A small molecule peptidomimetic that binds to c-KIT1 G-quadruplex and exhibits antiproliferative properties in cancer cells

Article abstract of DOI:10.1016/j.bmc.2014.05.060

A modular synthesis of l-proline derived peptidomimetics has been developed using the Cu^I catalyzed Huisgen cycloaddition between an azido prolinamide with pyridine and benzene dicarboxamide containing dialkynes. F?rster Resonance Energy Transfer (FRET) melting assay provided an initial indication that the pyridyl analogue can stabilize the c-KIT1 quadruplex DNA. A competitive FRET-melting assay and Fluorescent Intercalator Displacement (FID) assay suggest that the pyridyl ligand shows excellent selectivity for c-KIT1 quadruplex over duplex DNA and other investigated G-quadruplexes. Molecular docking studies indicate that the pyridyl ligand can adopt unique conformations upon binding to c-KIT1 quadruplex due to the presence of intramolecular hydrogen bonds. The pyridyl ligand can perturb cell cycle progression and induce necrotic cell death of human hepatocellular liver carcinoma HepG2 cells.

Full text of DOI:10.1016/j.bmc.2014.05.060

Accepted Manuscript
A small molecule peptidomimetic that binds to c-KIT1 G-quadruplex and ex-
hibits antiproliferative properties in cancer cells
Ajay Chauhan, Sushovan Paladhi, Manish Debnath, Samir Mandal, Rabindra
Nath Das, Sudipta Bhowmick, Jyotirmayee Dash
PII:
S0968-0896(14)00419-2
DOI:
http://dx.doi.org/10.1016/j.bmc.2014.05.060
BMC 11621
Reference:
Bioorganic & Medicinal Chemistry
To appear in:
Received Date:
Revised Date:
Accepted Date:
6 March 2014
19 May 2014
28 May 2014
Please cite this article as: Chauhan, A., Paladhi, S., Debnath, M., Mandal, S., Das, R.N., Bhowmick, S., Dash, J., A
small molecule peptidomimetic that binds to c-KIT1 G-quadruplex and exhibits antiproliferative properties in cancer
cells, Bioorganic & Medicinal Chemistry (2014), doi: http://dx.doi.org/10.1016/j.bmc.2014.05.060
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com
A small molecule peptidomimetic that binds to c-KIT1 G-quadruplex and exhibits
antiproliferative properties in cancer cells
Ajay Chauhana, Sushovan Paladhi a,b, Manish Debnathb, Samir Mandalb, Rabindra Nath Dasa, Sudipta
Bhowmickb, and Jyotirmayee Dasha,b
a Department of Chemical Sciences, Indian Institute of Science Education and Research Kolkata, Mohanpur Campus, Mohanpur, 741 252, India
b Department of Organic Chemistry, Indian Association for the Cultivation of Science, Jadavpur, Kolkata, 700 032, India
ARTICLE INFO
ABSTRACT
Article history:
Received
Received in revised form
Accepted
A modular synthesis of L-proline derived peptidomimetics has been developed using the CuI
catalyzed Huisgen cycloaddition between an azido prolinamide with pyridine and benzene
dicarboxamide containing dialkynes. Förster Resonance Energy Transfer (FRET) melting assay
provided an initial indication that the pyridyl analogue can stabilize the c-KIT1 quadruplex
DNA. A competitive FRET-melting assay and Fluorescent Intercalator Displacement (FID)
assay suggest that the pyridyl ligand shows excellent selectivity for c-KIT1 quadruplex over
duplex DNA and other investigated G-quadruplexes. Molecular docking studies indicate that the
pyridyl ligand can adopt unique conformations upon binding to c-KIT1 quadruplex due to the
presence of intramolecular hydrogen bonds. The pyridyl ligand can perturb cell cycle
progression and induce necrotic cell death of human hepatocellular liver carcinoma HepG2 cells.
Available online
De Keywords:
Click Chemistry
FID assay
FRET melting assay
G-quadruplex DNA
Necrosis
2009 Elsevier Ltd. All rights reserved.
Peptidomimetic
regulators of KIT expression.10 In vitro studies suggest that small
molecules can inhibit c-KIT expression in cancer cells.15
1. Introduction
Guanine-rich DNA sequences are capable of folding into four
stranded secondary structures, known as G-quadruplexes.1
Guanines form planar G-quartets stabilized by Hoogsteen
hydrogen bonding which stack upon each other to form these
structures.1,2 The ability of the G-rich sequences to form G-
quadruplexes in vitro has been demonstrated using X-ray
crystallography and NMR spectroscopic studies.3,4 Recent studies
revealed the presence of G-quadruplex forming sequences in
genomic regions which includes telomeres5 and promoters of
numerous proto-oncogenes, such as c-MYC,6 BCL-2,7 k-RAS,8 c-
KIT (c-KIT1 and c-KIT2)9,10 etc. G-quadruplex structures have
elicited the interest in biological processes due to their role in
regulation of transcription of different genes.11 Small molecules
interacting with the G-quadruplex structures in the promoter
region of oncogenes can repress gene expression.11
Due to the proposed regulatory roles of G-quadruplexes in
biological processes; they have recently become important
anticancer targets for designing small molecules.16-19 However,
G-quadruplexes are structurally similar and contain G-quartet as
a common feature. Therefore, it is quite challenging to design
small molecules that are selective towards a particular G-
quadruplex. In this paper, we describe design and synthesis of a
pyridyl peptidomimetic that shows high selectivity to c-KIT1
quadruplex and inhibits cancer cell proliferation in vitro.
2. Results and discussion
2.1. Design and synthesis of the peptidomimetic ligand
Peptides can adopt well-defined conformations due to the
presence of intramolecular hydrogen bonds and are often good
leads for the design of drug candidates.20 However; they rarely
serve as drug candidates due to their low bioavailability and high
conformational flexibility. There has been much interest in the
synthesis of conformationally restricted analogs, which can
mimic the function of peptides with increased bioavailability and
pharmacological behavior.21 The heteroaromatic 1,2,3-triazole
motif has recently become an appealing peptide bond isostere
because of their similar structural and electronic characteristics to
Expression of c-KIT is critical for a wide range of tumors
including melanocytes, small cell lung cancer,12 colorectal
cancer13 and gastrointestinal stromal tumors (GIST).14 The KIT
promoter contains two G-quadruplex forming sequences namely
c-KIT1 and c-KIT2 located between −87 and −109 base pairs and
between −140 and −160 base pairs relative to the transcription
start site respectively.9,10 The sequences are present in close
p—ro—xim—ity to the Sp1 binding site and therefore are critical
 Corresponding author. Tel.: +91-33-2473-4971 ext. 1405; fax: +91-33-2473-2805; e-mail: ocjd@iacs.res.in

