Express sequence tag analysis - Identification of anseriformes trypsin genes from full-length cDNA library of the duck (Anas platyrhynchos) and characterization of their structure and function

Article abstract of DOI:10.1134/S0006297916020097

Trypsins are key proteins important in animal protein digestion by breaking down the peptide bonds on the carboxyl side of lysine and arginine residues, hence it has been used widely in various biotechnological processes. In the current study, a full-leng

Full text of DOI:10.1134/S0006297916020097

ISSN 0006ꢀ2979, Biochemistry (Moscow), 2016, Vol. 81, No. 2, pp. 152ꢀ162. © Pleiades Publishing, Ltd., 2016.
Published in Russian in Biokhimiya, 2016, Vol. 81, No. 2, pp. 251ꢀ264.
Express Sequence Tag Analysis – Identification of Anseriformes
Trypsin Genes from FullꢀLength cDNA Library of the Duck
(
Anas platyrhynchos) and Characterization
of Their Structure and Function
1
1#
1#
1
1
Haining Yu *, Shasha Cai , Jiuxiang Gao , Chen Wang , Xue Qiao ,
1
1
2
Hui Wang , Lan Feng , and Yipeng Wang *
1
Dalian University of Technology, Institute of Marine Biological Technology, School of Life Science and Biotechnology,
1
16024 Dalian, Liaoning, China; Eꢀmail: joannyu@live.cn
2
Soochow University, College of Pharmaceutical Sciences, 215123 Suzhou, Jiangsu, China;
fax: + 86 (411) 847ꢀ08850; Eꢀmail: yipengwang@suda.edu.cn
Received March 4, 2015
Revision received May 25, 2015
Abstract—Trypsins are key proteins important in animal protein digestion by breaking down the peptide bonds on the carꢀ
boxyl side of lysine and arginine residues, hence it has been used widely in various biotechnological processes. In the curꢀ
5
rent study, a fullꢀlength cDNA library with capacity of 5·10 CFU/ml from the duck (Anas platyrhynchos) was constructed.
Using express sequence tag (EST) sequencing, genes coding two trypsins were identified and two fullꢀlength trypsin cDNAs
were then obtained by rapidꢀamplification of cDNA end (RACE)ꢀPCR. Using Blast, they were classified into the trypsin I
and II subfamilies, but both encoded a signal peptide, an activation peptide, and a 223ꢀa.a. mature protein located in the
Cꢀterminus. The two deduced mature proteins were designated as trypsinꢀIAP and trypsinꢀIIAP, and their theoretical isoꢀ
electric points (pI) and molecular weights (MW) were 7.99/23466.4 Da and 4.65/24066.0 Da, respectively. Molecular charꢀ
acterizations of genes were further performed by detailed bioinformatics analysis. Phylogenetic analysis revealed that
trypsinꢀIIAP has an evolution pattern distinct from trypsinꢀIAP, suggesting its evolutionary advantage. Then the duck
trypsinꢀIIAP was expressed in an Escherichia coli system, and its kinetic parameters were measured. The three dimensional
structures of trypsinꢀIAP and trypsinꢀIIAP were predicted by homology modeling, and the conserved residues required for
functionality were identified. Two loops controlling the specificity of the trypsin and the substrateꢀbinding pocket repreꢀ
sented in the model are almost identical in primary sequences and backbone tertiary structures of the trypsin families.
DOI: 10.1134/S0006297916020097
Key words: Anseriformes, Anas platyrhynchos, trypsin, molecular cloning, expression, structure and function
Trypsin is a serine protease found in the digestive sysꢀ and characterized, including those of chicken [3], bovine
tem of many vertebrates, where it hydrolyzes proteins [1]. [4], pig [5], ostrich [2], human [6ꢀ8], dogfish [9], mouse
It is produced by pancreatic acinar cells as a trypsinogen, [10], rat [11ꢀ14], etc. Belonging to the large serine proꢀ
released into the intestine, and converted into active tease family, trypsin is used for numerous biotechnologiꢀ
trypsin through the action of enterokinase or by autoactiꢀ cal processes, and the prototypes for investigating many
vation [2]. Trypsin is widely distributed in vertebrates, and aspects of enzyme action [3, 15]. It is a digestive enzyme
many trypsinogen genes and proteins have been isolated having strong specificity, selectively catalyzing the
hydrolysis of peptide bonds on the carboxyl side of lysine
and arginine residues of proteins in the intestinal lumen,
except when either is followed by proline. This specificity
comes from the matching of the negative charge of an Asp
residue in the primary substrateꢀbinding pocket S1 of
trypsin and the negative charge of the P1 side in the subꢀ
strate peptide chain [16].
Abbreviations: cDNA, complementary DNA; EST, express
sequence tags; FPLC, fast protein liquid chromatography;
ORF, open reading frame; PCR, polymerase chain reaction;
RACE, rapidꢀamplification of cDNA ends; 5′ꢀUTR, 5′ꢀ
untranslated region.
#
These authors contributed equally to this work.
*
To whom correspondence should be addressed.
