylate (8) with various
commercially available isocyanates and thiocyanates as depicted in
Table 1.
2. Results and discussion
2.1. Design and synthesis
Information on the common properties of the binding groups is
essential for resolving the type of inhibitor binding to the target
protein. We had previously designed and developed various classes
of inhibitors as mycobacterial GyrB inhibitors utilizing the concept
of molecular hybridization.8 The preliminary structure–activity
profiling studies of these leads provided valuable information
regarding the basic structural requirements for achieving selective
inhibition of mycobacterium GyrB. An imperative from our
previous research efforts revealed the importance of hydrophobic
interactions in bringing specificity toward the mycobacterial GyrB
protein. These findings were equally supported by the crystallo-
graphic characterization of the aminopyrazinamide analogs to
GyrB protein by researchers from AstraZeneca and reported that
the presence of a unique hydrophobic pocket in the active site
brought specificity toward the mycobacterial GyrB protein. Having
understood the important structural requisite for bringing about
specificity and potency toward the mycobacterial GyrB domain,
we envisaged re-engineering of the previously reported leads
(compounds 1, 2 and 3 in Fig. 1) to deliver a novel scaffold/lead
with better antimycobacterial activity via inhibition of the gyrase
domain. The design strategy utilized for developing the inhibitor
has been sketched in Figure 1. Optimization of the structural
classes was guided by two main criteria (i) to enhance hydropho-
bicity of the molecule so as to facilitate affinity toward the GyrB
domain and (ii) to evaluate steric and electronic effects that could
enhance the antimycobacterial potency. Chemical structure of
previously reported synthetic inhibitors of DNA GyrB bearing a
benzofuran core (1),10 urea side chain (2–3)11 were selected for
the design of novel inhibitors through molecular hybridization
(Series 1 and 2).
The synthetic strategy followed for developing the Series 2
(25–38) has been sketched in Scheme 2. As depicted, synthesis
started with alkylation of commercially available 3-chloro-1,
2-benzisothiazole with piperazine in refluxing ethanol, to give
3-(piperazin-1-yl)benzo[d]isothiazole in good yields. The dialky-
lated side product was countered by adding excess of piperazine.
The final library (25–38) was then generated by coupling the so
obtained 3-(piperazin-1-yl)benzo[d]isothiazole with various com-
mercially available isocyanates and thiocyanates as depicted in
Table 2.
In our effort, starting from previously reported GyrB inhibitors,
optimization at the left hand core was conducted simultaneously
by two approaches. In the first approach we retained a more
hydrophobic benzofuran nucleus was employed (compound 1)
and in the second approach, we introduced an isothiazole group
in place of benzofuran core. Overall, a rationalized effort to
2.2. Pharmacological evaluation
ATPase assay was done using Mycobacterium smegmatis (MS)
GyrB protein, which was cloned into a prokaryotic expression
R
Figure 1. Strategy employed for designing the lead.

6554
K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
Table 1
In vitro evaluation of the synthesized derivatives
R
Compd
R
MS GyrB assay (IC50) (
lM)
MTB supercoiling assay (IC50) (
lM)
MTB MIC (
lM)
Cytotoxicity (% inhib.)
9
10
11
12
13
14
15
16
17
18
19
20
21
22
Phenyl
16.89 0.33
20.67 0.55
7.86 0.26
5.07 0.44
8.19 0.33
4.32 0.21
2.97 0.12
15.63 0.74
35.18 0.41
27.34 1.32
12.91 0.74
24.39 0.82
20.45 0.88
29.90 0.62
180 3.9 nM
nd
7.14 0.48
18.2 0.18
3.55 0.33
2.93 0.31
7.33 0.71
3.12 0.25
1.61 0.18
7.2 0.35
13.24 0.22
16.9 1.56
10.55 0.11
19.8 0.77
9.1 0.34
11.25 0.51
46 10 nM
nd
92.62
16.76
83.54
16.30
4.24
35.46
64.61
35.26
16.06
31.52
62.57
16.25
33.91
62.03
nd
21.30
19.23
21.63
19.57
19.90
40.87
21.60
22.89
29.98
21.19
25.82
20.65
45.84
41.48
nd
4-Chlorophenyl
4-Acetylphenyl
4-Nitrophenyl
4-Methoxyphenyl
Benzyl
4-Chlorobenzyl
Phenyl
4-Chlorophenyl
4-Acetylphenyl
4-Nitrophenyl
4-Methoxyphenyl
Benzyl
4-Chlorobenzyl
Novobiocin
Isoniazid
Rifampicin
Ofloxacin
Ethambutol
0.66
0.23
2.16
0.66
nd
nd
nd
nd
nd
nd
nd
nd
nd
nd
Nd indicates not determined.
Table 2
In vitro evaluation of the synthesized derivatives
S
Compd
R
MS GyrB assay (IC50) (
lM)
MTB supercoiling assay (IC50) (
lM)
MTB MIC (
lM)
Cytotoxicity (% inhib.)
25
26
27
28
29
30
31
32
33
34
35
36
37
38
Phenyl
19.87 0.77
1.77 0.14
29.3 0.92
27.11 0.64
26.18 0.63
2.36 0.31
6.88 0.35
9.14 0.38
9.32 0.26
11.09 0.43
1.81 0.24
2.86 0.21
45.97
4.59 0.24
0.42 0.23
9.51 0.21
12.2 0.66
12.2 0.31
1.18 0.23
3.55 0.17
3.9 0.62
4.21 0.26
8.4 0.45
0.83 0.19
1.05 0.31
>25
68.92
3.44
28.70
28.51
14.72
1.9
14.1
15.22
3.51
13.82
13.72
3.54
14.72
6.82
nd
26.99
20.29
20.18
20.86
37.62
30.2
29.08
39.28
44.18
40.70
27.56
18.99
19.06
25.94
nd
4-Chlorophenyl
4-Acetylphenyl
4-Nitrophenyl
4-Methoxyphenyl
Benzyl
4-Chlorobenzyl
Phenyl
4-Chlorophenyl
4-Acetylphenyl
4-Nitrophenyl
4-Methoxyphenyl
Benzyl
4-Chlorobenzyl
11.32 0.55
180 3.9 nM
nd
nd
nd
4.4 0.41
46 10 nM
nd
nd
nd
Novobiocin
Isoniazid
Rifampicin
Ofloxacin
Ethambutol
0.66
0.23
2.16
0.66
nd
nd
nd
nd
nd
nd
Nd indicates not determined.
vector pQE2 and expressed in BL21 (DE3) pLysS cells. The
expressed protein was further induced with a final concentration
compounds showed more than 75% of inhibition at 200
lM, and
on further testing at concentrations of 100 and 50 M, thirteen
l
of 0.1 mM IPTG (isopropyl-b-
D
-thiogalactopyranoside), purified
compounds was found to exhibit inhibition more than 60%. Further
using Ni-NTA column and further identified by 10% SDS–PAGE.
All the synthesized compounds were biologically evaluated for
their in vitro MS GyrB ATPase assay. All the twenty eight
the compounds 11, 12, 13, 14, 15, 19, 26, 30, 31, 32, 33, 35 and 36
were tested at 25, 10, 5, 1 and 0.5
lM concentrations to calculate
their IC50s. Compound 26 was found to be the most potent

K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
6555
d
R
N
H
Scheme 1. Synthetic protocol adopted to achieve the designed ligands 9–22.
