New branched DNA constructs

Article abstract of DOI:10.1002/chem.200601473

The Watson-Crick base pairing of DNA is an advantageous phenomenon that can be exploited when using DNA as a scaffold for directed self-organization of nanometer-sized objects. Several reports have appeared in the literature that describe the generation o

Full text of DOI:10.1002/chem.200601473

DOI: 10.1002/chem.200601473
New Branched DNA Constructs
Madhavaiah Chandra, Sascha Keller, Christian Gloeckner, Benjamin Bornemann, and
Andreas Marx*[a]
Abstract: The Watson–Crick base pair-
ing of DNA is an advantageous phe-
nomenon that can be exploited when
using DNA as a scaffold for directed
self-organization of nanometer-sized
objects. Several reports have appeared
in the literature that describe the gen-
eration of branched DNA (bDNA)
with variable numbers of arms that
self-assembles into predesigned archi-
tectures. These bDNA units are gener-
ated by using cleverly designed rigid
crossover DNA molecules. Alternative-
ly, bDNA can be generated by using
synthetic branch points derived from
either nucleoside or non-nucleoside
building blocks. Branched DNA has
scarcely been explored for use in nano-
technology or from self-assembling per-
spectives. Herein, we wish to report
our results for the synthesis, characteri-
zation, and assembling properties of
asymmetrical bDNA molecules that
are able to generate linear and circular
bDNA constructs. Our strategy for the
generation of bDNA is based on a
branching point that makes use of a
novel protecting-group strategy. The
bDNA units were generated by means
of automated DNA synthesis methods
and were used to generate novel ob-
jects by employing chemical and bio-
logical techniques. The entities generat-
ed might be useful building blocks for
DNA-based nanobiotechnology.
Keywords: DNA · ligation · nano-
biotechnology · oligonucleotides ·
self-assembly
Introduction
side building blocks. As a result of this, several branch
points have been reported in the literature to generate
bDNA for several applications.[17–26] Additionally, bDNA
can be generated by the covalent cross-linking of two DNA
strands through disulfide linkages.[27–28] However, bDNA has
scarcely been explored for use in nanotechnology or from
self-assembling perspectives. Herein, we wish to report our
results for the synthesis, characterization, and assembling
properties of asymmetrical bDNA molecules that are able
to generate linear and circular bDNA constructs. We em-
DNA is the fundamental genetic material used to store and
pass information from one generation to the next. The
Watson–Crick base pairing of DNA is an advantageous phe-
nomenon that can be exploited when using DNA as a scaf-
fold for directed self-organization of nanometer-sized ob-
jects.[1–10] In an early report, Seeman proposed ordered
arrays of DNA with branched DNA (bDNA) building
blocks, which naturally exist in cellular DNA metabolism.[11]
Subsequently, several reports have appeared in the literature
that describe the generation of bDNA units with variable
numbers of arms that self-assemble into predesigned archi-
tectures.[12–16] These bDNA molecules are generated by
using cleverly designed rigid crossover DNA molecules. Al-
ternatively, bDNA can be generated by using synthetic
branch points derived from either nucleoside or non-nucleo-
ployed
a combination of chemical and enzymatic ap-
proaches to generate these objects, which represent a novel
class of bDNA constructs.
Results and Discussion
Synthesis of the branching
point and bDNA: We envisaged
the synthesis of asymmetric
bDNA constructs by using the
strategy outlined in Scheme 1.
To use this method, one re-
quires a protecting-group strat-
egy at the branching point (BP)
[a] Dr. M. Chandra, Dipl.-Chem. S. Keller, Dipl.-Biol. C. Gloeckner,
Dipl.-Chem. B. Bornemann, Prof. Dr. A. Marx
Fachbereich Chemie, Universität Konstanz
Universitätsstrasse 10, M 726
78457 Konstanz(Germany)
Fax : (+49)7531-88-5140
E-mail: Andreas.Marx@uni-konstanz.de
3558
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2007, 13, 3558 – 3564

FULL PAPER
the side arm. The DMTr group
of the last incorporated mono-
mer was deprotected by using
standard automated DNA syn-
thetic procedures, and was sub-
sequently acetylated by using
the capping protocol of the syn-
thesizer. The levulinyl group on
the 5’-OH position of the
branch point was cleaved by
treatment of the controlled
pore glass (CPG) loaded
column with hydrazine (0.5m)
in a mixture of pyridine/acetic
acid (1:1). Synthesis was contin-
Scheme 1. General synthetic strategy for asymmetrical bDNA. BP=branching point, A–E=synthesized DNA
strands.
that enables selective manipulations to be carried out to
elongate branch B without affecting the extension of linear
strand A. Phosphoramidite building block 1 was found to
fulfill these criteria and was used in the studies reported
herein. This is different to the well-known commercially
available
N4-(6-hydroxyhexyl)-5-methyl-2’-deoxycytidine
building block (2) that exhibits an inverted protecting-group
strategy with respect to N4-(6-hydroxyhexyl)- and 5’-OH-
protection.
