Highly Efficient Access to (S)-Sulfoxides Utilizing a Promiscuous Flavoprotein Monooxygenase in a Whole-Cell Biocatalyst Format

Article abstract of DOI:10.1002/cctc.201901894

Chiral sulfoxides have gained attention as synthons and precursors for API synthesis. Flavoproteins such as Baeyer-Villiger or styrene monooxygenases mainly provide access to (R)-sulfoxides and often suffer from low selectivity, activity, and/or limited substrate scope. The flavoprotein monooxygenase AbIMO from Acinetobacter baylyi ADP1 initiates indole degradation. Here, AbIMO was expressed recombinantly in E. coli and characterized for its sulfoxidation activity and substrate spectrum. Next to indole and styrene, AbIMO was found to accept numerous alkyl aryl sulfides as substrates, transforming them to (S)-sulfoxides with high enantioselectivity (95 percent to '99 percent for most sulfides). The formulation as a whole-cell biocatalyst allowed specific production rates of up to 370 U g_cdw^?1 – the highest specific oxygenase activity achieved in whole cells so far – and the preparative synthesis of enantiopure (S)-aryl alkyl sulfoxides. With its extraordinarily high specific activity, high specificity, ease of handling, and high stability (catalyst is stable for '16 days at 4 °C), the designed whole-cell biocatalyst adds enormous value to the portfolio of chemical and biological catalysts for asymmetric sulfoxide synthesis.

Full text of DOI:10.1002/cctc.201901894

Accepted Article
Title: Highly efficient access to (S)-sulfoxides utilizing a promiscuous
flavoprotein monooxygenase in a whole-cell biocatalyst format
Authors: Christian Willrodt, Janosch A.D. Gröning, Philipp Nerke,
Rainhard Koch, Anika Scholtissek, Thomas Heine, Andreas
Schmid, Bruno Bühler, and Dirk Tischler
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemCatChem 10.1002/cctc.201901894
Link to VoR: http://dx.doi.org/10.1002/cctc.201901894
A Journal of
www.chemcatchem.org

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
Highly efficient access to (S)-sulfoxides utilizing a promiscuous
flavoprotein monooxygenase in a whole-cell biocatalyst format
Christian Willrodt,[a,ǂ] Janosch A. D. Gröning,[b,†] Philipp Nerke, Rainhard Koch, Anika Scholtissek,
[a]
[c]
[b]
[b]
[a]
[a]
[b,d]
Thomas Heine, Andreas Schmid, Bruno Bühler,* and Dirk Tischler*
9]
[5]
Abstract: Chiral sulfoxides have gained attention as synthons and
precursors for API synthesis. Flavoproteins such as Baeyer-Villiger or
styrene monooxygenases mainly provide access to (R)-sulfoxides
and often suffer from low selectivity, activity, and/or limited substrate
scope. The flavoprotein monooxygenase AbIMO from Acinetobacter
baylyi ADP1 initiates indole degradation. Here, AbIMO was expressed
recombinantly in E. coli and characterized for its sulfoxidation activity
and substrate spectrum. Next to indole and styrene, AbIMO was found
to accept numerous alkyl aryl sulfides as substrates, transforming
them to (S)-sulfoxides with high enantioselectivity (95.5% to > 99.9%
for most sulfides). The formulation as a whole-cell biocatalyst allowed
resolution of racemates[ or direct asymmetric synthesis. The
latter can be accomplished by the application of chemical[
biological catalysts, with the biocatalysts typically having a
selectivity advantage.[11]
2, 10]
or
A
number of enzymes such as cytochrome P450
monooxygenases,[
12]
Baeyer-Villiger
monooxygenases
(BVMOs),[13, 14] peroxidases,[15] and styrene monooxygenases
(SMOs)[16] among others catalyze regio- and enantioselective
sulfoxidation, which has been pioneered by work on peroxidases
and BVMOs.[
11]
However, (enantio)selectivity, versatility with
respect to the structural diversity of accepted prochiral sulfides,
as well as activity and stability of respective biocatalysts are
properties which often hinder industrial application. Thus,
improving described systems or identifying novel ones is still
necessary. P450pyrI83H from Sphingomonas sp. HXN-200
expressed in E. coli BL21 (DE3) is one of the most promising
biocatalysts described so far and converted sulfides 1, 3, and 9 to
respective (R)-sulfoxides with remarkable enantioselectivities (e.e.
-
1
specific production rates of up to 370 U gcdw – the highest specific
oxygenase activity achieved in whole cells so far – and the preparative
synthesis of enantiopure (S)-aryl alkyl sulfoxides. With its
extraordinarily high specific activity, high specificity, ease of handling,
and high stability (catalyst is stable for > 16 days at 4°C), the designed
whole-cell biocatalyst adds enormous value to the portfolio of
chemical and biological catalysts for asymmetric sulfoxide synthesis.
9
1
9.5, 98.2, and 96.0%, respectively) and specific activities up to
6 U gcdw-
1 [17]
.
For sulfides 2 and 6, however, this biocatalyst
afforded an e.e. of only 61.8 and 66.9% for the (R)-enantiomers,
respectively. A similarly limited substrate scope was observed
Introduction
[17]
with whole cells of Rhodococcus sp. strain ECU066 primarily
producing (S)-sulfoxides at rather low rates (< 1 U gcdw-1).[18] For
Rhodococcus sp. CCZU10-1, a high (S)-selectivity for the
Chiral sulfoxides have gained huge attention as synthons and
precursors for the synthesis of APIs,[1, 2] flavors and fragrances,[3]
or as chiral auxiliaries in chemical syntheses.[4, 5] As the potency
of one enantiomer often outperforms the one of the antipode (e.g.,
shown for esomeprazole),[6-8] enantiopure sulfoxide preparation is
required. This can be achieved by costly and labor intensive
sulfoxidation of sulfides 1 – 4 (e.e. > 99.9%) was reported, but
specific activities remained low (< 1 U gcdw-1, increased up to 6.4
-1
U gcdw upon application of n-octane as second liquid organic
[19]
phase). Recently, an impressive study described asymmetric
sulfoxidation employing an isolated BVMO for the production of
an anti-cancer drug candidate precursor at the kilogram scale.[
The applied BVMO was chosen from a Codexis enzyme library
obtained by directed evolution. This approach is appropriate when
it comes to the synthesis of high-value drug candidates, but is
highly cost intensive as it requires the purification of two enzymes,
one of them for cofactor regeneration. From an economic and
ecological point of view, a universally applicable biocatalyst would
be desirable featuring high specific activity and operational
stability, cost-efficient catalyst formulation, and high
enantioselectivity (> 99%) for a broad set of prochiral sulfides.