Scheme 2. Synthetic protocol adopted to achieve the designed ligands 25–38.
molecule with an IC50 of 1.77 0.14
l
M. A dose dependent curve
surrogate MS protein was the sequence homology between MS
and MTB gyrase proteins which showed almost 87% identity when
performed using BLAST tool, was found to have high degree of con-
servation in the ATP binding pocket in the two organisms.13
Further to analyze the interaction profile of the molecules based
on GyrB assay, we performed molecular docking studies. The
molecules were docked into the GyrB ATPase domain of MS
retrieved from protein data bank (PDB ID: 4B6C)12 using extra pre-
cision mode (XP) of Glide module in Schrodinger suite (2012).14
Closer analyses of the co-crystallized ligand (6-(3,4 dimethyl-
phenyl)-3-[[4-[3-(4-methylpiperazin-1 yl)propoxy]phenyl]amino]
pyrazine-2-carboxamide) revealed one H-bonding interaction with
the amino group of the carboxamide moiety and the oxygen atom
for 26 is shown in Figure 2. As reported previously, ATPase activity
was performed using the MS DNA GyrB protein as MTB protein
showed less activity. The less activity of MTB was attributed due
to its slow growing mechanism when compared to MS.12 Novobio-
cin was used as standard inhibitor for the assay, while moxifloxa-
cin was used as a negative control. Brij-35 (detergent) was used to
prevent aggregation of molecules during the assay. By performing
the assay with MS DNA GyrB protein, we obtained correlation
variations approximately 3–5 fold in IC50 value between the ATP-
ase activity of MS and the supercoiling activity of MTB. Subse-
quently this gave us enough confidence to employ MS as a
surrogate enzyme to MTB GyrB in the ATPase assay. Furthermore,
the other parameters which were considered for using the
of Asp79 residue, while a
p-electron bond was observed between
the nitrogen atom of piperazine ring and hydrogen atom on the
guanidine moiety of Arg82 as shown in Figure 3. Presence of a
hydrophobic pocket formed by Val49, Ala53, Ile83, Val97, Val99,
Val124, Val128 and Ile171 in which the 3,4-dimethyl phenyl moi-
ety was stabilized by the non-polar interactions with Ile83 and
Val128 was also observed. As reported previously, hydrophobic
interactions were crucial in bringing selectivity and specificity
observed in the enzyme level.12,13 Upon docking the hit molecules
from in vitro GyrB assay, the most potent analog 26 exhibited good
docking score of ꢀ8.63 kcal/mol with similar orientation to that of
the crystal ligand in the active pocket and showed polar contact
between oxygen group of ethyl benzofuran-2-carboxylate and
Arg141 as illustrated in Figure 4. Secondly, stable interaction was
observed between the
p-electron environment of thiazole ring of
compound 26 and the ammonium ion (NH+3) present in the guani-
dine group of Arg82. The hydrophobic pocket was occupied by the
highly hydrophobic 4-chlorophenyl core of (4-chlorophenyl)piper-
azine-1-carboxamide where it was found to be stabilized by
Figure 2. Dose response curve of compound 26 of Mycobacterium smegmatis DNA
GryB ATPase assay for six different concentrations.

6556
K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
Figure 3. Interaction pattern of the crystal ligand 4B6C (6-(3,4 dimethylphenyl)-3-[[4-[3-(4-methylpiperazin-1 yl)propoxy]phenyl]amino]pyrazine-2-carboxamide) with
GyrB ATPase domain of M. smegmatis. Hydrophobic pocket is represented by the blue color residues, the polar contacts are shown by the red dotted lines.
non-polar interactions with Val49, Ile 84, Val99, Val123 and
Val128. Presence of a halogen group increased the activity as
chloro group in the aryl ring resulted in inductive effect which sub-
deep in to the active site pocket with strong hydrophobic interac-
tions. Compound 27 showed the least activity in this series with
docking score ꢀ3.6 kcal/mol and the 4-acetylphenyl group exhib-
sequently deactivated the
p
cloud thereby deactivating the ring.
ited no p-electron bonding which made the molecule unstable
Ultimately, the ring represented as electron acceptor at the pro-
teins active site thereby increasing the affinity toward the active
site residues. As previously reported these hydrophobic interac-
tions contributed toward their specificity and bioactivity.8 All these
above illustrations supported the activity of compound 26. Simi-
larly, compound 25 substituted with a phenyl group showed less
docking score of ꢀ6.35 kcal/mol when compared to 26 as the
removal of the halogen group at 4th position of phenylcarbamoyl
moiety drastically reduced the activity. Similarly, substitution of
benzyl 30 and 4-chlorobenzyl 31 showed better inhibitory effects
with a good docking score of ꢀ6.3, ꢀ6.1 kcal/mol and in vitro GryB
IC50 of 2.36 0.31 and 6.88 0.35, respectively. Compounds 28 and
29 with 4-nitro phenyl and 4-methoxy phenyl were observed to be
and disoriented with no hydrophobic interactions as shown in
Figure 5. Furthermore, compound 15 (N-(4-chlorobenzyl)-4-
(benzo[d]isothiazol-3-yl)piperazine-1-carboxamide) was found to
be equipotent with compound 26 showing polar contact with
Asp79 and
a p-electron bond between isothiazole ring of
benzo[d]isothiazole and guanidine moiety of Arg82 similar to that
of the crystal ligand as shown in Figure 6 from first series display-
ing three H-bonds with Asp79, Gly83 and Thr169. Subsequently,
the thio substituted 4-chlorobenzyl (22) showed lesser activity
due to loss of interactions with important amino acid residues.
Compound 17 was least active in in vitro MS DNA GyrB activity
with less docking score of ꢀ3.6 kcal/mol as the molecule aligned
in an opposite direction with no polar and hydrophobic contacts
within the active site pocket as shown in Figure 7. Overall, benzo-
furan derivatives, with some exceptions, can be considered as bet-
ter GyrB inhibitors when compared to benzisothiazole ones. In
particular, thio substitution over benzofuran derivatives (com-
pounds 32–36 and 38) can be more preferable as observed from
their GyrB activity and MIC values.
less active (with IC50 around 26 lM) displaying poor interactions at
the active site with docking scores of ꢀ4.2 and ꢀ4.5 kcal/mol.
Whereas their counter parts, compounds 35 and 36 with thio func-
tional moiety showed 10-fold better activity with IC50 around
2
lM. In these compounds, altered binding orientation was
observed with the terminal nitro and methoxy groups embedded
Figure 4. Interaction pattern of the compound 26 (4-(benzo[d]isothiazol-3-yl)-N-(4-chlorophenyl)piperazine-1-carboxamide) with GyrB ATPase domain of M. smegmatis.
Hydrophobic pocket is represented by the blue color residues and the polar contacts are shown by the red dotted lines.

K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
6557
Figure 5. Interaction pattern of the compound 27 (N-(4-acetylphenyl)-4-(benzo[d]isothiazol-3-yl)piperazine-1-carboxamide) with GyrB ATPase domain of M. smegmatis.
Hydrophobic pocket is represented by the blue color residues. No polar contacts are seen.
Figure 6. Interaction pattern of the compound 15 (ethyl 5-(4-(4-chlorobenzylcarbamoyl)piperazin-1-yl)benzofuran-2-carboxylate) with GyrB ATPase domain of M.
smegmatis. Hydrophobic pocket is represented by the blue color residues and the polar contacts are shown by the red dotted lines.
Figure 7. Interaction pattern of the compound 17 (ethyl 5-(4-(4-chlorophenylthiocarbamoyl)piperazin-1-yl)benzofuran-2-carboxylate) with GyrB ATPase domain of M.
smegmatis. Hydrophobic pocket is represented by the blue color residues. No polar contacts are observed.

6558
K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide
(MTT) assay.16 The most promising analog 26 displayed a good
safety profile showing 20.2%. Percentage inhibitions of cells of
the compounds are reported in Table.1.
The interaction profile of compound 26 to stabilize the protein
was evaluated by measuring the fluorescence of a dye with native
DNA GyrB protein and its protein–ligand complex.15 Fluorescence
was maximum when the protein was denatured completely; as a
result the native protein Tm was observed to be 43 °C whereas
the Tm of the protein- in complex with 26 was found to be
46.1 °C as shown in the Figure 9. A higher or positive shift of Tm sig-
nified a better stabilization of the protein–ligand complex, which
further re-ascertained for the interaction of the compound with
DNA GyrB protein.
Figure 8. Depicting the supercoiling assay picture of compound 26 at three
different concentrations of 3.4, 1.7, 0.6 lM, R-Relaxed DNA substrate + DMSO; C-
Relaxed DNA substrate + DNA Gyrase + DMSO; N-novobiocin.
All the compounds were also tested for their ability to inhibit
DNA supercoiling activity using MTB DNA gyrase supercoiling kit
from Inspiralis (Inspiralis, Norwich). Each of the compounds tested
showed dose-dependent inhibition of the mycobacterial gyrase
enzyme. DNA supercoiling inhibition studies were done at an ini-
3. Conclusion
tial concentration of 50 lM, and almost twenty compounds out
of twenty eight (9, 11, 12, 13, 14, 15, 16, 19, 21, 25, 26, 27, 30,
31, 32, 33, 34, 35, 36 and 38) showed more than 70% inhibition
as depicted in Table 1. Further these compounds were tested for
their inhibitions at lower concentrations to obtain IC50, and the
potent inhibitor 26 with good DNA GyrB inhibition also showed
This work described the design of 28 molecules by molecular
hybridization, synthesis and biological evaluation of MTB DNA
GyrB inhibition. This class of molecules targeted selectively the
mycobacterial DNA gyrase enzyme with promising attributes of
synthetic accessibility well defined SAR, and antitubercular activ-
ity, suggesting potential for the development of new class of MTB
gyrase inhibitors. In addition, molecular modeling studies were
performed to explain the importance of these compounds and
the orientation of various substituted side chains for their interac-
tions with the enzyme active site. Furthermore, in this class of mol-
ecules the substituents at 4th position were attempted,
substitutions at other positions would provide an interesting
potential for further optimization.
a better IC50 of 0.42 0.23
the standard compound novobiocin showed 100% inhibition at 50
and 25 M with an IC50 of 46 10 nM as illustrated in Figure 8.
lM in the supercoiling assay, while
l
These compounds were target specific as they had not inhibited
in Escherichia coli, Staphylococcus aureus and Pseudomonas aerugin-
osa DNA supercoiling assays (Inspiralis, Norwich).