those of a peptide bond.22 In addition, proline residues are present
in numerous biologically important peptide sequences and
provide unique effects on the conformation of the polypeptide
backbone.23 Here we present a modular design of proline-
terminated peptide mimics incorporating either a benzene-1,3-
dicarboxamide or a 2,6-pyridine dicarboxamide unit through
triazole linkages as G-quadruplex binding ligands. The pyridine
ligand can adopt intramolecularly folded conformations due to
the presence of bifurcated H-bonding interactions while the
benzene analogue may prefer linear conformations. We presumed
that these conformational features of the peptidomimetics may
exhibit preferred interactions with a particular G-quadruplex
leading to increased selectivity. Previously it has been described
that the conformational preferences of small molecule ligands
based on 2,6-pyridine dicarboxamide24,25 and bis-indole26,27
scaffolds can modulate the binding affinity and the selectivity of
G-quadruplexes. However, to the best of our knowledge, proline
containing peptidomimetics has not been described as G-
quadruplex DNA ligands. A simple and modular synthetic route
was devised to synthesize these peptidomimetic ligands 9 using
of the Boc group afforded the bis-prolinamide peptidomimetic
ligands 9a-b in near quantitative yields.
2.2 Förster Resonance Energy Transfer (FRET) melting
assay
FRET melting analysis29,30 is a commonly used high-throughput
technique to determine the stabilizing ability and selectivity of
ligands for G-quadruplex DNA. To test whether ligands 9a-b
could stabilize DNA sequences, we employed FRET melting
with four dual fluorescently labeled G-quadruplex targets
comprising c-MYC promoter quadruplex, two c-KIT (c-KIT1 and
c-KIT2) promoter quadruplexes and human telomeric quadruplex
(h-TELO). We also evaluated the stabilization potential of
ligands 9 to a dual fluorescently labeled hairpin duplex DNA (ds
DNA). First, the melting of DNA sequences were performed in
the absence and presence of fixed amount of 9a-b (1 M) using a
RT-PCR machine. Ligand 9a containing
a benzene-1,3-
dicarboxamide unit did not alter the melting of either the
investigated G-quadruplex targets or the duplex DNA at 1 M
concentration (Figure 1a). In contrast, ligand 9b with a central
pyridine ring showed high selectivity for c-KIT1 quadruplex with
a ΔTm of 10.4 K. Ligand 9b exhibited weak stabilization
potentials for c-MYC (ΔTm = 2.5 K), c-KIT2 (ΔTm = 2.7 K) and h-
TELO (ΔTm = 2.1 K) quadruplexes at 1 M concentration. Ligand
9b did not increase the melting of the ds DNA at 1 M
concentration. These results indicate that replacing a benzene
ring with a pyridine ring in the chemical scaffold could
contribute to the differences in observed stabilization for G-
quadruplexes. Next we performed FRET melting of the c-KIT1
quadruplex at various concentrations of the ligand 9b (Figure1b).
The FRET melting profile reveals that the ΔTm values were dose-
dependent. Ligand 9b shows a high stabilization potential for c-
KIT1 quadruplex (ΔTm = 30.6 K) at 2 M concentration.
CuI-catalyzed 1,3-dipolar azide–alkyne cycloaddition of
a
clickable azido prolinamide 4 with dialkyne buiding blocks 7
derived from isophthalic acid 5a and pyridine 2,6-dicarboxylic
acid 5b (Scheme 1).
H2N
N3
H
OH
OH
N
a)
3
N
H
N
N
N3
O
O
O
Boc
Boc
b)
1
2, 95%
4, 95%
(a) Synthesis of a chiral azido prolinamide
H2N
H
N
H
N
6
HOOC
HOOC
COOH
COOH
c)
5a
O
O
7a,
80%
H
N
H
N
d)
N
N
O
O
5b
7b,
79%
(b) Synthesis of dialkyne building blocks
N
N
N
N
H
N
H
N
N
N
HN
NH
7
X
4
O
O
e)
O
O
N
R1
N
R1
R
R
1 = Boc, X = CH, 78%
1 = Boc, X = N, 72%
8a,
8b,
f)
9a, R1 = H, X = CH, 97%
9b, R1 = H, X = N, 98%
a) Boc2O,Et3N, CH2Cl2, rt, 12 h;
b) DCC, HOBT, CH2Cl2 , rt, 12h;
c) EDC.HCl, HOBT, NMM, DMF, rt, 12 h;
6
d) (i) SOCl2, 0 °C to 80 °C, 10 h, (ii) , NMM, DMF, 0 °C to rt, 12 h;
e) CuSO4 5 H2O, sodium ascorbate, tBuOH:H2O, 16 h;
.
f) TFA,CH2Cl2, rt, 6 h.
Scheme 1. Synthesis of peptidomimetic ligands.
The azido prolinamide 4 was prepared in two steps using a
standard protocol previously reported from our laboratory.28
Dialkyne 7a was prepared in high yield by coupling of
isophthalic acid 5a with propargyl amine (6) using standard
coupling conditions (EDC hydrochloride and HOBt) in the
presence of NMM in DMF. Pyridine 2,6-dicarboxylic acid 5b
was treated with thionyl chloride to generate the corresponding
dicarbonyl chloride, which was subsequently coupled with
propargyl amine (6) to give the dialkyne building block 7b in
79% yield (Scheme 1). The azido prolinamide 4 was then treated
with the dialkynes 7a-b in the presence of Na-ascorbate and
Figure 1. (a) FRET stabilization potential of ligands 9a and 9b (1 M) in
50 mM potassium cacodylate buffer, pH 7.4, Tm (°C) for c-MYC = (70±1), c-
KIT1 = (53±1), c-KIT2 = (63±1), h-TELO = (56±1), ds DNA = (57±1) in 60
mM potassium cacodylate buffer, pH 7.4 without ligand. (b) Thermal shift
profiles for ligand 9b upon stabilization of c-KIT1 quadruplex.
t
CuSO4·5H2O in BuOH/H2O (1:1) as solvent to yield the bis-
triazole derivatives 8a-b in 72-78% yields. Subsequent removal

