Highly soluble expression and molecular characterization of an organic solvent-stable and thermotolerant lipase originating from the metagenome

Article abstract of DOI:10.1016/j.molcatb.2011.07.009

A novel organic solvent-stable and thermotolerant lipase gene (designated ostl28) was cloned from a metagenomic library and overexpressed in Escherichia coli BL21 (DE3) in soluble form. OSTL28 contained 262 amino acids with relative molecular mass 30.1 kD

Full text of DOI:10.1016/j.molcatb.2011.07.009

Journal of Molecular Catalysis B: Enzymatic 72 (2011) 319–326
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic
journal homepage: www.elsevier.com/locate/molcatb
Highly soluble expression and molecular characterization of an organic
solvent-stable and thermotolerant lipase originating from the metagenome
Xinjiong Fan, Xiaolong Liu, Kui Wang, Sidi Wang, Rui Huang, Yuhuan Liu∗
School of Life Science, Sun Yat-sen University, Guangzhou 510275, PR China
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 3 April 2011
Received in revised form 15 July 2011
Accepted 17 July 2011
Available online 22 July 2011
A novel organic solvent-stable and thermotolerant lipase gene (designated ostl28) was cloned from a
metagenomic library and overexpressed in Escherichia coli BL21 (DE3) in soluble form. OSTL28 contained
262 amino acids with relative molecular mass 30.1 kDa and isoelectric point 9.7. The optimum pH and
temperature of the OSTL28 were 7.5 and 60 ◦C, respectively. OSTL28 was stable in the pH range of 4.5–9.5
and at temperatures below 65 ◦C. The enzyme could hydrolyze a wide range of ꢀ-nitrophenyl esters,
but its best substrate is ꢀ-nitrophenyl laurate with the highest activity of 236 U/mg (54,000 U/L). The
recombinant OSTL28 was highly resisted to organic solvents, especially glycerol and methanol. The metal
ions, with the exception of Hg2+ and Ag+, did not have any influence on enzyme activity, whereas non-
ionic surfactants and Al3+ slightly activated the enzyme. These features indicate that it is a potential
biocatalyst for biodiesel production.
Keywords:
Lipase
Organic solvent tolerance
Thermotolerance
Highly soluble expression
Metagenomic
© 2011 Elsevier B.V. All rights reserved.
1. Introduction
stability, it would be more desirable to screen for naturally evolved
solvent-tolerant enzymes for application in non-aqueous enzy-
Lipases (triacylglycerol hydrolase; EC 3.1.1.3) are an important
group of biotechnologically valuable enzymes distributed in a wide
range of organisms from bacteria to animals [1]. They hydrolyze
acylglycerides and other fatty acid esters in aqueous environments
and synthesize them in non-aqueous environments [2]. In gen-
eral, lipases hydrolyze long-chain acylglycerols (≥C10) [3], whereas
esterases have the ability to hydrolyze ester substrates with short-
chain fatty esters (≤C10). The stereo-, regio- and enantiospecific
behaviours of lipase-catalyzed reactions in organic solvents have
caused tremendous interest among scientists and industrialists
because of their potential applications in various industries such
as food, dairy, pharmaceutical, detergents, textile, biodiesel, and
cosmetic, and in synthesis of fine chemicals, agrochemicals, and
new polymeric materials [4–7].
Although reactions catalyzed by lipases in the presence of
organic solvents have many advantages [8], enzymes, including
lipases, are not stable in organic solvents. Because organic sol-
vents may alter the structure and activity of enzymes that usually
function in an aqueous environment. In order to alleviate this
drawback, several strategies, such as chemical modification, immo-
bilization, and protein engineering, have been employed for the
stabilization of enzymes for use in organic solvents [2,7,9,10]. Alter-
natively, instead of modifying enzymes to increase their solvent
matic synthesis [11].
Microbial lipases are currently receiving considerable atten-
tion due to their diversity in catalytic activity, high yield and low
cost production, and relative ease of genetic manipulation. Par-
ticularly some lipases from solvent tolerant bacteria are stable in
organic solvents such as Pseudomonas aeruginosa LST-03 [12], Bacil-
lus sphaericus 205y [13], Bacillus megaterium [14], Staphylococcus
saprophyticus M36 [15], Bacillus cepacia ST-200 [16], Burkholde-
ria multivorans V2 [17] and Pseudomonas fluorescens P21 [5]. As
mentioned above, some organic solvent-stable lipases were puri-
fied and characterized, and a few genes of organic solvent-stable
lipases were cloned and expressed [18,19]. However, all these orig-
inal investigations relied on pure culture analysis for determination
of the organic solvent-stable lipases. In contrast, the search strate-
gies for novel organic solvent-stable lipases can be achieved using
uncultured methods.
To avoid the limitation of pure culture, metagenomics has been
in the spotlight since the 1990s [20]. More than 90% of bacteria
in the environment cannot be cultured using conventional meth-
ods [21,22]. The metagenomic approach, direct cloning of DNA
from environmental samples and thereby accessing the potential
of unculturable organisms, has proven to be a powerful tool for
the isolation of novel biocatalyst genes. Current computed esti-
mates of soil diversity are in the range of a million species per
1 g of soil [23], and metagenomic strategy has led to the discovery
of quite diverse and novel enzymes for a broad range of applica-
tions [24]. Metagenome-derived enzymes include polysaccharide
∗
Corresponding author. Tel.: +86 20 84113712; fax: +86 20 84036215.
E-mail address: lsslyh@mail.sysu.edu.cn (Y. Liu).