Further in vitro antimycobacterial activity studies against M.
tuberculosis H37Rv strain were performed by microplate Alamar
blue assay method for all the twenty eight synthesized com-
pounds.15 Sixteen compounds (10, 12, 13, 17, 20, 26, 29, 30, 31,
32, 33, 34, 35, 36, 37 and 38) showed commendable MIC values
4. Experimental section
4.1. Chemistry
<20
azid (MIC: 0.66
acin (MIC: 1.2
l
M. First-line TB drugs ethambutol (MIC: 15.31
M) were used as standards along with moxiflox-
M) and novobiocin (MIC: >200 M). Few of the
lM) and isoni-
l
l
l
inhibitors (13, 26, 29, 30, 31, 32, 33, 34, 35, 36, 37 and 38) showed
more potency than the standard ethambutol highlighting the
importance of these compounds as effective drugs against myco-
bacterial growth.
Eukaryotic cells safety profile of all the compounds were
observed by testing their in vitro cytotoxicity against mouse mac-
Melting points (mp) reported in this work were recorded in cap-
illary tubes on an Elchem lab melting point apparatus and uncor-
rected. 1H NMR and 13C NMR were recorded either in Bruker
500 MHz and 400 MHz FT-NMR spectrometer with 5 mm PABBO
BB-1H tubes. 1H NMR spectra recorded using approximately
0.03 M solutions in CDCl3 with TMS as internal reference. 13C
NMR spectra were recorded using approximately 0.05 M solutions
rophage RAW 264.7 cell line at 100 lM concentration, employing
Figure 9. Melt curve for compound 26 showing an increase in thermal stability between the native MS DNA GyrB protein (red) and DNA GyrB protein–ligand 26 complex
(blue) using differential scanning fluorimetry experiment.

K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
6559
in CDCl3 at 100 MHz or 125 MHz with TMS as internal reference.
The chemical shift values were reported in parts per million (d,
ppm) from internal standard TMS. Mass spectra were obtained
from JEOL GC Mate HRMS analyzer. The UV–visible spectra were
recorded on a SYSTRONIC AU-2701 UV–Vis spectrophotometer.
All reagents were purchased from Aldrich and used as received.
Solvents were removed under reduced pressure on a rotavapor.
Organic extracts were dried with anhydrous Na2SO4. Silica gel
60F254 aluminum sheets were used in analytical thin-layer
chromatography (TLC) and silica gel for column chromatography
purification (230–400 mesh). Visualization of spots on TLC plates
was effected by UV illumination, exposure to iodine vapor and
heating the plates dipped in KMnO4 stain.
(m, 2H), 6.62 (m, 3H), 4.43 (q, J = 7.2, 14.4 Hz, 2H), 3.74
(t, J = 5.2 Hz, 4H), 3.23 (t, J = 4.8 Hz, 4H), 1.42 (t, J = 7.2 Hz, 3H);
13C NMR (300 MHz, DMSO+CDCl3): 181.4, 157.3, 155.2, 148.4,
144.6, 142.8, 129.6, 126, 122.2, 115.9, 111.5, 107.2, 59.8, 48.9,
48.2, 13.5. MS calcd for C22H22N4O6: 438.4. Found: 439.6, (M+);
Anal. Calcd for C22H22N4O6: C, 60.27; H, 5.06; N, 12.78; Found: C,
60.29; H, 5.05; N, 12.79.
4.1.7. Ethyl 5-(4-(4-methoxyphenylcarbamoyl)piperazin-1-yl)
benzofuran-2-carboxylate (13)
White solid, yield (93%), mp: 297.5–299.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.51 (d, J = 8.8 Hz, 1H), 7.45 (s, 1H), 7.27
(m, 2H), 7.19 (m, 2H), 6.85 (d, J = 8.4 Hz, 2H), 6.32 (b, 1H), 4.43
(q, J = 7.2, 14.4 Hz, 2H), 3.78 (s, 3H), 3.69 (m, 4H), 3.21 (m, 4H),
1.42 (t, J = 7.2 Hz, 3H); 13C NMR (100 MHz, DMSO+CDCl3): 181.2,
158.6, 155.2, 154.6, 150.3, 147.6, 145.2, 132.1, 126.7, 121.8,
119.5, 113.0, 112.9, 111.7, 108.2, 60.5, 54.6, 50.2, 43.3, 13.5. MS
calcd for C23H25N3O5: 423.4. Found: 424.5, (M+). Anal. Calcd for
C23H25N3O5: C, 65.24; H, 5.95; N, 9.92; Found: C, 65.25; H, 5.93;
N, 9.94.
4.1.1. Procedure for synthesis of 5-nitro salicylaldehyde (5)
Ethyl 5-nitro benzofuran-2-carboxylate (6), ethyl 5-amino ben-
zofuran-2-carboxylate (7), ethyl 5-(piperazin-1-yl)benzofuran-2-
carboxylate (8) were reported in Ref. 10.
4.1.2. General procedure for compounds (9–22) preparation
To the solution of ethyl 5-(piperazin-1-yl)benzofuran-2-carbox-
ylate (1 mmol) in DCM, followed by addition of corresponding iso-
cyanate (1.2 mmol) and stirred for 12 h at RT. To the RM added
excess of DCM and wash with water. The organic layer was dried
with Na2SO4 and evaporated to get the required compound.
4.1.8. Ethyl 5-(4-(benzylcarbamoyl)piperazin-1-yl)benzofuran-
2-carboxylate (14)
Off white solid, yield (88%), mp: 298.5–300.1 °C, 1H NMR
(400 MHz, CDCl3): d = 7.48 (m, 1H), 7.31 (m, 4H), 7.13 (m, 1H),
4.79 (b, 1H), 4.43 (q, J = 7.2, 14.4 Hz, 2H), 3.58 (t, J = 4.8 Hz, 4H),
3.15 (t, J = 5.2 Hz, 4H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (300 MHz,
DMSO+CDCl3): 181.2, 158.4, 157.9, 157.1, 150.0, 147.8, 145.0,
139.5, 119.4, 112.9, 111.5, 107.8, 62.3, 60.4, 49.9, 43.0, 24.5, 13.4.
MS calcd for C23H25N3O4: 407.4. Found: 408.6, (M+); Anal. Calcd
for C23H25N3O4: C, 67.80; H, 6.18; N, 10.31; Found: C, 67.82; H,
6.17; N, 10.33.
4.1.3. Ethyl 5-(4-(phenylcarbamoyl) piperazin-1-yl)benzofuran-
2-carboxylate (9)
Off white solid, yield (87%), mp: 311.5–312.9 °C, 1H NMR
(400 MHz, CDCl3): d = 8.18 (s, 1H), 7.26 (m, 6H), 6.39 (m, 1H),
4.42 (q, J = 7.2, 14.4 Hz, 2H), 3.71 (t, J = 5.2 Hz, 4H), 3.18 (t,
J = 4.8 Hz, 4H), 1.41 (t, J = 7.2 Hz, 3H); 13C NMR (300 MHz,
DMSO+CDCl3): 165.9, 159.0, 155.2, 150.7, 148.1, 145.6, 139.1,
128.3, 127.1, 122.3, 121.8, 120.0, 118.3, 113.3, 112.1, 108.4, 60.9,
50.4, 43.8, 13.9. MS calcd for C22H23N3O4: 393.4. Found: 394.6,
(M+); Anal. Calcd for C22H23N3O4: C, 67.16; H, 5.89; N, 10.68;
Found: C, 67.17; H, 5.87; N, 10.71.
4.1.9. Ethyl 5-(4-(4-chlorobenzylcarbamoyl)piperazin-1-yl)
benzofuran-2-carboxylate (15)
White solid, yield (91%), mp: 285.5–286.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.28 (m, 6H), 4.43 (q, J = 7.2, 14.4 Hz, 2H),
4.14 (t, J = 5.2 Hz, 4H), 3.50 (m, 2H), 3.28 (m, 2H), 1.42 (t,
J = 7.2 Hz, 3H); 13C NMR (300 MHz, DMSO+CDCl3): 181.6, 164.4,
158.5, 154.7, 151.3, 147.3, 136.3, 129.3, 126.4, 124.4, 122.3,
119.0, 115.5, 112.3, 111.1, 109.4, 59.9, 50.4, 48.9, 13.4. MS calcd
for C23H24ClN3O4: 441.9. Found: 442.8, (M+); Anal. Calcd for
C23H24ClN3O4: C, 62.51; H, 5.47; Cl, 8.02; N, 9.51; Found: C,
62.53; H, 5.45; Cl, 8.01; N, 9.52.
