Methoxy-Substituted Hydroxychalcone Reduces Biofilm Production, Adhesion and Surface Motility of Acinetobacter baumannii by Inhibiting ompA Gene Expression

Article abstract of DOI:10.1002/cbdv.202000786

An increasing lack of available therapeutic options against Acinetobacter baumannii urged researchers to seek alternative ways to fight this extremely resistant nosocomial pathogen. Targeting its virulence appears to be a promising strategy, as it offers

Full text of DOI:10.1002/cbdv.202000786

Title: Methoxy-Substituted Hydroxychalcone Reduces Biofilm
Production, Adhesion and Surface Motility of Acinetobacter
baumannii by Inhibiting ompA Gene Expression
Authors: Dušan Ušjak, Miroslav Dinić, Katarina Novović, Branka
Ivković, Nenad Filipović, Magdalena Stevanović, and Marina
T Milenković
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: Chem. Biodiversity 10.1002/cbdv.202000786
Link to VoR: https://doi.org/10.1002/cbdv.202000786

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
Methoxy-Substituted Hydroxychalcone Reduces Biofilm Production,
Adhesion and Surface Motility of Acinetobacter baumannii by Inhibiting ompA
Gene Expression
Dušan Ušjak,a Miroslav Dinić,b Katarina Novović,b Branka Ivković,c Nenad Filipović,d Magdalena Stevanović,d
and Marina T. Milenković*,a
a Department of Microbiology and Immunology, University of Belgrade - Faculty of Pharmacy, Vojvode Stepe 450, 11221 Belgrade, Serbia
b Laboratory for Molecular Microbiology, Institute of Molecular Genetics and Genetic Engineering, University of Belgrade, Vojvode Stepe 444/a, 11010
Belgrade, Serbia
c Department of Pharmaceutical Chemistry, University of Belgrade - Faculty of Pharmacy, Vojvode Stepe 450, 11221 Belgrade, Serbia
d Institute of Technical Sciences of the Serbian Academy of Sciences and Arts, Knez Mihailova 35/IV, 11000 Belgrade, Serbia
* E-mail address for correspondence: marinama@pharmacy.bg.ac.rs
An increasing lack of available therapeutic options against Acinetobacter baumannii urged researchers to seek alternative ways to fight this extremely
resistant nosocomial pathogen. Targeting its virulence appears to be a promising strategy, as it offers considerably reduced selection of resistant mutants.
In this study, we tested antibiofilm potential of four synthetic chalcone derivatives against A. baumannii. Compound that showed the greatest activity was
selected for further evaluation of its antivirulence properties. Real-Time PCR was used to evaluate mRNA expression of biofilm-associated virulence
factor genes (ompA, bap, abaI) in treated A. baumannii strains. Also, we examined virulence properties related to the expression of these genes, such as
fibronectin- and collagen-mediated adhesion, surface motility, and quorum-sensing activity. The results revealed that the expression of all tested genes is
downregulated together with the reduction of adhesion and motility. The conclusion is that 2-methoxy-2’-hydroxychalcone exhibits antivirulence activity
against A. baumannii by inhibiting the expression of ompA and bap genes, which is reflected in reduced biofilm formation, adhesion, and surface motility.
Keywords: Acinetobacter baumannii • chalcones • virulence factors • polymerase chain reaction • gene expression
Introduction
Acinetobacter baumannii is recognized as one of the most troublesome nosocomial pathogens, due to its outstanding ability to rapidly develop
antimicrobial resistance and to persist in wide range of environmental conditions.[1] Extreme tolerance to desiccation and formation of highly recalcitrant
biofilms provide A. baumannii potential to survive for extended periods on hospital surfaces, materials, and medical devices, thus promoting hospital
outbreaks and epidemics.[2] The ever-increasing number of extensively drug-resistant (XDR) isolates, resistant to carbapenems, as well as emergence of
pandrug-resistant (PDR) strains, emphasizes the indisputable need for discovery and development of new therapeutic strategies.[3] One such strategy
that is being investigated deals with targeting of the A. baumannii virulence factors, which provides possibility to disarm pathogens, while minimally
affecting their growth, thereby generating much weaker selection of resistant mutants.[4][5]
Besides the well-known resistance to desiccation and an ability of biofilm formation that mediate the so-called “persist and resist” strategy of virulence,
there are now numerous recognized virulence factors in A. baumannii.[6] These include adherence mechanisms, motility, siderophore-mediated iron
acquisition systems, activities of polysaccharide membrane and outer membrane protein phospholipases, alteration in penicillin-binding proteins (PBPs),
outer membrane vesicles (OMVs), and mechanisms of immune evasion.[7] Of the particular interest is outer membrane protein A (OmpA), the most
abundant protein in outer membrane of A. baumannii, with well-characterized virulence involvement.[8] OmpA promotes bacterial adherence and
invasion, as well as subsequent apoptosis of host epithelial cells, partially by acting as a major fibronectin binding ligand.[9-11] Additionally, this protein
induces the biogenesis of cytotoxic OMVs, thus further enhancing host cell apoptosis.[12][13] Also, OmpA contributes to the resistance, survival, and
persistence of A. baumannii, by promoting immune evasion, biofilm formation, surface motility, and multidrug resistance.[8][14-17] Biofilm-associated
protein (Bap) is another large outer membrane protein that enables formation of fully mature biofilms and increases adherence to human cells,[18][19]
whose inhibition was shown to diminish the virulence potential of A. baumannii.[20] Finally, the quorum-sensing (QS) system in A. baumannii, consisting of
auto-inducer synthase (AbaI), acyl-homoserine lactone (AHL) signal molecules, and AbaR receptor,[21] was also shown to influence the expression of
virulence factors such as biofilm formation[22] and surface motility.[16] Moreover, the attenuated virulence in a zebrafish infection model was
demonstrated for abaI deficient mutants.[23]
1
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
Chalcones are natural compounds with simple common chemical scaffold 1,3-diaryl-2-propen-1-one (chalconoide), which can be found in fruits,
vegetables, spices, teas, and other products of some plant species.[24] A wide variety of biological and pharmacological activities of chalcones have been
observed. These include antioxidant properties, anti-inflammatory effects, chemopreventive and cytotoxic activities, anti-hyperglycemic and
hypolipidemic activities, cardioprotective and neuroprotective effects, antibacterial, antifungal, antiviral, and antiparasitic activities, and many others.[25-
27]
In addition to natural isolation, chalcones can be obtained by chemical synthesis that allows construction of compounds with targeted activity and
minimal side effects.[25][28] In that sense, a variety of synthetic chalcones were screened for antimicrobial activity and lots of them showed great potential
in this respect.[29]
In our recent study, we had demonstrated that among the four differently substituted 2’-hydroxychalcones, 2- methoxy substituted derivative is the most
active in inhibition of bacterial biofilm production.[30] For the purpose of this study, we synthesized two differently substituted 2’-hydroxy-5’-
fluorochalcones and one 2’-hydroxy-4’-methylchalcone, and tested their antibiofilm potential, along with 2-methoxy-2’- hydroxychalcone from previous
study, against A. baumannii. Further, since the biofilm production itself is not associated with A. baumannii virulence, we selected compound that
exhibited greatest antibiofilm activity for examination of its influence on biofilm-related virulence factors. We monitored expression levels of biofilm-
associated virulence factor genes, as well as fibronectin- and collagen-mediated adhesion, surface motility, and QS activity of A. baumannii strains
treated with the selected chalcone compound. Also, we examined crystallinity and thermal properties of this compound to get better insights into its
stability, solubility, and bioavailability.