1381-1177/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.molcatb.2011.07.009

320
X. Fan et al. / Journal of Molecular Catalysis B: Enzymatic 72 (2011) 319–326
degrading/modifying enzymes, esterases, nitrilases, amidases, pro-
teases, dehydrogenases, and oxidoreductases [25]. Many of them
displayed special enzymatic characteristics and high stability under
extreme conditions, and thus had potential applications in indus-
tries. Although several cold-adapted or thermostable lipase genes
were cloned by metagenomic approach from different environ-
ments (compost, intertidal flat sediment and hot spring) [26–29],
hitherto there have been no reports on organic solvent-stable and
thermotolerant lipases obtained via metagenomic strategies.
In this study, a metagenomic library from topsoil of Jiang Han oil
field of Hubei province in China was constructed for the screening of
clones with lipolytic activity. One novel lipase (OSTL28) was over-
expressed in Escherichia coli BL21 (DE3), purified and characterized.
This enzyme displayed excellent tolerance of organic solvents and
thermostability, and thus is considered as a good candidate of
lipases for industry after further study.
2.5. Construction of genomic libraries and screening for lipase
activity gene
The metagenomic library was constructed from environmen-
tal DNA isolated from oil field soil using protocols provided by
the manufacturer. DNA fragments (3–8 kb) obtained after par-
tial Sau3AI digestion were ligated into the BamHI restriction
site of the pZErO-2 vector, which had been previously digested
with BamHI. E. coli TOP10 was transformed by electroporation
with the ligated fragments and plated onto Luria–Bertani (LB)
agar plates containing kanamycin (50 ␮g/mL), 0.5 mM isopropyl-
␤-d-thiogalactopyranoside (IPTG), tributyrin (0.5%, v/v) and the
fluorescent dye rhodamine B (0.001%, w/v). Orange fluorescent
halos around lipase-positive E. coli strains could be seen when these
plates were exposed to UV light of 350 nm [30]. To avoid the iso-
lation of false-positive clones, plasmid DNA was isolated from the
positive clones obtained in the initial screening and retransformed,
and the new clones were examined on the same type of indicator
plates for lipase activity. The 3 colonies were further tested for their
abilities to hydrolyze ꢀ-nitrophenyl laurate. The only one transfor-
mant (pZD8-1) with lipase activity was obtained and reconfirmed.
2. Materials and methods
2.1. Strains, plasmids and culture conditions
E. coli TOP10 and pZErO-2 (Invitrogen, USA) were used as the
host and vector for the metagenomic library construction, respec-
tively. The pET-28a (+) (Novagen, USA) was used as an expression
vector to produce the target protein. E. coli BL21 (DE3) was used
as a host for expression of the OSTL28 gene under the control
of the T7 promoter. E. coli transformants were grown at 37 ◦C in
Luria–Bertani (LB) broth containing kanamycin (50 ␮g/mL), unless
otherwise stated.
2.6. Cloning and overexpression and purification of OSTL28
The putative lipase gene was amplified from the pZD8-1 plasmid
by using the primers and to introduce BamHI and HindIII restriction
sites for cloning in the pET-28a (+). The following primers were
used: fw (5ꢀ- GCCATGGCTGATATCGGATCCATGACCATTATTTTAC;
the BamHI cutting site is underlined) and rv (5ꢀ-
TTCAAGTTCAGACTCAAGCTTTCAAAACCGCTGCGGT; the HindIII
cutting site is underlined). The PCR product was digested with
BamHI/HindIII, and then ligated into BamHI/HindIII digested
expression vector pET-28a (+), and transformed into E. coli BL21
(DE3) (Stratagene). The E. coli transformed with this plasmid
was plated on LB agar containing kanamycin (50 ␮g/mL). The
transformant was grown in a 250-mL flask containing 50 mL
LB medium supplemented with kanamycin (50 ␮g/mL) at 37 ◦C
until the cell concentration reached OD600 of 0.8, and 0.2 mM
isopropyl-␤-d-thiogalactopyranoside (IPTG) of final concentration
to induce target protein expression. After incubation at 30 ◦C for
6 h with shaking at 220 rpm, cells were harvested by centrifugation
(6000 × g for 20 min at 4 ◦C) and resuspended in 50 mM Tris–HCl
buffer (pH 7.5) and disrupted by sonication for 10 s in ice-water
bath. The cell debris was removed by centrifugation at 10,000 × g
for 5 min at 4 ◦C. The clear supernatant was collected and the
recombinant OSTL28 was purified with his-tag affinity column.
The supernatant was applied to a Ni-nitrilotriacetic acid (Ni-NTA)
affinity chromatography column (Qiagen, Hilden, Germany),
equilibrated with buffer A (10 mM Tris–HCl, 500 mM NaCl, 5 mM
imidazole, pH 8) at a flow rate of 0.5 mL/min. The bound protein
was eluted with buffer B (10 mM Tris–HCl, 500 mM NaCl, 500 mM
imidazole, pH 8) at 4 ◦C. The purity of the enzyme was estimated
by 10% SDS (sodium dodecyl sulfate)-PAGE (polyacrylamide gel
electrophoresis) in the eluted fractions. Protein concentration was
determined by the method of Bradford, and bovine serum albumin
(Sigma) was used as standard for calibration [31]. Enzyme samples
were stored at −20 ◦C until further use.