152

FUNCTIONAL CHARACTERIZATION OF ANSERIFORMES TRYPSIN GENES
153
Trypsins can be divided into two major subfamilies: GAGACACCATTTTTTTTTTTTTTTTTTTTVNꢀ3′(N =
the cationic trypsin I subfamily and the anionic trypsin II A, C, G, or T; V = A, G, or C). The second strand was
subfamily [3]. Recently, another type of trypsin, named amplified using Advantage DNA polymerase (Clontech)
mesotrypsin, was found from the human pancreas. It is with the 5′ PCR primer: 5′ꢀAAGCAGTGGTATꢀ
described as a minor trypsin isoform with the remarkable CAACGCAGAGTꢀ3′ and the InꢀFusion SMARTer
property of near total resistance to biological trypsin CDS/3′ PCR primer. The doubleꢀstrand cDNAs (dsꢀ
inhibitors [17]. Previous studies have shown that these cDNAs) were digested with Sfi I restriction enzyme and
trypsin isoenzymes are encoded by different genes in the recovered for longer than 600 bp. The cDNA fragments
genome and have different tissue expression patterns, were ligated into pDNRꢀLIB vector digested by Sfi I, and
indicating their functional differences [3, 18ꢀ21]. Thus, it ultimately transferred into the competent cells of E. coli
is interesting to explore structure–activity relationships in DH10B. The cDNA library was calculated of clone numꢀ
trypsins from new species of evolutionary significance bers on plates by titration.
[
22]. Although trypsins have been studied in many animal
Identification of expressed sequence tag (EST)
species, there are no reports concerning those from the encoding trypsins. Individual cDNA clones were selected
Anatidae avian family. In the present study, we identified randomly from the A. platyrhynchos cDNA library and
two fullꢀlength trypsin cDNA sequences from the conꢀ sequenced. Raw sequences were first trimmed to remove
structed cDNA library of Anas platyrhynchos based on vector sequence and lowꢀquality sequences using the
EST analysis. The deduced amino acid sequences of the Crossmatch program. ESTs with length less than 100 bp
complete Anatidae trypsin precursors were aligned with were discarded. The sequences of cDNA clones were
other representative vertebrate trypsins, and the mature compared with sequences in the GenBank database
proteins were named trypsinꢀIAP and trypsinꢀIIAP, (http://www.ncbi.nlm.nih.gov/blast).
respectively. TrypsinꢀIIAP was expressed in E. coli to
Isolation of fullꢀlength cDNAs encoding novel
study its biochemical properties. Furthermore, the three trypsins. The synthesized cDNA library was used as a
dimensional structure of trypsinꢀIAP and trypsinꢀIIAP template to screen the cDNAs encoding trypsin
were predicted by homology modeling to elucidate the homologs of A. platyrhynchos. The obtained EST
possible functional mechanisms.
sequence coupled with the conserved domain from multiꢀ
ple alignments of trypsins was exploited to design the speꢀ
cific primers for cloning the Nꢀterminal part of fullꢀ
length duck trypsin precursor. Thus, the antiꢀsense
primer (5′ꢀAACCTCCACAGAAGTGATACCCꢀ3′) and
MATERIALS AND METHODS
Collection of tissues. One adult female A. platyrhynꢀ the 5′ꢀprimer supplied by the kit (5′ꢀAAGCAGTGꢀ
chos (weight 1.5 kg) was collected from local market of GTATCAACGCAGAGTꢀ3′) were used to amplify the
Dalian. It was sacrificed and tissues were rapidly dissectꢀ target sequence. The DNA polymerase used was univerꢀ
ed, frozen in liquid nitrogen, and stored at –80°C until sal rTaq polymerase (Takara, Japan). The reaction conꢀ
use. The collection procedure was approved by a recogꢀ ditions were: initial denaturation for 5 min at 94°C, folꢀ
nized Animal Ethics Committee of Dalian University of lowed by 30 cycles of denaturation at 94°C for 30 s,
Technology.
annealing at 53.9°C for 30 s, extension at 72°C for 30 s,
Total RNA extraction and purification. The Anas and a final extension at 72°C for 10 min. Finally, the
platyrhynchos pancreas (0.1 g) was cut into pieces with a PCR products were verified by 1% agarose gel elecꢀ
small sterile scissor, frozen immediately in liquid nitroꢀ trophoresis, purified using Agarose Gel DNA Puriꢀ
gen, and then ground into powder. Total RNA was fication Kit (TIANGEN, China), and cloned into
TM
TM
extracted using the RNeasy AxyPrep Multisource Total pMD 19ꢀT vector (Takara). DNA sequencing was perꢀ
RNA Miniprep Kit (Qiagen, USA). All RNA isolation formed using an ABI PRISM 377 instrument (Applied
procedures were carried out based on the manufacturer’s Biosystems, USA).
instructions. The total RNA was purified using
PolyATtract® mRNA Isolation Systems (Promega, USA) above, one sense primer trypsinꢀP2 (5′ꢀCCATGꢀ
in accordance with the user’s manual. CATTCTCTCTTCCTCCTꢀ3′) was designed and used to
Then, according to the signal domain characterized
Fullꢀlength cDNA library construction. The fullꢀ amplify the fullꢀlength duck trypsin cDNAs, coupled
length cDNA sequence was synthesized using an Inꢀ with InꢀFusion SMARTer CDS III/3′ PCR primer as
Fusion® SMARTer™ Directional cDNA Library described above. The PCR conditions were: 94°C for
Construction Kit (Clontech, USA) following the manuꢀ 4 min, 28 cycles of 94°C for 30 s, 55.9°C for 30 s, 72°C for
facturer’s protocol. In brief, the firstꢀstrand cDNA was 1 min, and again followed by a final extension at 72°C for
synthesized using PowerScript reverse transcriptase with 10 min. The purification of PCR product and the DNA
the SMARTer V oligonucleotide primer 5′ꢀAAGCAꢀ sequencing was performed as described above.