In agreement with FRET results, ligand 9b showed high
selectivity for c-KIT1 quadruplex with a DC50 value of 0.47 µM
and a submicromolar equilibrium dissociation constant (Kd) of
0.74 µM (Figure 3a, Table 1). While higher concentrations of 9
were required to displace 50% TO from c-MYC, c-KIT2 and h-
TELO G-quadruplexes (Figure 3b). It exhibited a DC50 value of
11.3 M, 9.5 M and 7.3 M for c-MYC, c-KIT2 and h-TELO
quadruplexes respectively. Correspondingly, it showed a modest
Kd (3.8 µM) for c-MYC and high Kd values of 11.6 M and 22.7
M for h-TELO and c-KIT2 G-quadruplexes respectively (Table
1). These results indicate that 9b displays 30-fold greater c-KIT1
specificity than the c-KIT2 quadruplex. It also shows nearly 5-
fold greater affinity for c-KIT1 over c-MYC promoter quadruplex
and a 15-fold higher affinity for c-KIT1 than h-TELO G-
quadruplex (Table 1, Figure 3). It is worth noting that ligand 9b
could not even displace 50% TO from ds-DNA at 25 µM ligand
concentrations (Figure 3b), indicating excellent selectivity of
ligand 9b for quadruplexes over duplex DNA.
The selectivity of the ligand 9b for the c-KIT1 quadruplex was
evaluated using a competitive FRET-melting assay (Figure 2).
The melting of c-KIT1 was performed in the presence of various
DNA competitors: a ds-DNA and three other quadruplex
sequences c-MYC, c-KIT2 and h-TELO. As shown in Figure 2,
the stabilization of c-KIT1 was only slightly altered at higher
concentration of the duplex DNA (20 µM, 80 mol equivalent
excess to c-KIT1). These data clearly support the selective
recognition of c-KIT1 in the presence of duplex DNA. The
stabilization temperature of the c-KIT1 quadruplex was found to
be moderately affected in the presence of 5µM quadruplex-
competitors (20 fold excess), which further indicates selectivity
of 9b for c-KIT1 over c-MYC, h-TELO and c-KIT2 (Figure 2).
Figure 2. FRET competition results at 2 M 9b for c-KIT1 (250 nM) in
the presence of ds DNA and quadruplex DNA competitor. Tm (ºC) for c-KIT1
= (53±1).
2.3 Fluorescence Intercalator Displacement (FID) assay
The FID assay has been used to evaluate the binding affinity
of a ligand for quadruplex and double stranded DNA.31-33 This
assay utilizes a light-up probe like thiazole-orange (TO), which is
virtually nonfluorescent in the free state and becomes strongly
fluorescent upon binding to duplex or quadruplex DNA.31-33
Thus, the quadruplex or duplex DNA affinity of a ligand can be
determined through its ability to displace TO from the DNA
target and can be readily monitored via the decrease of its
fluorescence. The concentrations of ligand 9b to induce a 50%
fluorescence decrease (DC50) were determined using four G-
quadruplexes (c-MYC, c-KIT1, c-KIT2, h-TELO) and a self-
complementary duplex DNA sequence (ds DNA).
Figure 3. TO displacement from (a) c-KIT1 G-quadruplex and (b) c-KIT2,
c-MYC, h-TELO G-quadruplexes and ds DNA with increasing concentrations
of ligand 9b in buffer containing 100 mM KCl and 10 mM tris·HCl, pH 7.4.
2.4 Molecular modeling
Table 1. DC50 and Kd obtained for ligand 9b from FID data.
Peptidomimetic 9a did not stabilize the nucleic acid sequences,
while 9b showed high selectivity for one of the G-quadruplexes
(c-KIT1) at 1 M (Figure 1a). The observed difference between
9a and 9b may be explained based on the conformational
constraint of 9b due to the presence of intramolecular hydrogen
bonds. Both ligands 9a and 9b are conformationally flexible and
can adopt multiple conformational motifs. The pyridyl analogue
9b can form intramolecular hydrogen bonds between the pyridine
nitrogen atom and the neighboring amides thereby restricting
rotation between the amide nitrogens and the pyridine ring.
However, the peptidomimetic 9a derived from isopthalic acid
allows free rotation around the benzene ring and the neighboring
amide bonds. Further, the N-atom of the triazole rings of both 9a
and 9b can also form intramolecular H-bonds with the amide
hydrogens. Density-functional-theory (DFT) calculations on 9b
Nucleic acid sequence
DC50
(µM) (µM)
Kd of 9b
c-MYC: 5ʹ-(TGAGGGTGGGTAGGGTGGGTAA)-
3ʹ
11.3
0.47
3.8
c-KIT1: 5ʹ-(GGGAGGGCGCTGGGAGGGAGGG)-
3ʹ
0.74
c-KIT2: 5ʹ-(GGGCGGGCGCGAGGGAGGGG)-3ʹ
9.5
7.3
22.7
11.6
h-TELO: 5ʹ-(GGGTTAGGGTTAGGGTTAGGG)-
3ʹ
ds DNA: 5ʹ-CCAGTTCGTAGTAACCC-3ʹ
3ʹ-GGTCAAGCATCATTGGG-5ʹ
>25
nd