2.2. DNA manipulation
Routine DNA manipulations were carried out according to stan-
dard techniques. Restriction enzymes and DNA polymerase were
purchased from Takara (Dalian, China). Each enzyme was used
according to the recommendations of the manufacturer. DNA lig-
ation was performed using T4 DNA ligase (Fermentas). Plasmids
were prepared from E. coli by using a QIAGEN miniplasmid purifi-
cation kit according to the manufacturer’s instructions (QIAGEN
Inc.). DNA fragments were isolated from agarose gels by using a
QIAquick gel extraction kit (QIAGEN Inc.). Electroporation was per-
formed with a Gene-Pulser II electroporation apparatus (Bio-Rad
Laboratories).
2.3. DNA sequencing and sequence analysis
Sequencing reactions were performed using a BigDye sequenc-
ing kit according to the instructions of the manufacturer. DNA
sequencing of positive plasmid clone (pZD8-1) was analyzed on ABI
377 DNA sequencer. Sequence manipulation, open reading frame
(ORF) searches, and multiple alignments among similar enzymes
were conducted with DNASTAR software. Database homology
search was performed with BLAST program provided by NCBI.
The conserved patterns of discrete amino acid sequences related
enzymes were analyzed by Clustal W program.
2.4. DNA extraction from soil samples
2.7. Determination of molecular mass and isoelectric point
The topsoil samples (5–10 cm) from oil field were used for the
experiments. Samples were collected and stored at −80 ◦C until
the DNA extraction was performed. Extraction of the total genomic
DNA from soil was performed using with the Fast DNA® SPIN kit for
soil according to the recommendations of suppliers (MP Biomedi-
cals, USA).
The molecular mass of the denatured protein was determined
by 10% SDS-PAGE. Proteins were stained with Coomassie brilliant
blue G. The molecular mass of the enzyme subunit was estimated
using protein marker as standards. Rabbit muscle phosphory-
lase B (97,200 Da), bovine serum albumin (66,409 Da), ovalbumin
(44,287 Da), carbonic anhydrase (29,000 Da) were used as the

X. Fan et al. / Journal of Molecular Catalysis B: Enzymatic 72 (2011) 319–326
321
Fig. 1. Multiple amino acid sequence alignment of OSTL28. Multiple alignment of the partial Amino acid sequences containing the conserved motifs of G × S × G
and putative catalytic triad resides of alpha/beta hydrolase family proteins. Except for OSTL28 (this study), other protein sequences were retrieved from GenBank
(http://www.ncbi.nlm.nih.gov). The accession numbers of the aligned sequences are for the following organisms: ACR13726, alpha/beta hydrolase family protein from
Teredinibacter turnerae T7901; ADG98142, alpha/beta hydrolase fold protein from Segniliparus rotundus DSM44985; EDM65472, hydrolase, alpha/beta fold family from
Moritella sp. PE36; ABR71813, alpha/beta hydrolase fold from Marinomonas sp. MWYL1; EDM27801, hydrolase, alpha/beta fold family protein from Lentisphaera araneosa
HTCC2155. The alignment was carried out using the Clustal W method. The open boxes indicate amino acid resides belonging to the putative catalytic triad resides, triangles
denote the active site. The same amino acid resides are marked by (*).
reference proteins. Isoelectric point (pI) was estimated by PAGE
with 6.25% Ampholine (pH 3.5–10) in a gel rod (0.5 by 10 cm) using
a kit for Isoelecric Focusing Calibration according to recommenda-
tions by the supplier.
of ꢀ-nitrophenol per minute under these conditions. In each mea-
surement, the effect of nonenzymatic hydrolysis of substrates was
taken into consideration and subtracted from the value measured
when the enzyme was added.
2.8. Substrate specificity of OSTL28
2.10. Kinetic assay
Substrate specificity against different ꢀ-nitrophenyl esters
was determined using ꢀ-nitrophenyl acetate (C2), ꢀ-nitrophenyl
butyrate (C4), ꢀ-nitrophenyl caprylate (C6), ꢀ-nitrophenyl caproate
(C8), ꢀ-nitrophenyl decanoate (C10), ꢀ-nitrophenyl laurate (C12),
ꢀ-nitrophenyl myristate (C14), ꢀ-nitrophenyl palmitate (C16), and
ꢀ-nitrophenylstearate (C18) as substrates, the activity was then
measured described above at the final substrate concentration of
0.3 mg/mL separately.
The purified lipase was incubated with various concentrations of
ꢀ-nitrophenyl laurate. The final concentration ranged from 1.0 mM
to 10.0 mM in Tris–HCl buffer (7.5). The kinetic constants were cal-
culated by fitting the initial rate data into the Michaelis–Menten
equation using the GraFit software (version 6; Erithacus Software
Ltd., Horley, UK).
2.11. Effect of pH and temperature on activity and stability of
OSTL28
2.9. Analysis of lipase OSTL28 activity
The optimum pH of OSTL28 was measured using ꢀ-nitrophenyl
laurate as a substrate at 60 ◦C. The buffers (at a final concentration of
50 mM) used for the measurement were as below: citric acid–NaOH
buffer (pH 3.5–5.5); potassium phosphate buffer (pH 5.0–7.0);
Tris–HCl buffer (pH 6.5–9.0), glycine–NaOH buffer (pH 8.5–10.0).
Overlapping pH values were used to verify that there were no
buffer effects on substrate hydrolysis. The optimum temperature
was determined analogously by measuring esterase activity at pH
7.5 in the temperature range of 30–80 ◦C. The pH stability was
tested after incubation of the purified enzyme for 24 h at 30 ◦C in
the above different buffers. Temperature stability was measured by
preincubation of the purified enzyme for different time in 50 mM
Tris–HCl buffer (pH 7.5) at different temperatures.