GTGGTATCAACGCAGAGTACXXXXXꢀ3′ and 3′ Inꢀ
Multiple sequence alignment and phylogenetic analysis.
Fusion SMARTer CDS Primer 5′ꢀCGGGGTACGATꢀ Multiple sequence alignments were performed using the
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

154
HAINING YU et al.
a
Fig. 1. cDNA sequences encoding duck (A. platyrhynchos) trypsinꢀIAP (a) and trypsinꢀIIAP (b) and the deduced precursor sequences. The
putative signal peptides are in bold and italic. The amino acid sequences of predicted activation peptides are in underlined. The stop codon is
indicated by an asterisk (*); the 3′ꢀuntranslated region is in lowercase letters.
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

FUNCTIONAL CHARACTERIZATION OF ANSERIFORMES TRYPSIN GENES
155
b
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

156
HAINING YU et al.
Fig. 2. Alignment of precursor sequences of trypsinꢀIAP and trypsinꢀIIAP. Dashes represent similar sequences. Gaps are inserted to maximize
the similarity. The lowercases indicate the online predicted secondary structures of trypsinꢀIAP and trypsinꢀIIAP (http://bioinf.cs.ucl.ac.uk/
psipred/), and the letters “h”, “e”, and “c” represent helix, strand, and coil structure, respectively.
ClustalW program (version 1.8) on basis of tens of known (IPTG) to final concentration 1 mM. After an additional
trypsin precursors including the currently deduced A. 4 h cultivation, the cells were harvested by centrifuging at
platyrhynchos trypsins (trypsinꢀIAP and trypsinꢀIIAP). 5000 rpm for 15 min at 4°C. The bacterial pellet was
Multiꢀsequences were obtained from the database at resuspended by adding 50 ml of buffer A (20 mM
NCBI. The phylogenetic trees were constructed using the NaH PO /0.5 M NaCl, pH 7.4) and then lysed by soniꢀ
2
4
neighborꢀjoining method (Mega, version 4.0; www.megaꢀ cation (5 s, 5 s, 30 min). The whole cell lysate was cenꢀ
software.net) by calculating the proportion of amino acid trifuged, and the supernatant and bacterial pellet were
differences (pꢀdistance) among all sequences, with collected. The collected supernatant and precipitate were
sequence from a fan shell used as the outgroup. A total of then identified by 15% SDSꢀPAGE. Finally, the precipiꢀ
1
000 bootstrap replicates were used to test the reliability of tation containing the inclusion bodyꢀexpressed protein
each branch. The numbers on branches indicate the perꢀ was collected, washed, and redissolved in binding buffer
centage of 1000 bootstrap samples supporting the branch. (20 mM NaH PO , 20 mM imidazole, 500 mM NaCl,
2
4
Expression vector construction and trypsinꢀIIAP 6 M urea, pH 7.4). The supernatant of the lysate was colꢀ
expression and purification. Host strain E. coli BL21 and lected by centrifuging at 12,000 rpm for 30 min at 4°C and
pETꢀ32a(+) plasmid (Novagen, Germany) was utilized purified with a Hisꢀtag affinity column (HisTrap FF,
for trypsinꢀIIAP expression. The two restriction sites for 1 ml), equilibrated with buffer B (6 M urea, 25 mM
Kpn I (GGTACC) upstream and Hind III (AAGCTT) Na HPO , 300 mM NaCl, pH 8.0) on an AKTA FPLC
2
4
downstream of the deduced mature trypsinꢀIIAP coding system (Amersham Biosciences, USA). Unwanted proꢀ
sequence were added by PCR. The forward primer was 5′ꢀ tein was eluted with buffer B containing 60 mM imidaꢀ
CGGGGTACCGACCCGGACCCGATTGTꢀ3′ and the zole, pH 8.0, and the target protein was eluted with buffer
reverse primer was 5′ꢀCCCAAGCTTTCAGTAGGCTGꢀ B containing 300 mM imidazole, pH 8.0. The absorbance
CAAꢀ3′, each containing one site for Kpn I and Hind III of the eluate was monitored at 280 nm. Fractions correꢀ
to amplify target gene. PCR was performed by running 30 sponding to the recombinant Hisꢀtagged protein were
cycles with 94°C for 30 s, 55°C for 30 s, 72°C for 30 s, and pooled and identified by 15% SDSꢀPAGE.
a final extension 72°C for 10 min. The purified PCR
The collected trypsinꢀIIAPꢀcontaining eluate was
product was digested with Kpn I and Hind III, and then concentrated and diluted to 0.1 mg/ml. After denaturing
ligated into the pETꢀ32a(+) plasmid at the corresponding in urea, gradient dialysis (50 mM NaCl, 100 mM Trisꢀ
restriction sites. The resultant recombination vector was HCl/1 mM EDTA, 0.02 mM GSSG, 2 mM GSH, 1%
named trypsinꢀIIAP/pETꢀ32a(+).