4.1.4. Ethyl 5-(4-(4-chlorophenylcarbamoyl)piperazin-1-yl)
benzofuran-2-carboxylate (10)
Off white solid, yield (v), mp: 302.5–304.5 °C, 1H NMR
(400 MHz, CDCl3): d = 8.90 (s, 1H), 7.62 (m, 1H), 7.51 (m, 6H),
7.33 (m, 6H), 4.34 (q, J = 7.2, 14.4 Hz, 2H), 3.63 (t, J = 5.2 Hz, 4H),
3.15 (t, J = 4.8 Hz, 4H), 1.34 (t, J = 7.2 Hz, 3H); 13C NMR (300 MHz,
DMSO+CDCl3): 163.0, 155.1, 152.2, 138.2, 127.9, 127.3, 126.7,
123.7, 123.2, 121.1, 120.1, 119.4, 49.9, 43.4. MS calcd for C22H22
ClN3O4: 427.8. Found: 428.6, (M+); Anal. Calcd for C22H22ClN3O4:
C, 61.75; H, 5.18; N, 9.82. Found: C, 61.77; H, 5.15; N, 9.83.
4.1.10. Ethyl 5-(4-(phenylthiocarbamoyl)piperazin-1-yl)
benzofuran-2-carboxylate (16)
Off white solid, yield (89%), mp: 276.7–277.9 °C, 1H NMR
(400 MHz, CDCl3): d = 7.49 (d, J = 8.8 Hz, 1H), 7.43 (d, J = 11.6 Hz,
2H), 7.35 (t, J = 7.6 Hz, 2H), 7.15 (m, 4H), 7.09 (m, 1H), 4.43 (q,
J = 7.2, 14.4 Hz, 2H), 4.02 (t, J = 5.2 Hz, 4H), 3.23 (t, J = 4.8 Hz, 4H),
1.41 (t, J = 7.2 Hz, 3H); 13C NMR (300 MHz, DMSO+CDCl3): 182.4,
159.0, 150.6, 147.6, 145.7, 140.2, 128.1, 127.1, 124.7, 119.5,
113.3, 112.2, 108.2, 60.9, 49.9, 48.2, 13.9, 7.5. MS calcd for C22H23
N3O3S: 409.5. Found: 410.4, (M+). Anal. Calcd for C22H23N3O3S: C,
64.53; H, 5.66; N, 10.26; Found: C, 64.55; H, 5.64; N, 10.25.
4.1.5. Ethyl 5-(4-(4-acetylphenylcarbamoyl)piperazin-1-yl)
benzofuran-2-carboxylate (11)
White solid, yield (93%), mp: 296.5–98.41 °C, 1H NMR
(400 MHz, CDCl3): d = 7.49 (d, J = 9.2 Hz, 1H), 7.44 (m, 4H), 7.12
(m, 2H), 7.12 (m, 1H), 4.89 (d, J = 5.2 Hz, 2H), 4.43 (q, J = 7.2,
14.4 Hz, 2H), 4.04 (t, J = 5.2 Hz, 4H), 3.25 (t, J = 5.2 Hz, 4H), 2.42
(s, 3H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (100 MHz, DMSO+CDCl3):
195.6, 194.8, 153.9, 151.8, 147.4, 144.2, 129.6, 128.2, 127.6,
126.4, 119.2, 117.6, 112.1, 111.4, 107.8, 66.8, 60.2, 49.7, 45.1,
43.2, 29.2, 27.7, 25.3, 24.9, 21.8, 13.0. MS calcd for C24H25N3O5:
435.4. Found: 436.2, (M+); Anal. Calcd for C24H25N3O5: C, 66.19;
H, 5.79; N, 9.65; Found: C, 66.17; H, 5.82; N, 9.66.
4.1.11. Ethyl 5-(4-(4-chlorophenylthiocarbamoyl)piperazin-1-yl)
benzofuran-2-carboxylate (17)
White solid, yield (87%), mp: 310.5–312.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.50 (d, J = 7.0 Hz, 1H), 7.43 (s, 1H), 7.21
(m, 4H), 6.32 (b, 1H), 4.43 (q, J = 7.2, 14.4 Hz, 2H), 3.82 (m, 4H),
3.10 (m, 4H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (100 MHz,
DMSO+CDCl3): 181.9, 157.9, 147.5, 145.5, 150.7, 138.9, 129.7,
127.9, 127.0, 126.3, 119.4, 113.2, 112.1, 108.1, 60.8, 49.8, 47.9,
13.8. MS calcd for C22H22ClN3O3S: 443.9. Found: 444.8, (M+). Anal.
4.1.6. 5-[4-(4-Nitro-phenylcarbamoyl)-piperazin-1-yl]-
benzofuran-2-carboxylic acid ethyl ester (12)
White solid, yield (91%), mp: 268.9–269.1 °C, 1H NMR
(400 MHz, CDCl3): d = 8.20 (d, J = 9.2 Hz, 1H), 8.07 (m, 3H), 7.52

6560
K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
Calcd for C22H22ClN3O3S: C, 59.52; H, 4.99; Cl, 7.99; N, 9.47; Found:
C, 59.53; H, 4.98; Cl, 7.97; N, 9.49.
4.1.17. General procedure for synthesis of 3-(piperazin-1-yl)
benzo[d]isothiazole
The compound 3-chloro-1, 2-benzisothiazole (1 mmol) was
allowed to react with piperazine (1.2 mmol) in Ethanol at 80 °C
for 36 h. Then reaction mixture was concentrate and RM was
dissolved in ethyl acetate and washed with water. Ethylacetate
layer dried with Na2SO4 and concentrate them and get 3-(pipera-
zin-1-yl)benzo[d]isothiazole. White solid, 85% yield, mp 215–
217 °C, 1H NMR (400 MHz, CDCl3): d = 7.42 (t, J = 7.2 Hz, 1H), 7.29
(m, 3H), 4.14 (t, J = 4.8 Hz, 4H), 3.15 (t, J = 4.8 Hz, 4H); 13C NMR
(100 MHz, DMSO+CDCl3): 166.8, 156.2, 135.8, 128.5, 127.6, 125.2,
124.9, 119.8, 53.6, 49.2, 46.6, 45.1, 7.1. MS calcd for C19H20N4OS2:
219.31. Found: 220.33, (M+); Anal. Calcd for C19H20N4OS2: C, 60.24;
H, 5.97; N, 19.16; S, 14.62; Found: C, 60.25; H, 5.99; N, 19.13; S,
14.61.
4.1.12. Ethyl 5-(4-(4-acetylphenylthiocarbamoyl)piperazin-1-
yl)benzofuran-2-carboxylate (18)
White solid, yield (86%), mp: 255.5–257.6 °C, 1H NMR
(400 MHz, CDCl3): d = 9.70 (s, 1H), 7.90 (d, J = 16.4 Hz, 2H), 7.63
(m, 2H), 7.50 (d, J = 8.8 Hz, 2H), 7.32 (dd, J = 2.4, 6.4 Hz, 1H), 7.23
(d, J = 2.4, 1H), 4.45 (q, J = 7.2, 14.4 Hz, 2H), 4.08 (t, J = 5.2 Hz,
4H), 3.26 (t, J = 5.2 Hz, 4H), 3.26 (m, 4H), 2.54 (s, 3H), 1.33
(t, J = 7.2 Hz, 3H); 13C NMR (300 MHz, DMSO+CDCl3): 182.6,
162.4, 154.4, 145.6, 142.6, 140.4, 129.8, 124.9, 123.1, 118.3,
113.8, 111.1, 109.4, 60.5, 49.8, 49.4, 13.9. MS calcd for C24H25N3O4S:
451.5. Found: 452.3, (M+); Anal. Calcd for C24H25N3O4S: C, 63.84;
H, 5.58; N, 9.31; Found: C, 63.85; H, 5.56; N, 9.33.
