Development of a 3′-amino linker with high conjugation activity and its application to conveniently cross-link blunt ends of a duplex

Article abstract of DOI:10.1016/j.bmc.2016.03.039

The 2-aminoethyl carbamate linker (ssH linker) exhibits high activity in modifying the 5′-termini of oligonucleotides; however, the ssH linker is not appropriate for 3′-terminal modification because it undergoes intramolecular trans-acylation under heat-a

Full text of DOI:10.1016/j.bmc.2016.03.039

Bioorganic & Medicinal Chemistry 24 (2016) 2108–2113
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Development of a 30-amino linker with high conjugation activity
and its application to conveniently cross-link blunt ends of a duplex
Keiko Kowata a, Naoshi Kojima b, Yasuo Komatsu a,
⇑
a Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), 2-17-2-1 Tsukisamu-Higashi, Toyohira-ku, Sapporo 062-8517, Japan
b Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Tsukuba Central 6, Higashi, Tsukuba-shi, Ibaraki 305-8566, Japan
a r t i c l e i n f o
a b s t r a c t
The 2-aminoethyl carbamate linker (ssH linker) exhibits high activity in modifying the 50-termini of
oligonucleotides; however, the ssH linker is not appropriate for 30-terminal modification because it
undergoes intramolecular trans-acylation under heat–aqueous ammonia conditions. We developed an
N-(2-aminoethyl)carbamate linker (revH linker), in which the carbamate is oriented in the reverse direc-
tion relative to that in 2-aminoethyl carbamate. The revH linker was tolerant to heat–alkaline conditions
and retained its high reactivity in conjugation with exogenous molecules. The 30-revH linker was effi-
ciently linked with the 50-ssH linker at the termini of complementary double strands with a bifunctional
molecule, producing a synthetic loop structure. An anti-microRNA oligonucleotide (AMO) was prepared
from the chemical ligation of three-stranded 20-O-methyl RNAs, and the AMO with two alkyl loops exhib-
ited high inhibition activity toward miRNA function. The revH linker is not only useful for 30-terminal
modification of oligonucleotides but also expands the utility range in combination with the 50-ssH linker.
Ó 2016 Elsevier Ltd. All rights reserved.
Article history:
Received 16 February 2016
Revised 24 March 2016
Accepted 25 March 2016
Available online 25 March 2016
Keywords:
Amino linker
Nucleic acids
Oligonucleotides
Labeling
Cross-link
anti-microRNA
1. Introduction
or linear alkyl chain, such as hexyl (C6) group,14,15 have been
developed for the 30-amino modifications. Primary amines are gen-
Post-synthetic modifications of oligonucleotides (ONTs) are
site-specifically promoted through reactive linkers, which involve
a primary amine,1 thiol,2 hydrazine,3 aldehyde,4,5 or amino-oxy
moiety.6,7 Recently, an increasing number of cycloaddition
reactions have also been reported for the modification of ONTs.
Copper-catalyzed azide–alkyne cycloadditions (CuAACs), known
as ‘click’ reactions, are a very powerful tool for ONT modifica-
tions.8,9 As metal-free cycloaddition reactions, strain-promoted
azide–alkyne cycloaddition (SPAAC)10,11 and inverse electron-
demand Diels–Alder reactions have also been applied to ONT
labeling.12
Amino linkers have been extensively used for ONT modifica-
tions because amino-modified ONTs are chemically stable and
cost-effective. Modifications of ONT terminals minimize the effects
on hybridization efficiency or sequence selectivity. The decision of
which termini to modify depends on each application. In the
synthesis of 30-amino-modified ONTs, the first nucleotide amidite
unit is coupled with an amino-linker unit that is covalently con-
nected to a solid support such as controlled pore glass (CPG) or
polystyrene resin. Primary aliphatic amino linkers with branched13
erally protected by alkaline labile15–17 or photolabile groups.18
Thus, amino-modified ONTs are cleaved from the solid support
by a heat–alkaline treatment or by UV-irradiation after the ONT
synthesis.