(w/v) glycine, 10% (v/v) glycerin, and 6, 4, 2, 1 M urea
The trypsinꢀIIAP/pETꢀ32a(+) construct was transꢀ each 6 h, pH 8.0) was performed, and the fusion protein
formed into E. coli strain BL21 for protein expression and was cleaved in 50% (v/v) formic acid at 45°C for 48 h.
cultured to OD600 of 0.6 in LB broth media (0.1 mg/ml After removing formic acid by lyophilization, the trypsinꢀ
ampicillin) at 37°C. Then fusion protein expression was IIAP was further purified on a Hisꢀtag affinity column by
initiated by adding isopropyl βꢀDꢀthiogalactopyranoside reverseꢀphase HPLC (Hypersil BDS C18, 30 × 0.46 cm;
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

FUNCTIONAL CHARACTERIZATION OF ANSERIFORMES TRYPSIN GENES
157
Elite, China) equilibrated with 5% acetonitrile and 0.1% sequencing. After removal of the vector sequences and
trifluoroacetic acid. blast with NCBI database, we identified an EST sequence
Kinetic measurements. Serine protease activity of the with the length of 665 bp, containing part of an open
expressed trypsinꢀIIAP was assayed based on the method reading frame (ORF) and a polyA tail, whereas missing
by Xu et al. [23, 24]. The substrates are T6140 (Nꢀ(pꢀ the 5′ꢀUTR and adjacent part of the ORF. The blast
tosyl)ꢀGlyꢀProꢀLys 4ꢀnitroanilide acetate salt; Sigma, search of this EST indicated that it showed significant
USA) and Bꢀ3133 (NꢀbenzoylꢀArgꢀ4ꢀnitroanilide hydroꢀ homology (87%) to the known Gallus gallus trypsin gene
choride, BzꢀLꢀArgꢀpNA; Sigma). The hydrolysis of synꢀ (GenBank Accession No. NM_205384) with function
thetic chromogenic substrates by trypsinꢀIIAP in 50 mM annotation. The trypsin gene has never been reported
TrisꢀHCl, pH 7.8, was tested at 37°C. The reaction was from the avian Anseriformes.
initiated by the addition of the substrate to final concenꢀ
tration 0.5 mM. The formation of pꢀnitroaniline was trypsin I and II. The EST clone of duck trypsin was used
monitored continuously at 405 nm for 5 min. to design the specific primers to clone the complete
Identification and characterization of Anseriformes
Threeꢀdimensional structure modeling. BLAST cDNA, and finally two fullꢀlength duck trypsin cDNAs
search for sequences of trypsinꢀIAP and trypsinꢀIIAP (GenBank accession Nos. KP876029 and KP876030)
were performed to obtain the most suitable templates. were obtained. Their ORFs were both 747 bp, encoding
Based on maximum similarity, the crystal structure of the deduced 248 a.a. precursor (Fig. 1). Sequence alignꢀ
3
MYW and 1CO7_E (PDB ID) deposited in the Protein ment showed that trypsinogenꢀII sequence shares 73%
Data Bank (PDB) were used as the templates for homolꢀ identity with that of trypsinogenꢀI. The two 223ꢀa.a.
ogy modeling of trypsinꢀIAP and trypsinꢀIIAP, respecꢀ mature peptides were predicted and designated as trypsinꢀ
tively. The comparative 3ꢀD structure model was generatꢀ IAP (trypsinꢀIIAP), with a 15 (16)ꢀa.a. signal peptide folꢀ
ed and optimized using the EasyModeller homology lowed by a 10 (9)ꢀa.a. activation peptide located at the Nꢀ
modeling program. The 3ꢀD structural model generated terminus of their propeptides, respectively (Fig. 2).
was visualized by PyMOL software (http://www. Analysis using the ProtParam tool (http://au.expasy.org/
pymol.org) without any other refinements.
tools/protparam.html) showed theoretical pI/MW for
trypsinꢀIAP and trypsinꢀIIAP are 7.99/23466.4 Da and
4
.65/24066.0 Da, respectively.