The lipase activity against ꢀ-nitrophenyl laurate (ꢀNPL) was
determined by measuring the amount of ꢀ-nitrophenol released by
lipase-catalyzed hydrolysis. The substrate (ꢀNPL) (3 mg) with final
concentration of 0.3 mg/mL was dissolved in 1 mL of isopropanol
and mixed with 9 mL of 50 mM Tris–HCl buffer (pH 7.5) containing
gum arabic (0.1%, w/v) and Triton X-100 (0.6%, w/v). After prein-
cubation for 5 min at 60 ◦C, the reaction was initiated by adding
enzyme into the reaction mixture. The hydrolysis of substrate was
performed at 60 ◦C for 10 min in 50 mM Tris–HCl (pH 7.5). The pro-
duction of ꢀ-nitrophenol was monitored spectrophotometrically at
405 nm by Labsystems Dragon Wellscan MK3. One unit of enzyme
activity was defined as the amount of enzyme that produced 1 ␮mol

322
X. Fan et al. / Journal of Molecular Catalysis B: Enzymatic 72 (2011) 319–326
Fig. 2. Phylogenetic analysis of OSTL28, its homologues and other lipases. Phylogenetic relationship of OSTL28 and lipase/esterase proteins of 8 different families was
performed using the program MEGALIGN (DNASTAR, Madison, WI). Except for OSTL28, the other protein sequences for previously identified families of bacterial lipolytic
and esterolytic enzymes were retrieved from GenBank (http://www.ncbi.nlm.nih.gov). The numbers at node indicate the bootstrap percentages of 1000 resamples. The units
at the bottom of the tree indicate the number of substitution events.
2.12. Effect of various reagents on activity and stability
of OSTL28
3. Results and discussion
3.1. Cloning, and sequence analysis of novel lipase OSTL28 gene
The effects of various chemicals on OSTL28 activity were inves-
tigated by preincubating for 24 h at 30 ◦C, containing 1% (v/v) of the
detergents (Triton X-100, Tween 80 and SDS) and 1 mM of CaCl2,
CdCl2, MgSO4, CuSO4, ZnSO4, MnCl2, AgNO3, HgCl2, AlCl3, EDTA,
1,10 phenanthroline, phenylmethanesulfonyl fluoride (PMSF). The
residual activity was then measured described above and expressed
as a percentage of the activity obtained in the absence of the added
compound.
Approximately 83,000 transformants of E. coli TOP10 contain-
ing the pZErO-2-based metagenomic DNA library were generated.
Restriction analysis of 100 randomly selected clones showed
that the average insert size was about 3.9 kb. The only one
lipase-positive strain from 83,000 transformants was selected, as
indicated by an orange fluorescent halo surrounding the colony,
and could hydrolyze tributyrin. Nucleotide sequence analysis of
the about 4.9 kb DNA insert in this clone showed the presence
of an open reading frame (789 bp) encoding a full-length lipase
gene (ostl28). The nucleotide sequence data reported here was
submitted to GenBank with the accession number HQ204320. The
DNA length of ostl28 is smaller than others derived from the
metagenome [28,32]. In some respects, the lipase gene ostl28 is
easier to be manipulated in follow-up experiments.
2.13. Effect of organic solvents on stability of OSTL28
The effect of various organic solvents at 25% (v/v) concentration
on the stability of OSTL28 was investigated. The reaction mixture
in screw capped tubes was incubated at 30 ◦C under shaking condi-
tion (150 rpm). After 24 h, the remaining activity was measured as
described above. Remaining activity was assayed under the stan-
dard condition and expressed as the lipase activity with distilled
water added to the reaction mixture instead of solvents.
The lipase encoding by ostl28 gene contained 262 amino acids
with a predicted molecular mass of 30.1 kDa. The putative amino
acid sequence of OSTL28 was used to perform a BLAST program pro-
vided by the National Centre for Biotechnology Information and
Swissprot databases. This search showed the moderate identity

X. Fan et al. / Journal of Molecular Catalysis B: Enzymatic 72 (2011) 319–326
323
Fig. 4. Substrate specificity of OSTL28. Substrate specificity of OSTL28 for ꢀ-
nitrophenyl esters of various fatty acids. This lipase displayed the highest activity
of 236 U/mg (54,000 U/L) with ꢀ-nitrophenyl laurate (C12) as a substrate, and the
activity was taken as 100%.
Fig. 3. Purification of OSTL28. SDS-PAGE analysis of the purified His6-tagged mature
OSTL28. Arrowhead indicates purified target protein (lane2); supernatant of E. coli
BL21 (DE3) cell lysates (lane 1); protein markers (lane M) stained with Coomassie
blue.
Table 1
Kinetic characterization of OSTL28.
(<50%) between OSTL28 and other esterases/lipases, the high-
est with alpha/beta hydrolase family protein from Teredinibacter
turnerae (101/249, 40% identity), followed by alpha/beta fold fam-
ily protein from Marinobacter algicola (102/248, 41% identity),
alpha/beta fold family hydrolase from Saccharophagus degradans 2-
40 (95/233, 40% identity), and alpha/beta fold family from Moritella
sp. PE36 (92/249, 36% identity). Multiple alignments of the deduced
amino acids of OSTL28 with the homologous proteins are pre-
sented in Fig. 1. The putative protein contained the conserved active
site motif of the pentapeptide G × S × G found in most bacterial
and eucaryotic serine hydrolases (residues from 74 to 78) with
a serine acting as the catalytic nucleophile, a conserved aspar-
tate or glutamate and a histidine, together constituting a catalytic
triad sequence (Ser 143, Asp195, His 222). An unrooted phyloge-
netic tree based on the amino acid sequences was constructed in
order to further verify the evolutionary relationship of the OSTL28
protein to other known lipase/esterase proteins, and 32 bacte-
rial lipase/esterase proteins representing 8 different families were
selected for the phylogenetic tree analysis. As shown in Fig. 2, the
OSTL28 protein belongs to Family VIII.