Group E flavoproteins are promising candidates for efficient and
14]
[
a]
Dr. C. Willrodt ZEICHEN, P. Nerke, Prof. Dr. A. Schmid, Prof. Dr. B.
Bühler *
Department Solar Materials, Helmholtz Center for Environmental
Research GmbH – UFZ
Permoser Str. 15, 04138 Leipzig, Germany
E-mail: bruno.buehler@ufz.de
Present address: BASF SE, Carl-Bosch-Straße 38, 67063
Ludwigshafen am Rhein, Germany
J.A.D. Gröning,† Dr. A. Scholtissek, Dr. T. Heine
Environmental Microbiology Group, Institute of Biosciences, TU
Bergakademie Freiberg
Leipziger Str. 29, 09599 Freiberg, Germany
Present address: Institut für Mikrobiologie, Universität Stuttgart,
Allmandring 31, 70569 Stuttgart, Germany
Dr. R. Koch
Engineering and Technology, Bayer AG
Kaiser-Wilhelm Allee 3, 51373 Leverkusen, Germany
Asst. Prof. Dr. D. Tischler *
Microbial Biotechnology, Ruhr University Bochum
Universitätsstr. 150, 44801 Bochum, Germany
E-mail: dirk.tischler@rub.de
ǂ
[
b]
†
selective sulfoxidation (Scheme 1).[
16,
20-25]
Well-known
[
[
c]
representatives of this group have been shown to initiate the
degradation of styrene by highly stereo- and enantioselective
epoxidation and also to catalyze sulfoxidation reactions, but with
d]
lower activities and enantioselectivites.[
20–22]
However, highly
enantioselective sulfoxidation was found for StyA1-like enzymes
from Rhodococcus opacus 1CP and Variovorax paradoxus
This article is protected by copyright. All rights reserved.

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
EPS[21, 23, 24] belonging to subgroup E2 of these flavoproteins.[25] It
was assumed that they play a role in the degradation of
heterocyclic compounds.[26] Just recently, indole was discovered
as a native substrate for two subgroup E2 oxygenases from
Acinetobacter, which thus can be referred to as indole
monooxygenases (IMOs).[27, 28]
biotransformation were used to calculate the yields and rates
given in Table 1. AbIMO converted most sulfides with a high
enantiomeric excess to respective (S)-sulfoxides except for the
relatively bulky sulfides 7 and 8. The rates calculated for the 2 h
of biotransformation, however, were much lower than initial rates
(within the range of the first 15 min) determined in the same setup
-1
for styrene epoxidation (139 ± 16 U g ) or benzyl methyl sulfide
-1
(
5
10) oxidation (539 ± 102 U g ) with a sampling time of only about
min for these substrates. This activity drop most likely was due
to enzyme deterioration caused by the presence of substrate
and/or product as it has been found for related
monooxygenases.[
24, 29, 34]
[
20-
Scheme 1. Reactions catalysed by group E flavoprotein monooxygenases.
30]
These are two component enzymes composed of a NADH-dependent FAD
reductase (B) and FADH -utilizing monooxygenase (A). The flavin cofactor can
be transferred directly or via diffusion and allows to form a hydroperoxy-FAD
FADOOH) intermediate in the monooxygenase for selective oxygenation of
2
(
substrates to corresponding epoxides or sulfoxides. Chiral centres might be
generated in dependence of the substrate and enzyme employed. Here the
standard substrates styrene, indole and thioanisole are shown.
In this study, we investigated the sulfoxidation potential of a
closely related monooxygenase system from Acinetobacter baylyi
ADP1 (AbIMO, earlier designated as SMOA-ADP1), for which
epoxidation activity has been reported before.[26, 29] First, we
explored the sulfoxidation capability of AbIMO utilizing the purified
enzyme. Styrene and thioanisole (1) were employed as standard
substrates to allow for a comparison with related catalysts. With
promising results in hand, we set out to develop a robust whole-
cell biocatalyst for enantioselective sulfoxidation.
Figure 1. Chemical structures of the (mostly) prochiral sulfides applied in this
study.
Table 1. Biotransformation of styrene and sulfides 1-11 with purified AbIMO.
a]
Conversion [b]
[%]
substrate
Rate [
[
Enantiomeric excess
-
1
[c]
U g ]
[%]
Results and Discussion
styrene
13 ± 1
67 ± 2
58 ± 7
77 ± 1
48 ± 1
82 ± 13
176 ± 7
17 ± 2
<1
9.4
47.8
41.5
54.8
34.1
58.1
100.0
12.4
0.4
(S) 87
(S) >99
(S) 98
(S) >99
(S) 96
(S) 98
(S) >99 [d]
n.d.
In vitro characterization of AbIMO. In order to investigate the
sulfoxidation capability of AbIMO, its monooxygenase component
containing an N-terminal His10-tag was produced recombinantly
in E. coli BL21 (DE3), purified, and assayed with different sulfide
substrates. During cultivation on LB medium, the recombinant
cells developed a dark blue color, which indicated the presence
of an active monooxygenase transforming indole (derived from
tryptophan) to indoxyl with subsequent spontaneous formation of
indigo as reported before for similar oxygenases.[30-32] This fits to
the recent classification of the enzyme as indole monooxygenase
catalyzing the initial step of indole degradation.[25,28,30]
1
2
3
4
5
6
7
8
9
The versatility of AbIMO for sulfoxidation was tested via in vitro
biotransformations of sulfides 1-11 (assays comprised 2 mM
n.d.
2
substrate; Figure 1) providing FADH in excess by adding a flavin
-1
76 ± 5
53.8
(S) 99
reductase component (PfStyB; 28700 U g ) which utilized NADH
to reduce FAD.[33] The product amounts formed within 2 h of
This article is protected by copyright. All rights reserved.

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
employing chemical[2] or biological catalysts such as Baeyer-
1
0
1
127 ± 7
58 ± 7
90.1
41.0
(S) 99
Villiger monooxygenases,[13,
37]
P450 monooxygenases,
peroxygenases, and peroxidases.[12,
1
(S) >99
18, 38, 39]
The specific
sulfoxidation catalysts described so far mainly give access to (R)-
enantiomers at lower rates emphasizing the attractiveness of the
whole-cell biocatalyst reported here.[40] Interestingly, the BVMO
designated 4-hydroxyacetophenone monooxygenase (HAPMO)
has been reported to produce highly pure (S)- and (R)-
enantiomers in dependence of the nature of the sulfide supplied
as substrate.[13] . A whole-cell approach with HAPMO would be
interesting.