RESULTS
Multiple sequences alignment and phylogenetic analyꢀ
sis. Multiꢀsequence alignment was performed on the basis
Construction of a fullꢀlength cDNA library from A. of the full precursor sequences of trypsinꢀIAP and ꢀIIAP
platyrhynchos. Total RNA was extracted from the panꢀ with other typical trypsins from vertebrates, revealing the
creas of A. platyrhynchos (with concentration 0.23 μg/μl). presence of conservative structure characteristics of
The OD260/OD280 ratio was 1.88, indicating that the RNA trypsins, including 12 conserved cysteine residues, catꢀ
isolated was suitable for a cDNA library construction. A alytic residues His40, Asp84, and Ser177 corresponding
2
ꢀμg sample of total RNA was subjected to reverse tranꢀ to the mature peptide indicated by arrowheads, and key
scription for synthesis of the first and doubleꢀstrand residue Tyr151 that determines the substrate specificity
cDNAs, which was concentrated on the range of 100 to (Fig. 3). The amino acids essential for calcium binding,
4
000 bp, suggesting that doubleꢀstrand cDNAs were sucꢀ Glu77, Asn79, Val82, Glu84, and Glu87, are also conꢀ
cessfully synthesized. Ten clones were picked randomly to served in the short sequence (G76ꢀEYNIDVQEDSꢀE87)
carry out colony PCR for confirming the size of cDNA of duck (underlined in Fig. 3) [25]. In addition, the critiꢀ
fragments. The amplified cDNA fragments were deterꢀ cal residues involved in the maintenance of structure and
mined as ranging from 600 to 2500 bp, and 90% of the function of the serine protease family were also identified,
insertion fragments were more than 1 kb in size, suggestꢀ such as the short sequence of GlyꢀAspꢀSerꢀGlyꢀGlyꢀPro,
ing that the insertion fragments harbored most of the shown in frames (Fig. 3).
mRNAs and reached the requirement for further studies
Multiꢀsequence alignment involved representative
on gene structure and expression. The capacity of the vertebrate trypsin precursors, including human, mamꢀ
5
unamplified constructed cDNA library was 5·10 CFU/ mals, birds, reptiles, and amphibians, using fish as an outꢀ
ml after calculation of clone numbers, which should meet group. A condensed multiꢀfurcating tree was constructed
almost all requirements to find a cDNA derived from a emphasizing the reliable portion of pattern branches
lowꢀabundance mRNA. Thus, a highꢀquality fullꢀlength without considering the exact distance between each pepꢀ
pancreas cDNA library from A. platyrhynchos was sucꢀ tide (Fig. 4). Thus, the branch lengths of the condensed
cessfully constructed, thus providing a useful resource for tree are not proportional to the number of amino acid
functional genomic research.
mutations. Phylogenetic comparisons of vertebrate
Screening of the A. platyrhynchos cDNA library. Two trypsins showed that the nearest relative of duck trypsinꢀ
hundred individual cDNA clones were picked randomly IIAP is G. gallus trypsinꢀII. The Anseriformes avian
from the constructed A. platyrhynchos cDNA library for trypsinꢀI had a distinct evolution pattern from trypsinꢀII
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

158
HAINING YU et al.
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

FUNCTIONAL CHARACTERIZATION OF ANSERIFORMES TRYPSIN GENES
159
Fig. 4. Phylogenetic analysis of representative vertebrate trypsins. The phylogenetic dendrogram was constructed by the neighborꢀjoining
method based on the proportional difference of aligned amino acid sites of the full sequence of the prepropeptide. Anas platyrhynchos trypsins
I and II are marked with triangles.
for being juxtaposed with only turtle of reptile and sparꢀ
Expression of trypsinꢀIIAP. Escherichia coli strain
row of avian. Whilst based on trypsinꢀIIAP sequence in BL21 harboring the trypsinꢀIIAP/pETꢀ32a(+) vector was
the phylogenetic tree, the duck (representing avian utilized to express a Hisꢀtagged fusion protein containing
Anseriformes) is confirmed as a transitional taxon the deduced mature trypsinꢀIIAP. After induction with
between reptiles and mammals. The built phylogenetic 1 mM IPTG for 4 h, the fusion protein was overexpressed
tree reveals that vertebrate trypsins are split into five disꢀ (Fig. 5, lanes 3 and 4). The supernatant and precipitation
crete branches. Among the five branches, there are two were separated by centrifugation after ultrasonic treatꢀ
major clusters: one is represented by various mammalian ment and identified by 15% SDSꢀPAGE. The protein
trypsins, whilst the other clusters involving trypsins from electrophoresis figure shows the fusion protein primarily
the evolutionarily inferior animals. Anuran (Xenopus laeꢀ in the precipitation of whole cell lysate, indicating that
vis) trypsin, as a separate clade, is observed located the trypsinꢀIIAP is expressed as inclusion bodies. After
between fish and lizard of reptiles, which bridges the evoꢀ Hisꢀtag affinity chromatography, the protein fractions
lutionary land–water gap of trypsins (Fig. 4).
eluted by imidazole were detected at the expected molecꢀ
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

1
60
HAINING YU et al.
hydrolyze both, indicating that trypsinꢀIIAP functions
kDa
М
1
2
3
4
5
6
9
6
7.2
6.4
like other trypsinꢀlike serine proteases.
Analyses of advanced structures of trypsinꢀIAP and
trypsinꢀIIAP. Sequence alignment revealed that crystal
structures (PDB ID 3MYW and 1CO7) are the best availꢀ
able templates for homology modeling of trypsinꢀIAP and
trypsinꢀIIAP, respectively. The best models of trypsinꢀIAP
and trypsinꢀIIAP were then depicted using the PyMOL
Viewer as shown in Fig. 6. Homology modeled structures
of trypsinꢀIAP and trypsinꢀIIAP reveal some interesting
structural features: two barrelꢀlike structures made up of
two sets of antiparallel βꢀstrands, flanked by two αꢀhelices
on the upꢀside, and widespread coil construction. Both of
the Anseriformes trypsins have 12 cysteines, and they may
form six disulfide bonds naturally. His40, Asp84, and
Ser177 forming the catalytic triad are conserved as shown
in Fig. 6. Residues 171ꢀ177, 192ꢀ197, and 203ꢀ206 form
the primary substrateꢀbinding pocket called the S1 binding
pocket. Trypsin favors basic residues like lysine and argiꢀ
nine [26]. Residues 165ꢀ170 and 198ꢀ202 form two loops
near the S1 pocket, called Loop 1 and Loop 2, respectiveꢀ
4
4.3
29.0
2
0.1
4.3
1
Fig. 5. Expression and purification of trypsinꢀIIAP protein
indicted by an arrow) as followed by SDSꢀPAGE (15%).