4.1.13. 5-[4-(4-Nitro-phenylthiocarbamoyl)-piperazin-1-yl]-
benzofuran-2-carboxylic acid ethyl ester (19)
4.1.18. General procedure for compounds (23–38) preparation
To the solution of 3-(piperazin-1-yl)benzo[d]isothiazole
(1 mmol) in DCM, followed by addition of corresponding isocya-
nates (1.2 mmol) or isothiocyanates (1.2 mmol) and stirred for
12 h at RT. To the RM excess of DCM was added and washed with
water. The organic layer was dried with Na2SO4 and evaporated, to
get the required compound.
Yellow solid, yield (90%), mp: 310.5–312.4 °C, 1H NMR
(400 MHz, CDCl3): d = 8.39 (b, 1H), 8.18 (d, J = 8.8 Hz, 1H), 7.52
(m, 2H), 7.34 (s, 1H), 7.13 (m, 1H), 4.43 (q, J = 7.2, 14.4 Hz, 2H),
4.14 (t, J = 5.2 Hz, 4H), 3.50 (m, 2H), 3.28 (m, 2H), 1.42
(t, J = 7.2 Hz, 3H); 13C NMR (100 MHz, DMSO+CDCl3): 168.9,
158.6, 154.8, 152.8, 150.1, 144.2, 143.9, 133.5, 124.2, 123.8,
119.4, 113.5, 112.3, 101.6, 60.5, 53.9, 49.6, 42.3, 13.4. MS calcd
for C22H23N4O5S: 455.5. Found: 456.6, (M+); Anal. Calcd for C22H23
N4O5S: C, 58.14; H, 4.88; N, 12.33; Found: C, 58.16; H, 4.87; N,
12.34.
4.1.19. 4-(Benzo[d]isothiazol-3-yl)-N-phenylpiperazine-1-
carboxamide (25)
Off white solid, yield (85%), mp: 254.4–256.1 °C, 1H NMR
(400 MHz, CDCl3): d = 7.93 (d, J = 8.0, Hz, 1H), 7.84 (d, J = 8.0, Hz,
1H), 7.50 (t, J = 7.2, Hz, 1H), 7.39 (m, 3H), 7.31 (t, J = 7.6, Hz, 2H),
7.06 (t, J = 7.6, Hz, 1H), 3.74 (m, 4H), 3.60 (m, 4H), 13C NMR
(100 MHz, DMSO+CDCl3): 163.3, 155.1, 152.0, 140.4, 128.3, 127.9,
127.3, 124.4, 124.1, 121.7, 121.0, 119.6, 49.5, 43.6, 7.1. MS calcd
4.1.14. Ethyl 5-(4-(4-methoxyphenylthiocarbamoyl)piperazin-
1-yl)benzofuran-2-carboxylate (20)
White solid, yield (84%), mp: 254.5–256.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.50 (d, J = 9.2 Hz, 1H), 7.44 (s, 1H), 7.25
(s, 1H), 7.12 (m, 4H), 6.89 (d, J = 8.8 Hz, 2H), 4.43 (q, J = 7.2,
14.4 Hz, 2H), 4.03 (t, J = 4.8 Hz, 4H), 3.80 (s, 3H), 3.23 (t, J = 4.8
Hz, 4H), 1.34 (t, J = 7.2 Hz, 3H); 13C NMR (300 MHz, DMSO+CDCl3):
182.4, 162.0, 155.7, 145.9, 142.1, 141.8, 129.5, 126.4, 122.1, 116.2,
11262, 109.6, 59.9, 49.9, 48.6, 13.5. MS calcd for C23H25N3O4S:
439.5. Found: 440.6, (M+); Anal. Calcd for C23H25N3O4S: C, 62.85;
H, 5.73; N, 9.56; Found: C, 62.86; H, 5.75; N, 9.54.
for
18H18N4OS: C, 63.88; H, 5.36; N, 16.56; Found: C, 63.89; H, 5.38; N,
C
18H18N4OS: 338.4. Found: 339.6, (M+); Anal. Calcd for
C
16.54.
4.1.20. 4-(Benzo[d]isothiazol-3-yl)-N-(4-chlorophenyl)
piperazine-1-carboxamide (26)
White solid, yield (86%), mp: 254.2–256.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.90 (dd, J = 8.0, 20.4 Hz, 2H), 7.51 (t, J = 6.8
Hz, 1H), 7.38 (m, 3H), 7.27 (m, 2H), 6.47 (s, 1H), 3.47 (m, 4H),
3.62 (m, 4H), 13C NMR (100 MHz, DMSO+CDCl3): 181.6, 162.2,
151.0, 143.5, 133.2, 129.5, 127.6, 125.1, 124.5, 122.6, 121.0, 51.9,
49.9, 48.7, 26.4, 7.0. MS calcd for C18H17ClN4OS: 372.8. Found:
373.6, (M+); Anal. Calcd for C18H17ClN4OS: C, 57.98; H, 4.60; Cl,
9.51; N, 15.03; Found: C, 57.99; H, 4.61; N, 15.01.
4.1.15. Ethyl 5-(4-(benzylthiocarbamoyl)piperazin-1-
yl)benzofuran-2-carboxylate (21)
White solid, yield (91%), mp: 284.2–286.5 °C, 1H NMR
(400 MHz, CDCl3): d = 7.49 (d, J = 9.2 Hz, 1H), 7.44 (m, 5H), 7.12
(m, 3H), 5.85 (b, 1H), 4.89 (d, J = 5.2 Hz, 2H), 4.43 (q, J = 7.2,
14.4 Hz, 2H), 4.04 (t, J = 5.2 Hz, 4H), 3.25 (t, J = 5.2 Hz, 4H), 1.42
(t, J = 7.2 Hz, 3H); 13C NMR (100 MHz, DMSO+CDCl3): 181.6,
157.2, 154.2, 153.8, 151.6, 147.8, 142.4, 134.1, 126.2, 120.2,
118.1, 113.9, 102.9, 101.2, 59.5, 54.6, 50.6, 42.3, 13.5. MS calcd
for C23H25N3O3S: 423.5. Found: 424.6, (M+). Anal. Calcd for C23
H25N3O3S: C, 65.23; H, 5.95; N, 9.92; Found: C, 65.25; H, 5.93; N,
9.94.
4.1.21. N-(4-Acetylphenyl)-4-(benzo[d]isothiazol-3-yl)
piperazine-1-carboxamide (27)
White solid, yield (91%), mp: 188.5–189.4 °C, 1H NMR
(400 MHz, CDCl3): d = 8.03 (dd, J = 8.4, 22.8 Hz, 2H), 7.85 (m, 2H),
7.59 (m, 1H), 7.32 (m, 3H), 4.14 (t, J = 4.8 Hz, 4H), 3.80 (t,
J = 4.8 Hz, 4H), 2.54 (s, 3H), 13C NMR (100 MHz, DMSO+CDCl3):
182.5, 163.8, 155.4, 153.5, 132.8, 125.9, 123.6, 121.2, 120.4,
119.2, 118.0, 113.2, 55.1, 49.9, 47.8, 7.0. MS calcd for C20H20N4O2S:
380.4. Found: 381.2, (M+); Anal. Calcd for C20H20N4O2S: C, 63.14;
H, 5.30; N, 14.73; Found: C, 63.15; H, 5.29; N, 14.75.
4.1.16. Ethyl 5-(4-(4-chlorobenzylthiocarbamoyl)piperazin-1-
yl)benzofuran-2-carboxylate (22)
Off white solid, yield (91%), mp: 297.5–299.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.49 (d, J = 9.2 Hz, 1H), 7.44 (s, 1H), 7.31
(m, 4H), 7.12 (m, 2H), 5.85 (s, 1H), 4.89 (d, J = 5.2 Hz, 2H), 4.43
(q, J = 7.2, 14.4 Hz, 2H), 4.04 (t, J = 5.2 Hz, 4H), 3.25 (t, J = 5.2 Hz,
4H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (100 MHz, DMSO+CDCl3):
181.6, 158.5, 150.1, 147.3, 145.2, 137.2, 131.5, 128.3, 127.5,
126.7, 119.0, 113.0, 111.7, 107.7, 60.5, 49.5, 47.8, 46.9, 24.6, 13.5.
MS calcd for C23H24ClN3O3S: 457.9. Found: 458.6, (M+); Anal. Calcd
for C23H24ClN3O3S: C, 60.32; H, 5.28; Cl, 7.74; N, 9.18; Found: C,
60.31; H, 5.29; Cl, 7.76; N, 9.21.