Results
Synthesis
Compounds 1-4 were obtained by base-catalyzed Claisen-Schmidt condensation (Scheme 1) in the form of yellow colored powders. Structures were
1
verified by Fourier-transform infrared (FTIR), H NMR, 13C NMR and 19F NMR spectroscopy techniques, and high-resolution electrospray ionization mass
spectrometry (HR-ESI-MS). NMR spectra are provided in Supporting information.
O
R3
R3
R5
R2
R2
R1
O
H
O
60% NaOH
C2H5OH/rt
+
R4
R1
CH3
OH R5
R4
1: 89.05%
2: 62.49%
3: 85.06%
4: 93.15%
2
-H
-F
-Cl
-H
-Cl
3
-H
-F
-CF3
-H
-H
4
-CH3
-H
-CH3
-F
1
-H
R1
R2
R3
R4
R5
-H
-OCH3
-H
-H
-H
Scheme 1. Synthesis of compounds 1-4.
Antibiofilm Activity of Compounds 1-4
Compounds 1-4 were screened for antibiofilm activity against A. baumannii reference strain and wound isolate at concentration of 70 μg ml-1
(Supplementary Figure S1). Significant activity against A. baumannii ATCC 19606 was exhibited by compounds 1, 2, and 4. However, only compound 1
significantly inhibited production of biofilm in A. baumannii wound isolate. Subsequently, we selected compound 1 for further examination of crystallinity,
thermal characteristics, and biofilm-associated virulence factor genes expression. Also, we evaluated its biofilm inhibitory activity at 35 μg ml-1 and 10 μg
ml-1, and revealed dose-dependent influence (Figure 3A). Whereas, concentration of 35 μg ml-1 still yielded significant biofilm inhibition in both strains,
concentration of 10 μg ml-1 had little effect.
Crystallinity and Thermal Properties of Compound 1
To further examine the structure and properties of compound 1, we employed X-ray diffraction (XRD), microscopy, and thermal analyses. Based on the
numerous sharp peaks, observed from the XRD pattern (Figure 1B), the sample possesses a highly crystalline nature which is also confirmed by optical
microscopy (Figure 1A). The most intense reflections of the incident beam were detected at the following 2θ angles: 26.25 and 24.85 along with a triplet in
the interval 14.05-15.4. Regarding the investigation of thermal stability, based on the data obtained from thermogravimetric differential thermal analysis
(TGA/DTA; Figure 1C), it can be concluded that the sample is stable up to 250 °C, after which it goes through the rapid weight loss of about 90%. The
combustion of remaining decomposition products took place at around 490 °C, which could be also noticed as a big exothermic peak on the DTA signal.
2
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
Differential scanning calorimetry (DSC) further revealed that two endothermic events took place (Figure 1D). The first one has a substantially lower
intensity and the second one clearly represents the melting of the sample with a detected melting temperature of 101.4 °C. The first peak occurs around
66 °C and it could be attributed to the removal of adsorbed moisture. However, the TGA signal did not record any weight loss in this region, thus it is
possible that this peak corresponds to some structural changes and arrangement of molecular conformation. The molecular conformation of chalcone is
influenced by the intramolecular forces, and based on the composition of the sample presented here, results obtained from FTIR spectroscopy, and XRD,
there is more than one conformation present in the sample.
Figure 1. Crystallinity and thermal properties of compound 1. (A) Microscopic and macroscopic evaluation, (B) XRD, (C) TGA/DTA, (D) DSC.
The Expression of ompA, bap, and abaI Genes is Downregulated by Compound 1
The mRNA expression, influenced by compound 1 at decreasing sub-minimum inhibitory concentrations (sub-MICs) from 70 to 10 μg ml-1, was
investigated for several biofilm-associated virulence factor genes of A. baumannii (Figure 2). Remarkably, all the tested genes exhibited significant
downregulation of the expression by all tested concentrations. The mRNA level of ompA, which encodes a protein involved in numerous virulence-
associated traits of A. baumannii, was dose-dependently decreased in both tested strains. Most notably, 1.58-fold and 1.85-fold downregulation was
achieved at concentration of 70 μg ml-1 in strains ATCC 19606 and 766, respectively. Interestingly, the reduction of mRNA level of Bap-encoding gene was
greater when using lower concentrations. In particular, its expression was almost twofold reduced in A. baumannii ATCC 19606 by compound 1 at 10 μg
ml-1. Finally, mRNA expression of abaI, a gene that encodes auto-inducer synthase, an essential component of A. baumannii QS system, was decreased in
A. baumannii ATCC 19606, but also in a reverse dose-dependent manner. The expression of this gene was not detected in strain 766.
3
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
Figure 2. The mRNA expression of ompA, bap, and abaI genes in A. baumannii treated with different concentrations of compound 1. Data are presented as mean values of three
experiments (± SD). *P < 0.05, **P < 0.01, ***P < 0.001 compared to the control group.
Compound 1 Inhibits Fibronectin- and Collagen-Mediated Binding of A. baumannii
The adherence ability of A. baumannii strains treated with compound 1 was evaluated through fibronectin- and collagen-binding affinity. A. baumannii
ATCC 19606 exhibited much higher binding affinity to both of these extracellular matrix (ECM) proteins, in comparison to the wound isolate (Figures 3B
and 3C). Strikingly, the cells of the standard strain were almost completely deprived of the binding ability to both fibronectin and collagen, when
incubated in the presence of compound 1 at70 μg ml-1. The binding affinity of this strain was substantially reduced by compound 1 at other two tested
concentrations as well. In case of A. baumannii 766, however, only the collagen-binding affinity was significantly reduced by compound 1 at all tested sub-
MICs.
Figure 3. Comparisons between control and treated groups of A. baumannii ATCC 19606 and A. baumannii 766. (A) Biofilm production, represented as OD values of the
extracted safranin dye at 490 nm, (B) Fibronectin- and (C) Collagen-binding ability represented as the percentage of bound bacterial cells, (D) AHL production, measured as OD
values of dark brown colored ferric hydroxamate complexes at 520 nm. Data are presented as mean values of three experiments (± SD). *P < 0.05, **P < 0.01, ***P < 0.001
compared to the control group.
Surface Motility of A. baumannii Wound Isolate is Inhibited by Compound 1
Surface motility was not exhibited by A. baumannii ATCC 19606, thus only A. baumannii 766 was used for the evaluation of antimotility activity of
compound 1. The surface motility of A. baumannii 766 was considerably inhibited by compound 1 at 70 μg ml-1 and 35 μg ml-1, while the lowest tested
concentration had no effect, since the surface of entire plate was covered as in the case of untreated control (Figure 4). Comparison of migration areas
revealed that the treatment with 70 μg ml-1 resulted in 150.16 mm2 of covered surface area, which is less compared to the extent of migration exhibited by
bacteria treated with 35 μg ml-1 (229.94 mm2), indicating the existence of dose-dependent activity.
4
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
Figure 4. Surface motility of A. baumannii 766 treated with decreasing sub-MICs of compound 1 compared to untreated control.
Compound 1 Reduces AHL Secretion in A. baumannii ATCC 19606
Since the expression of AbaI-encoding gene was not detected in A. baumannii wound isolate, we evaluated the influence of compound 1 on AHL
production only in strain ATCC 19606. The results revealed that the production is reduced by compound 1, at all tested concentrations, in a dose-
dependent manner (Figure 3D). However, significant reduction was achieved only with 70 μg ml-1, which inhibited AHL secretion by 36.22%.