We developed a straightforward synthetic strategy for de-
sired phosphoramidate 1, as shown in Scheme 2. Our synthe-
sis starts with 3’-O-TBS-protected thymidine 3 that was
treated with 2-chloro-1-methylpyridinium iodide in the pres-
ence of 1,4-diazabicyclo[2.2.2]octane (DABCO) and levulin-
G
ic acid to yield compound 4. Thymidine analogue 4 was sub-
sequently treated with 1,2,4-triazole in the presence of
POCl3 to give triazole derivative 5, which was then convert-
ed into 2’-deoxycytosine derivative 6 after treatment with 6-
aminohexanol. This compound was treated with 4,4’-dime-
thoxytriphenylmethylchloride (DMTr-Cl) in the presence of
(N,N-dimethylamino)pyridine (DMAP) to give fully protect-
ed intermediate 7. The 3’-O-TBS group was then removed
by using a mixture of AcOH and tetrabutyl ammonium fluo-
ride (TBAF) to give compound 8, which was converted into
target phosphoramidite 1 by reacting 8 with O-(2-cyanoeth-
yl)-N,N’-diisopropylchlorophoramidite in presence of N,N-
diisopropylethyl amine (DIPEA).
Scheme 2. Synthesis of phosphoramidite 1: a) 2-chloro-1-methylpyridini-
um iodide, DABCO, levulinic acid, CH3CN/dioxane, 90%; b) 1,2,4-tria-
zole, NEt3, POCl3, CH3CN, 100%; c) 6-aminohexanol, CH3CN, 88%; d)
DMTr-Cl, DMAP, pyridine, 88%; e) AcOH/TBAF, THF, 90%; f)
DIPEA, O-(2-cyanoethyl)-N,N’-diisopropylchlorophoramidite, CH2Cl2,
97%. (TBS=tert-butyldimethylsilyl)
ued to extend the branch to form strand C. From the detec-
tion of the DMTr cation, the yield of every coupling step
was found to be >98%. Remarkably, the depicted synthetic
route towards bDNA is compatible with conventional and
inverse amidites (5’-CE phosphoramidites, CE=cyanoeth-
yl). Figure 1 depicts the bDNA molecules that were synthe-
sized and investigated in this study.
The general synthesis for the generation of bDNA out-
lined in Scheme 1 shows that after insertion of branched
monomer 1, synthesis was continued to form segment B as
Chem. Eur. J. 2007, 13, 3558 – 3564
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
3559

A. Marx et al.
was formed in high yields (see
Figure 2, lane 3). Employment
of the 3’–3’ splint resulted in a
product that migrated slightly
differently to that described
previously (see Figure 2, lane
4). In the same lane another
new product appeared, which
might be a 61-mer that results
from annealing bDNA I and
the 3’–3’ splint. Interestingly,
annealing
bDNA I
and
bDNA II in the presence of all
three splints resulted in a new
product (Figure 2, lane 5),
which has the slowest electro-
phoretic mobility observed in
this series compared with other
Figure 1. Representations of the bDNA molecules employed in this study; bDNA I=41-mer, bDNA II=41-
mer, and bDNA III=75-mer.
To generate novel noncovalent and covalent bDNA con-
structs, we synthesized two different bDNA molecules with
a single branch point (41-mer, I and II), and a third one
with three branch points (75-mer III). In bDNA I, the a
branch is designed with a partial EcoRI restriction sequence
(5’-GAAT-3’), and in bDNA II the b branch ends up with
the remaining EcoRI restriction sequence (5’-TC-3’). The
bDNA molecules were characterized by using ESI mass
spectrometry, and the purity was checked by means of ana-
lytical polyacrylamide gel electrophoresis (PAGE) with 32P-
labeled bDNA.
Figure 2. Self-assembly of bDNA molecules I and II. A) Depiction of the
proposed structures. B) Native PAGE analysis of self-assembled bDNAs.
Lane 1=bDNA I; lane 2=bDNA I+II+ab splint; lane 3=bDNA I+
II+ab and cd splints; lane 4=bDNA I+II+3’–3’ splint; and lane 5=
bDNA I+II+all three splints.
Generation of noncovalent self-assemblies of bDNAs: Ini-
tially we envisaged generating noncovalent self-assemblies
of bDNA I and II in the presence of small templating oligo-
nucleotide splints. For this purpose, three splints (20-mer;
ab, cd, and 3’–3’) were used as linking strands. Splint ab rep-
resents the complementary sequence to branch a of bDNA I
and branch b of bDNA II. Splint cd represents the comple-
mentary sequence to branch c of bDNA I and branch d of
bDNA II. The 3’–3’ splint is complementary to both of the 3’
branches of bDNA I and II. This splint was synthesized with
the aid of 3’– and 5’-CE phosphoramidites.
Next, we investigated the self-assembling properties of
the bDNA molecules. To follow the predicted processes, I
was labeled with 32P at its 5’-OH position by employing stan-
dard procedures. Formation of the noncovalent constructs
composed of I and II was monitored by means of native
PAGE analysis. First, we investigated the ability of the ab
splint to hybridize with complementary sites in I and II to
connect both bDNA molecules through self-assembly.
Indeed, we identified significantly lower electrophoretic mo-
bility of I when it was incubated with II and the ab splint
(see Figure 2, lane 2).
annealed products. This might be a result of the intramolec-
ular annealing of two 3’-ends in I and II with the 3’–3’ splint
to lead to a compact double circular structure. We then in-
vestigated the thermal stability of the duplexes formed be-
tween bDNA I and II in the presence of splint oligonucleoti-
des ab, cd, and 3’–3’ by measuring the melting temperatures.
In all cases, we have observed curves with single transitions
that indicate melting temperatures ranging from 50 to 528C
(data not shown). This study further indicated that stable
constructs were formed. Circular dichroism (CD) studies
were performed to determine the conformations of the self-
assembled bDNA. Three CD curves were generated with
bDNA I and II in the presence of i) an ab splint; ii) ab and
cd splints; and iii) ab, cd, and 3’–3’ splints. In all three cases,
characteristic signatures for the B form of DNA were ob-
served (data not shown).