Assays were performed in triplicates with a reconstituted enzyme system
comprised of the monooxygenase component of AbIMO and PfStyB.
Reaction mixtures were supplemented with surplus amounts of NADH and
FAD. [a] One unit U corresponds to 1 µmol product formed per min. [b] The
conversion was determined by quantifying product concentrations by HPLC
after 2 h of incubation at 30°C under constant shaking. [c] Mean values are
presented. Enantioselectivity was measured multiple times for each product
and the standard deviation was always less than 2% [d] Only the (S)-
enantiomer was detected.
The high specific production rates achieved with E. coli JM101
Overall, AbIMO was found to be a rather slow and unselective
(
pCom10L:AbIMO) constitute a milestone for the synthesis of
-1
enzyme with respect to styrene epoxidation (vmax 139 U g ,
chiral sulfoxides, but at the same time pose a major challenge for
the microbial metabolism that supplies reduction equivalents in
the form of NADH. NADH is produced by glucose oxidation via
glycolysis and the TCA cycle. By employing flux balance analysis,
Blank et al. estimated a maximum NADH regeneration rate of
-1
biotransformation rate 13.2 U g , (S)-87.1 % ee). In contrast, most
sulfides were converted at substantially higher rates and
enantioselectivities. Based on these promising sulfoxidation
properties, we set out to develop a powerful AbIMO-based whole-
cell system.
-1
-1
~
370 µmol min gcdw for resting E. coli cells metabolizing glucose
Sulfoxidation by means of AbIMO-based whole-cell
biocatalysts. As shown in Table 1, purified AbIMO catalyzes the
bioconversion of prochiral sulfides with a remarkably high
enantioselectivity, but suffers from a decreasing activity limiting
achievable product yields. Furthermore, utilization of isolated
AbIMO not only requires the laborious purification of the
respective two enzyme components, but also costly cofactor
addition or regeneration. Thus, a whole-cell approach was chosen
as a means to develop a stable, highly active, and easily
producible and applicable biocatalyst. A possible complication of
the downstream processing may be overcome via in situ product
removal, e.g., a second liquid organic phase, as shown before for
oxygenase-based whole-cell biocatalysis.[35]
-1
-1
at a typical rate of 2.4 mmol gcdw h . The sulfoxidation rate
achieved for benzyl-methyl sulfide (10) of 370 µmol min-1
-1
g
cdw
thus fully exploits this theoretical metabolic capacity of resting E.
coli cells, given an equimolar stoichiometry of NADH consumption
and sulfoxide production. Higher rates of glucose catabolism, as
a target for metabolic engineering and as achieved with solvent-
tolerant Pseudomonads as host strains,[36] may enable even
higher NADH regeneration rates, further advancing the presented
whole-cell sulfoxidation approach.
A whole-cell biocatalyst expressing the two AbIMO genes under
control of the pLacUV5 promoter was constructed. In resting cell
biotransformations, the resulting heterologous biocatalyst E. coli
JM101 (pCom10L:AbIMO) efficiently oxidized most of the tested
thioanisole derivatives to respective sulfoxides with excellent
enantioselectivity. Extraordinarily high specific activities up to 370
-1
U gcdw were obtained, and the activity pattern among the different
substrates (Figure 2) correlated quite well with the observations
made in in vitro bioconversions. This underlines that AbIMO
qualifies very well for the sulfoxidation of a broad range of
substituted thioanisole derivatives. The very high biocatalyst-
specific sulfoxidation activities obtained via the whole-cell
approach deserve special emphasis. The active enzyme portion
of the biomass was ≤ 10% of the cell dry weight (gcdw). Thus, the
specific enzyme activities obtained in vivo (≥ 3080 U g-1 for
thioanisole oxidation; Figure 2) are approximately one order of
Figure 2. Specific sulfoxide production rates of resting-cell biocatalysts. Product
formation was assessed 5 min after addition of the prochiral sulfide. One U
corresponds to 1 µmol sulfoxide formed per min.
-
magnitude higher than initial activities measured in vitro (539 U g
1
for thioanisole, see also Table 1). Sulfides 1 (thioanisole), 6 (4-
methoxy-phenyl-methyl-sulfide), and 10 (benzyl-methly-sulfide)
-
were converted at biocatalyst-specific rates exceeding 300 U gcdw
(
1
CDW, cell dry weight). These rates substantially exceed the
The relatively bulky sulfides 7 and 8 were oxidized at substantially
-1
highest specific production rates reported so far for oxygenase-
containing whole cells, that is, 180 U gcdw for the oxygenation of
styrene to (S)-styrene oxide.[36]
Moreover, no overoxidation to sulfones was observed, which
poses a common drawback among asymmetric sulfoxidations
lower specific rates of 10.6 and 0.3 U gcdw , respectively.
According to the general similarity of in vitro and in vivo activity
patterns, a higher activity for those bulky sulfides was expected.
Hence, these low activities may, beside enzyme specificity, have
-1
This article is protected by copyright. All rights reserved.

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
been caused by substrate uptake limitation over the cell
membranes. Cell permeabilization with polymyxin B, however, did
not lead to increased rates (Figure S2). Thus, a sulfide uptake
limitation can be excluded. Together with the consistent in vitro
data, this finding indicates that AbIMO hardly converts bulky
sulfides with two phenyl substituents, but efficiently converts a
broad set of thioanisole and benzyl phenyl sulfide derivatives.
Preparative scale in vivo bioconversions provide access to
enantiopure sulfoxides. In order to determine the usefulness of
the whole-cell biocatalyst for preparative sulfoxide synthesis, a 50
mL suspension (100 mM potassium phosphate buffer, pH 7.2,
on the product amount formed (Figures S3, S4, and S5). The isolation yield
relates the amount of product isolated to the amount product formed.