We previously developed an amino linker consisting of an 2-
aminoethyl carbamate structure (ssH linker, Fig. 1b) for 50-terminal
modification. Some chemical features of a primary amine were
induced by the neighboring effect of the carbamate group. The
ssH-linker-modified ONTs more efficiently conjugate with exoge-
nous molecules with active esters than do C6-ONTs.19 In addition,
the monomethoxytrityl (MMT) group protecting a primary amine
can be rapidly removed, resulting in high-throughput purification
of amino-modified ONTs. However, in the ssH linker, trans-acyla-
tion to a free primary amine occurs during the heat–aqueous
ammonia treatment unless the primary amine is protected by the
MMT. Thus, the ssH linker is not suitable as a 30-terminal amino
linker that cannot employ the MMT group. In this study, to develop
a more suitable linker structure, we improved our carbamate-con-
taining amino linker to be applicable to 30-terminal modifications.
The novel 30-amino linker was stable under alkaline conditions and
exhibited the same efficiency as the ssH linker in labeling with
molecules of active esters. We also report here that 50- and 30-car-
bamate-containing amino linkers enabled convenient cross-linking
⇑
Corresponding author. Tel.: +81 11 857 8437; fax: +81 11 857 8954.
E-mail address: komatsu-yasuo@aist.go.jp (Y. Komatsu).
http://dx.doi.org/10.1016/j.bmc.2016.03.039
0968-0896/Ó 2016 Elsevier Ltd. All rights reserved.

K. Kowata et al. / Bioorg. Med. Chem. 24 (2016) 2108–2113
2109
1,6-hexanediol, whereas ssH-CPG units required seven steps for
preparation from 2-aminoethanol (Schemes S1 and S2).
(a)
(b)
T5-X :5 -TTTTT-X
25-X : 5 -TCTTCCAAGCAATTCCAATGAAAGC-X
2.2. Stability under heat–alkaline conditions
-X
C6
We first synthesized penta-thymidylic acids with 30-amino link-
ers (T5-X; X = C6, ssH, revH, revMe; Fig. 1a) using each amino-
modified CPG. After these amino-modified ONTs were treated in
AMA solution (i.e., 1:1 mixture of 40% methylamine and concen-
trated ammonia solution) at 65 °C for 10 min, they were purified
by reversed-phase HPLC. Their stabilities in AMA and concentrated
aqueous ammonia were examined (Fig. 2 and Fig. S1 in Supple-
mentary data). All 30-amino-ONTs were observed to be stable in
the short AMA treatment (Fig. S1). On the other hand, the chro-
matogram of T5-ssH exhibited two peaks (P1 and P2, Fig. 2a) after
incubation in concentrated aqueous ammonia at both 55 °C and
65 °C. The percentage of P2 was approximately 2.6 times greater
than that of P1, and the total percentage (P1 + P2) increased with
the incubation temperature (Fig. 2b). These results are consistent
with the previously reported results of the aqueous ammonia
treatment of 50-ssH-modified ONTs.19 On the basis of the previous
results and the molecular-weight analyses (Table S2), P1 and P2
were identified to have 6-aminohexyl and trans-acylated urea
structures (Fig. 2c), respectively.
ssH
revH
revMe
revPro
(c)
In contrast to the chromatogram of T5-ssH, that of T5-revH
exhibited only a low-intensity peak (P3 in Fig. 2a; 0.8% at 55 °C,
2.9% at 65 °C), whose percentage was only one-tenth the total
degradation of T5-ssH. Although T5-revMe is cognate with T5-
revH, its chromatogram exhibited two peaks (P4 and P5, Fig. 2a)
and the total percentage was much higher than that of T5-revH
(Fig. 2b). Molecular-weight analyses revealed that both P3 and P4
had 6-hydroxyhexyl structures and that P5 had the same molecu-
lar weight as the parent molecule (Table S2). These results indicate
that the intramolecular trans-acylation reaction evidently occurred
in the revMe linker (Fig. 2c) and P5 was identified to be a trans-acy-
lated product. By contrast, whether the same reaction proceeded in
the revH linker was unclear because the revH structure could be
reformed as a consequence of its symmetrical ethylenediamine
moiety, even after the intramolecular trans-acylation. Another pos-
sibility is that the revH linker is tolerant to the alkaline treatment.
In any event, the revH linker had the alkali resistance necessary for
a 30-amino linker.
ssH-CPG
revH-CPG: n=1, R=H
revMe-CPG: n=1, R=CH3
revPro-CPG:n=2, R=H
Figure 1. Sequences of 30-amino-modified ONTs (T5-X and 25-X) (a) and the
structures of 30-terminal amino linkers (b). X indicates the 30-amino linker (C6, ssH,
revH, revMe, or revPro). (c) Structures of the 30-amino-linker CPG units synthesized
in this study.
at the terminals of complementary strands, probing the usefulness
of these linkers for preparing long ONTs.