suggested that the fully folded conformation 9b-C, in which the
pyridine nitrogen H-bonds with both the neighboring amide
hydrogen atoms (Figure 4) was the lowest-energy conformer.
The linear conformer 9b-A without any H-bond with the lone
pairs of electrons on nitrogen showed higher energy than the one-
side folded conformer 9b-B (Figure 4). In contrast, the linear
conformer of the benzene analogue 9a-A was the lowest energy
conformer, as its energy of formation was lower than the other
two folded conformers 9a-B and 9a-C (Figure 4).
quadruplex (PDB ID: 3QXR)34 using the Auto-Dock 4.0
program.35 The pyridyl ligand 9b can undergo conformational
changes upon interacting with the c-KIT1 quadruplex, as it allows
conformational flexibility due to the presence of rotatable bonds
unlike the rigid structure of many reported macrocyclic or planar
heteroaromatic G-quadruplex binding ligands.24-27 The two
possible binding models were selected on the basis of their low
energy and optimum interactions between the conformers of 9b
and the c-KIT1 G-quadruplex. It was observed that due to the
conformational constraint imposed by the intramolecular H-
bonding of the pyridine nitrogen
with amide protons, the two triazole-
phenylene-prolinamide units of 9b
interact with two distinct binding
sites of c-KIT1 quadruplex. The best
docking orientation of 9b with c-
KIT1 shows an interaction energy
value of –51.41 KJ/mol (Figure 5a-
b). In this model, one of the triazole-
phenylene-prolinamide
units
exhibits a stacking interaction with
the external G-quartet and covers a
larger surface area of the G-quartet.
The other unit interacts with the
loop and groove regions (Figure 5a-
b). Another model with interaction
energy of –31.48 KJ/mol indicates
possible interaction of 9b with the
groove and loop regions (Figure 5c-
d). In this model, one of the triazole-
phenylene-prolinamide units binds
to the quadruplex groove by external
stacking and the other unit interacts
with the loop region of the qudruplex (Figure 5c-d). In both the
models, the –NH– group of proline ring was found to participate
an electrostatic interaction with the phosphate backbone.
Figure 4. Energy minimised conformers of peptidomimetics 9a and 9b
obtained using B3LYP/6-31+G(d) level (Gaussian03 program). The relative
energies compared to the lowest energy conformation are given under each
structure. (Color codes: C = gray, H = white, N = blue, O = red).
2.5 Cell cycle analysis and mode of cell death
The ability of 9b to inhibit cancer cell proliferation was
studied in HepG2 human hepatocellular liver carcinoma cells.
The cytotoxic effect of 9b on HepG2 cells was determined with
varying concentrations of 9b (0.5, 1, 2, 5, 10, 15, 20 M) for 24 h
using the MTT assay.36 Cells treated with 0.1% DMSO served as
controls. The IC50 value of 9b was found to be 7.42 μM, which
indicates the potential of the ligand to inhibit cancer cell growth
and proliferation at low micromolar concentrations
(Supplementary material, Figure S1).
Figure 5. Two possible docked conformations of the peptidomimetic 9b
with c-KIT1 quadruplex (PDB ID: 3QXR); (a,c) top views; (b,d) side views.
In order to understand the binding interactions, docking of the
lowest energy conformer 9b-C was performed with c-KIT1
Figure 6. Flow cytometric analysis of cell cycle parameters. HepG2
cancer cells were incubated for 12 h in the presence of (2.5-10 μM) 9b.

Histogram a (control), b (2.5 µM), c (5.0 µM), d (10.0 µM) indicate the
percent of cells in G0-G1, S, G2-M and sub G0 phases of the cell cycle upon
treatment with 9b.
Q1), late apoptotic (upper right quadrant, Q2) and early apoptotic cells (lower
right quadrant, Q4) upon treatment with 9b.
3. Conclusion
Inhibition of cell growth by 9b was examined by measuring
cell cycle distribution, HepG2 cells were treated with various
concentrations (2.5, 5 and 10 µM) of 9b for 12 h, and the cell-
cycle distribution was evaluated by flow cytometry (Figure 6).37
Fluorometric histogram revealed an increase in sub G0 cell
population concomitant with a decrease in the percentage of cells
in S phase in a dose dependent manner. As shown in Figure 6,
treatment of cells with 9b at a dose of 10 µM resulted in an
increase in the proportion of G0-G1cells (12.4%) at the expense
of cells in S phase and G2-M phase in comparison to the controls
(DMSO treated cells). These results suggest that 9b induced
inhibition of cell proliferation is associated with cell-cycle arrest
in G0-G1 phase.
Two new bis-prolinamide derivatives containing pyridine and
benzene dicarboxamide central units were prepared using ‘Click’
chemistry. Pyridine analogue was found to be a more promising
c-KIT1 G-quadruplex binding ligand than the benzene analogue,
suggesting that H-bonding plays a key role in controlling the
conformation of the pyridyl ligand for the selective recognition.
FRET melting analysis showed high selectivity of the pyridyl
ligand for quadruplexes over duplex DNA. The FID assay
revealed that the pyridyl ligand binds with high affinity to c-KIT1
and displays moderate to high c-KIT1 specificity over c-MYC, h-
TELO and c-KIT2 quadruplexes. In addition, the pyridyl ligand
effectively inhibited the cell growth and induced cell death of
HepG2 cancer cells. These results demonstrate that
conformationally constrained peptidomimetic ligands can be
engineered for achieving high selectivity for a particular G-
quadruplex. Further chemical modifications in the scaffold are
currently underway for developing more selective G-quadruplex
binding ligands.
The nature of 9b-induced cytotoxicity of HepG2 cells was
further evaluated by flow cytometric analysis using annexin V-
propidium iodide (PI) double staining (Figure 7).38 Annexin V, a
phospholipid-binding protein binds to externally exposed
phosphatidylserine of apoptotic cells. The DNA-binding agent PI
can stain cells only after loss of membrane integrity, a
characteristic event of necrosis. This dual staining allows the
discrimination of living cells (unstained, lower left quadrant Q3)
from necrotic (stained only with PI, upper left quadrant Q1),
early apoptotic cells (stained only with annexin-V, lower right
quadrant Q4) and late apoptotic cells (stained with both annexin-
V and PI, upper right quadrant Q2). Treatment of HepG2 cells
with various concentrations (2.5, 5 and 10 µM) of 9b for 24 h
resulted in a dose-dependent increase in the proportion of
necrotic cells (upper left quadrant Q1, Figure 7). The PI positive
cell population was enhanced from 0.2% to 23.3%, 38.6% and
85.8% in the presence of 2.5, 5.0, and 10 µM of 9b respectively.
There was no remarkable increase of annexin V positive cells
(lower right quadrant Q4) even after treatment of 10 µM of 9b
for 24 h. These results indicate that cellular growth arrest at G0-
G1 phase and subsequent decrease at S and G2-M phase might
lead to induction of necrosis in human liver carcinoma cells.
4. Experimental
All the starting materials were obtained from commercial
suppliers and used as received. Products were purified by column
chromatography on silica gel (60-120 mesh, Merck). Unless
1
otherwise stated, yields refer to analytical pure samples. H and
13C NMR spectra were recorded on either Brüker AVANCE 500
(500 MHz and 125 MHz), or JEOL 400 (400 MHz and 100
MHz) instruments. NMR spectra were recorded in deuterated
solvents as detailed and at ambient probe temperature (300 K).
Chemical shifts are reported in parts per million (ppm) and are
referenced to the residual solvent peak. The following notations
are used: singlet (s); doublet (d); triplet (t); quartet (q); multiplet
(m); broad (sbr). Data is reported in the following manner:
chemical shift (integration, multiplicity, coupling constant if
appropriate). Signals are quoted as δ values in ppm and coupling
constants (J) are reported in Hertz. Using residual protonated
solvent signals as internal standard (1H: δ(CDCl3) = 7.26 ppm,
δ((CD3)2SO) = 2.50 ppm, δ(CD3OD) = 3.30 ppm and 13C:
δ(CDCl3) = 77.16 ppm, δ(CD3)2SO) = 39.52 ppm, δ(CD3OD) =
79.0 ppm).
Synthesis of N1,N3-di(prop-2-ynyl)isophthalamide 7a: To an
ice-cooled suspension of isophthalic acid 5a (200.0 mg, 1.2
mmol, 1.0 equiv) in dry DMF (25 mL), EDC.HCl (692.0 mg, 3.6
mmol, 3.0 equiv), NMM (1.1 mL, 5.0 mmol, 8.4 equiv) and 1-
hydroxy-1H-benzotriazole (HOBT) (551.0 mg, 3.6 mmol, 3.0
equiv) were added and the mixture was allowed to stir for 45
min. Then propargylamine 6 (0.4 mL, 3.6 mmol, 3.00 equiv)
was added dropwise to the reaction mixture, and stirred for 12 h.
The solvent was removed in vacuum and was purified by column
chromatography using methanol-CH2Cl2 (2:98) as eluent to
afford the desired product 7a as a colorless solid (231 mg, 80%);
1
m.p. 177 °C. H NMR (500 MHz, DMSO-d6): 9.06 (2H, t, J =
5.51 Hz), 8.32 (1H, t, J = 1.61 Hz), 8.00–7.98 (2H, m), 7.58 (1H,
t, J = 7.75 Hz), 4.09-4.07 (4H, m), 3.11 (2H, t, J = 2.49 Hz); 13
C
NMR (125 MHz, DMSO-d6): 165.2, 133.7, 129.7, 128.2, 126.0,
80.8, 72.5, 28.2. HRMS (ESI) calcd for C14H13N2O2 (M+H)+:
241.0977; found, 241.0981.
Synthesis
of
N2,N6-di(prop-2-ynyl)pyridine-2,6-
Figure 7. Mode of cell death after 9b treatment using flow cytometry.
HepG2 cancer cells were incubated for 24 h in the presence of 9b (2.5-10
μM). Histogram a (control), b (2.5 µM), c (5.0 µM), d (10.0 µM) indicate the
percentage of normal (lower left quadrant, Q3), necrotic (upper left quadrant,
dicarboxamide 7b: Thionyl chloride (10.0 mL) was added drop
wise to pyridine-2, 6-dicarboxylic acid 5b (200.0 mg, 1.2 mmol,
1.0 equiv ) at 0 °C and allowed to stir at 80 °C for 10 h. The