Resting, AbIMO containing E. coli JM101 converted all tested
sulfides (1-6 and 9-11) to respective sulfoxides with enantiomeric
purities exceeding 99% (Table 2), thus being even higher than
those obtained in vitro with purified AbIMO. Often, no second
enantiomer was detected (Fig. S4). These differences typically fall
into the range of limits of detection and standard deviations, which,
depending on the enantiomer separation efficiency accounted for
maximally 2%. However, as in case of sulfoxide 4, a significant
difference among in vivo and in vitro sulfoxidations may indeed
exist. Flavoprotein monooxygenases are well known for the
uncoupling of NADH oxidation from oxygenation leading to the
1.5% (w/v) glucose) of resting AbIMO containing cells were
incubated (30°C, 200 rpm, 2.5 cm amplitude) in a baffled flask and
supplied with 1 mM of the sulfides 1-6 and 9-11. Another 1 mM
sulfide portion was added every 30 min to prevent biocatalyst
limitation and toxification by the sulfide as well as its excessive
evaporation. After 11 successive cycles of substrate
supplementation and conversion (6 h), no remaining prochiral
substrate was detected in either case, indicating high biocatalyst
stability. Whereas the sulfides 1, 6, 9, and 10 were completely
transformed into corresponding sulfoxides (Table 2), only 36 to
formation of
2 2
H O (excellently reviewed by Hollman and
[41]
coworkers ), which is known to oxidize sulfides to racemic
sulfoxides.[
42]
In addition, superoxide might be formed and
destabilize the enzymes in the in vitro assays.[41b] On the one
hand, uncoupling may be less pronounced in the native enzyme
environment in vivo (lower O
2
concentration, high protein
7
9% of the other substrates were converted. The apparently
concentration etc.) and, on the other hand, the efficiency of H O2
2
disproportionation by catalase, which was present both in in vivo
and in in vitro biotransformations, may vary depending on the
enzyme’s environment and its abundance The high specific
activity, stability, and enantiospecificity of the whole-cell
sulfoxidation biocatalyst developed in this study augur well for a
straight forward scale up in high cell density bioreactor setups
giving rise to high product titers and space time yields as it has
been reported for a related group E flavoprotein monooxygenase
catalyzing enantioselective epoxidation.[43-45]
reduced conversion of sulfides 2-5 and especially 11 can be
ascribed to their high volatility and consequent loss via
evaporation. More than 70% of the initially available sulfide 3
evaporated from the reaction medium within 2 h in the absence of
cells or in the presence of E. coli JM101 carrying an empty control
plasmid (Figure S1). Substrate conversion or absorption could be
excluded as control experiments with and without cells gave the
same results. Thus, sulfide conversion efficiency depended on
the rate, at which the sulfide was oxidized, and its volatility.
A typical challenge connected to the application of whole-cell
catalysts is their limited storability and thus complex handling.
This means that cultivation to the desired cell density has to
precede every biotransformation in a timely manner. In order to
evaluate, if a temporal decoupling of biocatalyst production and
biotransformation would be feasible with E. coli JM101
Table 2. Preparative scale whole-cell biotransformations with repeated
substrate addition.
Sulfide
Conversion
%]
Isolation yield
[%]
Enantiomeric excess
[%]
[
(
pCom10L:AbIMO), we investigated its storability by assessing
1
2
3
4
5
6
9
100
79
73
77
51
58
100
60
54
54
98
≥99 (GC)
≥99 (GC)
the sulfoxidation activity of resting cells that were stored under
similar conditions as during biotransformations (2 gcdw L , 30°C,
-1
64
≥99 (GC)
67
≥99 (GC)
52
≥99 (GC)
100
95
>99 (HPLC)
≥99 (GC)
1
0
1
98
≥99 (HPLC)
>99 (HPLC)
1
36
Prochiral sulfide was added every 30 min in 12 portions of 50 µmol each to
the reaction mixture (total volume: 50 mL). Conversion is calculated based
This article is protected by copyright. All rights reserved.

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
2
L
00 rpm, KPi buffer pH 7.4, but no glucose) or at 4°C (~100 gcdw
in the same buffer, no orbital shaking) for different time periods.
rev (GCGGCCGCTTAAGCCACTTTCTGAC) containing NdeI and NotI
restriction sites (underlined) to be introduced adjacent to the amplified
gene. A. baylyi ADP1 freshly cultivated at 30°C on an LB agar plate served
as the source of template DNA. The amplicon was ligated into the vector
pJET1.2 (Thermo Fisher Scientific), and the resulting plasmid was
amplified in E. coli DH5α. The gene was then excised by restriction
digestion with NdeI and NotI and inserted into the of the expression vector
pET16bP cut with the same enzymes. The resulting plasmid pETADP1MO
was transformed into E. coli BL21 (DE3) pLysS and used for expression
purposes.
-1
Whereas the cells stored under biotransformation-like conditions
lost their sulfoxidation activity within 3 days, the cells stored at 4°C
retained more than 50% of their initial sulfoxidation activity after
16 days of storage (Figure 3). The high stability at 4°C
substantially simplifies biocatalyst handling and thus facilitates
the application of this whole-cell biocatalyst in the daily routine of
chemical synthesis.
Figure 3. Relative residual specific activity of resting E. coli JM101
To construct the expression vector for the whole-cell biocatalyst, the
monooxygenase component was amplified from pETADP1MO using the
(
L
pCom10L:AbIMO) during incubation under biotransformation conditions (2 gcdw
-
1
suspension, 30°C, 200 rpm, KPi buffer pH 7.4, no glucose) (○) or at 4°C
primers
PCW111
(5’-
-1
(~100 gcdw
L in the same buffer, no orbital shaking) (●). Initial specific activity
-1
TAGGAACCAGTACTGGAGAATTCCATATGCGTCGTATAGCAATTGTT
G-3’) and PCW108 (5’-ATCCACGCGTAACTTAAGTGC-3’). After DpnI
treatment of the PCR mix, the amplicon was purified from an agarose gel.
The reductase gene was obtained by PCR amplification from
with sulfide 6 was 303.9 ± 0.9 U gcdw (cells incubated at 30°C) and 297.1 ± 2.3
U gcdw (cells stored at 4°C). Error bars result from experiments with cells
-
1
originating from two independent cultivations.
pETADP1SMOB[29]
GGCCGCACTTAAGTTACGCGTGGATAGGAGATATCATATGAATATTA
ATACATCACATG-3’) and PCW110 (5’-
ACGGATCCCGGGCGCGCCAAGCATATGTTATGCACTGAG-
using
the
primers
PCW109
(5’-
Conclusions
In summary, we have developed a promiscuous, selective, stable,
and highly active whole-cell biocatalyst that provides access to
chiral sulfoxides with an excellent enantiomeric purity. The
synthetic applicability of the biocatalyst was demonstrated by
preparative biotransformations affording the sulfoxides at the 100
mg scale. Further reaction engineering efforts are required to
minimize sulfide loss by evaporation. This can be achieved by an
increased biocatalyst concentration and/or a continuous substrate
feeding strategy. The very high specific biocatalyst activity of up
to 370 U gcdw emphasizes the efficiency and benefit of the whole-
cell approach followed and sets a new benchmark in whole-cell
oxygenase catalysis. It will be interesting to investigate, how the
microbial metabolism deals with such a high demand of reduction
equivalents.