A. baumannii Growth is not Affected by Tested Sub-MICs of Compound 1
In order to demonstrate that investigated sub-MICs (70 μg ml-1, 35 μg ml-1, and 10 μg ml-1) of compound 1 do not affect A. baumannii growth, we
measured bacterial cell growth at five different time points. According to constructed growth curves (Supplementary Figure S2), it can be concluded that
tested concentrations do not inhibit A. baumannii growth. Subsequently, it is reasonable to consider that potential inhibition of virulence by compound 1
will not enhance selection of resistant mutants, i.e. compound 1 at selected concentrations is an appropriate antivirulence drug candidate.
Discussion
So far, myriad of chalcone structures have displayed efficient antibacterial activities against both Gram-positive and Gram-negative species (aerobic or
anaerobic), Mycobacterium tuberculosis, and other resilient genera.[29][31] Besides the substantially efficient growth inhibition activities, with MICs reaching
the values below 1 μg ml-1 in some cases,[32][33] several antivirulence properties of chalcones have also been documented, including the inhibition of biofilm
formation, glycocalyx production, motility, and adhesion,[30][34][35] the quorum-quenching activity,[36] inhibition of certain genes’ expression and bacterial
toxin production,[37] and inhibition of the efflux pumps.[38-40]
Biofilm formation in A. baumannii is responsible for colonization of abiotic and biotic surfaces, including medical devices and host tissues, thus enabling
the persistence and spreading of infection in hospital settings.[6][15] Besides, increased resistance or tolerance of biofilm-associated A. baumannii cells to
antimicrobial drugs, including carbapenems, aminoglycosides, and colistin, has been documented in several studies.[41-43] Also, A. baumannii biofilm
formation was shown to contribute to the immune evasion,[44] and could be related to several other virulence properties, perhaps at the level of gene
expression. Earlier, we demonstrated that a synthetic 2-methoxy substituted 2’-hydroxychalcone has the greatest antibiofilm activity in comparison to
other tested variously substituted 2’-hydroxychalcones.[30] For the purpose of this study we synthesized three new chalcones (compounds 2-4) and
compared their antibiofilm activity to that of 2-methoxy-2’-hydroxychalcone (compound 1). One of the newly-synthesized compounds was derivative of
2’-hydroxy-4’-methylchalcone, while the remaining two were derivatives of 2’-hydroxy-5’-fluorochalcone. Still, the best activity was exhibited by 2-
methoxy-2’-hydroxychalcone, possibly due to the presence of methoxy group, considering that potentiating effect of methoxy group on antibiofilm
activity is known from some previous studies.[45][46] We therefore selected this compound for further investigation of its antivirulence properties. To
demonstrate that this chalcone is not just a potent antibiofilm agent, we tested its influence on several important biofilm-associated virulence factor
genes of A. baumannii. All of the tested biofilm-associated genes exhibited significant downregulation, however, the most notable finding is significant
inhibition of ompA gene expression. As described previously, OmpA is a protein which can induce adherence and invasion of bacteria to human epithelial
cells, and trigger host cell apoptosis, promote antimicrobial resistance, inhibit the alternative complement pathway, and induce the biogenesis of
cytotoxic OMVs, biofilm formation, and surface motility.[1][8] The combination of these features results in a strain that is much more virulent and
associated with higher morbidity and mortality rates in infected patients. Recent study has demonstrated that bacteremic or non-bacteremic pneumonia-
causing strains express much higher levels of ompA compared to colonizing non-pathogenic strains. Multivariate analysis, performed within latter study,
further showed that ompA expression is an independent risk factor for pneumonia, bacteremia, and mortality in A. baumannii infected patients.
Additionally, the same study demonstrated a substantial role of OmpA in mortality and dissemination of infection in a murine peritoneal sepsis model.[47]
In order to demonstrate the potential ompA-dependent antivirulence activity of compound 1, we decided to further evaluate phenotypic features
associated with this gene, such as adhesion and motility. ECM proteins are important mediators in bacterial adhesion to host tissues, and A. baumannii
5
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
displays high affinity binding to these proteins, including fibronectin and collagen.[48] Furthermore, it was shown that OmpA plays a significant role in
fibronectin-mediated adhesion.[11] Therefore, we tested fibronectin- and collagen-mediated binding affinity of A. baumannii, and found that it is
considerably reduced by compound 1. Only the fibronectin binding of A. baumannii wound isolate was not significantly affected, most likely due to
generally weaker ECM-binding affinity exhibited by this strain. Fibronectin-associated antiadherence properties of similar chalcone compounds were
previously demonstrated against methicillin-resistant Staphylococcus aureus (MRSA).[34] Also, comparable results were reported for AOA-2, a cyclic
hexapeptide that was shown to inhibit the adhesion of A. baumannii strain ATCC 17978 to A549 cells. This peptide, also a potent biofilm inhibitor, was
further tested in vivo, in a peritoneal sepsis murine model, where it succeeded to significantly reduce spleen and lung bacterial loads, and to decrease
mortality. Most importantly, the authors have demonstrated that AOA-2 interact with OmpA protein.[49]
Two independent forms of motility have been described in A. baumannii: twitching and surface motility.[6] Although, the role of motility in virulence of A.
baumannii is still not well established, there are some observations that indicate its potential contribution to the increased virulence. For example, a
hypermotile variant of A. baumannii ATCC 17978 strain with disrupted hns-like gene displayed increased virulence potential in the Caenorhabditis elegans
infection model.[50] Similarly, several isolated rifampin-resistant A. baumannii ATCC 17978 rpoB mutants showed defective surface motility and attenuated
phenotype in C. elegans fertility model.[51] According to Clemmer et al.,[16] the expression of ompA is linked to the surface motility of A. baumannii,
therefore we tested the impact of compound 1on this type of motility. Unluckily, A. baumannii ATCC 19606 is a non-motile strain,[52] so it could not be
used for evaluation of antimotility activity. However, surface motility of A. baumannii wound isolate was considerably inhibited by compound 1. The QS
system is also involved in surface motility of A. baumannii, but since the expression of abaI was not detected in wound isolate, it could be assumed that
impaired motility is related to the inhibition of ompA expression. Interestingly, two recent studies showed that honokiol, magnolol, and curcumin, which
are plant products same as chalcones, also co-inhibit biofilm formation and surface motility in A. baumannii ATCC 17978 strain. These studies further
demonstrated increased survival of C. elegans nematodes infected with treated strains in comparison to positive controls. Consequently, these results
provide additional evidence that impaired biofilm formation and surface motility in A. baumannii strains result in reduced virulence in vivo.[53][54]
Finally, since we demonstrated significant downregulation of abaI in A. baumannii ATCC 19606, we decided to test the production of AHLs, signal
molecules that are synthesized by AbaI, as a part of QS system.[21] N-(3-hydroxydodecanoyl)-L-homoserine lactone is so far the only described AHL
molecule in A. baumannii, whose binding to AbaR was shown to contribute to biofilm forming ability and surface motility through the modification of
gene expression. More importantly, some authors have documented its association with virulence.[23][55] Regarding the quorum-quenching ability of
chalcone-related compounds in A. baumannii, i.e. the ability to suppress QS-mediated intercellular communication, Bhargava et al. discovered potent
activity of certain Glycyrrhiza glabra flavonoids.[55] This finding is in agreement with potent quorum-quenching activity of compound 1 against A.
baumannii ATCC 19606, that we observed in this study, however, we could not test its impact on QS system of A. baumannii 766, since the expression of
key QS element AbaI, was not detected by qPCR.