2.53 (2H, m), 2.16-2.09 (6H, m), NH could not be detected; 13C
NMR (100 MHz, CD3OD): 168.0, 166.9, 145.8, 138.5, 134.4,
133.2, 130.2, 128.7, 126.3, 121.2, 120.8, 120.7, 60.5, 47.5, 34.9,
29.7, 23.8; HRMS (ESI) calcd for C36H39N12O4 (M+H)+:
703.3217; found, 703.3215.
reaction mixture was concentrated and dried under vacuum to
provide the crude pyridine-2,6-dicarboxylic acid chloride. The
crude product was dissolved in DMF (10.0 mL) and cooled to 0
oC. NMM (1.1 mL, 10.1 mmol, 8.4 equiv) and propargylamine 6
(0.3 mL, 4.2 mmol, 3.5 equiv) were added under an argon
atmosphere at 0 oC and allowed to stir at room temperature for 12
h. The solvent was removed in vacuum and the residue was
purified by column chromatography using MeOH-CH2Cl2 (3:97)
to give the compound 7b (228.0 mg, 79%) as colorless solid;
Synthesis of compound 9b: To an ice-cooled solution of
compound 8b (250.0 mg, 0.26 mmol, 1.0 equiv) in 10.0 mL dry
CH2Cl2 was added TFA (0.2 mL, 1.7 mmol, 6.0 equiv) and the
mixture was stirred for 6 h at room temperature. After
consumption of the starting material 8b (monitored by TLC), the
reaction mixture was brought to pH 8-9 by adding drop wise a
solution of liquid NH3 (30%) at 0 °C. Then the reaction mixture
was extracted with CH2Cl2 (3 x 20 mL), dried in vacuum,
purified by column chromatography using CH2Cl2:MeOH:NH3
(90:09:1 to 75:20:5) to give 9b (190 mg, 98%) as a colorless
solid; m.p. 200.4 °C. 1H NMR (400 MHz, DMSO-d6): 10.80 (2H,
s), 9.96 (2H, t, J = 7.72 Hz), 8.63 (2H, s), 8.24-8.16 (3H, m), 7.89
(4H, d, J = 11.3 Hz), 7.76 (4H, d, J = 11.3 Hz), 4.69 (4H, d, J =
7.6 Hz), 4.36 (2H, t, J = 9.0 Hz), 3.37-3.27 (4H, m, merged with
water peak of DMSO-d6), 2.43-2.35 (2H, m), 2.03-1.91 (6H, m);
13C NMR (125MHz, DMSO-d6): 167.2, 163.4, 148.6, 146.0,
138.2, 132.6, 124.5, 121.1, 120.8, 120.4, 79.2, 59.8, 45.9, 34.5,
29.6, 23.6; HRMS (ESI) calcd for C35H37N13NaO4 (M+Na)+:
726.2989; found, 726.2985.
1
m.p. 188 °C. H NMR (400 MHz, DMSO-d6): 9.72 (2H, t, J =
7.4 Hz), 8.22-8.20 (3H, m), 4.19-4.17 (4H, m), 3.17-3.16 (2H, t,
J = 2.9 Hz); 13C NMR (100 MHz, DMSO-d6): 163.4, 148.8,
140.2, 125.2, 81.6, 73.7, 28.6. HRMS (ESI) calcd for
C13H11N3NaO2 (M+Na)+: 264.0749; found, 264.0751.
Synthesis of compound 8a: A mixture of N1,N3-di(prop-2-
ynyl)isophthalamide 7a (200.0 mg, 0.8 mmol,1.0 equiv), the aryl
azide 4 (605.8 mg, 1.8 mmol, 2.2 equiv), sodium ascorbate
(119.1 mg , 0.6 mmol, 0.8 equiv) and CuSO4.5H2O (62.5 mg,
0.25 mmol, 0.3 equiv) in H2O/tBuOH (7:3, 10 mL) was stirred at
room temperature for 16 h. After consumption of the starting
material 4 (monitored by TLC), the reaction mixture was
concentrated under vacuum and the residue was purified by
column chromatography using MeOH-CH2Cl2 (4:96) to give
corresponding product 8a (272.0 mg, 78%) as colorless solid;
m.p. 94 °C. 1H NMR (400 MHz, CDCl3): 9.92 (2H, s ), 8.55 (2H,
s), 8.34 (1H, s), 7.92 (2H, d, J = 8.8 Hz), 7.69 (2H, s), 7.42 (4H,
d, J = 9.9 Hz), 7.37-7.33 (1H, m), 7.16 (4H, d, J = 8.6 Hz), 4.76
(2H, d, J = 15.9 Hz), 4.51 (4H, sbr), 3.59-3.44 (4H, m), 2.14-1.92
(8H, m), 1.48 (18H, s); 13C NMR (100 MHz, CDCl3): 171.7,
167.6, 155.4, 145.2 139.2, 134.2, 132.0, 131.6, 131.0, 129.0,
125.1, 120.1, 120.0, 80.8, 60.6, 47.4, 35.4, 29.8, 28.5, 24.7;
HRMS (ESI) calcd for C46H54N12NaO8 (M+Na)+: 925.4085;
found, 925.4087.
4.2 FRET melting experiments
Four dual fluorescently labeled G-quadruplex forming DNA
oligonucleotide sequences were used in the study; c-KIT1: 5′-
FAM-(GGGAGGGCGCTGGGAGGGAGGG)-TAMRA-3′);
c-
KIT2: 5′-FAM-(GGGCGGGCGCGAGGGAGGGG)-TAMRA-3′),
c-MYC: (5′-FAM-(TGAG3TG3TAG3TG3TA2)-TAMRA-3′), h-
TELO: 5′-FAM-(GGTTAGGGTTAGGGTTAGGG)-TAMRA-3′
and a self-complementary duplex DNA sequence with a central
Synthesis of compound 8b: A mixture of N2,N6-di(prop-2-
ynyl)pyridine-2,6-dicarboxamide 7b (100.0 mg, 0.414 mmol, 1.0
equiv), the aryl azide 4 (301.85.0 mg, 0.912 mmol, 2.2 equiv),
sodium ascorbate (41.06 mg, 0.207 mmol, 0.5 equiv) and
CuSO4.5H2O (31.1 mg, 0.124 mmol, 0.3 equiv) in H2O/tBuOH
(7:3, 10 mL) was stirred at room temperature for 16 h. After
consumption of the starting material 4 (monitored by TLC), the
reaction mixture was concentrated under vacuum and the residue
was purified by column chromatography using MeOH-CH2Cl2
(4:96) to give the corresponding product 8b (272.0 mg, 72%) as
hexaethylene
glycol
(HEG)
linker
(ds:
5′-FAM-
(TATAGCTATA-HEG-TATAGCTATA)-TAMRA-3′).
The
donor fluorophore was 6-carboxyfluorescein, FAM, and the
acceptor fluorophore was 6-carboxytetramethylrhodamine,
TAMRA. These dual labeled DNA oligonucleotide sequences
were diluted from a 100 M stock solution in MilliQ (MQ) water
to a concentration of 500 nM in 60 mM potassium cacodylate
°
buffer, pH 7.4 and then annealed by heating to 95 C for 10 min,
followed by cooling to room temperature. Samples were prepared
in 96-well plates by aliquoting the annealed dual labeled DNA
into each well, followed by the buffer solution of ligand 9b (2
μM) and further incubated for 1 h. The melting of G-
quadruplexes was monitored alone or in the presence of 1 μM
concentration of ligand 9b (Figure 1a). The melting of c-KIT1
quadruplex was then monitored by aliquoting the annealed c-
KIT1 dual labeled DNA into each well, followed by the addition
of increasing concentrations of ligand 9b in the same buffer
(Figure 1b). Competition experiments were carried out in the
presence of an excess of 4 or 80 mole equivalents of duplex ds
DNA (5′-CAATCGGATCGAATTCGATCCGATTG-3′) and in
the presence of an excess of 8 to 20 mole equivalents of
quadruplex forming sequences such as h-TELO (5′-
1
colorless solid; m.p. 183 °C. H NMR (400 MHz, CDCl3): 9.93
(2H, s), 9.17 (2H, s), 8.22 (2H, d, J = 9.5 Hz), 7.94 (1H, t, J = 9.5
Hz), 7.68 (2H, s), 7.45 (4H, d, J = 8.5 Hz), 7.21 (4H, d, J = 6.9
Hz), 4.92-4.90 (2H, m), 4.55-4.54 (4H, m), 3.63-3.46 (4H, m),
1.96-1.89 (4H, m), 1.84-1.78 (4H, m), 1.49 (18H, s); 13C NMR
(125 MHz, CDCl3): 171.9, 163.7, 155.5, 148.6, 145.4, 139.4,
138.9, 131.8, 124.9, 120.3, 120.0, 119.5, 80.9, 60.7, 47.5, 30.0,
29.9, 28.7, 24.8; HRMS (ESI) calcd for C45H53N13NaO8
(M+Na)+: 926.4038; found, 926.4041.
Synthesis of compound 9a: To an ice-cooled solution of
compound 8a (250.0 mg, 0.3 mmol, 1.0 equiv) in 10.0 mL dry
CH2Cl2 was added TFA (0.2 mL, 1.7 mmol, 6.0 equiv) and the
mixture was stirred for 6 h at room temperature. After
consumption of the starting material 8a (monitored by TLC), the
reaction mixture was brought to pH 8-9 by adding drop wise a
solution of liquid NH3 (30%) at 0 °C. Then the reaction mixture
was extracted with CH2Cl2 (3 x 20 mL), dried in vacuum,
purified by column chromatography using CH2Cl2:MeOH:NH3
(90:09:1 to 75:20:5) to give 9a (190 mg, 97%) as a colorless
GGTTAGGGTTAGGGTTAGGG-3′),
GGGCGGGCGCGAGGGAGGGG-3′)
TGAGGGTGGGTAGGGTGGGTAA-3′)
c-KIT2
and c-MYC
with
(5′-
(5′-
μM
2
concentration of ligand 9b. Measurements were made in
triplicate with an excitation wavelength of 483 nm and a
detection wavelength of 533 nm using a LightCycler® 480-II
System RT-PCR machine (Roche).
1
solid; m.p. 264 °C. H NMR (400 MHz, CD3OD): 8.42 (2H, s),
8.37 (1H, s), 8.02-7.99 (2H, m), 7.78 (8H, s), 7.55 (1H, t, J = 8.9
Hz), 4.72 (4H, s), 4.47-4.45 (2H, m), 3.49-3.40 (4H, m), 2.55-