CTCTGGATG-3’) (65°C annealing temperature, 40 s elongation time). The
two amplicons were fused using the primers PCW111 and PCW110. PCR
settings were 65°C annealing temperature and 1 min elongation time, and
the primers were added during the denaturation phase of the fourth PCR
cycle. The fusion PCR construct was then recombined with NdeI digested
pCom10lac leading to the expression plasmid pCom10L:AbIMO.[49]
Expression of the heterologous gene in this vector is driven by the IPTG
inducible PlacUV5 promotor. Accuracy of all manipulations was assessed
by sequence analysis.
-1
Bacterial strains and cultivation conditions. E. coli DH5α was used for
cloning purposes and E. coli BL21 (DE3) pLysS or E. coli JM101[50] were
used for AbIMO expression/purification or whole-cell biotransformations,
respectively. E. coli strains were cultivated on solid or liquid LB media with
appropriate antibiotics. For expression/purification purposes, E. coli BL21
(DE3) pLysS was cultivated in 2-fold YPTG medium in order to reach a
high cell density: Freshly cultivated E. coli BL21 (pETADP1MO) cells were
inoculated in 15-ml LB-medium with 100 µg ml-1 ampicillin and 50 µg ml-1
chloramphenicol and incubated overnight at 37°C on a rotary shaker (120
rpm, 3.0 cm amplitude). The overnight culture was used to inoculate 1.5-l
of 2xYPTG-medium with 100 µg ml-1 ampicillin and 50 µg ml-1
chloramphenicol in a 2.8-L Fernbach flask. The culture was grown at 37°C
under constant shaking (120 rpm). When a biomass concentration of ~0.2
Experimental Section
Oligonucleotides and chemicals. Custom synthesized oligonucleotides
were purchased from Eurofins (Ebersberg, Germany). All other chemicals
were obtained from AppliChem (Darmstadt, Germany), Sigma Aldrich
g
cdw L-1 was reached, expression was induced by the addition of 1 mM
(Steinheim, Germany), or Carl Roth (Karlsruhe, Germany).
IPTG. After incubation for another 20 h at 37°C, the cells were harvested
by centrifugation (5.000 x g, 15 min, 4°C), washed with 54 mM Na/K-
phosphate buffer (pH 7.2), and stored at -80°C until further use.
Substrates and Products. All substrates and some products (methyl
phenyl sulfoxide, diphenyl sulfoxide, phenyl vinyl sulfoxide) were obtained
from commercial sources (TCI Europe; Sigma Aldrich) at highest available
For whole-cell biotransformation purposes, 5 mL of LB medium were
inoculated with frozen glycerol stocks of E. coli JM101 (pCom10L:AbIMO)
and incubated for 16 h at 30°C (200 rpm, 2.5 cm amplitude). Five hundred
µL from this culture were used to inoculate 50 mL M9 medium
supplemented with 0.5% (w/v) glucose and 50 µg mL kanamycin in a 250
mL baffled Erlenmeyer flask.[51] After overnight incubation at 30°C, this
culture was used to inoculate an identical cultivation setup to an OD450 of
purity. The other sulfoxides were synthesized by a protocol described
earlier,[46] with batches of 7 mmol sulfide in 100 ml methanol serving as the
starting material. Products obtained were dried with anhydrous
magnesium sulfate. Success of chemical sulfoxidation was controlled by
GC-MS as described elsewhere.[47]
-
1
Generation of AbIMO expression vectors. Cloning of genes was
performed by restriction/ligation or in vitro assembly.[48] Reagents were
obtained from Thermo Fisher Scientific (Waltham, MA). Phusion high
fidelity or DreamTaq polymerases were used according to the
manufacturer`s instructions. The indole monooxygenase gene was
amplified from the chromosome of A. baylyi ADP1 using 50 pmol of the
primers ADP1-MO-fw (CATATGCGTCGTATAGCAATTG) and ADP1-MO-
0
.2. Gene expression was induced in the early exponential phase (OD450
between 0.6 and 0.8) and incubation was continued according to the
desired induction time.
Protein purification. Biomass was thawed and resuspended in buffer A
(10 mM Tris-HCl, pH 7.5, 500 mM NaCl). Then, cells were disrupted by 3
passages through a chilled French Press at maximum pressure. Soluble
This article is protected by copyright. All rights reserved.

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
protein was obtained in the supernatant after centrifugation at 20,000 x g
and 4°C for 1 h and applied to Ni-chelate chromatography with buffer A as
solvent phase, followed by elution with an imidazole (500 mM) containing
buffer as described elsewhere.[33] Then, purified enzyme was precipitated
and washed in 80% ammonium sulfate to remove the imidazole prior to
solubilization in the final storage buffer (10 mM Tris-HCl, pH 7.5, 50% [v/v]
glycerol) and storage at -20°C. The protein concentration of batches
obtained was assayed according to the Bradford method using bovine
serum albumin as the standard.[52] Enzyme purity was controlled by means
of SDS-PAGE.[53]
Isolation of enantiopure sulfoxides. Isolation of the biocatalytically
produced sulfoxides was initiated by clarification of the reaction mixture via
centrifugation (3,900 g, 15 min). Portions of 20 mL were extracted 4 times
with 5 mL dichloromethane. After phase separation, the emulsion-like
interphases were combined and extracted once again with 5 mL
dichloromethane. The combined organic phases were dried over
anhydrous Na SO , and the solvent was removed under reduced pressure
2 4
(850 mbar, 60°C, 120 rpm). Solvent evaporation was considered complete
when a constant weight was achieved.
Product analysis. The conversion of styrene to styrene oxide as well as
the enantiomeric configuration of the product were monitored by HPLC as
described previously.[34] For validation, commercial standards (Sigma
Aldrich, Steinheim, Germany) were applied.