The newly formed product was generated exclusively and
in high yields, as determined by quantification of the PAGE
analysis results by means of phosphorimaging. When two
splints (ab and cd) were used, a product of similar mobility
Enzymatic generation of novel bDNAs constructs: The re-
markable thermal stability of the duplexes generated in the
presence of bridging oligonucleotides prompted us to syn-
3560
www.chemeurj.org
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2007, 13, 3558 – 3564

Branched DNA
FULL PAPER
thesize covalently linked, novel bDNA structures by using
enzymatic approaches. Previously, ligation of oligonucleoti-
des was employed for the synthesis of circular DNA mole-
cules.[29–32] By using this methodology, nanocircles containing
36–54 nucleotides were synthesized.[29]
However, this methodology has not yet been employed
for the generation of novel bDNA structures. For this pur-
pose, bDNA I was 5’-O-phosphorylated with 32P by T4 poly-
nucleotide kinase and thus, radioactively labeled, whereas II
was nonradioactively phosphorylated. In the first experi-
ment, both radioactively labeled bDNA I and phosphorylat-
ed bDNA II were ligated with T4 DNA ligase in the pres-
ence of the ab splint. Denaturating PAGE indicates that the
new covalently linked assembly (bDNA IV) is formed in
high yields (Figure 3B, section a). Under similar conditions,
Figure 4. EcoRI digestion of linear and circular bDNA. A) Depiction of
the proposed structures. B) Denaturating PAGE analysis. Lane 1=
bDNA I, lane 2=bDNA IV, lane 3=bDNAVI, lane 4=EcoRI digestion
of linear bDNA IV, and lane 5=EcoRI digestion of circular bDNAVI.
in the a branch of bDNA I. Interestingly, EcoRI digestion of
circular ligated bDNAVI, which resulted from the ligation
of bDNA I and bDNA II in the presence of two splints,
gave exactly the same length of linear ligated bDNA IV
(Figure 4, lane 5). This occurred as a consequence of a
single nick in the circular portion of bDNA IV and resulted
in a structural change, namely, from the circular to the
linear form.
Then we attempted to generate circular bDNA constructs
containing three branches. Thus, we synthesized bDNA III
with three branch points, in which all three branches (B, D,
and F) are fixed as side arms at the N4-(6-hydroxyhexyl)
group of the branch point and contain 3’-ends. Branches A
and G of bDNA III were intramolecularly ligated with T4
DNA ligase, in the presence of 20-mer splint AG that is
complementary to the A and G strands. As shown in
Figure 5, the conversion of linear bDNA III to the 43-mer
circular form resulted in one product with a slower electro-
phoretic mobility than the linear one.
Figure 3. Denaturing PAGE analysis of bDNA ligation. A) Depiction of
proposed structures. B) Denaturating PAGE analysis of bDNA objects:
a) lane 1=bDNA I; lanes 2–6=ligation with bDNA II for 5 min, 1 h, 3 h,
5 h, and 7 h, respectively, by using the ab splint; b) lane 1=bDNA I;
lanes 2–6=ligation with bDNA II for 5 min, 1 h, 3 h, 5 h, and 7 h, respec-
tively, by using the cd splint; c): lane 1=bDNA I; lanes 2–6=ligation
with bDNA II for 5 min, 1 h, 3 h, 5 h, and 7 h, respectively, by using the
ab and cd splint.
but in the presence of the cd splint, ligation resulted in the
expected product, which has the same length as that ob-
tained by using the ab splint (Figure 3B, section b). To syn-
thesize a circular 42-mer bDNA unit, bDNA molecules I
and II were ligated in the presence of the ab and cd splints.
An entirely new product was obtained (bDNAVI) that ex-
hibits greater electrophoretic mobility than the former prod-
ucts (Figure 3B, section c). Interestingly, in all cases exclu-
sively one ligation product was formed after a short reaction
time. This result reveals that the depicted approach is suita-
ble to generate linear bDNA molecules and circular bDNA
molecules that contain two branches.
Figure 5. Synthesizing circular bDNA from bDNA III. A) Depiction of
the proposed structures. B) Denaturating PAGE analysis. Lane 1=
bDNA III, lanes 2 and 3=ligation in presence of AG splint for 1 and 4 h,
respectively.
The formation of the desired linear and circular bDNA
molecules was confirmed by treating the ligated products
with the restriction endonuclease enzyme EcoRI. Linear li-
gated bDNA IV was incubated with EcoRI, which convert-
ed IV into a new bDNA structure that is shorter than
bDNA I (Figure 4, lane 4). This shorter bDNA fragment re-
sulted from the nicking of the restriction sequence present
The CD spectrum of the duplex, which resulted from
bDNA III and splint AG, showed the characteristic profile
of the B form DNA conformation (data not shown). The
thermal denaturing curve was generated in the presence of
splint AG and the melting temperature was found to be
59.48C. This indicates the remarkable stability of the
Chem. Eur. J. 2007, 13, 3558 – 3564
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
3561

