Targeted Degradation of the Oncogenic Phosphatase SHP2

Article abstract of DOI:10.1021/acs.biochem.1c00377

SHP2 is a protein tyrosine phosphatase that plays a critical role in the full activation of the Ras-MAPK pathway upon stimulation of receptor tyrosine kinases, which are frequently amplified or mutationally activated in human cancer. In addition, activating mutations in SHP2 result in developmental disorders and hematologic malignancies. Several allosteric inhibitors have been developed for SHP2 and are currently in clinical trials. Here, we report the development and evaluation of a SHP2 PROTAC created by conjugating RMC-4550 with pomalidomide using a PEG linker. This molecule is highly selective for SHP2, induces degradation of SHP2 in leukemic cells at submicromolar concentrations, inhibits MAPK signaling, and suppresses cancer cell growth. SHP2 PROTACs serve as an alternative strategy for targeting ERK-dependent cancers and are useful tools alongside allosteric inhibitors for dissecting the mechanisms by which SHP2 exerts its oncogenic activity.

Full text of DOI:10.1021/acs.biochem.1c00377

pubs.acs.org/biochemistry
Article
Targeted Degradation of the Oncogenic Phosphatase SHP2
Vidyasiri Vemulapalli, Katherine A. Donovan, Tom C. M. Seegar, Julia M. Rogers, Munhyung Bae,
Ryan J. Lumpkin, Ruili Cao, Matthew T. Henke, Soumya S. Ray, Eric S. Fischer, Gregory D. Cuny,
and Stephen C. Blacklow*
Cite This: Biochemistry 2021, 60, 2593−2609
Read Online
ACCESS
Metrics & More
Article Recommendations
*
sı Supporting Information
ABSTRACT: SHP2 is a protein tyrosine phosphatase that plays a
critical role in the full activation of the Ras-MAPK pathway upon
stimulation of receptor tyrosine kinases, which are frequently
amplified or mutationally activated in human cancer. In addition,
activating mutations in SHP2 result in developmental disorders
and hematologic malignancies. Several allosteric inhibitors have
been developed for SHP2 and are currently in clinical trials. Here,
we report the development and evaluation of a SHP2 PROTAC
created by conjugating RMC-4550 with pomalidomide using a
PEG linker. This molecule is highly selective for SHP2, induces
degradation of SHP2 in leukemic cells at submicromolar
concentrations, inhibits MAPK signaling, and suppresses cancer
cell growth. SHP2 PROTACs serve as an alternative strategy for
targeting ERK-dependent cancers and are useful tools alongside allosteric inhibitors for dissecting the mechanisms by which SHP2
exerts its oncogenic activity.
he proto-oncogene PTPN11 encodes a cytoplasmic
protein tyrosine phosphatase, SHP2, which is required
Upon engagement of the N-SH2 and C-SH2 domains of SHP2
with tyrosine-phosphorylated signaling proteins, SHP2 activity
is induced, presumably due to an induced conformational
opening that alleviates N-SH2 autoinhibition of the PTP
T
for normal development. SHP2 acts downstream of multiple
receptor tyrosine kinases (RTKs) to exert sustained activation of
the RAS-MAPK signaling cascade. The first oncogenic
phosphatase to be identified, SHP2 is dysregulated in multiple
human diseases, where germline mutations cause the devel-
opmental disorders Noonan and LEOPARD syndromes.
Somatic mutations of SHP2 are found in ∼35% of cases of
juvenile myelomonocytic leukemia (JMML) and are seen
recurrently in myelodysplastic syndrome, in ALL, in AML,
8
domain active site. Cancer mutations typically occur at the
interface between the N-SH2 and PTP domains and, in most
8
cases, activate the phosphatase.
Given the importance of SHP2 in cancer therapy, there have
been a number of efforts to develop SHP2-selective inhibitors.
Early reports described active site-directed competitive
9
,10
inhibitors that had poor selectivity.
More recently, research
1
,2
and even in solid tumors. Oncogenic mutations in SHP2
destabilize the “off” or “auto-inhibited” state of the enzyme and