4.3 FID assay
4.6 Cell cycle analysis by flow cytometry
Exponentially growing HepG2 cells were seeded in a 60 mm
petridish (~1 × 106 cells/petridish) and allowed to grow in
DMEM complete media for 24 h. Then the cells were treated
with various concentrations of 9b (2.5, 5.0, 10.0 µM) and DMSO
(0.1% as control) in duplicate for 12 h. Then the cells were
trypsinized, centrifuged and washed twice with 1X PBS. The cell
pellets were then resuspended in 2 mL of 70% ethanol and were
stored at 4 °C for overnight. The overnight fixed samples were
centrifuged and washed twice with 1X PBS and were incubated
with 10 μg/mL RNase A and 10 μg/mL PI in 1X PBS for 45 min
at room temperature in the dark. The cells were analyzed for cell
cycle by acquiring the fluorescence of PI using flow cytometry
(FACSCalibur, BD Biosciences, Mountain View, CA, USA) and
the cell cycle distribution was analyzed using CellQuest Pro
software.
0.25 µM of pre-folded quadruplexes and duplex were mixed with
thiazole orange (0.50 µM TO) in buffer containing 100 mM KCl
and 10 mM tris·HCl, pH 7.4. Ligand 9b was added to the mixture
stepwise in the same buffer with a 3-min equilibration period and
the fluorescence spectrum was recorded. The percentage of
displacement is calculated from the fluorescence area (FA, 510-
700 nm, λex = 501 nm), using
 FA