A. Marx et al.
RT. The reaction mixture was diluted with EtOAc (100 mL) and washed
with aqueous NaHCO3 (80%) and with brine. The organic layer was
dried over anhydrous magnesium sulfate and concentrated under reduced
pressure. The crude compound was purified by means of flash chroma-
tography on silica gel (5–6% acetone in CH2Cl2) to give compound 5 in a
quantitative yield. Rf =0.45 (5% acetone in CH2Cl2; highly fluorescent
when visualized with UV light); 1H NMR (CDCl3, 250 MHz): d=8.10 (s,
1H; triazole H-3), 8.07 (s, 1H; triazole H-5), 8.06 (s, 1H; H-6); 6.20 (t,
J=5.8 Hz, 1H; H-1’), 4.40–4.15 (m, 5H; H-5’, H-4’, H-3’), 2.80–2.53 (m,
5H; CH2CH2-Lev, H-2’), 2.44 (s, 3H; CH3-CO), 2.21–2.11 (m, 4H; CH3-
5, H-2’), 0.85 (s, 9H; (CH3)3C-Si), 0.04 (s, 3H; CH3-Si), 0.03 ppm (s, 3H;
CH3-Si); 13C NMR (CDCl3, 62.5 MHz): d=206.1, 172.3, 158.1, 153.7,
153.3, 146.3, 105.4, 96.0, 87.6, 85.4, 70.8, 62.9, 41.8, 37.7, 29.6, 27.7, 25.6,
17.8, 17.2, À4.8, À5.1 ppm; ESIMS: m/z: 528.2 [M+Na]+.
duplex, which eventually led to the formation of circular
bDNA.
Conclusion
In conclusion, we have demonstrated the synthesis of novel
asymmetric bDNA. Herein, the strategy depicted is based
on the employment of a nucleotide analogue that functions
as a branching point. By changing the protecting-group
strategy in comparison with known branching nucleotides
we were able to synthesize novel noncovalent and covalent
bDNA constructs that might be useful for DNA-based nano-
biotechnology.
Synthesis of 5’-O-levulinyl-3’-O-tert-butyldimethylsilyl-N4-(6-hydroxyhex-
yl)-5-methyl-2’-deoxycytidine (6): Compound
5
(2.64 g, 5.2 mmol,
1.0 equiv) in CH3CN (40 mL) was added dropwise at RT to a solution of
6-aminohexanol (5.5 g, 47 mmol, 9.0 equiv) in CH3CN (200 mL) and the
reaction mixture was stirred for 3 h. The reaction mixture was then dilut-
ed with EtOAc (300 mL) and washed with aqueous NaHCO3 (80%) and
with brine. The organic layer was dried over anhydrous magnesium sul-
fate and the solvent was removed under reduced pressure. The crude
compound was purified by means of flash column chromatography on
silica gel (4% MeOH in CH2Cl2) to yield compound 6 (2.56 g, 4.6 mmol,
88%). Rf =0.33 (4% methanol in CH2Cl2); 1H NMR (CDCl3, 250 MHz):
d=7.3 (s, 1H; H-6), 6.29 (t, J=6.3 Hz, 1H; H-1’), 5.1 (brs, 1H; H-
NCH2), 4.34–4.20 (m, 3H; H-5’, H-3’), 4.00 (q, J=4.1 Hz, 1H; H-4’), 3.61
(t, J=6.3 Hz, 2H; CH2-OH), 3.5 (brq, J=4.2 Hz, 2H; CH2-NH), 2.78 (t,
J=6.3 Hz, 2H; CH2-Lev), 2.61–2.55 (m, 2H; CH2-Lev), 2.41–2.35 (ddd,
J=4.8, 6.3, 11.3 Hz, 1H; H-2’), 2.18 (s, 3H; CH3-CO), 2.12–2.01 (m, 1H;
H-2’), 1.91 (s, 3H; CH3-5), 1.65–1.35 (m, 8H; CH2-N4-alkyl), 0.85 (s, 9H;
(CH3)3C-Si), 0.04 (s, 3H; CH3-Si), 0.03 ppm (s, 3H; CH3-Si); 13C NMR
(CDCl3, 62.5 MHz): d=206.3, 172.4, 162.9, 156.0, 136.4, 101.6, 85.8, 84.1,
71.4, 63.6, 62.6, 41.4, 40.8, 37.7, 32.4, 29.7, 29.1, 27.7, 26.4, 25.6, 25.2, 17.9,
13.2, À4.7, À5.0 ppm; ESIMS: m/z: 554.3 [M+1]+, 576.3 [M+Na]+; ele-
mental analysis calcd (%) for C27H47N3O7Si: C 58.56, H 8.55, N 7.59;
found: C 59.13, H 7.99, N 6.86.
Experimental Section
General: All synthetic reactions were performed under an inert atmos-
phere. Dry solvents were purchased from Fluka and were stored over
molecular sieves and used without further purification. Elemental analy-
sis was carried out by the microanalysis facility of the University of Kon-
stanz. NMR spectra were recorded by using Bruker AC 250 Cryospec
(1H: 250 MHz), Jeol JNA-LA-400 (1H: 400 MHz), and Bruker DRX 600
(1H: 600 MHz) spectrometers. Chemical shifts are given in parts per mil-
lion and tetramethyl silane was used as the external standard. Electro-
spray ionization ion trap (ESI-IT) mass spectra were recorded by using a
Bruker Daltonics esquire 3000+ instrument in positive or negative mode
with a flow rate of 3 mLminÀ1. DNA oligonucleotide synthesis was car-
ried out by using an Applied-Biosystems 392 DNA/RNA synthesizer. Re-
verse-phase HPLC was performed by using a Prominence HPLC (Shi-
madzu) instrument equipped with a Nucleosil-100-5 C18 column (250”
4 mm, Macherey-Nagel). A binary gradient system (triethyl ammonium
acetate buffer (0.1m, pH 7.0)/CH3CN, 258C) was used.