4.1.22. 4-Benzo[d]isothiazol-3-yl-piperazine-1-carbothioic acid
(4-nitro-phenyl)-amide (28)
White solid, yield (93%), mp: 254.3–255.4 °C, 1H NMR
(400 MHz, CDCl3): d = 8.15 (m, 4H), 7.57 (m, 4H), 4.16 (m, 4H),
3.61 (m, 4H), 13C NMR (100 MHz, DMSO+CDCl3): 181.0, 162.7,
152.0, 147.8, 142.0, 127.9, 127.1, 124.4, 124.2, 123.9, 122.4,
121.0, 51.9, 48.9, 48.2, 46.8, 42.8, 7.1. MS calcd for C18H18N5O2S2:

K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
6561
400.5. Found: 401.3, (M+); Anal. Calcd for C18H18N5O2S2: C, 54.12;
H, 4.29; N, 17.53; Found: C, 54.14; H, 4.27; N, 17.51.
J = 4.8 Hz, 4H), 2.54 (s, 3H), 13C NMR (100 MHz, DMSO+CDCl3):
196.6, 181.3, 162.8, 152.0, 145.6, 131.9, 128.5, 127.9, 127.1,
124.4, 124.2, 121.0, 51.9, 48.9, 48.0, 26.4, 7.1. MS calcd for C20H20
N4OS2: 396.5. Found: 397.3, (M+); Anal. Calcd for C20H20N4OS2: C,
60.58; H, 5.08; N, 14.13; Found: C, 60.59; H, 5.06; N, 14.15.
4.1.23. 4-(Benzo[d]isothiazol-3-yl)-N-(4-methoxyphenyl)
piperazine-1-carboxamide (29)
Brown solid, yield (91%), mp: 236.4–238.8 °C, 1H NMR
(400 MHz, CDCl3): d = 7.88 (dd, J = 8.0, 16.8 Hz, 2H), 7.56
(t, J = 6.8 Hz, 1H), 7.42 (t, J = 7.0 Hz, 1H), 7.20 (m, 2H), 6.90
(d, J = 7.2 Hz, 2H), 4.08 (t, J = 5.2 Hz, 4H), 3.80 (s, 3H), 3.66
(t, J = 5.2 Hz, 4H), 13C NMR (100 MHz, DMSO+CDCl3): 162.9,
155.5, 154.7, 151.9, 127.1, 123.5, 123.1, 122.0, 119.9, 113.0, 62.2,
54.7, 51.9, 49.3, 46.1, 43.2, 42.1, 7.0. MS calcd for C19H20N4O2S:
368.4. Found: 369.5, (M+); Anal. Calcd for C19H20N4O2S: C, 61.94;
H, 5.47; N, 15.21; Found: C, 61.96; H, 5.45; N, 15.22.
4.1.29. N-(4-Nitrophenyl)-4-(benzo[d]isothiazol-3-yl)
piperazine-1-carbothioamide (35)
Off white solid, yield (89%), mp: 197.5–199.7 °C, 1H NMR
(400 MHz, CDCl3): d = 8.06 (m, 3H), 8.09 (d, J = 8.0 Hz, 1H), 7.75
(m, 2H), 7.58 (t, J = 8.0 Hz, 1H), 7.47 (t, J = 8.0 Hz, 1H), 3.74
(t, J = 4.4 Hz, 4H), 3.50 (t, J = 5.2 Hz, 4H), 13C NMR (100 MHz,
DMSO+CDCl3): 163.2, 154.1, 152.0, 147.4, 145.6, 141.4, 140.8,
127.9, 127.2, 125.1, 124.6, 124.4, 124.1, 121.0, 118.3, 117.8, 51.9,
49.4, 43.7, 7.1. MS calcd for C18H18N5O3S: 384.4. Found: 385.2,
(M+); Anal. Calcd for C18H18N5O3S: C, 56.38; H, 4.47; N, 18.27;
Found: C, 56.37; H, 4.45; N, 18.29.
4.1.24. 4-(Benzo[d]isothiazol-3-yl)-N-benzylpiperazine-1-
carboxamide (30)
Off white solid, yield (94%), mp: 187.5–189.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.91 (d, J = 8.4, 1H), 7.83 (d, J = 8.4, 1H),
7.48 (t, J = 6.8 Hz, 1H), 7.35 (m, 6H), 4.83 (b, 1H), 4.48 (t,
J = 7.2 Hz, 2H), 3.61 (m, 8H), 13C NMR (100 MHz, DMSO+CDCl3):
163.4, 157.6, 152.7, 139.2, 128.5, 127.7, 127.6, 127.2, 124.0,
123.6, 120.5, 52.7, 49.6, 44.9, 43.5, 7.9. MS calcd for C19H20N4OS:
352.4. Found: 353.6, (M+); Anal. Calcd for C19H20N4OS: C, 64.75;
H, 5.72; N, 15.90; Found: C, 64.77; H, 5.70; N, 15.91.
4.1.30. 4-(Benzo[d]isothiazol-3-yl)-N-(4-methoxyphenyl)
piperazine-1-carbothioamide (36)
White solid, yield (91%), mp: 185.5–186.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.88 (dd, J = 8.0, 16.8 Hz, 2H), 7.51 (t, J = 6.8
Hz, 1H), 7.40 (t, J = 8.4 Hz, 1H), 7.21 (m, 2H), 6.90 (d, J = 9.2 Hz,
2H), 4.08 (t, J = 5.2 Hz, 4H), 3.80 (s, 3H), 3.66 (t, J = 5.2 Hz, 4H),
13C NMR (100 MHz, DMSO+CDCl3): 182.0, 162.9, 156.4, 152.0,
133.8, 127.9, 127.3, 127.2, 124.4, 124.2, 121.0, 113.2, 55.1, 49.0,
47.5, 7.1. MS calcd for C19H20N4OS2: 384.5. Found: 385.6, (M+);
Anal. Calcd for C19H20N4OS2: C, 59.35; H, 5.24; N, 14.57; O, 4.16;
Found: C, 59.37; H, 5.22; N, 14.58.
4.1.25. N-(4-Chlorobenzyl)-4-(benzo[d]isothiazol-3-yl)
piperazine-1-carboxamide (31)
White solid, yield (93%), mp: 199.5–201.6 °C, 1H NMR
(400 MHz, CDCl3): d = 7.89 (d, J = 8.0, Hz, 1H), 7.83 (d, J = 8.0, Hz,
1H), 7.51 (t, J = 7.6, Hz, 1H), 7.40 (t, J = 8.4, Hz, 1H), 7.30 (m, 4H),
4.84 (b, 1H), 4.44 (d, J = 5.6 Hz, 2H), 3.60 (m, 8H), 13C NMR
(100 MHz, DMSO+CDCl3): 163.1, 157.5, 152.7, 137.9, 133.0, 129.0,
128.7, 127.7, 127.7, 124.1, 123.6, 120.6, 49.6, 44.2, 43.5, 8.0. MS
calcd for C19H19ClN4OS: 386.9. Found: 387.8, (M+); Anal. Calcd for
4.1.31. 4-(Benzo[d]isothiazol-3-yl)-N-benzylpiperazine-1-
carbothioamide (37)
White solid, yield (90%), mp: 211.5–213.8 °C, 1H NMR
(400 MHz, CDCl3): d = 7.91 (d, J = 8.4 Hz, 1H), 7.83 (d, J = 8.4 Hz,
1H), 7.49 (m, 1H), 7.39 (m, 1H), 7.28 (m, 3H), 6.85 (m, 2H), 3.71
(m, 4H), 3.59 (m, 4H), 13C NMR (100 MHz, DMSO+CDCl3): 182.9,
162.6, 151.8, 151.4, 129.1, 123.3, 122.1, 122.0, 118.9, 111.6, 62.8,
53.9, 51.9, 48.3, 45.1, 43.7, 42.1, 7.0. MS calcd for C19H20N4S2:
368.5. Found: 369.6, (M+); Anal. Calcd for C19H20N4S2: C, 61.92;
H, 5.47; N, 15.20; Found: C, 61.94; H, 5.45; N, 15.22.
C19H19ClN4OS: C, 58.98; H, 4.95; Cl, 9.16; N, 14.48; Found: C,
58.97; H, 4.97; N, 14.47.
4.1.26. 4-(Benzo[d]isothiazol-3-yl)-N-phenylpiperazine-1-
carbothioamide (32)
White solid, yield (91%), mp: 198.6–200.4 °C, 1H NMR
(400 MHz, CDCl3): d = 7.87 (dd, J = 8.0, 14.8 Hz, 2H), 7.49 (m, 3H),
7.35 (m, 3H), 7.16 (m, 3H), 4.07 (t, J = 5.2 Hz, 4H), 3.65 (t,
J = 5.2 Hz, 4H), 13C NMR (100 MHz, DMSO+CDCl3): 181.8, 162.9,
152.0, 141.0, 128.0, 127.2, 125.1, 124.4, 124.3, 124.2, 121.0, 99.3,
52.0, 49.0, 47.7, 46.6, 7.1. MS calcd for C18H18N4S2: 354.4. Found:
355.1, (M+); Anal. Calcd for C18H18N4S2: C, 60.99; H, 5.12; N,
15.80; Found: C, 60.98; H, 5.14; N, 15.78.