Percentage of TO displacement = 100 
 100

FA


o
FA0 being the fluorescence area from TO bound to DNA without
added ligand. The percentage of displacement was then plotted as
a function of the concentration of the ligand 9b. Binding affinity
was then calculated by using the following formula.
4.7 Determination of apoptosis/necrosis by flow cytometry
KaTO  TO = K  DC



50 
aL
Annexin V–FITC and PI stains were used to determine the
percentage of cells undergoing apoptosis and necrosis. The assay
was conducted using the protocol supplied by the manufacturer.
Briefly, 1 × 106 HepG2 cells per 60 mm petridish (~90%
confluence) were treated with various concentrations of 9b (2.5,
5.0, 10.0 µM) and DMSO (0.1% as control) for 24 h. Cells were
then harvested with trypsin. After centrifugation, the cell pellets
were resuspended in 500 µL of 1X annexin binding buffer (10
mM HEPES, 140 mM NaCl, and 2.5 mM CaCl2, pH 7.4.) and
then double-stained with annexin V–FITC (5 µL) and PI (5 µL).
After incubation for 5 min on ice, samples were immediately
analyzed by flow cytometry (FACSCalibur, BD Biosciences,
Mountain View, CA, USA) using Cell Quest Pro software.
Approximately 10,000 HepG2 cells were analyzed in each
sample.
KaTO is the binding affinity of TO for different quadruplexes,
[TO] concentration of TO 0.5 µM, KaL is the association constant
of ligands for different quadruplexes and [DC50] is the
concentration of ligand required for 50 % displacement of TO.
Dissociation constant (Kd) = 1/ KaL
4.4 Molecular modeling
Docking studies were carried out using the Auto-Dock 4.0
program.31 The Protein Data Bank file (PDB ID: 3QXR)30 was
used as the c-KIT1 quadruplex DNA receptor for dockings.
Energy minimized structures of 9b was created with Gaussian 03
program using DFT analysis B3LYP/6-31+G(d) level. 50
Docking calculations were performed using the Lamarckian
genetic algorithm (LGA) with the default parameters from Auto-
Dock 4.0 program. A maximum of 25 million energy evaluations
was applied for the experiment. The results were clustered using
a tolerance of 2.0 Å and 10 lowest potential energy structures
were collected from the experiment. The docked 9b.c-KIT1
complex structures were imaged using Chimera 1.6.2 software.
Acknowledgments
This work was supported by the Council of Science and
Industrial Research (CSIR) and Department of Biotechnology
(DBT) India. SP and RD thank CSIR for a research fellowship
and MD thanks Department of Science and Technology (DST)
for an INSPIRE research fellowship.
4.5 Cytotoxicity assay
The human hepatocellular liver carcinoma cells (HepG2) were
cultured in DMEM containing high glucose (5.5 mM)
supplemented with 10% FBS at pH 7.4. Cells were maintained in
tissue culture plates containing 4×105 cells/well at 37 C in an
atmosphere of 5% carbon dioxide (CO2)/95% air. The cancer
cells were treated with various concentrations (0.5, 1, 2, 5, 10,
15, 20 µM) of ligand 9b for 24 h. Cell viability was determined
by MTT assay. 20 µL of 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazoliumbromide (MTT, concentration 5 mg/mL in
PBS buffer) was added to each well, and the plate was incubated
for 4 h at 37°C. The purple colored crystals were dissolved in
acidified isopropanol and the conversion of MTT to purple
formazan by viable cells was measured by measuring absorbance
(A) at 570 nm with an automated microplate reader (Thermo
Scientific). The assay was performed in triplicate. Growth curves
or viable cell curve were generated using the following
expression:
Supplementary material
Supplementary data (Synthesis of azido prolinamide 4,
computational methods, growth curve, NMR copy of all
synthesized compounds) associated with this article can be
found, in the online version, at http://dx.doi.org/
References and notes
1. S. Neidle, S. Balasubramanian, Quadruplex Nucleic Acids,
RSC, Cambridge, 2006.
2. Neidle, S. Curr. Opin. Struct. Biol. 2009, 19, 239.
3. Parkinson, G. N.; Lee, M. P.; Neidle, S. Nature 2002, 417,
876.
4. Phan, A. T.; Modi, Y. S.; Patel, D. J. J. Am. Chem. Soc. 2004,
126, 8710.
5. Paeschke, K.; Simonsson, T.; Postberg, J.; Rhodes, D.; Lipps,
H. J. Nat. Struct. Mol. Biol. 2005, 12, 847.
6. Siddiqui-Jain, A.; Grand, C. L.; Bearss, D. J.; Hurley, L.H.
Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 11593.
7. Dai, J.; Dexheimer, T. S.; Chen, D.; Carver, M.; Ambrus, A.;
Jones, R. A.; Yang, D. J. Am. Chem. Soc. 2006, 128, 1096.
8. Cogoi, S.; Xodo, L. E. Nucleic Acids Res. 2006, 34, 2536.
A of experimental group
Viable cells (%) =
× 100
A of control group
The concentration of 9b that inhibited cell survival by 50%
(IC50) was determined from viable cell curve.