Synthesis of 5’-O-levulinyl-3’-O-tert-butyldimethylsilyl-N4-[O-(4,4’-dime-
thoxytrityloxy)hexyl]-5-methyl-2’-deoxycytidine (7): Compound 6 (2.4 g,
4.33 mmol) was co-evaporated twice with dry pyridine (20 mL) and then
dissolved in dry pyridine (45 mL). 4,4’-Dimethoxytritylchloride (1.76 g,
5.2 mmol) and a catalytic amount of DMAP (0.05 g) were added to the
solution, which was stirred overnight at RT. The reaction mixture was
then quenched with dry methanol (0.9 mL, 26 mmol) before it was dilut-
ed with EtOAc (100 mL) and washed with aqueous NaHCO3 (80%) and
with brine. The organic layer was then dried over anhydrous magnesium
sulfate, the solvent was evaporated under reduced pressure, and the
crude compound was purified by means of flash column chromatography
on silica gel (75–80% EtOAc in petroleum ether, 1% NEt3) to give com-
pound 7 (3.02 g, 3.5 mmol, 80%). Rf =0.25 (80% EtOAc in petroleum
ether); 1H NMR (CDCl3, 250 MHz): d=7.43–7.17 (m, 10H; H-Ar, H-6),
6.79 (d, J=10.0 Hz, 4H; H-Ar), 6.29 (t, J=6.3 Hz, 1H; H-1’), 4.83 (t, J=
4.9 Hz, 1H; H-N4), 4.35–4.20 (m, 3H; H-5’, H-3’), 4.03–3.98 (m, 1H; H-
4’), 3.77 (s, 6H; CH3-O), 3.48 (q, J=5.9 Hz, 2H; CH2-NH), 3.01 (t, J=
6.5 Hz, 2H; CH2-ODMTr), 2.77 (t, J=6.3 Hz, 2H; CH2-Lev), 2.63–2.56
(m, 2H; CH2-Lev), 2.42 (ddd, J=5.0, 6.5, 11.3 Hz, 1H; H-2’), 2.18 (s, 3H;
CH3-CO), 2.12–2.02 (m, 1H; H-2’), 1.90 (s, 3H; CH3-5), 1.59–1.30 (m,
8H; CH2-N4-alkyl), 0.85 (s, 9H; (CH3)3C-Si), 0.04 (s, 3H; CH3-Si),
0.03 ppm (s, 3H, CH3-Si); 13C NMR (CDCl3, 150 MHz): d=209.1, 174.1,
164.7, 159.9, 158.5, 146.9, 137.8, 137.7, 131.1, 129.3, 128.6, 127.6, 113.9,
113.4, 105.2, 87.2, 87.0, 86.3, 73.6, 64.7, 64.3, 55.7, 42.0, 38.6, 31.0, 30.1,
29.6, 28.8, 27.8, 27.3, 26.2, 18.8, 13.4, À4.6, À4.8 ppm; ESIMS: m/z: 856.1
[M]+, 878.4 [M+Na]+; elemental analysis calcd (%) for C48H65N3O9Si: C
67.34, H 7.65, N 4.91; found: C 67.69, H 7.76, N 4.78.
5’-O-Levulinyl-3’-O-tert-butyldimethylsilylthymidine (4): A solution of 3’-
O-(tert-butyldimethylsilyl)thymidine (3) (5.53 g, 15.5 mmol, 1.0 equiv) in
dioxane (100 mL) was added to a suspension of 2-chloro-1-methylpyridi-
nium iodide (7.9 g, 31 mmol, 2.0 equiv) in CH3CN (100 mL). Subsequent-
ly, a solution of levulinic acid (7.2 g, 62 mmol, 4.0 equiv) and DABCO
(8.7 g, 77 mmol, 5.0 equiv) in dioxane (100 mL) was added dropwise to
the reaction mixture over a period of 1 h at RT. Stirring was continued
until the starting material had disappeared (7 h), as determined by TLC,
before the solvent was evaporated under reduced pressure. EtOAc was
added to the resulting residue, and the solution was washed with aqueous
NaHCO3 (80%) and with brine. The organic layer was dried over anhy-
drous magnesium sulfate and concentrated under reduced pressure. The
crude compound was purified by means of flash column chromatography
on silica gel (6% acetone in CH2Cl2) to give compound
4 (6.5 g,
13.9 mmol, 90%). Rf =0.25 (6% acetone in CH2Cl2); 1H NMR (CDCl3,
250 MHz): d=9.35 (s, 1H; H-N), 7.27 (s, 1H; H-6), 6.21 (t, J=6.5 Hz,
1H; H-1’), 4.33–4.12 (m, 3H; H-3’, H-5’), 3.97 (q, J=3.8 Hz, 1H; H-4’),
2.23 (m, 2H; CH2-Lev), 2.55–2.50 (m, 2H; CH2-Lev), 2.23 (ddd, J=3.8,
6.3, 10.3 Hz, 1H; H-2’), 2.12 (s, 3H; CH3-CO), 2.07–1.95 (m, 1H; H-2’),
1.86 (s, 3H; CH3-5), 0.8 (s, 9H; (CH3)3C-Si), 0.003 (s, 3H; CH3-Si),
À0.003 ppm (s, 3H; CH3-Si); 13C NMR (CDCl3, 62.5 MHz): d=206.2,
172.3, 163.8, 150.3, 135.2, 111.0, 84.9, 84.6, 71.6, 66.9, 63.3, 40.7, 37.7, 29.6,
27.7, 25.6, 17.8, 12.5, À4.8, À5.03 ppm; ESIMS: m/z: 477.2 [M+Na]+.