2.3. Labeling reactions with active esters
2. Results and discussion
All 30-amino-linkers were found to be stable under the AMA
treatment (Fig. S1). By using the AMA deprotection, we prepared
30-modified 25-mer (25-Y; Y = C6, ssH, revH, revMe, Fig. 1a) to
investigate the labeling efficiencies with fluorescein isothiocyanate
(FITC), biotin-N-hydroxysuccinimidyl ester (biotin-NHS), and poly-
ethylene glycol N-hydroxysuccinimidyl ester (PEG-NHS). As evi-
dent in Figure 3 and 25-ssH gave several times more conjugates
than 25-C6; these results are consistent with our previous results
obtained for the modifications of 50-ssH-ONTs.19 Notably, both
25-revH and 25-revMe exhibited high labeling efficiencies compa-
rable with that of 25-ssH. To examine the structural requirement of
the N-(aminoalkyl)carbamate moiety, the N-(3-aminopropyl)car-
bamate structure (revPro, Fig. 1b) was prepared. The labeling reac-
tions with the 30-revPro-modified 25-mer (25-revPro) decreased
the conjugation yields compared to those of the revH- and ssH-
modified ONTs (Fig. 3). We attributed this decrease in revPro to
the reduction in the neighboring effect of the carbamate group
because of the insertion of 3-aminopropyl spacer, indicating that
2.1. Design and synthesis of novel 30-amino linkers
When 50-ssH-modified ONTs without protecting group for a pri-
mary amine are treated in heat–aqueous ammonia, a trans-acyla-
tion reaction occurs through the attack of a primary amino group
on a carbamate carbon atom.19 On the basis of this result, we
designed an N-(2-aminoethyl)carbamate linkage (revH, Fig. 1b),
where a 2-aminoethyl group was connected to the nitrogen atom
of the carbamate moiety. We expected that the revH structure
could be reformed even after the intramolecular trans-acylation.
We also synthesized a revMe linker unit with a methyl group on
an ethylenediamine chain (Fig. 1b). All primary amines of these lin-
ker units were covalently tethered with CPG using trimellitic anhy-
dride (revH-CPG, revMe-CPG, Fig. 1c).16,17 Although the ssH linker
is originally suitable for 50-modification, we prepared an ssH-CPG
for 30-modification to enable a comparison of the chemical stability
or reactivity. The revH-CPG was observed to be advantageous in
preparation because it could be synthesized in five steps from
the N-(2-aminoethyl)carbamate structure is
a more effective
30-amino linker.

2110
K. Kowata et al. / Bioorg. Med. Chem. 24 (2016) 2108–2113
(a)
(b)
40
T5-ssH
55°C
65°C
32.7
P2
P1
29.7
min
20
0
17.3
T5-revH
13.5
P3
2.9
0.8
0 0
min
T5-revMe
C6
ssH
revH revMe
P5
P4
min
(c)
T5-ssH
+
+
+
P1
P3
P2
T5-revH
T5-revH
T5-revMe
P4
P5
Figure 2. Stabilities of 30-amino-modified ONTs in heat–alkaline conditions. (a) Chromatograms of HPLC analyses of T5-ssH, T5-revH and T5-revMe after treated in conc.
NH4OH at 55 °C for 16 h. (b) Percentages of ONT fragments produced by the incubation of T5-X at 55 °C (black bars) or 65 °C (gray bars) in conc. NH4OH. (c) Schemes of the
intramolecular trans-acylation reactions. The sum of each product is plotted in Figure 2b.
2.4. pKa values of the primary amino groups
100
FITC
biotin-NHS
PEG-NHS
Our previous study revealed that the pKa value of a primary
amine on the ssH linker was decreased, compared with that of
an aliphatic amine, C6 linker.19 To examine the pKa values of the
N-(aminoalkyl)carbamate moiety, amino-linker monomer units
(revHOH and revProOH, Scheme S2) were prepared. The pKa values
of the primary amines were determined on the basis of the chem-
ical shift changes in the 13C NMR spectra collected under various
pH conditions (Fig. S2). The determined pKa value of revHOH was
9.8. This value is substantially lower than that of C6OH
(pKa = 11.0) and is similar to that of ssHOH (pKa = 9.6).19 By con-
trast, revProOH with an N-(3-aminopropyl)carbamate exhibited a
pKa intermediate (pKa = 10.4) between those of revHOH and C6.