Conclusions
Thus far, we showed that the use of 2-methoxy, 2’-hydroxy substituted chalcone could provide us with a possibility to reduce two key features that make
A. baumannii one of the most problematic pathogens of today, that is, ability to persist and to rapidly develop antimicrobial resistance. By inhibiting its
biofilm production, this compound makes these bacteria vulnerable to a range of exterior agents, whereas attenuation of its virulence substantially
reduces pathogenic infections and severe outcomes without direct activity against its growth, consequently generating much slower selection of resistant
mutants. The fact that the impact of chalcones or related compounds on the expression of A. baumannii key virulence factors have not been studied
earlier, further contributes to the significance of this study. Having described structure and properties of this potential antivirulence agent, we provide
information on its stability, solubility, and bioavailability that could be useful in future investigations, perhaps design of drug formulations for in vivo
studies.
Experimental Section
Materials and Methods
Reagents purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA) were used for synthesis of compounds. Also, 96% (v/v) ethanol, NaOH, HCl, dimethyl
sulfoxide (DMSO), type I recombinant human collagen, Triton X-100, ethyl acetate, and hydroxylamine were purchased from Sigma-Aldrich Inc. Tryptic
soy broth (TSB), agarose, and tryptone were bought from Torlak (Belgrade, Serbia), whereas Mueller-Hinton broth (MHB) and 0.5% safranin were
procured from HiMedia Laboratories Pvt. Ltd. (Mumbai, India). Also, human fibronectin, purchased from Serva (Heidelberg, Germany) was used in this
study. Thin-layer chromatography (TLC) was conducted with silica gel 60 F254 aluminum sheets (Merck, Darmstadt, Germany). FTIR spectra were
recorded on spectrometer Nicolet iS10 (Thermo Fisher Scientific, Waltham, MA, USA), using attenuated total reflectance (ATR) mode. Measurements
6
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
were performed in a spectral range of 400–4000 cm−1 with a resolution of 4 cm-1 and the number of scans was 32. NMR spectra were taken on Bruker 400
spectrometer (Bruker, Billerica, MA, USA), at 400, 100 and 376.46 MHz for 1H, 13C and 19F NMR spectra, respectively, using tetramethylsilane as an internal
standard in deuterated chloroform (CDCl3). The chemical shifts were expressed in ppm and the coupling constants (J) in Hz. Splitting patterns were
designated as singlet (s), doublet (d), triplet (t) and multiplet (m). High-resolution mass spectra were measured by Agilent 6210 Time-of-Flight LC/MS
system (Agilent Technologies, Palo Alto, CA, USA). The microscopy analysis was performed using the OPTICA B-500MET light microscope (Optica SRL,
Ponteranica, Italy). Image was collected in reflective mode with OPTIKAM PRO 8LT - 4083.18 camera equipped with scientific-grade CCD sensor. XRD
from sample powder was obtained on Philips PW 1050 diffractometer (Philips, Eindhoven, The Netherlands) using Cu-Kα radiation (Ni filter). The sample
was scanned in the 2θ range of 10° to 70°, with a scanning step width of 0.05°, and speed of 2 s per step. Thermal analysis was conducted on SETARAM
apparatuses (Caluire-et-Cuire, France), SETSYS evolution TGA/DTA and DSC 131 EVO controlled by CALISTO software. For TGA/DTA sample was placed
in an alumina crucible and heated from room temperature up to 900 °C with a heating rate of 10 °C min-1. The phase transition within the region of
thermal stability was evaluated by DSC. For this purpose accurately weighed sample was hermetically sealed in 30 μl aluminum pans and heated from
30 °C to 150 °C at a rate of 10 °C min-1 in nitrogen gas flow. EZ Read 400 Microplate Reader (Biochrom, Holliston, MA, USA) was used for the
measurement of optical density (OD) values.
General Procedure for the Synthesis of Compounds 1-4
Compounds were synthesized by Claisen-Schmidt condensation of non-substituted (1) or substituted 2-hydroxyacetophenone (2-4) and substituted
benzaldehyde, in the presence of relatively strong base (60% (w/v) NaOH), at room temperature. 2-hydroxyacetophenon (0.012 mol) and benzaldehyde
(0.01 mol) were simultaneously dissolved in 96% (v/v) ethanol (10 ml) with continuous stirring. Resulting colorless solution was supplemented gradually
with 60% (w/v) NaOH in small portions (20 g in total), until the blood-red color was achieved. The solution was then stirred overnight at room
temperature, in order to precipitate the chalcone as orange sodium salt and the resulting mixture was kept at 0 °C for 24 h. Afterwards, the mixture was
diluted with ice water and acidified with cold 1 mol l-1 HCl, gradually until the pH of approx. 3 was reached. The resulting yellow precipitate was then
filtered in vacuum, washed with ice water to a near neutral pH level, and the crude mixture was left to air-dry in dark, after which it was purified by
preparative TLC using the silica gel plates and toluene as eluent. After removal of toluene under vacuum, the crude products recrystallized from ethanol.
(E)-1-(2-hydroxy-5-fluorophenyl)-3-(2,6-dichlorophenyl)-prop-2-en-1-one (2)
1
Yellow crystals, Yield: 62.49%. IR (ATR): 1645.1, 1578.9, 1478.9, 1355.4, 1240.9, 1170.0, 972.3, 850.5, 835.5, 784.1, 722.1, 677.2. H NMR (400 MHz, CDCl3):
12.43 (s, -OH, 1H); 8.02 (d, J=16, a, 1H); 7.75 (d, J=16, b, 1H); 7.51-7.49 (m, ArH-C(6’), 1H); 7.42 (d, J=8, ArH-C(3), ArH-C(5), 2H); 7.26-7.22 (m, ArH-C(4), ArH-
C(4’), 2H); 7.03-6.99 (m, ArH-C(3’), 1H). 13C NMR (100 MHz, CDCl3): 192.90; 159.88; 156.13; 153.76; 139.18; 135.44; 132.04; 130.34; 129.05; 128.34; 124.46;
124,22; 120.00; 119.92; 119.43; 119.37; 114.92; 114.69. 19F NMR (376.46 MHz, CDCl3): δ = −123.78. HRMS (ESI) m/z calcd for C15H9Cl2FO2 [M]+ 311.135 found
311.839.
(E)-1-(2-hydroxy-5-fluorophenyl)-3-(2-trifluoromethylphenyl)-prop-2-en-1-one (3)
Yellow crystals, Yield: 85.06%. IR (ATR): 1644.3, 1586.8, 1574.6, 1484.1, 1351.8, 1286.4, 1238.9, 1099.8, 1061.1, 1034.7, 1015.6, 970.9, 850.8, 771.4, 757.5,
1
719.2, 680.3, 651.1. H NMR (400 MHz, CDCl3): 12.50 (s, -OH, 1H); 8.31 (d, J=15.20, a, 1H); 7.85 (d, J=7.6, ArH-C(6’), 1H); 7.69 (d, J=7.6, ArH-C(3), 1H); 7.66-
7.62 (m, ArH-C(6), 1H); 7.56-7.53 (m, ArH-C(4), ArH-C(5), 2H); 7.49 (d, J=15.20, b, 1H); 7.28-7.23 (m, ArH-C(4’), 1H); 7.03-6.99 (m, ArH-C(3’), 1H). 13C NMR
(100 MHz, CDCl3): 192.47; 159.92; 156.11; 153.74; 141.57; 133.48; 132.22; 130.27; 128.10; 126.51; 126.45; 124.42; 124.19; 123.99; 120.11; 114.74. 19F NMR
(376.46 MHz, CDCl3): δ = −124.00 (-F); δ = −58.78 (-CF3). HRMS (ESI) m/z calcd for C16H10F4O2 [M]+ 310.243 found 311.084.