Substrate
Km (␮M)
kcat (S−1
)
ꢀ-Nitrophenyl acetate
ꢀ-Nitrophenyl butyrate
ꢀ-Nitrophenyl caprylate
ꢀ-Nitrophenyl caproate
ꢀ-Nitrophenyl decanoate
ꢀ-Nitrophenyl laurate
ꢀ-Nitrophenyl myristate
ꢀ-Nitrophenyl palmitate
ꢀ-Nitrophenyl lstearate
69.8 3.5
74.4 2.9
130.2 7.1
76.1 4.3
13.6 3.0
5.1 0.5
8.3 0.2
45.9 2.7
57.3 3.9
41.7 2.9
29.6 1.2
10.2 0.8
34.4 1.2
68.9 5.1
99 4.6
88.2 3.2
58.8 2.2
43.4 4.5
that of putative OSTL28 protein due to N-terminal fusion peptide
of 32 amino acids (about 4 kDa) in Fig. 3. This result is in agreement
with the calculated molecular mass of the predicted amino acid
sequence (30.1 kDa). The relative molecular mass of native enzyme
estimated by gel filtration on a calibrated column of Sephacryl
200 HR was 30 kDa. Hence, it is assumed that OSTL28 is a monomer.
The pI value was estimated to be 9.7.
3.3. Biochemical characterization of recombinant lipase OSTL28
3.2. Heterologous expression and purification of OSTL28
3.3.1. Substrate specificity and activity of OSTL28
The PCR product of ostl28 gene was purified and digested with
BamHI/HindIII to ligate it into a T7 RNA polymerase derived E. coli
expression vector of pET 28a (+) and was expressed in E. coli
BL21 (DE3) at 30 ◦C with 0.5 mM IPTG induction for 8 h. The cells
were harvested and disrupted by sonication in ice-water bath.
The recombinant OSTL28 was expressed in soluble form with no
inclusion bodies in Fig. 3. The highest expression level of OSTL28
(OD600 = 2.8) was about 0.23 mg/mL and its content in total soluble
protein reached up to 42.7% according to Quantity One software
(Bio-Rad laboratories Inc., Hercules, USA) for protein band visual-
ization.
In recent years, a variety of lipase-encoding genes from different
species have been cloned and sequenced. Unfortunately, heteroge-
neous expressions of many lipases are hampered by the fact that
a lipase chaperone is necessary for correctly folding to the active
form [33]. In contrast, we assume that OSTL28 exhibits an intrinsic
folding capability in vitro without chaperon protein.
The substrate specificity toward ꢀ-nitrophenyl esters of various
fatty acids is shown in Fig. 4. Recombinant lipase OSTL28 showed
the highest activity with ꢀ-nitrophenyl laurate (C12) among the
ꢀ-nitrophenyl esters examined, but it exhibited very low levels of
activity toward ꢀ-nitrophenyl esters with acyl groups shorter than
C8 or longer than C16, similar finding was reported by other lipases.
For example, the highest hydrolytic activities of thermostable
lipases from the extreme thermophilic anaerobic bacteria Ther-
moanaerobacter thermohydrosulfuricus SOL1 and Caldanaerobacter
subterraneus [34], different from esterases that can only catalyze
a variety of hydrolytic or synthetic reactions of short-chain fatty
acid esters. From these results, it is very clear that OSTL28 is a true
lipase.
Moreover, when acyl chain lengths were 12, its kcat and Km val-
ues was 99 S−1 and 5.1 ␮M, respectively. When acyl chain lengths
were between 6 and 12, its kcat values increased, while Km values
decreased with increasing acyl chain length. In contrast, when acyl
chain lengths were in the range of 14–18, the kcat values decreased,
whereas Km values remained constant with increasing acyl chain
length (Table 1). This kind of behavior characterizes that OSTL28
The recombinant OSTL28 was purified by Ni-NTA chromatog-
raphy. SDS-PAGE of the purified protein indicated a single protein
band with molecular mass of about 34 kDa, which was higher than

324
X. Fan et al. / Journal of Molecular Catalysis B: Enzymatic 72 (2011) 319–326
Fig. 5. Effect of pH on enzyme activity. Effect of pH on activity (ꢁ) and stability (ꢀ)
of recombinant OSTL28.
displayed the highest catalytic efficiency toward ꢀ-nitrophenyl lau-
rate (C12).
At 60 ◦C, this lipase displayed the highest activity of 236 U/mg
(54,000 U/L) with ꢀ-nitrophenyl laurate (C12) as a substrate, while
189 U/mg (ꢀ-nitrophenyl decanoate), 210 U/mg (ꢀ-nitrophenyl
myristate), and 117 U/mg (ꢀ-nitrophenyl palmitate). It was much
higher than lipases from T. thermohydrosulfuricus SOL1 and C. sub-
terraneus [34], but slightly lower than low-temperature lipase from
Psychrotrophic Pseudomonas sp. Strain KB700A with ꢀ-nitrophenyl
palmitate as substrate [35]. These above showed that the inducible
lipase displayed high activity in heterogeneous hosts.