4.1.32. N-(4-Chlorobenzyl)-4-(benzo[d]isothiazol-3-yl)
piperazine-1-carbothioamide (38)
Off white solid, yield (87%), mp: 235.5–237.48 °C, 1H NMR
(400 MHz, CDCl3): d = 7.89 (dd, J = 8.4, 21.6 Hz, 2H), 7.51 (m, 1H),
7.32 (m, 5H), 5.82 (s, 1H), 4.82 (s, 2H), 4.08 (m, 4H), 3.68 (m,
4H), 13C NMR (100 MHz, DMSO+CDCl3): 182.0, 162.9, 152.0,
138.7, 131.0, 129.0, 127.9, 127.9, 127.2, 124.4, 124.2, 121.0, 51.9,
48.9, 47.6, 47.0, 42.6, 7.1. MS calcd for C19H19ClN4S2: 402.9. Found:
403.8, (M+); Anal. Calcd for C19H19ClN4S2: C, 56.63; H, 4.75; Cl,
8.80; N, 13.90; Found: C, 56.65; H, 4.74; N, 13.91.
4.1.27. 4-(Benzo[d]isothiazol-3-yl)-N-(4-
chlorophenyl)piperazine-1-carbothioamide (33)
White solid, 93% yield, mp 264.3–266.4 °C, 1H NMR (400 MHz,
CDCl3): d = 8.12 (dd, J = 8.0, 16.4 Hz, 2H), 7.62 (t, J = 8.0 Hz, 1H),
7.32 (m, 3H), 7.12 (m, 2H), 4.02 (t, J = 5.2 Hz, 4H), 3.52
(t, J = 4.8 Hz, 4H), 13C NMR (100 MHz, DMSO+CDCl3): 181.8,
162.4, 151.9, 139.0, 129.2, 127.6, 127.2, 126.4, 123.6, 123.2,
120.0, 51.8, 48.8, 47.4, 7.0. MS calcd for C18H17ClN4S2: 388.9.
Found: 389.8, (M+); Anal. Calcd for C18H17ClN4S2: C, 55.59; H,
4.41; Cl, 9.12; N, 14.41; S, 16.49; Found: C, 55.61; H, 4.40; Cl,
9.13; N, 14.38; S, 16.50.
4.2. Cloning and purification
In order to perform the ATPase assay MS GyrB protein was
required. Subsequently, cloning of MS GyrB was done by amplify-
ing the GyrB gene from the genomic DNA of mc2155 using specific
forward and reverse primer with the sequence 50 CAC-
CCATATGGTGGCTGCC CAGAAGAACAA 30 (NdeI), and 30 AGC-
TAAGCTTTTAAACATCCAGGAAGCGAA 50 (Hind III), respectively.8
The final amplified PCR products were cloned in E. coli expression
vector pQE2 (Qiagen) which was His-tagged and later was trans-
formed into BL21 (DE3) pLysS cells. The transformed cells were
grown at room temperature 37 °C in Luria Bertani (LB) broth con-
4.1.28. N-(4-Acetylphenyl)-4-(benzo[d]isothiazol-3-yl)
piperazine-1-carbothioamide (34)
Off white solid, yield (94%), mp: 214.6–216.8 °C, 1H NMR
(400 MHz, CDCl3): d = 8.13 (dd, J = 8.4, 22.8 Hz, 2H), 7.91 (m, 2H),
7.60 (m, 1H), 7.49 (m, 3H), 4.14 (t, J = 4.8 Hz, 4H), 3.60 (t,
taining 100
lg/mL ampicillin to an optical density (OD) of 0.5
(A595). Once bacterial cells reached an exponential growth phase,

6562
K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
they were induced with isopropyl-b-
D-thiogalactopyranoside
4.5. In vitro MTB MABA assay
(IPTG) at a final concentration of 0.1 mM and the cell growth was
further continued for another 12 h at 18 °C. Further, the bacterial
cells were then centrifuged at 10,000 g and at 4 °C for 15 min.
The cell pellet was resuspended in PBSG buffer (PBS containing
5% glycerol). Cells were then lysed using sonicator with (20 s pulse
and 45 s halt) and centrifuged the crude lysate at 8000 rpm at 4 °C
for 10 min; further centrifugation was repeated for the superna-
tant obtained from the previous step at 10,000 rpm at 4 °C for
45 min. The cell extract was later applied to Ni-NTA column
(Bio-Rad). After washing the column with wash buffer (5% glycerol
in PBS and 500 mM NaCl) desired protein was eluted using differ-
ent concentration of imidazole ranging from 10 mM to 500 mM in
the elution buffer (5% Glycerol, 140 mM NaCl in 25 mM Tris–Cl
(pH 8.0)). Fractions containing the GyrB subunit were identified
by running a sodium dodecyl sulfate–polyacrylamide gel electro-
phoresis (SDS–PAGE), samples were pooled; dialysed against 15%
glycerol, 140 mM NaCl in 25 mM Tris–Cl (pH 7.4); frozen in liquid
nitrogen and stored at ꢀ80 °C.
To perform the MABA assay, the inoculum was prepared from
fresh LJ medium, resuspended in 7H9 medium (7H9 broth, 0.1%
casitone, 0.5% glycerol, supplemented oleic acid, albumin, dextrose,
and catalase [OADC]), later adjusted to a McFarland tube No. 1, and
diluted 1:20; further 100 l
L was used as inoculums.16 Each
dissolved drug stock was thawed and diluted in 7H9-S at four-fold
the final highest concentration tested. In this way, serial two-fold
dilutions of each drug were prepared directly in a sterile 96
flat-bottomed well microtiter plate using 100 lL 7H9-S. A control
containing no antibiotic and a sterile control were also prepared
for each plate. In order to avoid evaporation of the contents during
the incubation for 7 days, sterile water was added to all perimeter
wells. The plate was covered with the lid, sealed in plastic bags and
incubated at 37 °C at normal atmosphere. After seven days of incu-
bation, 30 lL of Alamar blue solution was added to each well, and
the plate was re-incubated overnight. A change in color from blue
(oxidized state) to pink (reduced) indicated the growth of bacteria,
and so the MIC was defined as the lowest concentration of drug
that prevented this change in color.
4.3. MS GyrB ATPase assay
The ATPase assay was performed in the presence of ATP mole-
cule which got hydrolyzed similar to the previously reported
4.6. In vitro cytotoxicity screening
protocol.12 Briefly, the assay was carried out in 30
lL reaction
The safety profile of all the compounds in the eukaryotic cells
were examined by evaluating their in vitro cytotoxicity against
mouse macrophages RAW 264.7 cell line at a concentration of
volume for 2 h at 25 °C in reaction buffer containing 60 mM
HEPES–KOH (pH 7.7), 250 mM potassium glutamate, 200 mM
KCl, 2 mM magnesium chloride, 1 mM DTT, 2% Glycerol, 4% DMSO,
0.001% BriJ-35, 40 nM GyrB and 0.65 mM ATP. All the test com-
pounds were diluted in DMSO to about 30 times the final assay
concentration. Assay was performed in 96-well V-shape bottomed
100 lM. After 72 h of exposure of the drug with the cells, viability
was assessed on the basis of cellular conversion of the dye MTT
into a formazan product using the Promega Cell Titer 96 non-radio-
active cell proliferation assay.17 The absorbance was read at
560 nm after 10 min incubation.
plates (Polystyrene untreated). Initially 1
placed in the assay wells, which was followed by 15
trated 2ꢁ assay buffer which includes 1 L of purified GyrB
enzyme and substrate mix, the enzyme reaction was initiated by
adding 14 L of 2 mM MgCl2 solution. Then the reaction was
allowed to proceed for 100 min at room temperature. Further,
the reaction was quenched by adding 20 L of malachite green
l
L of test compound was
lL of concen-
l
4.7. Differential Scanning fluorimetry (DSF)
l
The thermal stability of the protein with the ligand and affin-
ity of most potent ligand with the protein of our interest can be
l
known by using DSF technique. The assay was carried in 15
reaction volume consisting of 3.5 L of assay buffer (50 mM Tris
pH 7.4, 1 mM EDTA, 5 mM DTT), 7.5 L of DNA gyrB protein
(1.5 mg/mL) and 2.5 L of Sypro orange dye (1:100) (Sigma)
lL
reagent (Bioassay systems, USA). The inorganic phosphates (Pi)
released after the reaction was measured at 635 nm after incubat-
ing for 20 min.
l
l
l
which were subjected to stepwise heating in a PCR instrument
(Bio-Rad) from 25 °C to 100 °C with an increment of 0.6 °C/
min.18 With increase in temperature the protein, slowly unfolds
and the inner hydrophobic residues get exposed, eventually more
dye binds to the protein and fluorescence increases till it reaches
equilibrium and this point is termed as melting temperature
(Tm).17 When the affinity of inhibitor is strong we observe a posi-
tive shift or increase in Tm when compared to the native protein
Tm.