Synthesis of 4-(1,2,4-triazol-1-yl)-5’-O-levulinyl-3’-O-tert-butyldimethylsil-
yl-2’-deoxythymidine (5): POCl3 (4.12 g, 27 mmol, 3.5 equiv) was added
dropwise at 08C with vigorous stirring to a suspension of 1,2,4-triazole
(8.03 g, 116 mmol, 15.0 equiv) in CH3CN (135 mL). NEt3 (18 mL,
140 mmol, 18.0 equiv) was then added dropwise over a period of 15 min
and was stirred for an additional 30 min at 08C. Compound 4 (3.51 g,
7.7 mmol, 1.0 equiv) in CH3CN (35 mL) was added dropwise over a
period of 30 min to the resulting slurry, which was then stirred for 1 h at
Synthesis of 5’-O-levulinyl-N4-[O-(4,4’-dimethoxytrityl-6-oxy)hexyl]-5-
methyl-2’-deoxycytidine (8): Acetic acid (0.26 mL, 4.5 mmol) was added
to a solution of compound 7 (1.95 g, 2.3 mmol) in dry THF (30 mL)
before TBAF (1m in THF, 4.6 mL, 4.5 mmol) was added dropwise with
3562
www.chemeurj.org
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2007, 13, 3558 – 3564

Branched DNA
FULL PAPER
constant stirring at RT. The reaction mixture was stirred for 7 h, and di-
luted with EtOAc (100 mL). The organic phase was washed with aqueous
NaHCO3 solution (80%) and with brine. It was then dried over anhy-
drous magnesium sulfate and the solvent was evaporated under reduced
pressure. The crude compound was purified by means of flash column
chromatography on silica gel (4–5% methanol in CH2Cl2, 1% NEt3) to
yield compound 8 (1.67 g, 2.2 mmol, 98%). Rf =0.4 (5% methanol in
CH2Cl2); m.p. 64–668C; 1H NMR (CDCl3, 250 MHz): d=7.43–7.17 (m,
10H; H-Ar, 6-H), 6.78 (d, J=9.0 Hz, 4H; H-Ar), 6.35 (t, J=6.4 Hz, 1H;
H-1’), 4.83 (t, J=6.4 Hz, 1H; H-N4), 4.40–4.24 (m, 3H; H-5’, H-3’), 4.14
(q, J=5.0 Hz, 1H; H-4’), 3.76 (s, 6H; CH3-O), 3.47 (q, J=5.0 Hz, 2H;
CH2-NH), 3.00 (t, J=7.5 Hz, 2H; CH2-ODMTr), 2.77 (t, J=6.0 Hz, 2H;
CH2-Lev), 2.61–2.52 (m, 3H; CH2-Lev, H-2’), 2.17 (s, 3H; CH3-CO),
2.07–1.96 (m, 1H; H-2’), 1.90 (s, 3H; CH3-5), 1.59–1.32 ppm (m, 8H;
CH2-N4-alkyl); 13C NMR (CDCl3, 62.5 MHz): d=206.6, 172.6, 163.0,
158.2, 156.2, 145.3, 136.6, 129.9, 128.1, 127.6, 126.5, 112.9, 101.8, 85.9,
85.6, 83.8, 71.3, 64.2, 63.2, 55.1, 41.1, 37.8, 29.9, 29.8, 29.2, 27.8, 26.8, 26.1,
13.1 ppm; ESIMS: m/z: 764.4 [M+Na]+; elemental analysis calcd (%) for
C42H51N3O9: C 68.00, H 6.93, N 5.66; found: C 67.6, H 6.92, N 5.50.
Synthesis of N4-(O-dimethoxytrityl-6-oxyhexyl)-5’-O-levulinyl-5-methyl-
2’-deoxycytidine-3’-O-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite
(1): DIPEA (0.57 mL, 2.5 mmol) was added dropwise with constant stir-
ring to a solution of 8 (0. 31 g, 0.42 mmol) in dry THF (6 mL) at 08C. At
the same temperature, O-(2-cyanoethyl)-N,N’-diisopropylchlorophorami-
dite (0.2 mL, 0.84 mmol) was added dropwise with vigorous stirring. Stir-
ring was continued for 3 h at 08C. The reaction was quenched with dry
methanol (0.33 mL, 8.2 mmol) and the reaction mixture was diluted with
CH2Cl2 (25 mL). The organic layer was washed with cold water and with
brine. It was then dried over anhydrous magnesium sulfate and the sol-
vent was evaporated under reduced pressure. The crude compound was
purified by means of flash column chromatography on silica gel (85%
EtOAc in petroleum ether, 2% NEt3) to yield phosphoramidite 1 as a
mixture of diastereomers (0.38 g, 0.4 mmol, 97%). 1H NMR (CDCl3,
250 MHz): d=7.40–7.16 (m, 10H; H-Ar, 6-H), 6.75 (d, J=7.5 Hz, 4H;
H-Ar), 6.29–6.23 (m, 1H; H-1’), 4.53–4.45 (m, 1H; H-4’), 4.28–4.02 (m,
4H; H-5’, CH2O-CN), 3.68 (s, 6H; CH3-O), 3.61–3.34 (m, 3H; H-3’, CH-
iPrN), 2.97 (t, J=6.1 Hz, 2H; CH2-ODMTr), 2.82–2.62 (m, 6H; CH2-Lev,
CH2-NH, CH2-CN), 2.53–2.48 (m, 3H; CH2-Lev, H-2’), 2.20–2.14 (m, 1H;
H-2’), 2.08 (s, 3H; CH3-CO), 1.87 (s, 3H; CH3-5), 1.56–1.51 (m, 4H;
CH2-N4-alkyl), 1.25–1.14 ppm (m, 16H; (CH3)2CH-N, CH2-N4-alkyl);
13C NMR (CD3OD, 62.5 MHz): d=209.1, 174.0, 164.8, 159.9, 158.5, 146.9,
137.8, 131.2, 129.3, 128.7, 119.6, 114.0, 105.3, 87.0, 64.4, 55.8, 46.7, 44.6,
44.4, 42.1, 40.8, 38.6, 31.1, 30.1, 29.7, 28.9, 27.9, 27.3, 25.0, 24.9, 23.2, 21.0,
20.9, 20.4, 13.4 ppm; 31P NMR (CD3OD, 160 MHz): d=149.79,
149.57 ppm; ESIMS: m/z: 941.5 [M+Na]+; elemental analysis calcd (%)
for C15H68N5O10P: C 65.02, H 7.28, N 7.43; found: C 65.3, H 7.32, N 7.50.