3.3.2. Effect of pH and temperature on lipase activity and stability
The effect of pH and temperature over recombinant lipase
OSTL28 activity was determined. The enzyme showed an optimal
activity at approximately pH 7.5 (Fig. 5). corresponding to that of
other bacterial lipases such as P. aeruginosa LST-03 (Lip3) (pH 7.0)
[18], P. aeruginosa LX1 (pH 7.0) [36], and Geobacillus stearother-
mophilus strain-5 (pH 8.0) [37], while the optimum pH values for
the lipase activities of Staphylococcus aureus and Acinetobacter sp.
EH28 were 9.5 and 10, respectively [38,39]. OSTL28 was found to
be stable in the pH range of 4.5–9.5, and retained more than 80% of
maximal activity (Fig. 5). Therefore, the high activity and stability
of OSTL28 at broad pH conditions showed its usefulness in a range
of biotechnological applications.
As shown in Fig. 6a, the optimal temperature for recombinant
lipase OSTL28 is 60 ◦C, equal to that of G. stearothermophilus strain-5
lipase (60 ◦C) [37], lower than those recorded from Thermoanaer-
obacter thermohyfrosulfuricus (75 ◦C) [34] and Thermosyntropha
lipolytica (96 ◦C) [1], and higher than those reported from P.
aeruginosa LST-03 (37 ◦C) and P. aeruginosa LX1 (40 ◦C) [12,36].
The enzyme was fully stable below 55 ◦C, and the total activity
retained more than 60% after 5 h incubation at this temperature
(Fig. 6b). Interestingly, even incubating at 65 ◦C for 2 h, it still
retained as much as 50% of its total enzyme activity, in comparison
with thermostable lipases from other sources such as Amycolatop-
sis mediterranei DSM 43304 and Burkholderia cepacia [40,41], worse
than lipases from T. lipolytica [1] and T. thermohyfrosulfuricus [34].
According to these results, OSTL28 could be classified in range of
thermotolerant or moderately thermostable lipases. According to
research that most of the industrial processes operate at a tem-
perature exceeding 45 ◦C, lipase should be active and stable at a
temperature around 50 ◦C [42]. At 45 ◦C, LipA and LipB from T.
lipolytica had no activity, and the lipase from T. thermohyfrosulfu-
ricus exhibited less than 30% activity [1,34]. While the novel lipase
Fig. 6. Effect of temperature on enzyme activity. (a) Effect of temperature on activity
(ꢁ) of recombinant OSTL28. (b) Effect of temperature on stability of recombinant
OSTL28. The purified enzyme was preincubated at 30 ◦C (ꢂ), 40 ◦C (᭹), 50 ◦C (ꢂ),
55 ◦C (ꢀ), 60 ◦C (ꢁ) and 65 ◦C (ꢃ) for 1 h, 2 h, 3 h, 4 h and 5 h.
Table 2
Effect of the various substance on activity of OSTL28.
Substance
Relative activity (%)
None
100
1 mM CdCl2
1 mM CaCl2
1 mM AlCl3
1 mM MnCl2
1 mM MgCl2
1 mM CuSO4
1 mM ZnSO4
113 5.1
115 5.6
157 6.8
92 4.3
94 4.2
92 4.1
93 4.1
1 mM AgNO3
1 mM HgCl2
8
6
0.3
0.2
10 mM EDTA
10 mM 1,10 phenanthroline
1 mM PMSF
SDS (1%, w/v)
Triton X-100 (1%, w/v)
Tween 80 (1%, w/v)
96 4.5
92 4.1
95.8 3.1
5.8 0.1
114 4.8
123 5.3
OSTL28 had 75% activity. So this lipase OSTL28 is suitable for appli-
cation at this condition.
3.3.3. Effect of metal ions and surfactants on OSTL28
The effect of various reagents is shown in Table 2. The enzyme
activity of OSTL28 was obviously promoted by 1 mM Al3+ (157%).
The presence of Cu2+, Zn2+, Mn2+, Mg2+, Cd2+ and Ca2+ did not have

X. Fan et al. / Journal of Molecular Catalysis B: Enzymatic 72 (2011) 319–326
325
Table 3
incubation time and temperature, shaking speed, concentra-
tion and type of organic solvents in reaction mixture [6].
Lipase-catalyzed methanolysis has attracted considerable atten-
tion [16,45,46] as it is considered to be an effective mean of
circumventing drawbacks involved in the chemical processes.
Unfortunately, lipase such as Novozym 435 is deactivated when
more than one-third stochiometric amount of methanol present in
the reaction [16,45,47]. However, high stability in the presence of
glycerol and methanol (25%, v/v) was an excellent feature of OSTL28
for biodiesel production.
Effect of the various solvent on activity of OSTL28.
Solvent
Log P
Relative activity (%)
None
Glycerol
DMSO
DMF
Methanol
Ethanol
Acetone
Tert-butanol
Benzene
Toluene
Petroleum ether
n-Hexane
n-Dodecane
n-Tetradecane
n-Hexadecane
0
100
−1.76
−1.35
−1
148 6.3
91 4.6
68 3.8
92 1.3
64 3.2
57 3.1
39 2.1
68 3.3
76 4.2
105 4.5
127 6.1
113 5.4
113 5.1
118 5.8
−0.76
−0.24
−0.23
0.18
2
2.5
3
3.5
6.6
7.6
8.8
4. Conclusions
In this study, a novel lipase OSTL28 has been cloned and charac-
terized by metagenomic approach. Characteristics of the purified
enzyme described here differ from those reported hitherto in at
least one of following aspects: molecular mass, pI, pH and tem-
perature optima, substrate specificity and the tolerance to organic
solvents. These differences of the isofunctional enzymes suggest
diversity in evolution and a spread of lipase genes among dif-
ferent microorganisms. Given its high tolerance to glycerol and
methanol, accessibility to non-ionic surfactant, overexpression in
soluble form, and broad pH range and thermostability, OSTL28 is
a promising candidate for application in nonaqueous biocatalysis,
especially biodiesel production. In addition, this study also demon-
strates that the metagenomic approach is a useful tool to expand
our knowledge of enzyme diversity, especially for bacterial lipases.