4.4. MTB DNA supercoiling assay
Supercoiling assay is performed by the A2B2 holoenzyme of
DNA gyrase. The assay was performed using MTB DNA supercoiling
assay kit (Inspiralis Limited, Norwich), in brief the assay was
performed in 30 lL reaction volume for a period of 30 min at
37 °C in assay buffer containing 50 mM HEPES. KOH (pH 7.9),
6 mM magnesium acetate, 4 mM DTT, 1 mM ATP, 2 mM spermi-
dine, 100 mM potassium glutamate, and 0.05 mg/mL of albumin.
During the assay 1 U of MTB DNA gyrase was incubated with
4.8. Molecular modelling studies
0.5
l
g of relaxed pBR322 substrate in 1ꢁ assay buffer. Later the
reaction was quenched by the addition of equal volume of 30
lL
The most active compound which was proved to be active in MS
DNA gyrB and MTB DNA supercoiling assay was docked onto the
active pocket of the GyrB ATPase domain of MS retrieved from
Protein Data Bank (PDB ID: 4B6C). The protein was initially pro-
cessed (optimized and minimized) using the Protein Preparation
Wizard of Schrödinger Suite 2012.19 Further, the optimization of
the hydrogen-bonding network and also the ligands to be docked
were sketched in Maestro panel of Schrödinger and optimized with
OPLS force field.20 The docking of these molecules with the protein
was done using Glide v5.8.21
of chloroform: isoamylalcohol (24:1) and STEB (40% sucrose,
100 mM Tris HCl (pH 8.0), 100 mM EDTA, 0.5 mg/mL bromophenol
blue) subjected to a brief vortex, followed by centrifugation at
6000 rpm. The final product was analyzed by electrophoresis by
running on 1% agarose gel and by staining with ethidium bromide
(EtBr). Destaining was performed using Image lab software
(Bio-Rad), intensity of the bands were measured and analyzed to
know the enzyme inhibition by relative band intensity when
compared to the positive control.

K.I. Reddy et al. / Bioorg. Med. Chem. 22 (2014) 6552–6563
7. Champoux, J. J. Annu. Rev. Biochem. 2001, 70, 369.
6563
Acknowledgment
8. Jeankumar, V. U.; Renuka, J.; Santosh, P.; Soni, V.; Sridevi, J. P.; Suryadevara, P.;
Yogeeswari, P.; Sriram, D. Eur. J. Med. Chem. 2013, 70, 143.
D.S. would like to thank University Grant Commission, Govern-
ment of India for UGC researcher award.
9. Kaur, P.; Agarwal, S.; Datta, S. PLoS One 2009, 4, e5923.
10. Renuka, J.; Reddy, K. I.; Srihari, K.; Jeankumar, V. U.; Shravan, M.; Sridevi, J. P.;
Babu, K. S.; Yogeeswari, P.; Sriram, D. Bioorg. Chem. 2014, 22, 4924.
11. Stokes, N. R.; Thomaides-Brears, H. B.; Barker, S.; Bennett, J. M.; Berry, J.;
Collins, I.; Czaplewski, L. G.; Gamble, V.; Lancett, P.; Logan, A.; Lunniss, C. J.;
Peasley, H.; Pommier, S.; Price, D.; Smee, C.; Haydon, D. J. Antimicrob. Agents
Chemother. 2013, 57, 5977.
12. Shirude, P. S.; Madhavapeddi, P.; Tucker, J. A.; Murugan, K.; Patil, V.;
Basavarajappa, H.; Raichurkar, A. V.; Humnabadkar, V.; Hussein, S.; Sharma,
S.; Ramya, V. K.; Narayan, C. B.; Balganesh, T. S.; Sambandamurthy, V. K. ACS
Chem. Biol. 2013, 8, 519.
13. Friesner, R. A.; Murphy, R. B.; Repasky, M. P.; Frye, L. L.; Greenwood, J. R.;
Halgren, T. A.; Sanschagrin, P. C.; Mainz, D. T. J. Med. Chem. 2006, 49, 6177.
14. Franzbalu, G. S.; Witzig, S. R.; McLaughlin, C. J.; Torres, P.; Madico, G.;
Hernandez, A.; Degnan, T. M.; Cook, B. M.; Quenzer, K. V.; Ferguson, M. R.;
Gilman, H. R. J. Clin. Microbiol. 1998, 36, 362.
15. Gerlier, D.; Thomasset, N. Immunol. Methods 1986, 94, 57.
16. Niesen, F. H.; Berglund, H.; Vedadi, M. Nat. Prot. 2007, 2, 2212.
17. Brvar, M.; Perdih, A.; Renko, M.; Anderluh, G.; Jerala, R.; Solmajer, T. J. Med.
Chem. 2012, 55, 6413.
18. Brvar, M.; Perdih, A.; Hodnik, V.; Renko, M.; Anderluh Hodnik, G.; Renko, V.;
Anderluh, M.; Jerala, G.; Solmajer, R.; Bioorg, T. Med. Chem. 2012, 20, 2572.
19. (a) Protein Preparation Wizard; Schrödinger Suite, 2012; (b) Epik Version 2.2;
Schrödinger, LLC: New York, NY, 2012; (c) Impact Version 5.7; Schrödinger
Suite: New York, NY, 2012; (d) Prime Version 2.3; Schrödinger Suite: New York,
NY, 2012.
20. Kar, R. K.; Suryadevara, P.; Sahoo, B. R.; Sahoo, G. C.; Dikhit, M. R.; Das, P. SAR
QSAR Environ. Res. 2013, 24, 215.
21. Glide, Version 5.8; Schrödinger, LLC: New York, NY, 2012.
References and notes
1. Kale, M. G.; Raichurkar, A.; Waterson, S. H. P. D.; McKinney, D.; Manjunatha, M.
R.; Koushik, K.; Jena, L. K.; Shinde, V.; Rudrapatna, S.; Barde, S.; Humnabadkar,
V.; Madhavapeddi, P.; Basavarajappa, H.; Ghosh, A.; Ramya, V. K.; Guptha, S.;
Sharma, S.; Vachaspati, P.; Kumar, K. N.; Giridhar, J.; Reddy, J.; Panduga, V.;
Ganguly, S.; Ahuja, V.; Gaonkar, S.; Kumar, C. N.; Ogg, D.; Tucker, J. A.; Boriack-
Sjodin, P. A.; de Sousa, S. M.; Sambandamurthy, V. K.; Ghorpade, S. R. J. Med.
Chem. 2013, 56, 8834.
2. Aboul-Fadl, T.; Abdel-Aziz, H. A.; Abdel-Hamid, M. K.; Elsaman, T.; Thanassi, J.;
Pucci, M. J. Molecules 2011, 16, 7864.
3. World Health Organization. Global Tuberculosis Control; WHO 2011 Report on
Tuberculosis. http://www.who.int/mediacentre/news/releases/2011/tb_20111011/
en/index.html.
4. World Health Organization. Multidrug and Extensively Drug-Resistant TB
(M/XDR-TB); WHO 2010 Global Report on Surveillance and Response.
5. Cole, S. T.; Brosch, R.; Parkhill, J.; Garnier, T.; Churcher, C.; Harris, D.; Gordon, S.
V.; Eiglmeier, K.; Gas, S.; Barry, C. E.; Tekaia, F.; Badcock, K.; Basham, D.; Brown,
D.; Chillingworth, T.; Connor, R.; Davies, R.; Devlin, K.; Feltwell, T.; Gentles, S.;
Hamlin, N.; Holroyd, S.; Hornsby, T.; Jagels, K.; Krogh, A.; McLean, J.; Moule, S.;
Murphy, L.; Oliver, K.; Osborne, J.; Quail, M. A.; Rajandream, M. A.; Rogers, J.;
Rutter, S.; Seeger, K.; Skelton, J.; Squares, R.; Squares, S.; Sulston, J. E.; Taylor, K.;
Whitehead, S.; Barrell, B. G. Nature 1998, 393, 537.
6. Aubry, A.; Fisher, L. M.; Jarlier, V.; Cambau, E. Biochem. Biophys. Res. Commun.
2006, 348, 158.