gel, and characterized by using ESIMS. The sequences of the splints are
as follows: ab=5’-d(ACTGCTACGAATTCGTCAGC), cd=5’-d(CGA
GTATAGCAGCGAGCCAA)-3’, 3’–3’=3’-d(CGCGGCGGCA)-5’-5’-
(ATCCTCCTTC)-3’,
CTGCG)-3’.
and
AG =5’-d(CGGCTCAGCTTCGAA
ESI measurements: The purified bDNA molecules and oligonucleotide
templates (50–100 pmol) were dissolved in a solution of 2-propanol
(20%) containing NEt3 (1%).[33] The mass measurements were carried
out by using an Esquire 3000+ (Bruker) instrument and nitrogen was
used as the nebulizing gas (12 psi) at 3008C. The samples were injected
into the system with the aid of a syringe pump (180 mLhÀ1).
Radioactive phosphorylation of bDNAs: bDNA (10 pmol) was dissolved
in a solution (46 mL, pH 7.6, 258C) containing Tris-HCl (79.5 mm), mag-
nesium chloride (11.4 mm), dithiothreitol (5.7 mm), and g-32P-ATP (4 mL,
2.0 mM). Polynucleotide kinase (2 mL, 10 UmLÀ1) was added to this solu-
tion and it was incubated at 378C for 1 h. The reaction was stopped by
heating the solution to 958C for 5 min, followed by purification by using
a G-25 column.
Ligation: Radioactively phosphorylated and nonradioactively phosphory-
lated bDNA strands (5 pmol) were combined with oligonucleotide tem-
plates (10–15 pmol) in ligation buffer (50 mL contains the following final
concentrations: Tris-HCl (50 mm), MgCl2 (10 mm), ATP (1 mm), dithio-
threitol (10 mm), and BSA (1.25 mg)) and heated up to 958C for 3 min
and cooled to 48C (0.18C per 3 s) in a thermocycler. T4 DNA ligase
(1 mL, 1 UmLÀ1) was added to the solution and incubated for 378C for
8 h. The reaction was stopped by heating the solution at 658C for 25 min.
Denaturing polyacrylamide gel electrophoresis: Samples were loaded
onto 8% acrylamide gel (bisacrylamide/acrylamide 29:1) prepared in 1X
TBE buffer (Tris-HCl (89 mm), pH 8, boric acid (89 mm), EDTA (2 mm),
and urea (8.3m)). Electrophoresis was carried out at constant 110 W and
approximately 2000 V, at constant temperature (458C), and by using 1X
TBE without urea as the running buffer.
Native polyacrylamide gel electrophoresis: Equimolar amounts of bDNA
(radioactively phosphorylated and nonradioactively phosphorylated) and
templated oligonucleotides were mixed in ligation buffer and annealed as
mentioned in the ligation experiment. The gel was prepared with 8% ac-
rylamide (acrylamide/bisacrylamide 29:1) in a buffer containing Tris-HCl
(70 mm, pH 8), boric acid (70 mm), EDTA (1.5 mm), and magnesium ace-
tate (12.5 mm). The samples were loaded onto the gel with an agarose
loading buffer (glycerol (50%) with xylene cyanol (0.3%) and bromo-
phenol blue (0.3%) as tracking dyes).
EcoRI digestion of ligated bDNA: EcoR1 buffer (1 mL; Tris-HCl
(100 mm), NaCl (50 mm), and MgCl2 (10 mm)) was added to the ligated
bDNA (10 mL of 0.125 mM) and the solution was heated to 948C then
cooled to 48C (0.18C per 3 s). EcoRI (1 mL, NEB, 1 UmLÀ1) was then
added and incubated at 378C for 1 h. The reaction was stopped by heat-
ing the solution to 658C for 25 min and was analyzed by denaturing
PAGE.
General procedure for the synthesis of bDNA: The synthesis of bDNA
oligonucleotides was performed by using an Applied Biosystems 392
DNA synthesizer with a 3’-CPG support (1000 Š) and commercially
available 3’-O-2-CE phosphoramidites on either a 0.2 or 1.0 mmol scale.
After insertion of branch point 1, DNA synthesis was continued and
standard coupling conditions were utilized in the case of the 3’- and 5’-
CE phosphoramidites, whereas for the insertion of branch point 1, the
coupling times were extended to 10 min by using 1 (0.12m) in CH3CN.
The extension of each branch was terminated by first cleaving the respec-
tive DMTr group and subsequently passing capping mixtures A (acetic
Acknowledgements
M.C. wishes to thank the Alexander von Humboldt Foundation for a
postdoctoral fellowship. We thank Dr. K.-H. Jung for his assistance in the
preparation of the manuscript.
anhydride/pyridine/THF) and
B (N-methylimdidazole/pyridine/THF)
over the solid support for 3”15 s. The automated synthesis was then tem-
porarily interrupted and the column was detached from the synthesizer.