(E)-1-(2-hydroxy-4-methylphenyl)-3-(2-methyl-4-fluorophenyl)-prop-2-en-1-one (4)
Yellow crystals, Yield: 93.15%. IR (ATR): 3015.3, 1640.7, 1573.2, 1504.2, 1493.9, 1365.5, 1286.9, 1234.9, 1208.3, 1167.9, 1146.06, 975.9, 955.7, 943.8, 849.7,
784.2, 735.1. 1H NMR (400 MHz, CDCl3): 12.79 (s, -OH, 1H); 8.15 (d, J=15.6, a, 1H); 7.79 (d, J=8.4, ArH-C(6’), 1H); 7.71-7.67 (m, ArH-C(6), 1H); 7.51 (d, J=15.2, b,
1H); 6.96-6.93 (m, ArH-C(5), ArH-C(5’), 2H); 6.84 (s, ArH-C(3), 1H); 6.76-6.74 (m, ArH-C(3’), 1H); 2.49 (s, -C(2)-CH3, 3H). 13C NMR (100 MHz, CDCl3): 193.01;
163.17; 163.88; 162.67; 148.17; 141.37; 141.32; 141.24; 130.05; 129.52; 128.61; 128.52; 121.15; 120.21; 118.75; 117.81; 117.60; 113.74; 113.53; 22.00; 19.95. 19
F
NMR (376.46 MHz, CDCl3) δ = −109.90. HRMS (ESI) m/z calcd for C17H15FO2 [M]+ 270.298 found 270.829.
Spectral data of previously published compound 1[30] are provided in Supporting information.
7
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
Bacterial Strains and Growth Conditions
A. baumannii wound isolate (766) obtained from Clinical Medical Center Zvezdara Belgrade and A. baumannii type strain ATCC 19606 (KWIK-STIK™,
Microbiologics Inc., St. Cloud, MN, USA) were used in this study. The wound isolate (766) was initially identified as member of Acinetobacter calcoaceticus-
baumannii (Acb) complex by VITEK® 2 system (bioMérieux, Craponne, France). The strain was later confirmed as A. baumannii on the basis of growth at
44 °C and obtained FTIR spectrum. According to susceptibility testing performed by broth microdilution method and VITEK® 2 system, A. baumannii 766
was classified as XDR, susceptible only to colistin. Both strains were grown in TSB at 37 °C for 24 h prior to experiments.
Growth of A. baumannii strains in MHB supplemented with compound 1 at concentrations of 70 μg ml-1, 35 μg ml-1, and 10 μg ml-1 was monitored at five
different time points (1 h, 3 h, 6 h, 24 h, and 48 h).[56] Cultures were inoculated at an initial optical density at 600 nm (OD600) of 0.04 and incubated at 37 °C.
The growth was followed by determining OD600 values at each time point.
Biofilm Assay
The biofilm production of A. baumannii was tested in the presence of compounds 1-4 at sub-MIC of 70 μg ml-1. Compound that exhibited greatest activity
was further evaluated at concentrations of 35 μg ml-1 and 10 μg ml-1. The samples were prepared by using DMSO at concentrations below 1% (v/v) for
dissolution. TSB supplemented with an additional 1% glucose was used as the growth medium. Briefly, strains, inoculated at approx. 106 CFU ml-1, were
grown in 96-well plates (Sarstedt, Newton, NC, USA) at 37 °C for 24 h. Afterwards, the plates were washed three times with phosphate-buffered saline
(PBS) and then fixated by air-drying at 60 °C for 1 h. Fixed biofilms were then stained with 0.5% safranin for 15 min. Unbounded dye was rinsed off under
running tap water, and the bounded dye extracted with 96% (v/v) ethanol. Finally, ODs were measured at 490 nm.[57]
Quantitative Real-Time PCR
Cultures of A. baumannii in MHB, inoculated at approx. 108 CFU ml-1 and treated with 70 μg ml-1, 35 μg ml-1, and 10 μg ml-1 of compound 1, along with
untreated counterparts, were incubated at 37 °C overnight. Then, the total RNA extraction was performed using RNeasy Mini Kit (Qiagen, Hilden,
Germany) with a modified lysis step.[58] DNase I treatment was performed by an Ambion DNAfree™ Kit (Thermo Fisher Scientific, Cambridge, MA, USA).
Reversed transcription was done using isolated RNA (1 μg) as a template, according to the manufacturer’s protocol (Thermo Scientific, Vilnius, Lithuania).
Random hexamers (Applied Biosystems, Foster City, CA, USA) and RiboLock RNase inhibitor (Thermo Scientific, Vilnius, Lithuania) were used in the
reactions. Quantification of gene transcripts was performed using KAPA SYBR Fast qPCR Kit (KAPA Biosystems, Wilmington, MA, USA) in 7500 Real-
Time PCR 265 system (Applied Biosystems, Foster City, CA, USA) under the following conditions: 3 min at 95 °C activation, 40 cycles of 15 s at 95 °C and
60 s at 60 °C. Normalization was done against the rpoB gene using the 2-ΔΔCt method.[59] Primers used in the study are listed in Table 1. All primers were
purchased from Thermo Scientific.
Table 1. The list of primers used in this study.
Gene
Primer sequence (5'→3')
Reference
TCCGCACGTAAAGTAGGAAC
ATGCCGCCTGAAAAAGTAAC
rpoB
[58]
TCTTGGTGGTCACTTGAAGC
ACTCTTGTGGTTGTGGAGCA
ompA
bap
[59]
[60]
[61]
AATGCACCGGTACTTGATCC
TATTGCCTGCAGGGTCAGTT
CCGCCTTCCTCTAGCAGTCA
AAAACCCGCAGCACGTAATAA
abaI
Fibronectin- and Collagen-Binding Assays
The methods were performed as described earlier with some modifications.[11][64] Wells of the sterile 96-well plates were coated with human fibronectin
(100 μg ml-1) or type I recombinant human collagen (100 μg ml-1) at 4 °C for 16 h. Then the wells were washed three times with PBS and blocked with 2%
(w/v) bovine serum albumin (BSA) in PBS at room temperature for 1 h. Following the removal of BSA, the wells were once more washed three times with
PBS, just before the addition of A. baumannii strains (100 μl), previously grown overnight at 37 °C in MHB (initial inoculum of approx. 108 CFU ml-1), non-
8
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
supplemented or supplemented with compound 1 at 70 μg ml-1, 35 μg ml-1, and 10 μg ml-1. The plates were subsequently incubated at 37 °C for 3 h, after
which non-adherent bacteria were washed out with PBS and the adhered cells collected by adding of sterile PBS supplemented with 0.5% Triton X-100
(125 μl). Serial tenfold dilutions of lysates were then plated onto Luria-Bertani agar (LBA) and incubated at 37 °C for 24 h in order to enumerate the
colonies.
Surface Motility Assay
Surface motility was tested on 0.3% agarose plates, containing 2.5 g l-1 NaCl and 5 g l-1 of tryptone, as described with slight modification.[65] Cultures in
MHB, with an inoculum size of 1.5 x 108 CFU ml-1, treated with 70 μg ml-1, 35 μg ml-1, and 10 μg ml-1 of compound 1, along with untreated control, were
grown at 37 °C to an early stationary phase, after which the freshly prepared plates were point inoculated with bacterial suspensions (2 μl). The plates
were subsequently incubated at 37 °C in dark for 42 h i.e. until the appearance of specific motility patterns. ImageJ 1.52a software (National Institutes of
Health, Bethesda, MA, USA) was used for the calculation of surface areas covered by migrating bacteria.