2
For the in situ provision of the reduced flavin cofactor (FADH ) required for
oxygenase catalysis, the flavin reductase PfStyB was produced and
assayed as described earlier.[33]
Enzyme assay and in vitro biotransformation. A typical oxygenase
assay mixture of 250 µL contained 10 mM Tris-HCl (pH 7.5), 5% (v/v)
glycerol, PfStyB at an at least 2-fold molar excess over AbIMO, 37.5 µmol
formate, excess formate dehydrogenase, excess catalase, 43.8 nmol
NADH, 12.5 nmol FAD, and 2 mM substrate (added via a 100 mM stock
solution in ethanol). It was placed in a 3 mL glass vial sealed with a Teflon
coated septum, which was continuously shaken in a thermo-shaker at 750
rpm and 30°C. The reaction was started by adding an appropriate amount
of enzyme AbIMO. Samples (10µl) were taken by means of a glass syringe
and the reaction immediately stopped by mixing the sample with a 1:1-mix
of ice cold acetonitrile and methanol (20µl). Then, samples were
centrifuged (10,000 x g; 10 min) and applied to RP-HPLC analytics as
described before.[34] For initial rate determination with the substrates
styrene and 10, sampling was done in the linear range of product formation
in a time range from 0 to 15 min, depending on the substrate. Afterwards,
the reaction rate decreased. Biotransformations with purified enzyme were
performed similarly with one sampling after 2 h.
In vitro conversions of sulfides were analyzed by means of a Dionex
UltiMate 3000 HPLC system (Thermo Fisher Scientific) equipped with a
DAD detector and a non-polar C18 reverse-phase column (Vertex Plus
Eurospher 100-5, 4 x 125 mm, 5 µm particle size, Knauer, Berlin,
Germany). Analytes were eluted at room temperature in a gradient of 40
to 90% methanol in water at a flow of 0.7 ml min-1 and detected at 210
nm.[33, 34] Ten µl of samples (from stopped enzyme assays, diluted with
methanol if necessary) were injected, and authentic standards were
employed to calibrate the system. The enantiopurity of products was
analyzed by means of chiral GC (see below).
In vivo conversions were analyzed using the same HPLC system equipped
with a C18 column (Accucore C18, 3 x 150 mm, 2.6 µm particle size,
Thermo Fisher Scientific). Two µL of sample were injected, and analytes
were eluted at 30°C with a mixture of 80% 10 mM ammonium phosphate
buffer and 20% ACN for 6 min, followed by a gradient to 90% ACN (6-18
min) and detected at 210 nm. Sample preparation for analytical standards
was performed as follows: 5 µL of 100-fold concentrated isopropanol stock
solutions of sulfides or sulfoxides were added to 495 µL potassium
phosphate buffer (pH 7.4, 0.1 M). Subsequently, 500 µL of a 1:1 (v/v)
mixture of ACN and MeOH were added. After mixing, the sample was
centrifuged and subjected to HPLC analysis.
Resting-cell biotransformations. Resting-cell experiments for the
determination of specific biocatalyst activities were performed with cells
harvested from an exponentially growing M9 culture (see above; typically
4
h after induction). After centrifugation, cells were resuspended to
approximately 0.25 gcdw L-1 in 0.1 M potassium phosphate buffer (pH 7.4)
supplemented with 1.5% (w/v) glucose. Aliquots of 0.75 mL were
distributed in 2 mL reaction tubes and incubated in a thermos-shaker at
The enantiomeric purity of sulfoxides obtained from whole-cell
biotransformations was determined by normal-phase HPLC (6, 10, 11) or
chiral gas chromatography (1, 2, 3, 4, 5, 9). Normal phase HPLC was
performed using a Dionex UltiMate 3000 HPLC system (Thermo Fisher
Scientific) equipped with a chiral Lux Cellulose-3 column (4.6 x 150 mm, 3
µm particle size, Phenomenex, Aschaffenburg, Germany) and a DAD
detector. The oven was set to 25°C and the analytes were eluted by an
isocratic mixture of 80/20% (v/v) n-hexane and isopropanol at 0.8 mL min-
1500 rpm (3 mm amplitude) and 30°C for 10 min. Prochiral sulfides were
added from 100-fold stock solutions in isopropanol to a final concentration
of 2 mM. Reactions were terminated after 5 min by addition of an equal
volume of a methanol/acetonitrile mixture (1:1 v/v) for reverse-phase
HPLC analysis or ethyl acetate for normal-phase HPLC analysis, followed
by centrifugation (17,000 x g, 2 min) for biomass removal. Samples for
normal-phase HPLC analysis were mixed vigorously for 5 min (2000 rpm,
1.
n-Hexane half-saturated with water (by mixing equal volumes of water-
3
mm amplitude) before centrifugation. The specific activities in U gcdw-1,
saturated n-hexane with pure n-hexane) was applied, in order to minimize
retention time shifts. Two µL of respective samples in ethyl acetate (see
above) were injected. Organic compounds were detected at a wavelength
of 210 nm. Chiral GC analysis was performed with a Trace 1310 gas
chromatograph (Thermo Fisher Scientific) equipped with an Astec
CHIRALDEX G-PN capillary GC column (30 m x 0.25 mm, 0.12 μm film
thickness; Sigma-Aldrich). Prior to GC analysis, sulfoxide samples in ethyl
acetate were appropriately diluted in the same solvent and dried over
with 1 U defined as 1 µmol of sulfoxide formed per min, were retrieved
from accumulated product and applied biomass concentrations.
Preparative biocatalysis at the 100 mg scale was performed with resting
cells obtained as described above with the following modification: after
harvest, the cells were resuspended to approximately 100 gcdw L-1 in 0.1 M
potassium phosphate buffer (pH 7.4) and stored overnight (16 h) at 4°C.
Subsequently, the cells were diluted in the same buffer supplemented with
anhydrous Na
2
SO
4
. Oven and inlet temperatures were set to 170 and
1
5
.5% (w/v) glucose to a cell concentration of 2 gcdw L-1 in a total volume of
0 mL (screw-capped baffled Erlenmeyer flask, 1:10 aqueous:gas ratio)
90 °C, respectively. N
2
was used as carrier gas at a column flow rate of
1.5 mL min-1 and a split ratio of 1:7. Separation was conducted for 25 min
and detection of the sulfoxides was achieved with a flame ionization
detector (FID) at 250 °C.
and revived by incubation in a rotary shaker for 30 min at 30°C. Then,
sulfides were supplied as pure compounds to a concentration of 1 mM in
the reaction mixture. This substrate addition was repeated 11 times every
3
0 min giving a total reaction time of 6 h. This procedure prevented
The purified sulfoxides (synthesized from sulfides 1, 2, 3, 4, 5, 6, 9, 10, 11)
were identified by GC-MS analysis on a Trace 1310 Gas chromatography
system coupled to an ISQ LT Single Quadrupole Spectrometer equipped
toxification of the biocatalyst by high sulfide concentrations.