(
Lanes: M, protein markers; 1) BL21(DE3); 2) whole cell lysate
without IPTG induction; 3, 4) whole cell lysate with 1 mM IPTG
induction; 5) fusion protein fractions after purification by
HisTrapTM FF affinity chromatography; 6) trypsinꢀIIAP protein
after renaturation and formic acid hydrolysis.
ular weights by 15% SDSꢀPAGE (Fig. 5, lane 5). After ly, which play key roles in enzyme specificity (Fig. 6). The
renaturation and hydrolysis by formic acid, the superꢀ S1 binding pocket in trypsin is almost identical in primary
natant was collected by centrifugation, and a 24ꢀkDa structures and backbone tertiary structures [22].
band was detected in SDSꢀPAGE (Fig. 5, lane 6).
Kinetic parameters determination. Kinetic parameꢀ
ters of recombinant trypsinꢀIIAP for different chroꢀ
mogenic substrates are listed in the table. T6140 is a speꢀ
cial substrate for plasmin, whilst B3133 is the substrate for
DISCUSSION
Trypsin plays a central role in pancreatic exocrine
trypsinꢀlike serine proteases. TrypsinꢀIIAP could physiology because it acts as the trigger enzyme for the
а
b
Fig. 6. Homology models of trypsinꢀIAP (a) and trypsinꢀIIAP (b). The model produced by the Mod6v2 version of MODELLER. The strucꢀ
ture was visualized by PyMOL and is represented in the form of a cartoon. The active site residues of His40, Asp84, and Ser177 are displayed
in stick structures. The substrateꢀbinding pocketꢀS1 and the two loops of trypsinꢀIAP and trypsinꢀIIAP are indicated by arrows.
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

FUNCTIONAL CHARACTERIZATION OF ANSERIFORMES TRYPSIN GENES
161
Kinetic parameters of trypsinꢀIIAP for different chroꢀ
mogenic substrates
As an ancient gene family, trypsin is widely distribꢀ
uted in organisms ranging from invertebrates to verteꢀ
brates. However, the evolutionary relation of these imporꢀ
tant functional molecules remains unresolved. Here, the
acquisition of an Anseriformes trypsin family fills gaps in
trypsin molecular evolution in phylogenetic analysis.
Despite the difference between sequences in the S1 pockꢀ
et of trypsinꢀIAP and trypsinꢀIIAP, commonalities of
precursor organization, some activity related sites, and
threeꢀdimensional structure suggests that they are evoluꢀ
tionarily related and likely originated from a common
ancestor by gene duplication.
Parameter
T6140
B3133
K (mM)
9.3
6.25
1.05
0.51
0.08
m
–
1
Vmax (mM⋅s )
0.87
0.93
0.10
5
–1
kcat (10 s )
5
–1 –1
k /K (10 mM ⋅s )
cat
m
It was reported that a residue within the activation
activation of all other pancreatic digestive zymogens, as peptide domain, especially Asp of the penultimate
well as its own trypsinogen. Regarding industrial and medꢀ residue, and the number of anionic residues, are closely
ical applications, trypsin is often used in proteomics, i.e. related to the rate of trypsinogen autoactivation [2, 30].
the study of proteins. As trypsin cuts proteins specifically Interestingly, unlike most other trypsinogens that usualꢀ
between at amino acids arginine and lysine, it is particularꢀ ly have four anionic residues in the activation domain,
ly useful in the analysis of amino acid sequences within trypsinꢀIAP has five Asp residues (Fig. 3), whilst trypsinꢀ
proteins. Trypsin dissociates individual cells from dissected IIAP only contains three Asps adjacent to two alanines,
tissue samples, allowing them to be studied more closely which results in relatively less negative charge of the
and/or preserved in cell cultures. More importantly, puriꢀ cleavage site and may accelerate the autoactivation
fied trypsin can be used pharmaceutically to help break process [2, 31]. The possible fast autoactivation properꢀ
down blood clots, which could result in serious complicaꢀ ty of trypsinꢀIIAP owing to its special AADDDK motif
tions such as strokes or emboli [27]. Trypsin is also useful in is very important for exerting enzymatic function. In
treating acute inflammation. Topical preparations of addition, the sequences of trypsinꢀIAP and trypsinꢀIIAP
trypsin are commercially available to promote wound healꢀ provide new templates for the study of activation effiꢀ
ing [28]. Also, trypsin is used in the treatment of pancreatꢀ ciency of trypsinogen and the development of trypsin
ic disease, and more recently it has been examined as a inhibitor.
potential therapy in the treatment of cancerous tumors
[
29]. The existence of various trypsin isozymes may explain
the multiple functions of trypsins and for the maintenance National Natural Science Foundation (41206153),
of multiple trypsinogen genes in genomes [22].