Colorimetric Quantification of AHLs
AHL production was screened by colorimetric quantification method.[66] The strains, inoculated at 1.5 x 108 CFU ml-1, were grown overnight in MHB (5 ml)
supplemented with compound 1 at 70 μg ml-1, 35 μg ml-1, and 10 μg ml-1. Then the tubes were centrifuged at 5,000 rpm for 15 min, and the cell pellets
were discarded. Supernatants were collected and filtered through a 0.22 μm pore size filters, in order to eliminate cell debris. The filtrates were mixed
with ethyl acetate in 2:1 ratio and vortexed for 10 min, after which the mixtures were left to stand for 5 min. The upper organic portions were recovered,
and the procedure was repeated twice with the remaining lower aqueous portions. Collected organic portions were then dried at 40 °C, and each sample
(160 μl) was transferred into wells of 96-well plates supplemented with 1:1 mixture of 2 M hydroxylamine and 3.5 M NaOH (20 μl), and 1:1 mixture of FeCl3
(10% in 4 M HCl) and 96% (v/v) ethanol (20 μl). The ODs of dark brown colored ferric hydroxamate complexes were then measured at 520 nm.
Statistical Analysis
All experiments were performed at least three times and the results are presented as mean values ± SDs. One-way analysis of variance (ANOVA),
followed by Tukey’s post hoc test was used for comparisons between control and experimental groups. Values for P < 0.05 or less were considered to be
statistically significant. Statistical analysis was carried out and graphs were prepared by using GraphPad Prism 8 software (San Diego, CA, USA).
Supplementary Material
Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/cbdv.202000786.
Acknowledgements
The authors would like to thank Dr. Miloš Petković for recording the NMR spectra.
Author Contribution Statement
Dušan Ušjak collected bacterial strains, performed experiments regarding biofilm production, QS activity, motility, and growth curves, assisted in other
experiments, analyzed the data, and wrote the article. Miroslav Dinić and Katarina Novović performed Real-Time PCR and adhesion assays. Miroslav
Dinić also assisted in study design, data interpretation, and writing of article. Branka Ivković synthesized the compounds. Nenad Filipović and Magdalena
Stevanović performed XRD, microscopy, and thermal analyses. Marina T. Milenković designed the study and supervised the work.
References
[1]
C. R. Lee, J. H. Lee, M. Park, K. S. Park, I. K. Bae, Y. B. Kim, C. J. Cha, B. C. Jeong, S. H. Lee, ‘Biology of Acinetobacter baumannii: Pathogenesis, Antibiotic Resistance
Mechanisms, and Prospective Treatment Options’, Front. Cell. Infect. Microbiol. 2017, 7, 55.
[2]
[3]
M. V. Villegas, A. I. Hartstein, ‘Acinetobacter outbreaks, 1977-2000’, Infect. Control. Hosp. Epidemiol. 2003, 24, 284-295.
B. Isler, Y. Doi, R. A. Bonomo, D. L. Paterson, ‘New Treatment Options against Carbapenem-Resistant Acinetobacter baumannii Infections’, Antimicrob. Agents
Chemother. 2018, 63, e01110-18.
[4]
R. López-Rojas, Y. Smani, J. Pachón, ‘Treating multidrug-resistant Acinetobacter baumannii infection by blocking its virulence factors’, Expert Rev. Anti Infect. Ther. 2013,
11, 231-233.
[5]
[6]
S. W. Dickey, G. Y. C. Cheung, M. Otto, ‘Different drugs for bad bugs: antivirulence strategies in the age of antibiotic resistance’, Nat. Rev. Drug Discov. 2017, 16, 457-471.
C. M. Harding, S. W. Hennon, M. F. Feldman, ‘Uncovering the mechanisms of Acinetobacter baumannii virulence’, Nat. Rev. Microbiol. 2018, 16, 91-102.
9
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
[7]
[8]
[9]
D. Wong, T. B. Nielsen, R. A. Bonomo, P. Pantapalangkoor, B. Luna, B. Spellberg, ‘Clinical and Pathophysiological Overview of Acinetobacter Infections: a Century of
Challenges’, Clin. Microbiol. Rev. 2017, 30, 409-447.
M. J. McConnell, L. Actis, J. Pachón, ‘Acinetobacter baumannii: human infections, factors contributing to pathogenesis and animal models’, FEMS Microbiol. Rev. 2013, 37,
130-155.
C. H. Choi, J. S. Lee, Y. C. Lee, T. I. Park, J. C. Lee, ‘Acinetobacter baumannii invades epithelial cells and outer membrane protein A mediates interactions with epithelial
cells’, BMC Microbiol. 2008, 8, 216.
[10] J. S. Lee, C. H. Choi, J. W. Kim, J. C. Lee, ‘Acinetobacter baumannii outer membrane protein A induces dendritic cell death through mitochondrial targeting’, J. Microbiol.
2010, 48, 387-392.
[11]
Y. Smani, M. J. McConnell, J. Pachón, ‘Role of fibronectin in the adhesion of Acinetobacter baumannii to host cells’, PLoS One 2012, 7, e33073.
[12] J. S. Jin, S. O. Kwon, D. C. Moon, M. Gurung, J. H. Lee, S. I. Kim, J. C. Lee, ‘Acinetobacter baumannii secretes cytotoxic outer membrane protein A via outer membrane
vesicles’, PLoS One 2011, 6, e17027.
[13]
D. C. Moon, C. H. Choi, J. H. Lee, C. W. Choi, H. Y. Kim, J. S. Park, S. I. Kim, J. C. Lee, ‘Acinetobacter baumannii outer membrane protein A modulates the biogenesis of
outer membrane vesicles’, J. Microbiol. 2012, 50, 155-160.
[14] S. W. Kim, C. H. Choi, D. C. Moon, J. S. Jin, J. H. Lee, J. H. Shin, J. M. Kim, Y. C. Lee, S. Y. Seol, D. T. Cho, J. C. Lee, ‘Serum resistance of Acinetobacter baumannii through
the binding of factor H to outer membrane proteins’, FEMS Microbiol. Lett. 2009, 301, 224-231.
[15] J. A. Gaddy, A. P. Tomaras, L. A. Actis, ‘The Acinetobacter baumannii 19606 OmpA protein plays a role in biofilm formation on abiotic surfaces and in the interaction of
this pathogen with eukaryotic cells’, Infect. Immun. 2009, 77, 3150-3160.
[16] K. M. Clemmer, R. A. Bonomo, P. N. Rather, ‘Genetic analysis of surface motility in Acinetobacter baumannii’, Microbiology 2011, 157, 2534-2544.
[17]
Y. Smani, A. F{brega, I. Roca, V. S|nchez-Encinales, J. Vila, J. Pachón, ‘Role of OmpA in the multidrug resistance phenotype of Acinetobacter baumannii’, Antimicrob.
Agents Chemother. 2014, 58, 1806-1808.
[18] T. W. Loehfelm, N. R. Luke, A. A. Campagnari, ‘Identification and characterization of an Acinetobacter baumannii biofilm-associated protein’, J. Bacteriol. 2008, 190,
1036-1044.
[19] K. A. Brossard, A. A. Campagnari, ‘The Acinetobacter baumannii biofilm-associated protein plays a role in adherence to human epithelial cells’, Infect. Immun. 2012, 80,
228-233.