We think that the significant reduction in the pKa values of revHOH
and ssHOH was derived from the electron-withdrawing effect of the
carbamate group. Thus, this neighboring effect was slightly
diminished in revProOH containing the 3-aminopropyl spacer. In a
80
60
40
20
0
C6
ssH
revH revMe revPro
Figure 3. Conjugating reactions of 25-X ONTs with activated molecules. Percent-
ages of ONTs labeled with FITC (black bars), biotin-NHS (gray bars), and PEG-NHS
(white bars).

K. Kowata et al. / Bioorg. Med. Chem. 24 (2016) 2108–2113
2111
coupling reaction between a primary amine and an active ester, a
protonated amine loses nucleophilicity. In addition, deprotonation
from the amine of the intermediate is essential to complete a cova-
lent bond formation. Hence, the reduced pKa values of both ssHOH
and revHOH are thought to be closely related with the enhanced
conjugation efficiencies of the ssH and revH linkers.
the presence of the DSG reagent. The cross-linked AMO (CL-
AMO) was successfully obtained from the blunt end cross-links
of short MeRNAs (Fig. 5a). We also prepared a single stranded
MeRNA with two hairpin loops as a control AMO (HP-AMO,
Fig. 5a).22,23 To examine the inhibiting activity against miRNA,
CL-AMO, HP-AMO and three-stranded AMO (I/II/III) were sepa-
rately transfected into HeLa cells, and their activities were evalu-
ated by the dual-luciferase assay. Although the three-stranded
AMO exhibited no suppression of miRNA function, both HP-AMO
and CL-AMO efficiently inhibited miR-21 (Fig. 5b). Because the
2.5. Cross-linking of amino linkers on blunt ends of duplexes
In chemical synthesis of ONTs, amount of ONTs are generally
reduced as the number of nucleotides increase. In addition, it
becomes difficult to purify long ONTs. To address these issues,
there is a post-synthetic ligation method of short ONTs. Double
strands can be cross-linked between 50 and 30 terminals to produce
a hairpin loop ONTs. So far, the chemical ligation using aldehyde-
amine coupling20 or the CuAAC reaction have been reported.21
Amino-modified ONTs are not only chemically stable but also are
superior in terms of convenience and cost. By utilizing these
advantages, we originated the cross-linking between 50 and 30 ter-
minal amino linkers on a blunt end of a duplex. One of the blunt
ends of a complementary 25-mer duplex was modified with an
amino-linker pair of 50-ssH/30-revH or 50-C6/30-C6, followed by
cross-linking with a bifunctional linker, disuccinimidyl glutarate
(DSG) (Fig. 4a). As the results of the reaction, the pair of 50-
ssH/30-revH completed the cross-linking after 5 min (98.4% yield),
in contrast to 43.5% yield in the cross-linking of the 50-C6/30-C6
pair (Fig. 4b). Although the long alkyl-loop structure is formed
after the cross-link of 50-ssH/30-revH, the result indicates that the
ligation reaction between revH and ssH could be cost-effective
and superior method in the convenient preparation of hairpin-type
long ONTs.
Various types anti-microRNA ONTs (AMOs) have been devel-
oped to control microRNA (miRNA) function in living cells.22 Single
stranded ONTs having hairpin-stem loops at both 50 and 30 termi-
nals has been reported to especially show high inhibitory activi-
ties.23,24 To conveniently prepared these long sequence AMOs, we
applied the blunt end cross-link using 50-ssH/30-revH linkers. We
synthesized a 50-ssH- and 30-revH-modified 36-base 20-O-methyl
RNA (MeRNA) (I), which consisted of a complementary sequence
for microRNA-21 (miR-21). The MeRNA-I was subjected to cross-
link with 30-revH- and 50-ssH-modified short MeRNAs (II, III) in
(a)
II
III
5
3
ssH-GUCUCGA
AGCUCUG-revH
AMO (I/II/III)
revH-CAGAGCUAUCGAAUAGUCUGACUACAACUUCGAGAC-ssH
3
5
I
DSG
3
5
-GUCUCGA AGCUCUG-
-CAGAGCUAUCGAAUAGUCUGACUACAACUUCGAGAC-
CL-AMO
HP-AMO
3
5
G
U
G
A
C
U
UCUCGA AGCUCU
AGAGCUAUCGAAUAGUCUGACUACAACUUCGAGA
A
A
(b)
1
0.8
0.6
0.4
0.2
0
HP-AMO
CL-AMO
AMO (I/II/III)
0
5
10
AMO conc.(nM)
Figure 5. (a) Schematic of CL-AMO preparation and the structure of HP-AMO. (b)
Plots of relative luciferase intensities (Rluc/Fluc) versus concentrations of AMOs.