9. Rankin, S.; Reszka, A. P.; Huppert, J.; Zloh, M.; Parkinson, G.
N.; Todd, A. K.; Ladame, S.; Balasubramanian, S.; Neidle, S.
J. Am. Chem. Soc. 2005, 127, 10584.
10. Fernando, H.; Reszka, A. P.; Huppert, J.; Ladame, S.; Rankin,
S.; Venkitaraman, A.; Neidle, S.; Balasubramanian, S.
Biochemistry 2006, 45, 7854.
24. De Cian, A.; DeLemos, E.; Mergny, J.-L.; Teulade-Fichou,
M.-P.; Monchaud, D. J. Am. Chem. Soc. 2007, 129, 1856.
25. Müller, S.; Pantoș , G. D.; Rodriguez, R.; Balasubramanian,
S.; Chem. Commun. 2009, 80.
26. Dash, J.; Shirude, P. S.; Balasubramanian, S. Chem. Commun.
2008, 3055.
11. Balasubramanian, S.; Hurley, L. H.; Neidle, S. Nat. Rev. Drug
Discovery 2011, 10, 261.
12. Wang, W. L.; Healy, M. E.; Sattler, M.; Verma, S.; Lin, J.;
Maulik, G.; Stiles, C. D.; Griffin, J. D.; Johnson, B. E.; Salgia,
R. Oncogene, 2000, 19, 3521.
13. Attoub, S.; Rivat, C.; Rodrigues, S.; Van Bocxlaer, S.; Bedin,
M.; Bruyneel, E.; Louvet, C.; Kornprobst, M.; André, T.;
Mareel, M.; Mester, J.; Gespach, C. Cancer Res. 2002, 62,
4879.
14. Hirota, S.; Isozaki, K.; Moriyama, Y.; Hashimoto, K.; Nishida,
T.; Ishiguro, S.; Kawano, K.; Hanada, M.; Kurata, A.; Takeda,
M.; Muhammad Tunio, G.; Matsuzawa, Y.; Kanakura, Y.;
Shinomura, Y.; Kitamura, Y. Science, 1998, 279, 577.
15. Bejugam, M.; Sewitz, S.; Shirude, P. S.; Rodriguez, R.;
Shahid, R.; Balasubramanian, S. J. Am. Chem. Soc. 2007, 129,
12926.
27. Dash, J.; Das, R. N.; Hegde, N.; Pantoș , G. D.; Shirude, P. S.;
Balasubramanian, S. Chem. Eur. J. 2012, 18, 554.
28. Paladhi, S.; Das, J.; Mishra, P. K.; Dash, J. Adv. Synth. Catal.
2013, 355, 274.
29. Darby, R. A. J.; Sollogoub, M.; McKeen, C.; Brown, L.;
Risitano, A.; Brown, N.; Barton, C.; Brown, T.; Fox, K. R.
Nucleic Acids Res. 2002, 30, e39.
30. De Cian, A.; Guittat, L.; Kaiser, M.; Saccá, B.; Amrane, S.;
Bourdoncle, A.; Alberti, P.; Teulade-Fichou, M. P.; Lacroix,
L.; Mergny, J. L. Methods 2007, 42, 183.
31. Monchaud, D.; Allain, C.; Teulade-Fichou, M. P. Bioorg.
Med. Chem. Lett. 2006, 16, 4842.
32. Monchaud, D.; Allain, C.; Bertrand, H.; Smargiasso, N.; Rosu,
F.; Gabelica, V.; De Cian, A.; Mergny, J. L.; Teulade Fichou,
M. P. Biochimie 2008, 90, 1207.
33. Largy, E.; Hamon, F.; Teulade Fichou, M. P. Anal. Bioanal.
Chem. 2011, 400, 3419.
16. Davis, J. T. Angew. Chem. Int. Ed. 2004, 43, 668.
17. Monchaud, D.; Teulade-Fichou, M. P. Org. Biomol. Chem.
2008, 6, 627.
34. Wei, D.; Parkinson, G. N.; Reszka, A. P.; Neidle, S., Nucleic
Acids Research, 2012, 40, 4691.
18. Qin, Y.; Hurley, L. H. Biochimie 2008, 90, 1149.
19. Collie, G. W.; Parkinson, G. N. Chem. Soc. Rev. 2011, 40,
5867.
35. Morris, G. M.; Goodsell, D. S.; Halliday, R. S.; Huey, R.;
Hart, W. E.; Belew, R. K.; Olson, A. J. J. Comput. Chem.
1998, 19, 1639.
20. Lee, S.; Xie, J.; Chen X. Chem. Rev. 2010, 110, 3087.
21. Giannis, A.; Kolter, T. Angew. Chem. Int. Ed. Engl. 1993, 32.
124.
36. Mosmann, T. J. Immunol. Methods, 1983, 65, 55.
37. Krishan, A. J. Cell Biol. 1975, 66, 188.
38. Vermes,
I.;
Haanen,
C.;
Steffens-Nakken,
H.;
22. Angell, Y. L.; Burges, K. Chem. Soc. Rev. 2007, 36, 1674.
23. Vanhoof, G.; Goossens, F.; De Meester, I.; Hendriks, D.;
Scharpe, S. FASEB J, 1995, 9, 736.
Reutelingsperger, C. J. Immunol. Methods 1995, 184, 39.

Graphical Abstract
A small molecule peptidomimetic that binds
to c-kit1 G-quadruplex and exhibits
Leave this area blank for abstract info.
antiproliferative properties in cancer cells
Ajay Chauhana, Sushovan Paladhi a,b, Manish Debnathb, Samir Mandalb, Rabindra Nath Dasa, Sudipta
Bhowmickb, and Jyotirmayee Dasha,b
a Department of Chemical Sciences, Indian Institute of Science Education and Research Kolkata, Mohanpur Campus, Mohanpur, 741 252, India
b Department of Organic Chemistry, Indian Association for the Cultivation of Science, Jadavpur, Kolkata, 700 032, India