[20] Y. Fattahian, I. Rasooli, S. L. Mousavi Gargari, M. R. Rahbar, S. Darvish Alipour Astaneh, J. Amani, ‘Protection against Acinetobacter baumannii infection via its functional
deprivation of biofilm associated protein (Bap)’, Microb. Pathog. 2011, 51, 402-406.
[21] K. Saipriya, C. H. Swathi, K. S. Ratnakar, V. Sritharan, ‘Quorum-sensing system in Acinetobacter baumannii: a potential target for new drug development’, J. Appl.
Microbiol. 2020, 128, 15-27.
[22] C. Niu, K. M. Clemmer, R. A. Bonomo, P. N. Rather, ‘Isolation and characterization of an autoinducer synthase from Acinetobacter baumannii’, J. Bacteriol. 2008, 190,
3386-3392.
[23] M. S. Bhuiyan, F. Ellett, G. L. Murray, X. Kostoulias, G. M. Cerqueira, K. E. Schulze, M. H. Mahamad Maifiah, J. Li, D. J. Creek, G. J. Lieschke, A. Y. Peleg, ‘Acinetobacter
baumannii phenylacetic acid metabolism influences infection outcome through a direct effect on neutrophil chemotaxis’, Proc. Natl. Acad. Sci. USA 2016, 113, 9599-
9604.
[24] Z. Rozmer, P. Perjési, ‘Naturally occurring chalcones and their biological activities’, Phytochem. Rev. 2016, 15, 87-120.
[25] D. I. Batovska, I. T. Todorova, ‘Trends in utilization of the pharmacological potential of chalcones’, Curr. Clin. Pharmacol. 2010, 5, 1-29.
[26] P. Singh, A. Anand, V. Kumar, ‘Recent developments in biological activities of chalcones: a mini review’, Eur. J. Med. Chem. 2014, 85, 758-777.
[27] D. K. Mahapatra, S. K. Bharti, V. Asati, ‘Chalcone scaffolds as anti-infective agents: structural and molecular target perspectives’, Eur. J. Med. Chem. 2015, 101, 496-524.
[28] M. J. Matos, S. Vazquez-Rodriguez, E. Uriarte, L. Santana, ‘Potential pharmacological uses of chalcones: a patent review (from June 2011 - 2014)’, Expert Opin. Ther. Pat.
2015, 25, 351-366.
[29] L. G. Sarbu, L. G. Bahrin, C. Babii, M. Stefan, M. L. Birsa, ‘Synthetic flavonoids with antimicrobial activity: a review’, J. Appl. Microbiol. 2019, 127, 1282-1290.
[30] D. Ušjak, B. Ivković, D. D. Božić, L. Bošković, M. Milenković, ‘Antimicrobial activity of novel chalcones and modulation of virulence factors in hospital strains of
Acinetobacter baumannii and Pseudomonas aeruginosa’, Microb. Pathog. 2019, 131, 186-196.
[31]
M. Xu, P. Wu, F. Shen, J. Ji, K. P. Rakesh, ‘Chalcone derivatives and their antibacterial activities: Current development’, Bioorg. Chem. 2019, 91, 103133.
[32] A. T. Mbaveng, B. Ngameni, V. Kuete, I. K. Simo, P. Ambassa, R. Roy, M. Bezabih, F. X. Etoa, B. T. Ngadjui, B. M. Abegaz, J. J. Meyer, N. Lall, V. P. Beng, ‘Antimicrobial
activity of the crude extracts and five flavonoids from the twigs of Dorstenia barteri (Moraceae)’, J. Ethnopharmacol. 2008, 116, 483-489.
[33]
W. C. Chu, P. Y. Bai, Z. Q. Yang, D. Y. Cui, Y. G. Hua, Y. Yang, Q. Q. Yang, E. Zhang, S. Qin, ‘Synthesis and antibacterial evaluation of novel cationic chalcone derivatives
possessing broad spectrum antibacterial activity’, Eur. J. Med. Chem. 2018, 143, 905-921.
[34] D. D. Bozic, M. Milenkovic, B. Ivkovic, I. Cirkovic, ‘Newly-synthesized chalcones-inhibition of adherence and biofilm formation of methicillin-resistant Staphylococcus
aureus’, Braz. J. Microbiol. 2014, 45, 263-270.
[35]
D. Kunthalert, S. Baothong, P. Khetkam, S. Chokchaisiri, A. Suksamrarn, ‘A chalcone with potent inhibiting activity against biofilm formation by nontypeable
Haemophilus influenzae’, Microbiol. Immunol. 2014, 58, 581-589.
[36] A. J. Martín-Rodríguez, J. C. Ticona, I. A. Jiménez, N. Flores, J. J. Fern|ndez, I. L. Bazzocchi, ‘Flavonoids from Piper delineatum modulate quorum-sensing-regulated
phenotypes in Vibrio harveyi’, Phytochemistry 2015, 117, 98-106.
[37]
L. Wang, R. Yang, B. Yuan, Y. Liu, C. Liu, ‘The antiviral and antimicrobial activities of licorice, a widely-used Chinese herb’, Acta Pharm. Sin. B 2015, 5, 310-315.
[38] T. D. Tran, T. H. Do, N. C. Tran, T. D. Ngo, T. N. Huynh, C. D. Tran, K. M. Thai, ‘Synthesis and anti Methicillin resistant Staphylococcus aureus activity of substituted
chalcones alone and in combination with non-beta-lactam antibiotics’, Bioorg. Med. Chem. Lett. 2012, 22, 4555-4560.
10
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
[39] J. G. Holler, S. B. Christensen, H. C. Slotved, H. B. Rasmussen, A. Gúzman, C. E. Olsen, B. Petersen, P. Mølgaard, ‘Novel inhibitory activity of the Staphylococcus aureus
NorA efflux pump by a kaempferol rhamnoside isolated from Persea lingue Nees’, J. Antimicrob. Chemother. 2012, 67, 1138-1144.
[40] L. K. Omosa, J. O. Midiwo, A. T. Mbaveng, S. B. Tankeo, J. A. Seukep, I. K. Voukeng, J. K. Dzotam, J. Isemeki, S. Derese, R. A. Omolle, T. Efferth, V. Kuete, ‘Antibacterial
activities and structure-activity relationships of a panel of 48 compounds from Kenyan plants against multidrug resistant phenotypes’, Springerplus 2016, 5, 901.
[41] A. M. S. Kumari, A. Routray, D. Yadav, R. Madhavan, ‘Imipenem resistance and biofilm production in Acinetobacter’, Drug Invent. Today 2013, 5, 256-258.
[42] P. Bocanegra-Ibarias, C. Peña-López, A. Camacho-Ortiz, J. Llaca-Díaz, J. Silva-S|nchez, H. Barrios, U. Garza-Ramos, A. M. Rodríguez-Flores, E. Garza-Gonz|lez,
‘Genetic characterisation of drug resistance and clonal dynamics of Acinetobacter baumannii in a hospital setting in Mexico’, Int. J. Antimicrob. Agents 2015, 45, 309-313.
[43] H. A. Kim, S. Y. Ryu, I. Seo, S. I. Suh, M. H. Suh, W. K. Baek, ‘Biofilm Formation and Colistin Susceptibility of Acinetobacter baumannii Isolated from Korean Nosocomial
Samples’, Microb. Drug Resist. 2015, 21, 452-457.
[44] A. de Breij, L. Dijkshoorn, E. Lagendijk, J. van der Meer, A. Koster, G. Bloemberg, R. Wolterbeek, P. van den Broek, P. Nibbering, ‘Do biofilm formation and interactions
with human cells explain the clinical success of Acinetobacter baumannii’, PLoS One 2010, 5, e10732.