(a)
TCTTCCAAGCAATTCCAATGAAAGC-X
5´
3´
25-X
Y-25
3´
AGAAGGTTCGTTAAGGTTACTTTCG-Y
5´
DSG :
5´ TCTTCCAAGCAATTCCAATGAAAGC-
3´ AGAAGGTTCGTTAAGGTTACTTTCG-
(b)
X/Y = revH/ssH
X/Y = C6/C6
CL-duplex
CL-duplex
duplex
yields = 98.4%
yields = 43.5%
Figure 4. (a) Scheme of cross-linking reaction at a blunt end of a duplex (25-X/Y-25). (b) Analyses of the cross-linking reactions (X/Y = revH/ssH, or C6/C6).

2112
K. Kowata et al. / Bioorg. Med. Chem. 24 (2016) 2108–2113
inhibitory activity has been reported to depend on the lengths of
the stems flanking a sequence complementary to miRNA,23 these
results suggest that three-stranded AMO (I/II/III) could not
maintain the stem structures due to the small number of base
pairs. On the other hand, it was revealed that CL-AMO could
involve a stable stem-loop structure via the cross-linked linkages.
It is not clear why HP-AMO exhibited the slightly higher activity
than CL-AMO. Since HP-AMO involves two types of stable hairpin
loops, it might be superior to CL-AMO in nuclease resistance or
binding affinity against miRNA. Further experiments to reveal
them are ongoing. We confirmed that the cross-links between
50-ssH and 30-revH are able to provide functional long ONTs
conveniently.
Table S1. The results of molecular-weight analyses of the decom-
posed products (P1–P5) are listed in Table S2.
4.4. Labeling of amino-modified ONTs
The 30-amino-modified ONT (150 pmol) was reacted with FITC
(150 nmol) or biotin succinimidyl ester (15 nmol) in a solution
(100 lL) containing 250 mM phosphate buffer (pH 8.0) and 10%
dimethylformamide (DMF) at 25 °C. After 30 min (for biotin suc-
cinimidyl ester) or 60 min (for FITC), the reaction mixture was
desalted with a cartridge column (NAP5) and the products were
analyzed by HPLC equipped with a reversed-phase column and a
photodiode array detector (Waters). The percentage of the product
was determined by HPLC analysis.
Labeling with PEG-NHS (75 nmol) was carried out as described
for the reaction with biotin-NHS but in the absence of DMF. We
used branched PEG (SUNBRIGHTGL 2-400GS2, NOF Corp.).
3. Conclusion
N-(2-Aminoethyl)carbamate (revH) and 2-aminoethyl carba-
mate (ssH) linkers were synthesized for 30-terminal modification
of ONTs. Both the carbamate-containing linkers could exhibit effi-
cient reactivity toward active esters compared to the aminoalkyl
linker. Importantly, the revH was more stable in alkaline treat-
ments than the ssH. This high stability was attributed to the sym-
metrical ethylene diamine structure in the revH. These results
indicate the high potential of the revH as 30-amino-linker.
4.5. Cross-linking reaction between amino linkers on a blunt
end of a duplex
Amino-modified duplexes of complementary 25 bases (25-
revH/ssH-25 or 25-C6/C6-25; 200 pmol) were dissolved in
150 mM phosphate buffer (pH 8; 200 lL). The solution was heated
at 90 °C for 1 min and then cooled to room temperature. A 0.4 mM
solution of disuccinimidyl glutarate (Thermo) dissolved in DMF
(50 lL) was added, and the reaction solution was incubated at
27 °C. After 5 min, the reaction mixtures were analyzed as
described for the analysis of labeled ONTs.