The levulinyl group was deprotected manually by using the deprotection
solution (hydrazine (0.5m) in pyridine/acetic acid=1:1) with the aid of
syringes for 55 min. Afterwards the column was thoroughly washed with
CH3CN (30 mL) and with CH2Cl2 (30 mL). The column was then reinstal-
led and the synthesis was continued from the branch point. At the end of
the synthesis the DMTr group was retained (“trityl ON”), which allowed
failed sequences to be removed by means of reverse-phase HPLC with a
binary gradient of CH3CN in triethylammonium acetate buffer (pH 7.0).
The desired bDNA containing the DMTr group was collected, deprotect-
ed by using 80% AcOH, purified by using a preparative polyacrylamide
[1] U. Feldkamp, C. M. Niemeyer, Angew. Chem. 2006, 118, 1888;
Angew. Chem. Int. Ed. 2006, 45, 1856.
[2] K. V. Gothelf, T. H. LaBean, Org. Biomol. Chem. 2005, 3, 4023.
[3] G. von Kiedrowski, L.-H. Eckardt, K. Naumann, W. M. Pankau, M.
Reimold, M. Rein, Pure Appl. Chem. 2003, 75, 609.
[4] J. Sharma, R. Chhabra, Y. Liu, Y. Ke, H. Yan, Angew. Chem. 2006,
118, 744; Angew. Chem. Int. Ed. 2006, 45, 730.
[5] F. A. Aldaye, H. F. Sleiman, Angew. Chem. 2006, 118, 2262; Angew.
Chem. Int. Ed. 2006, 45, 2204.
Chem. Eur. J. 2007, 13, 3558 – 3564
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
3563

A. Marx et al.
[6] B. Zou, B. Ceyhan, U. Simon, M. Niemeyer, Adv. Mater. 2005, 17,
1643.
[7] J. D. Le, Y. Pinto, N. C. Seeman, K. Musier-Forsyth, T. A. Taton,
R. A. Kiehl, Nano Lett. 2004, 4, 2343.
[8] H. Yan, S. H. Park, G. Finkelstein, J. H. Reif, T. H. LaBean, Science
2003, 301, 1882.
[9] M. G. Warner, J. E. Hutchison, Nat. Mater. 2003, 2, 272.
[10] C. A. Mirkin, R. L. Letsinger, R. C. Mucic, J. J. Storhoff, Nature
1996, 382, 607.
[21] L. H. Eckardt, K. Naumann, W. M. Pankau, M. Rein, M. Schweitzer,
N. Windhab, G. von Kiedrowski, Nature 2002, 420, 286.
[22] M. Scheffler, A. Dorenbeck, S. Jordan, M. Wꢂstefeld, G. von Kie-
drowski, Angew. Chem. 1999, 111, 3513; Angew. Chem. Int. Ed.
1999, 38, 3311.
[23] T. Horn, C.-A. Chang, M. S. Uredea, Nucleic Acids Res. 1997, 25,
4842.
[24] M. S. Shchepinov, I. A. Udalova, A. J. Bridgman, E. M. Southern,
Nucleic Acids Res. 1997, 25, 4447.
[11] N. C. Seeman, J. Theor. Biol. 1982, 99, 237.
[12] N. C. Seeman, Angew. Chem. 1998, 110, 3408; Angew. Chem. Int.
Ed. 1998, 37, 3220.
[25] R. S. Braich, M. J. Damha, Bioconjugate Chem. 1997, 8, 370.
[26] H. Thrane, J. Fensholdt, M. Regner, J. Wengel, Tetrahedron 1995,
37, 10389.
[13] D. Liu, S. H. Park, J. H. Reif, T. H. LaBean, Proc. Natl. Acad. Sci.
USA 2004, 101, 717.
[14] N. C. Seeman, Nature 2003, 421, 427.
[15] N. C. Seeman, Nano Lett. 2001, 1, 22.
[16] E. Winfree, F. Liu, L. A. Wenzler, N. C. Seeman, Nature 1998, 394,
539.
[27] M. Endo, T. Majima, Chem. Commun. 2006, 2329.
[28] M. Endo, T. Majima, J. Am. Chem. Soc. 2003, 125, 133654.
[29] J. S. Hartig, E. T. Kool, Nucleic Acids Res. 2004, 32, e152.
[30] J. Selvasekaran, K. D. Turnbull, Nucleic Acids Res. 1999, 27, 624.
[31] K. D. James, A. R. Boles, D. Henckel, A. D. Ellington, Nucleic Acids
Res. 1998, 26, 5203.
[17] M. Endo, N. C. Seeman, T. Majima, Angew. Chem. 2005, 117, 6228;
Angew. Chem. Int. Ed. 2005, 44, 6074.
[18] K. M. Stewart, L. W. Mclaughlin, J. Am. Chem. Soc. 2004, 126, 2050.
[19] K. V. Gothelf, A. Thomsen, M. Nielsen, E. Clꢁ, R. S. Brown, J. Am.
Chem. Soc. 2004, 126, 1044.
[32] G. Prakash, E. T. Kool, J . Chem. Soc., Chem. Commun. 1993, 215.
[33] G. Bellis, G. Salani, G. Battaglia, P. Pietta, E. Rosti, P. Mauril, Rapid
Commun. Mass Spectrom. 2000, 14, 243.
[20] S. A. Ivanov, Eugene, M. Volkov, T. S. Oretskaya, S. Mꢂller, Tetra-
hedron 2004, 60, 9273.
Received: October 17, 2006
Published online: January 12, 2007
3564
www.chemeurj.org
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2007, 13, 3558 – 3564