This article is protected by copyright. All rights reserved.

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
with a TG-5MS column (Thermo Fisher Scientific). Prior to analysis,
sulfoxides samples in ethyl acetate were appropriately diluted in the same
[16] a) T. Heine, A. Scholtissek, S. Hofmann, R. Koch, D. Tischler,
ChemCatChem 2019, 11, 1-12; b) J. Nikodinovic-Runic, L. Coulombel,
D. Francuski, N.D. Sharma, D.R. Boyd, R.M. Ferrall, K.E. O'Connor, Appl.
Microbiol. Biotechnol. 2013, 97, 4849–4858.
solvent and dried over anhydrous Na
2 4
SO . GC-MS settings were: inlet
temperature: 90 °C, splitless flow, program: 90 °C (2 min), 90-300 °C
-
1
(
15 °C min ), 300 °C (5 min), ionization mode: EI, ion source temperature:
[17] P. Gao, A. Li, H.H. Lee, D.I.C. Wang, Z. Li, ACS Catal. 2014, 4, 3763–
3771.
180 °C.
[
[
[
18] A.T. Li, J.D. Zhang, J.H. Xu, W.Y. Lu, G.Q. Lin, Appl. Environ. Microbiol.
009, 75, 551–556.
2
19] Y.C. He, C.L. Ma, Z.X. Yang, M. Zhou, Z. Xing, J.T. Ma, H.L. Yu, Appl.
Microbiol. Biotechnol. 2013, 97, 10329–10337.
Acknowledgements
20] M.M.E. Huijbers, S. Montersino, A.H. Westphal, D. Tischler, W.J. van
Berkel, Arch. Biochem. Biophys. 2014, 544, 2–17.
The generous support of the junior research group from the
European Union and the Saxon Government (GETGEOWB;
[21] C.E. Paul, D. Tischler, A. Riedel, T. Heine, N. Itoh, F. Hollmann, ACS
Catal. 2015, 5, 2961–2965.
100101363; SAB 100263733) to AScho, TH and DT is
[
22] F. Hollmann, P.-C. Lin, B. Witholt, A. Schmid, J. Am. Chem. Soc. 2003,
25, 8209–8217.
acknowledged. The authors thank Sarah Hofmann and Stefan R.
Kaschabek for support during analysis and sulfoxide preparation.
CW, PN, ASchm, and BB are grateful for using the facilities of the
Centre for Biocatalysis (MiKat) at the Helmholtz Centre for
Environmental Research-UFZ, supported by the European
Regional Development Funds (EFRE − Europe funds Saxony)
and the Helmholtz Association. The authors thank Ron Stauder
for assistance in analytics.
1
[
23] D. Tischler, R. Kermer, J.A.D. Gröning, S.R. Kaschabek, W.J. van Berkel,
M. Schlömann, J. Bacteriol. 2010, 192, 5220–5227.
[24] D. Tischler, R. Schwabe, L. Siegel, K. Joffroy, S.R. Kaschabek, A.
Scholtissek, T. Heine, Molecules 2018, 23, E809.
[
[
25] a) T. Heine, W.J.H. van Berkel, G. Gassner, K.-H. van Pée, D. Tischler,
Biology 2018, 7,42; b) S. Montersino, D. Tischler, G.T. Gassner, W.J.H.
van Berkel, Adv. Synth. Catal. 2011, 353, 2301–2319.
26] D. Tischler, J.A.D. Gröning, S.R. Kaschabek, M. Schlömann, Appl.
Biochem. Biotechnol. 2012, 167, 931–944.
Keywords: Monooxygenase • Whole-cell biocatalysis •
Flavoprotein • Sulfoxidation • Biotransformation
[27] G.-H. Lin, H.-P. Chen, H.-Y. Shu, PLoS One 2015, 10, e0138798.
[28] M. Sadauskas, J. Vaitekūnas, R. Gasparavičiūtė, R. Meškys, Appl.
Environ. Microbiol. 2017, 83, e01453-17.
[
[
[
[
[
[
[
29] J.A.D. Gröning, S.R. Kaschabek, M. Schlömann, D. Tischler, Arch.
Microbiol. 2014, 196, 829–845.
[
1]
M. Carmen Carreño, G. Hernández-Torres, M. Ribagorda, A. Urbano,
Chem. Commun. 2009, 41, 6129-6144.
30] T. Heine, C. Großmann, S. Hofmann, D. Tischler, Biol. Chem. 2019, 400,
[
[
2]
3]
E. Wojaczyńska, J. Wojaczyński, Chem. Rev. 2010, 110, 4303–4356.
B. Brueckner, S. Wyllie (Eds.), Fruit and vegetable flavour: Recent
advances and future prospects, 1st ed., Woodhead Publishing, Sawston
9
39-950.
31] K.E. O’Connor, A.D.W. Dobson, S. Hartmans, Appl. Environ. Microbiol.
997, 63, 4287–4291.
32] S. Panke, B. Witholt, A. Schmid, M.G. Wubbolts, Appl. Environ. Microbiol.
998, 64, 2032–2043.
1
2008.
[
[
4]
5]
H. Pellissier, Tetrahedron 2006, 62, 5559–5601.
1
J. Han, V.A. Soloshonok, K.D. Klika, J. Drabowicz, A. Wzorek, Chem.
Soc. Rev. 2018, 47, 1307–1350.
33] A. Riedel, T. Heine, A.H. Westphal, C. Conrad, P. Rathsack, W.J.H. van
Berkel, D. Tischler, AMB Express 2015, 5, 30.
[
[
6]
7]
I. Agranat, H. Caner, Drug Discov. Today 1999, 4, 313–321.
I. Agranat, H. Caner, J. Caldwell, Nat. Rev. Drug Discov. 2002, 1, 753–
34] D. Tischler, D. Eulberg, S. Lakner, S.R., Kaschabek, W.J. van Berkel, M.