We proved that the combination of 50-ssH and 30-revH linkers
enable the efficient cross-links at the blunt ends of duplexes in
the presence of a bifunctional reagent. An anti-microRNA ONT
(CL-AMO) was prepared via the cross-linking of three ONT pieces,
and it efficiently inhibited miRNA function compared to
a
noncross-linked ONT. In conclusion, the revH linker containing a
carbamate linkage is very useful for various 30-terminal modifica-
tions of ONTs and its combined use with a cognate ssH linker as
a 50-amino linker further enables versatile applications.
4.6. Preparation of a CL-AMO from cross-links of amino linkers
Oligo-I (1.0 nmol), oligo-II (1.2 nmol), and oligo-III (1.2 nmol)
were dissolved in 156 mM phosphate buffer (200 lL), heated at
90 °C for 1 min, and then annealed to room temperature. The solu-
tion was placed on an ice bath for 5 min, followed by the addition
4. Experimental
of 2 mM DSG dissolved in DMF (5 lL). The reaction solution was
4.1. Synthesis of 30-amino-linker CPG units
incubated at 17 °C for 3 h, and CL-AMO was purified by reversed-
phase HPLC. The molecular weight of CL-AMO, which was mea-
sured using liquid chromatography–mass spectrometry, was
observed to be nearly identical to the calculated value: calcd
17,815.48, found 17,818.06.
The syntheses of ssH-, revH-, revMe-, and revPro-CPG units are
presented in the Supplementary data.
4.2. Synthesis of 30-amino-modified ONTs
4.7. Luciferase assays
All ONTs were chemically synthesized using standard phospho-
ramidite chemistry. 30-Amino-modified oligoribonucleotides were
synthesized using 20-O-TBDMS-amidite units (Glen Research) with
the trityl-off mode. Cleavage from the support and removal of the
protecting groups were carried out in AMA solution at 65 °C for
10 min. The deprotection of TBDMS groups was carried out in a
A target sequence complementary to mature miR-21 was
inserted into the 30 untranslated region of the Renilla luciferase
(hRluc) gene of psiCHECK-2 vector (Promega), providing the plas-
mid of psiCHECK-2-miR21, which contained both hRluc and firefly
luciferase genes. HeLa cells were seeded at densities of 2 ꢀ 104
solution containing 3HF/TEA (75
(60
lL), DMSO (115 lL), and TEA
cells per well in 96 well plates in DMEM (200
l
L) containing 10%
L) was
removed from each well, the cells were transfected in triplicate
with DMEM solution (10 L) containing Lipofectamine 2000 (Invit-
rogen; 0.3 L), psiCHECK-2-miR21 (100 ng), and AMOs. The con-
l
L) at 65 °C for 2.5 h. After the reaction solution was desalted
FBS the day before transfection. After an aliquot (100
l
with NAP10, 30-modified oligoribonucleotides were purified by
HPLC using a reversed-phase column.
l
l
4.3. HPLC analyses of T5-X treated with alkaline solutions
centrations of the AMOs were varied from 0 to 10 nM.
Assays were performed 48 h post-transfection according to the
manufacturer’s instructions. Renilla luciferase/firefly luciferase
(Rluc/Fluc) values are the average of triplicate wells. All values
were normalized by the ratio of the plasmid signal to the control
plasmid (psiCHECK-2) signal.
After T5-X (1.5 nmol) were incubated in various alkaline sol-
vents (100 lL; condition 1: AMA at 65 °C for 10 min; condition 2:
conc. NH4OH at 55 °C or 65 °C for 16 h), each solvent was evapo-
rated under reduced pressure. The residues were dissolved in
water and subjected to HPLC analyses using a reversed-phase col-
umn. Figure 2a and Figure S1 show the chromatograms of the HPLC
analyses before and after the alkaline treatments (AMA at 65 °C,
conc. NH4OH at 55 °C). Percentages of each peaks generated from
the incubations in conc. NH4OH at 55 °C and 65 °C are listed in
Acknowledgments
We thank Drs. Yu Hirano and Yasuhiro Mie (Bioproduction
Research Institute, National Institute of Advanced Industrial

K. Kowata et al. / Bioorg. Med. Chem. 24 (2016) 2108–2113
2113
8. Gramlich, P. M.; Wirges, C. T.; Manetto, A.; Carell, T. Angew. Chem., Int. Ed. 2008,
47, 8350.