Growth Project for Liaoning Distinguished Young
This work was supported by grants from the Chinese
Trypsin is a structureꢀconservative serine protease, Scientists of Colleges and Universities (LJQ2013010),
especially in some activity related sites, like the conserved and Dalian Distinguished Young Scientists Funding
1
2 cysteine residues, the catalytic triplets (SerꢀHisꢀAsp), (2013J21DW013).
the residues for the charge relay system and the substrateꢀ
binding site residues, etc. (Fig. 3). Though a number of
trypsins or trypsinogens have been well studied in mamꢀ
mals like bovine [4], pig [5], and human [6ꢀ8], there are
few detailed reports about trypsins in avians, except one
about the chicken trypsinogen gene family without any
protein level findings [3], and one about ostrich (repreꢀ
senting the Ratite superorder) trypsinogen [2]. In the curꢀ
rent study, we successfully cloned two fullꢀlength cDNA
REFERENCES
1
.
.
Rawlings, N. D., and Barrett, A. J. (1994) Families of serꢀ
ine peptidases, Methods Enzymol., 244, 19ꢀ61.
Szenthe, B., Frost, C., Szilagyi, L., Patthy, A., Naude, R.,
and Graf, L. (2005) Cloning and expression of ostrich
trypsinogen: an avian trypsin with a highly sensitive autolyꢀ
sis site, Biochim. Biophys. Acta, 1748, 35ꢀ42.
2
sequences of the Anseriformes trypsinꢀIAP and trypsinꢀ 3. Wang, K., Gan, L., Lee, I., and Hood, L. (1995) Isolation
IIAP from a constructed cDNA library using the RACEꢀ
PCR method on basis of EST analysis. This is the first
report about characterization of Anseriformes trypsin
genes on the basis of EST analysis with denoted protein
structure and function. TrypsinogenꢀII shares 73% idenꢀ
tity with trypsinogenꢀI in amino acid sequence (Fig. 2).
Observed from the trypsin primary and tertiary structures
modeled by homology, those highly variable positions of
trypsinꢀIAP and trypsinꢀIIAP are mainly located on the
exterior of the molecule.
and characterization of the chicken trypsinogen gene famiꢀ
ly, Biochem. J., 307, 471ꢀ479.
4
.
Le Huerou, I., Wicker, C., Guilloteau, P., Toullec, R., and
Puigserver, A. (1990) Isolation and nucleotide sequence of
cDNA clone for bovine pancreatic anionic trypsinogen.
Structural identity within the trypsin family, Eur. J.
Biochem., 193, 767ꢀ773.
Hermodson, M. A., Ericsson, L. H., Neurath, H., and
Walsh, K. A. (1973) Determination of the amino acid
sequence of porcine trypsin by sequenator analysis,
Biochemistry, 12, 3146ꢀ3153.
5
.
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016

162
HAINING YU et al.
6
. Emi, M., Nakamura, Y., Ogawa, M., Yamamoto, T., Nishide,
ization and gene expression of six trypsinogens in the flatꢀ
fish Senegalese sole (Solea senegalensis Kaup) during larval
development and in tissues, Comp. Biochem. Physiol. B
Biochem. Mol. Biol., 149, 334ꢀ344.
T., Mori, T., and Matsubara, K. (1986) Cloning, characteriꢀ
zation and nucleotide sequences of two cDNAs encoding
human pancreatic trypsinogens, Gene, 41, 305ꢀ310.
7
8
. Tani, T., Kawashima, I., Mita, K., and Takiguchi, Y. (1990)
Nucleotide sequence of the human pancreatic trypsinogen
III cDNA, Nucleic Acids Res., 18, 1631.
. Wiegand, U., Corbach, S., Minn, A., Kang, J., and Mullerꢀ
Hill, B. (1993) Cloning of the cDNA encoding human
brain trypsinogen and characterization of its product, Gene,
21. Suzuki, T., Srivastava, A. S., and Kurokawa, T. (2002)
cDNA cloning and phylogenetic analysis of pancreatic serꢀ
ine proteases from Japanese flounder, Paralichthys oliꢀ
vaceus, Comp. Biochem. Physiol. B Biochem. Mol. Biol., 131,
63ꢀ70.
22. Roach, J. C., Wang, K., Gan, L., and Hood, L. (1997) The
molecular evolution of the vertebrate trypsinogens, J. Mol.
Evol., 45, 640ꢀ652.
23. Ma, D., Wang, Y., Yang, H., Wu, J., An, S., Gao, L., Xu,
X., and Lai, R. (2009) Antiꢀthrombosis repertoire of bloodꢀ
feeding horsefly salivary glands, Mol. Cell. Proteom., 8,
2071ꢀ2079.
1
36, 167ꢀ175.
. Titani, K., Ericsson, L. H., Neurath, H., and Walsh, K. A.
1975) Amino acid sequence of dogfish trypsin,
Biochemistry, 14, 1358ꢀ1366.