any influence on enzyme activity at 1.0 mM, while the presence
of Hg2+ and Ag+ caused complete inhibition at 1.0 mM. Although
there are many reports describing the activation effect of Ca2+ on
enzyme activity due to conserved calcium-binding site formed by
two conserved aspartic acid resides near the active-site in numer-
ous lipases [36]. To our knowledge, this is the first report on the
activation effect of Al3+ on lipase activity.
Ionic surfactant SDS (1%, w/v) showed complete inhibition,
whereas a slight increase of lipase activity was observed by non-
ionic surfactant Triton X-100 (114%) and Tween 80 (123%) at the
concentration of 1% (w/v) due to enhancement of substrate accessi-
bility. The metal chelating agents EDTA and 1,10-phenanthroline at
the concentration of 1 mM had no significant effect on the enzyme
activity (96%, 92%), suggesting that the enzyme was not a metal-
loenzyme. Interestingly, the lipase activity is not affected by 1 mM
phenylmethylsulfonyl fluoride (PMSF), suggesting it may possess
a lid structure, which could eliminate the inhibition effect, similar
result was reported by other esterases/lipases [43].
Acknowledgements
We are grateful to the National High Technology Research and
Development Program of China (863 Program) (2007AA10Z308),
Major Science & Technology Projects of Guangdong Province, China
(2011A080403006) and the Research (Innovative) Fund of Labora-
tory Sun Yat-sen University (YJ201027) for their financial support.
References
3.3.4. Stability of OSTL28 in solvents
In present study, effects of various solvents on the enzyme activ-
ity were examined by preincubating the enzyme with solvents
(25%, v/v) in 50 mM Tris–HCl buffer (pH 7.5) at 30 ◦C, 150 rpm for
24 h and then measuring the residual activities of the enzyme under
standard condition. The results are shown in Table 3. The high-
est activity (148%) compared to that of the control was observed
in glycerol. In contrast, lipase activity from P. aeruginosa LST-03
and Bjerkandera adusta R59 were inhibited by glycerol [12,44].
More than 90% of its maximal activity was retained in presence of
dimethyl sulfoxide (DMSO) and methanol, whereas residual activ-
ity was 68, 64, and 57% in the presence of dimethylformamide
(DMF), ethanol and acetone, respectively. The enzyme activity was
slightly increased by 10–27% in the presence of n-hexane, n-decane,
n-tetradecane, and n-hexadecane, similar to that of lipases from
B. adusta R59 [44] and different from lipases from G. stearother-
mophilus and S. saprophyticus M36 [15,37]. The 39–76% of the
original activity was found in the presence of tert-butanol, ben-
zene, and toluene. The same behavior was found with lipases from
P. aeruginosa LST-03 and P. fluorescens P21 [5,12]. Thus, these results
showed that OSTL28 has distinct stabilities against various organic
solvents which were dependent on the nature of the solvent and
its structure. Stability of lipase in organic solvents is important cri-
terion for biocatalyst used in organic synthesis, but most enzymes
(including lipases) are not stable in the presence of organic sol-
vents, especially polar organic solvents which are highly toxic to
most enzymes. In fact, there are some difficulties in comparing the
stable property of various lipases in the presence of organic sol-
vents because of the differences in experimental conditions such as
[1] M.A. Salameh, J. Wiegel, Appl. Environ. Microbiol. 73 (2007) 7725–7731.
[2] K. Jaeger, T. Eggert, Curr. Opin. Biotechnol. 15 (2004) 305–313.
[3] R. Verger, Trends Biotechnol. 15 (1997) 32–38.
[4] M. Ferrera, J. Soliverib, J.P. Francisco, N. Lopez-Cortesa, R.D. Dolores, M. Chris-
tensenc, A. Ballesterosa, Enzyme Microb. Technol. 36 (2005) 391–398.
[5] B.H. Cadirci, I. Yasa, J. Mol. Catal. B: Enzym. 64 (2010) 155–161.
[6] N. Doukyu, H. Oginod, Biochem. Eng. J. 48 (2010) 219–223.
[7] Z.Y. Shu, H. Jiang, J.R. Lin, Y.M. Jiang, L. Lin, J.Z. Huang, J. Mol. Catal. B: Enzym.
62 (2010) 1–8.
[8] V. Gotor-Ferndez, R. Brieva, V. Gotor, J. Mol. Catal. B: Enzym. 40 (2006) 111–120.
[9] A.O. Magnusson, J.C. Rotticci-Mulder, A. Santagostino, K. Hult, Chem. Biochem.
6 (2005) 1051–1056.
[10] K.M. Polizzi, A.S. Bommarius, J.M. Broering, J.F. Chaparro-Riggers, Curr. Opin.
Chem. Biol. 11 (2007) 220–225.
[11] G.R. Castro, T. Knubovets, Crit. Rev. Biotechnol. 23 (2003) 195–231.
[12] H. Ogino, S. Nakagawa, K. Shinya, T. Muto, N. Fujimura, M. Yasuda, H. Ishikawa,
J. Biosci. Bioeng. 89 (2000) 451–457.
[13] C.J. Hun, R.N.Z.A. Rahman, A.B. Salleh, M. Basri, Biochem. Eng. J. 15 (2003)
147–151.