9. El-Sagheer, A. H.; Brown, T. Acc. Chem. Res. 2012, 45, 1258.
10. Marks, I. S.; Kang, J. S.; Jones, B. T.; Landmark, K. J.; Cleland, A. J.; Taton, T. A.
Bioconjugate Chem. 2011, 22, 1259.
Science and Technology) for helpful discussions. Financial support
was received, in part, from the Ministry of Education, Culture,
Sports, Science and Technology, Japan (Grant-in-Aid for Scientific
Research (No. 25293030)), and Akiyama Life Science Foundation.
11. Winz, M. L.; Samanta, A.; Benzinger, D.; Jaschke, A. Nucleic Acids Res. 2012, 40,
e78.
Supplementary data
12. Schoch, J.; Staudt, M.; Samanta, A.; Wiessler, M.; Jaschke, A. Bioconjugate Chem.
2012, 23, 1382.
13. Nelson, P. S.; Kent, M.; Muthini, S. Nucleic Acids Res. 1992, 20, 6253.
14. Asseline, U.; Thuong, N. T. Tetrahedron Lett. 1990, 31, 81.
15. Petrie, C. R.; Reed, M. W.; Adams, A. D.; Meyer, R. B., Jr. Bioconjugate Chem.
1992, 3, 85.
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2016.03.039.
16. Nelson, P. S.; Sherman-Gold, R.; Leon, R. Nucleic Acids Res. 1989, 17, 7179.
17. Lyttle, M. H.; Adams, H.; Hudson, D.; Cook, R. M. Bioconjugate Chem. 1997, 8,
193.
18. McMinn, D. L.; Matray, T. J.; Greenberg, M. M. J. Org. Chem. 1997, 62, 7074.
19. Komatsu, Y.; Kojima, N.; Sugino, M.; Mikami, A.; Nonaka, K.; Fujinawa, Y.;
Sugimoto, T.; Sato, K.; Matsubara, K.; Ohtsuka, E. Bioorg. Med. Chem. 2008, 16,
941.
20. Kojima, N.; Sugino, M.; Mikami, A.; Nonaka, K.; Fujinawa, Y.; Muto, I.;
Matsubara, K.; Ohtsuka, E.; Komatsu, Y. Bioorg. Med. Chem. Lett. 2006, 16, 5118.
21. Ichikawa, S.; Ueno, H.; Sunadome, T.; Sato, K.; Matsuda, A. Org. Lett. 2013, 15,
694.
22. Lennox, K. A.; Behlke, M. A. Gene Ther. 2011, 18, 1111.
23. Vermeulen, A.; Robertson, B.; Dalby, A. B.; Marshall, W. S.; Karpilow, J.; Leake,
D.; Khvorova, A.; Baskerville, S. RNA 2007, 13, 723.
References and notes
1. Emson, P. C.; Arai, H.; Agrawal, S.; Christodoulou, C.; Gait, M. J. Methods
Enzymol. 1989, 168, 753.
2. Diezmann, F.; Eberhard, H.; Seitz, O. Biopolymers 2010, 94, 397.
3. Raddatz, S.; Mueller-Ibeler, J.; Kluge, J.; Wass, L.; Burdinski, G.; Havens, J. R.;
Onofrey, T. J.; Wang, D.; Schweitzer, M. Nucleic Acids Res. 2002, 30, 4793.
4. Paredes, E.; Evans, M.; Das, S. R. Methods 2011, 54, 251.
5. Zatsepin, T. S.; Stetsenko, D. A.; Arzumanov, A. A.; Romanova, E. A.; Gait, M. J.;
Oretskaya, T. S. Bioconjugate Chem. 2002, 13, 822.
6. Salo, H.; Virta, P.; Hakala, H.; Prakash, T. P.; Kawasaki, A. M.; Manoharan, M.;
Lonnberg, H. Bioconjugate Chem. 1999, 10, 815.
7. Sethi, D.; Patnaik, S.; Kumar, A.; Gandhi, R. P.; Gupta, K. C.; Kumar, P. Bioorg.
Med. Chem. 2009, 17, 5442.
24. Haraguchi, T.; Ozaki, Y.; Iba, H. Nucleic Acids Res. 2009, 37, e43.