0. Stevenson, B. J., Hagenbuchle, O., and Wellauer, P. K.
1986) Sequence organization and transcriptional regulaꢀ
9
(
1
1
(
tion of the mouse elastase II and trypsin genes, Nucleic
Acids Res., 14, 8307ꢀ8330.
1. Craik, C. S., Choo, Q. L., Swift, G. H., Quinto, C.,
MacDonald, R. J., and Rutter, W. J. (1984) Structure of two
related rat pancreatic trypsin genes, J. Biol. Chem., 259,
24. Xu, X., Yang, H., Ma, D., Wu, J., Wang, Y., Song, Y.,
Wang, X., Lu, Y., Yang, J., and Lai, R. (2008) Toward an
understanding of the molecular mechanism for successful
blood feeding by coupling proteomics analysis with pharꢀ
macological testing of horsefly salivary glands, Mol. Cell.
Proteom., 7, 582ꢀ590.
25. Bode, W., and Schwager, P. (1975) The refined crystal
structure of bovine betaꢀtrypsin at 1.8 Å resolution. II.
Crystallographic refinement, calcium binding site, benzaꢀ
midine binding site and active site at pH 7.0, J. Mol. Biol.,
98, 693ꢀ717.
26. Vajda, T., and Szabo, T. (1976) Specificity of trypsin and
alphaꢀchymotrypsin towards neutral substrates, Acta
Biochim. Biophys. Acad. Sci. Hung., 11, 287ꢀ294.
27. Hsu, R. L., Lee, K. T., Wang, J. H., Lee, L. Y., and Chen,
R. P. (2009) Amyloidꢀdegrading ability of nattokinase from
Bacillus subtilis natto, J. Agric. Food Chem., 57, 503ꢀ508.
28. Adair, J. E., Stober, V., Sobhany, M., Zhuo, L., Roberts, J.
D., Negishi, M., Kimata, K., and Garantziotis, S. (2009)
Interꢀalphaꢀtrypsin inhibitor promotes bronchial epithelial
repair after injury through vitronectin binding, J. Biol.
Chem., 284, 16922ꢀ16930.
29. Himmelfarb, M., Klopocki, E., Grube, S., Staub, E.,
Klaman, I., Hinzmann, B., Kristiansen, G., Rosenthal, A.,
Durst, M., and Dahl, E. (2004) ITIH5, a novel member of
the interꢀalphaꢀtrypsin inhibitor heavy chain family is
downregulated in breast cancer, Cancer Lett., 204, 69ꢀ77.
30. SahinꢀToth, M. (2000) Human cationic trypsinogen. Role
of Asn21 in zymogen activation and implications in heredꢀ
itary pancreatitis, J. Biol. Chem., 275, 22750ꢀ22755.
31. Chen, J. M., Kukor, Z., Marechal, C., Toth, M., Tsakiris,
L., Raguenes, O., Ferec, C., and SahinꢀToth, M. (2003)
Evolution of trypsinogen peptides, Mol. Biol. Evol., 20,
1767ꢀ1777.
1
4255ꢀ14264.
2. Fletcher, T. S., Alhadeff, M., Craik, C. S., and Largman, C.
1987) Isolation and characterization of a cDNA encoding
1
1
1
(
rat cationic trypsinogen, Biochemistry, 26, 3081ꢀ3086.
3. Lutcke, H., Rausch, U., Vasiloudes, P., Scheele, G. A., and
Kern, H. F. (1989) A fourth trypsinogen (P23) in the rat
pancreas induced by CCK, Nucleic Acids Res., 17, 6736.
4. MacDonald, R. J., Stary, S. J., and Swift, G. H. (1982) Two
similar but nonꢀallelic rat pancreatic trypsinogens.
Nucleotide sequences of the cloned cDNAs, J. Biol. Chem.,
2
57, 9724ꢀ9732.
1
1
5. Kraut, J. (1977) Serine proteases: structure and mechanism
of catalysis, Annu. Rev. Biochem., 46, 331ꢀ358.
6. Ma, W., Tang, C., and Lai, L. (2005) Specificity of trypsin
and chymotrypsin: loopꢀmotionꢀcontrolled dynamic corꢀ
relation as a determinant, Biophys. J., 89, 1183ꢀ1193.
7. Salameh, M. A., and Radisky, E. S. (2013) Biochemical
and structural insights into mesotrypsin: an unusual human
trypsin, Int. J. Biochem. Mol. Biol., 4, 129ꢀ139.
8. Douglas, S. E., and Gallant, J. W. (1998) Isolation of
cDNAs for trypsinogen from the winter flounder,
Pleuronectes americanus, J. Mar. Biotechnol., 6, 214ꢀ219.
9. Gudmundsdottir, A., Gudmundsdottir, E., Oskarsson, S.,
Bjarnason, J. B., Eakin, A. K., and Craik, C. S. (1993)
Isolation and characterization of cDNAs from Atlantic cod
encoding two different forms of trypsinogen, Eur. J.
Biochem., 217, 1091ꢀ1097.
1
1
1
2
0. Manchado, M., Infante, C., Asensio, E., Crespo, A.,
Zuasti, E., and Canavate, J. P. (2008) Molecular characterꢀ
BIOCHEMISTRY (Moscow) Vol. 81 No. 2 2016