[14] V.M.G. Lima, N. Krieger, D.A. Mitchell, J.D. Fontana, J. Mol. Catal. B: Enzym. 31
(2004) 53–61.
[15] Y. Fang, Z. Lu, W. Xu, Curr. Microbiol. 53 (2006) 510–515.
[16] M.M.R. Talukder, S.M. Puah, J.C. Wu, W.J. Choi, Y. Chow, Biocatal. Biotransform.
24 (2006) 257–262.
[17] V. Dandavate, J. Jinjala, H. Keharia, D. Madamwar, Biores. Technol. 100 (2009)
3374–3381.
[18] H. Ogino, S. Hiroshima, S. Hirose, M. Yasuda, K. Ishimi, H. Ishikawa, Mol. Genet.
Genomics 271 (2004) 189–196.
[19] A.J. Zhang, R.J. Gao, N.B. Diao, G.Q. Xie, G. Gao, S.G. Cao, J. Mol. Catal. B: Enzym.
56 (2009) 78–84.
[20] J. Handelsman, M.R. Rondon, S.F. Brady, J. Clardy, R.M. Goodman, Chem. Biol. 5
(1998) R245–R249.
[21] M.S. Rappé, S.J. Giovannoni, Annu. Rev. Microbiol. 57 (2003) 369–394.
[22] K. Wang, G. Li, S.Q. Yu, C.T. Zhang, Y.H. Liu, Appl. Microbiol. Biotechnol. 88 (2010)
155–165.
[23] T.P. Curtis, W.T. Sloan, Science 309 (2005) 1331–1333.

326
X. Fan et al. / Journal of Molecular Catalysis B: Enzymatic 72 (2011) 319–326
[24] R. Daniel, Nat. Rev. Microbiol. 3 (2005) 470–478.
[25] H.L. Steele, K.E. Jaeger, R. Daniel, W.R. Streit, J. Mol. Microbiol. Biotechnol. 16
(2009) 25–37.
[26] K. Lammle, H. Zipper, M. Breuer, B. Hauer, C. Buta, H. Brunner, S. Rupp, J. Biotech-
nol. 127 (2007) 575–592.
[27] S.W. Lee, K. Won, H.K. Lim, J.C. Kim, G.J. Choi, K.Y. Cho, Appl. Microbiol. Biotech-
nol. 65 (2004) 720–726.
[28] M.H. Lee, C.H. Lee, T.K. Oh, J.K. Song, J.H. Yoon, Appl. Environ. Microbiol. 72
(2006) 7406–7409.
[37] M.M. Berekaa, T.I. Zaghloul, Y.R. Abdel-Fattah, H.M. Saeed, M. Sifour, World J.
Microbiol. Biotechnol. 25 (2009) 287–294.
[38] E.H. Ahmed, T. Raghavendra, D. Madamwar, Biores. Technol. 101 (2010)
3628–3634.
[39] H. Horchani, H. Mosbah, N.B. Salem, Y. Gargouri, A. Sayari, J. Mol. Catal. B:
Enzym. 56 (2009) 237–245.
[40] D.S. Dheeman, J.M. Frias, G.T.M. Henehan, J. Ind. Microbiol. Biotechnol. 37
(2010) 1–17.
[41] Y.P. Lu, F.X. Lu, X. Wang, X.M. Bie, H.G. Sun, W.Y.D. Lai, Z.X. Lu, Ann. Microbiol.
59 (2009) 565–571.
[42] R. Sharma, S.K. Soni, R.M. Vohra, L.K. Gupta, J.K. Gupta, Process Biochem. 37
(2002) 1075–1084.
[43] X.M. Chu, H.Z. He, C.Q. Guo, B.L. Sun, Appl. Microbiol. Biotechnol. 80 (2008)
615–625.
[29] R. Ranjan, A. Grover, R.K. Kapardar, R. Sharma, Biochem. Biophys. Res. Commun.
335 (2005) 57–65.
[30] G. Kouker, K.E. Jaeger, Appl. Environ. Microbiol. 53 (1987) 211–213.
[31] M.M. Bradford, Anal. Biochem. 72 (1976) 248–254.
[32] E.Y. Kim, K.H. Oh, M.H. Lee, Appl. Environ. Microbiol. 75 (2009) 257–260.
[33] F. Rosenau, K. Jaeger, Biochimie 82 (2000) 1023–1032.
[34] M. Royter, M. Schmidt, C. Elend, H. Hobenreich, T. Schafer, U.T. Bornscheuer, G.
Antranikian, Extremophiles 13 (2009) 769–783.
[44] R. Bancerz, G. Ginalska, J. Ind. Microbiol. Biotechnol. 34 (2007) 553–560.
[45] W. Du, Y. Xu, D. Liu, J. Zeng, J. Mol. Catal. B: Enzym. 30 (2004) 125–129.
[46] H. Fukuda, A. Kondo, H. Noda, J. Biosci. Bioeng. 920 (2001) 405–416.
[47] S. Tamalampuddy, M.M.R. Talukder, S. Hama, T. Nomuta, A. Kondo, H. Fukuda,
Biochem. Eng. J. 39 (2008) 185–189.
[35] N. Rashid, Y. Shimada, S. Ezaki, H. Atomi, T. Imanaka, Appl. Environ. Microbiol.
67 (2001) 4064–4069.
[36] Q.C. Ji, S.J. Xiao, B.F. He, X.N. Liu, J. Mol. Catal. B: Enzym. 66 (2010) 264–269.