Schlömann, J. Bacteriol. 2009, 191, 4996–5009.
7
68.
P.B. Kale-Pradhan, H.K. Landry, W.T. Sypula, W.T., Ann. Pharmacother.
002, 36, 655–63.
A. Nemes, D. Szabó, J. Rábai, Tetrahedron: Asymmetry 2017, 28, 1078–
082.
35] a) D.J. Leak, R.A. Sheldon, J.M. Woodley, P. Adlercreutz, Biocatal.
Biotransform. 2009, 27, 1–26; b) M. Schrewe, M.K. Julsing, B. Bühler, A.
Schmid, Chem. Soc. Rev. 2013, 42, 6346–6377.
[
[
[
[
8]
9]
2
[
36] a) J. Volmer, A. Schmid, B. Bühler, Biotechnol. J. 2017, 12, 1600558. b)
J. Volmer, M. Lindmeyer, J. Seipp, A. Schmid, B. Bühler, Biotechnol.
Bioeng. 2019, 116, 1089–1101.
1
10] H.B. Kagan, Asymmetric synthesis of chiral sulfoxides, in: Organosulfur
Chemistry in Asymmetric Synthesis., 2008, pp. 1–30.
[37] M.T. Reetz, F. Daligault, B. Brunner, H. Hinrichs, A. Deege, Angew.
Chemie Int. Ed. 2004, 43, 4078–4081.
11] a) S. Bormann, A. Gomez Baraibar, Y. Ni, D. Holtmann, F. Hollmann,
Catal. Sci. Technol. 2015, 5, 2038–2052; b) S. Colonna, B. Gaggero, G.
Carrea, P. Pasta, Chem. Comm. 1997, 5, 439–440; c) W. Mączka, K.
Wińska, M. Grabarczyk, Catalysts 2018, 8, 624; d) A. Schmid, J.S.
Dordick, B. Hauer, A. Kiener, M. Wubbolts, B. Witholt, Nature 2001, 409,
[38] C. Pinedo-Rivilla, J. Aleu, I.G. Collado, J. Mol. Catal-B: Enzymatic. 2007,
49, 18–23.
[39] G. de Gonzalo, M. Fürst, M. Fraaije, Catalysts 2017, 7, 288.
[40] K. Auclair, V. Polic, Adv. Exp. Med. Biol. 2015, 851, 209–228.
[41] a) D. Holtmann, F. Hollmann, ChemBioChem 2016, 17, 1391–1398; b)
V. Massey, J. Biol. Chem. 1994, 269, 22459-22462.
258–268.
[
[
12] A. Schallmey, G. den Besten, I.G.P. Teune, R.F. Kembaren, D.B.
Janssen, Appl. Microbiol. Biotechnol. 2011, 89, 1475–1485.
[
[
[
[
42] K. Sato, M. Hyodo, M. Aoki, X.Q. Zheng, R. Noyori, Tetrahedron 2001,
13] a) G. De Gonzalo, D.E.T. Pazmiño, G. Ottolina, M.W. Fraaije, G. Carrea,
Tetrahedron: Asymmetry 2006, 17, 130-135; b) A. Rioz-Martínez, G. De
Gonzalo, D.E.T. Pazmiño, M.W. Fraaije, V. Gotor, Eur. J. Org. Chem.
57, 2469–2476.
43] S. Panke, M. Held, M.G. Wubbolts, B. Witholt, A. Schmid, Biotechnol.
Bioeng. 2002, 80, 33–41.
2010, 6409–6416.
44] D. Kuhn, M.A. Kholiq, E. Heinzle, B. Bühler, A. Schmid, Green Chem.
[
[
14] W.R.F. Goundry, B. Adams, H. Benson, J. Demeritt, S. McKown, K.
Mulholland, A. Robertson, P. Siedlecki, P. Tomlin, K, Vare, Org. Process
Res. Dev. 2017, 21, 107–113.
2
010, 12, 815–827.
45] D. Kuhn, M.K. Julsing, E. Heinzle, B. Bühler, Green Chem. 2012, 14,
45–653.
6
15] W. Adam, C. Mock-Knoblauch, C.R. Saha-Möller, J. Org. Chem. 1999,
[
46] Y. Watanabe, T. Numata, S. Oae, Synthesis (Stuttg). 1981, 3, 204–206.
47] J.L. Anderson, J. Ding, R.D. McCulla, W.S. Jenks, D.W. Armstrong, J.
Chromatogr. A 2002, 946, 197–208.
64, 4834–4839.
[
This article is protected by copyright. All rights reserved.

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
[
[
[
48] D.G. Gibson, L. Young, R. Chuang, J.C. Venter, C.A. Hutchison, 3rd,
[51] J. Sambrook, D.W. Russel, Molecular cloning: A laboratory manual, Cold
Spring Harbor, NY, 2001.
H.O. Smith, Nat. Methods 2009, 6, 343–345.
49] M. Lindmeyer, D. Meyer, D. Kuhn, B. Bühler, A. Schmid, J. Ind. Microbiol.
Biotechnol. 2015, 42, 851–866.
[52] M.M. Bradford, Anal. Biochem. 1976, 72, 248–54.
[53] U.K. Laemmli, Nature 1970, 227, 680–685.
50] J. Messing, Recomb. DNA Tech. Bull. (NIH). 1979, 3, 43–48.
This article is protected by copyright. All rights reserved.

ChemCatChem
10.1002/cctc.201901894
FULL PAPER
Entry for the Table of Contents (Please choose one layout)
Layout 1:
FULL PAPER
Flavoprotein monooxygenases are
versatile tools in the field of
biocatalysis. Here, an indole
monooxygenases derived of
Acinetobacter baylyi ADP1 (AbIMO)
was studied regarding
Christian Willrodt, Janosch A. D.
Gröning, Philipp Nerke, Rainhard
Koch, Anika Scholtissek, Thomas
Heine, Andreas Schmid, Bruno
Bühler,* and Dirk Tischler *
enantioselective sulfoxidation. The
enzyme accepts numerous alkyl aryl
sulfides and thus provides access
towards interesting products. It was
possible to formulate it as a stable
and easy to handle whole-cell
biocatalyst with very high activity.
Page No. – Page No.
Highly efficient access to (S)-
sulfoxides utilizing a promiscuous
flavoprotein monooxygenase in a
whole-cell biocatalyst format
This article is protected by copyright. All rights reserved.