[45] J. J. Richards, C. S. Reed, C. Melander, ‘Effects of N-pyrrole substitution on the anti-biofilm activities of oroidin derivatives against Acinetobacter baumannii’, Bioorg. Med.
Chem. Lett. 2008, 18, 4325-4327.
[46] S. Andjouh, Y. Blache, ‘Click-based synthesis of bromotyrosine alkaloid analogs as potential anti-biofilm leads for SAR studies’, Bioorg. Med. Chem. Lett. 2015, 25, 5762-
5766.
[47] V. S|nchez-Encinales, R. Álvarez-Marín, M. E. Pachón-Ib|ñez, F. Fern|ndez-Cuenca, A. Pascual, J. Garnacho-Montero, L. Martínez-Martínez, J. Vila, M. M. Tom|s, J. M.
Cisneros, G. Bou, J. Rodríguez-Baño, J. Pachón, Y. Smani, ‘Overproduction of Outer Membrane Protein A by Acinetobacter baumannii as a Risk Factor for Nosocomial
Pneumonia, Bacteremia, and Mortality Rate Increase’, J. Infect. Dis. 2017, 215, 966-974.
[48] S. Kõljalg, J. Vuopio-Varkila, O. Lyytikäinen, M. Mikelsaar, T. Wadström, ‘Cell surface properties of Acinetobacter baumannii’, APMIS 1996, 104, 659-665.
[49] X. Vila-Farrés, R. Parra-Mill|n, V. S|nchez-Encinales, M. Varese, R. Ayerbe-Algaba, N. Bayó, S. Guardiola, M. E. Pachón-Ib|ñez, M. Kotev, J. García, M. Teixidó, J. Vila, J.
Pachón, E. Giralt, Y. Smani, ‘Combating virulence of Gram-negative bacilli by OmpA inhibition’, Sci. Rep. 2017, 7, 14683.
[50] B. A. Eijkelkamp, U. H. Stroeher, K. A. Hassan, L. D. Elbourne, I. T. Paulsen, M. H. Brown, ‘H-NS plays a role in expression of Acinetobacter baumannii virulence features’,
Infect. Immun. 2013, 81, 2574-2583.
[51] M. Pérez-Varela, J. Corral, J. A. Vallejo, S. Rumbo-Feal, G. Bou, J. Aranda, J. Barbé, ‘Mutations in the β-Subunit of the RNA Polymerase Impair the Surface-Associated
Motility and Virulence of Acinetobacter baumannii’, Infect. Immun. 2017, 85, e00327-17.
[52] C. N. McQueary, L. A. Actis, ‘Acinetobacter baumannii biofilms: variations among strains and correlations with other cell properties’, J. Microbiol. 2011, 49, 243-250.
[53] S. K. Khadke, J. H. Lee, J. T. Woo, J. Lee, ‘Inhibitory Effects of Honokiol and Magnolol on Biofilm Formation by Acinetobacter baumannii’, Biotechnol. Bioproc. E. 2019, 24,
359-365.
[54] C. J. Raorane, J. H. Lee, Y. G. Kim, S. K. Rajasekharan, R. García-Contreras, J. Lee, ‘Antibiofilm and Antivirulence Efficacies of Flavonoids and Curcumin Against
Acinetobacter baumannii’, Front. Microbiol. 2019, 10, 990.
[55] N. Bhargava, S. P. Singh, A. Sharma, P. Sharma, N. Capalash, ‘Attenuation of quorum sensing-mediated virulence of Acinetobacter baumannii by Glycyrrhiza glabra
flavonoids’, Future Microbiol. 2015, 10, 1953-1968.
[56] T. Maeda, R. García-Contreras, M. Pu, L. Sheng, L. R. Garcia, M. Tom|s, T. K. Wood, ‘Quorum quenching quandary: resistance to antivirulence compounds’, The ISME
journal 2012, 6, 493-501.
[57]
S. Stepanović, D. Vuković, V. Hola, G. Di Bonaventura, S. Djukic, I. Ćirković, F. Ruzicka, ‘Quantification of biofilm in microtiter plates: overview of testing conditions and
practical recommendations for assessment of biofilm production by staphylococci’, APMIS 2007, 115, 891-899.
[58] K. Novović, S. Mihajlović, M. Dinić, M. Malešević, M. Miljković, M. Kojić, B. Jovčić, ‘Acinetobacter spp. porin Omp33-36: Classification and transcriptional response to
carbapenems and host cells’, PLoS One 2018, 13, e0201608.
[59] K. J. Livak, T. D. Schmittgen, ‘Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method’, Methods 2001, 25, 402-408.
[60] S. Coyne, N. Rosenfeld, T. Lambert, P. Courvalin, B. Périchon, ‘Overexpression of resistance-nodulation-cell division pump AdeFGH confers multidrug resistance in
Acinetobacter baumannii’, Antimicrob. Agents Chemother. 2010, 54, 4389-4393.
[61] M. J. McConnell, A. Pérez-Ordóñez, P. Pérez-Romero, R. Valencia, J. A. Lepe, I. V|zquez-Barba, J. Pachón, ‘Quantitative real-time PCR for detection of Acinetobacter
baumannii colonization in the hospital environment’, J. Clin. Microbiol. 2012, 50, 1412-1414.
[62] E. De Gregorio, E. Roscetto, V. D. Iula, M. Martinucci, R. Zarrilli, P. P. Di Nocera, M. R. Catania, ‘Development of a real-time PCR assay for the rapid detection of
Acinetobacter baumannii from whole blood samples’, New Microbiol. 2015, 38, 251-257.
[63] G. N. Selasi, A. Nicholas, H. Jeon, S. H. Na, H. I. Kwon, Y. J. Kim, S. T. Heo, M. H. Oh, J. C. Lee, ‘Differences in Biofilm Mass, Expression of Biofilm-Associated Genes, and
Resistance to Desiccation between Epidemic and Sporadic Clones of Carbapenem-Resistant Acinetobacter baumannii Sequence Type 191’, PLoS One 2016, 11, e0162576.
[64] M. Malešević, Z. Vasiljević, A. Sovtić, B. Filipić, K. Novović, M. Kojić, B. Jovčić, ‘Virulence traits associated with Burkholderia cenocepacia ST856 epidemic strain isolated
from cystic fibrosis patients’, Antimicrob. Resist. Infect. Control 2017, 6, 57.
[65] C. M. Harding, E. N. Tracy, M. D. Carruthers, P. N. Rather, L. A. Actis, R. S. Munson Jr, ‘Acinetobacter baumannii strain M2 produces type IV pili which play a role in
natural transformation and twitching motility but not surface-associated motility’, MBio. 2013, 4, e00360-13.
[66] F. Modarresi, O. Azizi, M. R. Shakibaie, M. Motamedifar, E. Mosadegh, S. Mansouri, ‘Iron limitation enhances acyl homoserine lactone (AHL) production and biofilm
formation in clinical isolates of Acinetobacter baumannii’, Virulence 2015, 6, 152-161.
11
This article is protected by copyright. All rights reserved.

10.1002/cbdv.202000786
Chemistry & Biodiversity
Chem. Biodiversity
Entry for the Graphical Illustration
Twitter Text
2-methoxy substituted hydroxychalcone has
a
potential to prevent serious illness in A. baumannii infected patients through
downregulation of bap and most notably ompA gene expression.
12
This article is protected by copyright. All rights reserved.