increase basal activity by shifting the conformational equilibrium
groups at Novartis and Revolution Medicines developed
allosteric inhibitors that are highly selective for SHP2, called
4,11
12
SHP099
and RMC4550, which were both shown to be
3
toward a more open state, which leads to uncontrolled MAPK
effective tool compounds with nanomolar potency and
activation. Reduction of SHP2 activity through genetic knock-
down or allosteric inhibition suppresses RAS-ERK signaling and
inhibits tumor growth, validating SHP2 as a target for cancer
4,12
preclinical activity in RTK- and RAS-driven cancers.
13
Currently, several SHP2 allosteric inhibitors (TNO155,
14
15
16
JAB-3312, RMC-4630, RLY-1971, and ERAS-601) are in
phase I/II clinical trials for the treatment of advanced or
metastatic solid tumors.
4
therapy. Moreover, because SHP2 lies downstream of the T cell
immunoinhibitory receptor PD-1, SHP2 inhibition may also be
a viable strategy for cancer immunotherapy in combination with
5
−7
PD-1 blockade or with other immunomodulatory agents.
Received: June 2, 2021
Revised: August 9, 2021
Published: August 19, 2021
Structurally, SHP2 is composed of two tandem Src homology
(SH2) domains, N-SH2 and C-SH2, followed by a catalytic
protein tyrosine phosphatase (PTP) domain and an unstruc-
tured C-terminal tail. In the basal state, the N-SH2 domain packs
against and sterically occludes the active site of the PTP domain
by inserting a loop into the cleft that inhibits substrate access.
2
©
2021 American Chemical Society
https://doi.org/10.1021/acs.biochem.1c00377
2
593
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Although allosteric SHP2 inhibitors show clinical promise,
recent preclinical studies highlight the potential for the
triturated with n-heptane (100 mL) at 105 °C for 3 h to give the
product tert-butyl 2-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoi-
soindolin-4-yl]oxy}acetate (36.0 g, 90.1 mmol, 88.7% yield,
97.7% purity) as a white solid.
17
emergence of nonmutational mechanisms of resistance. By
acutely depleting the target protein, proteolysis targeting
chimeras (PROTACs) have the potential to overcome such
resistance mechanisms. By degrading the target protein, they
have the additional benefit of eliminating any residual activity of
the target protein associated with the inhibitor-bound state.
Here, we report the development and characterization of a
PROTAC that is highly selective for degradation of SHP2. Our
lead compound consists of a SHP2-binding warhead (RMC-
To a solution of tert-butyl 2-{[2-(2,6-dioxopiperidin-3-yl)-
1,3-dioxoisoindolin-4-yl]oxy}acetate (5.00 g, 12.9 mmol, 1.00
equiv) in EtOAc (2.00 mL) was added HCl/EtOAc (4 M, 45.0
mL, 14.0 equiv). The mixture was stirred at 10 °C for 18 h. The
reaction mixture was concentrated under reduced pressure to
remove the EtOAc. The crude product was triturated with
MTBE (200 mL) at 10 °C for 1 h, filtered, and concentrated
under reduced pressure. To the solid was added deionized water
(100 mL). The residual aqueous solution was lyophilized to give
intermediate 2 (4.00 g, 11.6 mmol, 90.3% yield, 96.6% purity) as
a white solid.
(4-Amino-2,3-dichlorophenyl)methanol (S2-1). To a sol-
ution of methyl 4-amino-2-chlorobenzoate (72.0 g, 387 mmol,
1.00 equiv) in DMF (360 mL) was added NCS (55.0 g, 411
mmol, 1.06 equiv) at 0 °C, and the mixture was stirred at 40 °C
for 24 h. The reaction mixture was poured into water (500 mL),
and a precipitate was formed, filtered, and collected. The crude
product was purified by recrystallization from EtOH (250 mL)
at 80 °C to give methyl 4-amino-2,3-dichlorobenzoate (48.0 g,
4
550) tethered to an IMiD (immunomodulatory drug)
derivative using a PEG linker. By increasing the linker length
of our first-generation PROTAC, we identified a lead compound
that carries out highly selective SHP2 degradation with a low
nanomolar DC , suppresses MAPK signaling, and inhibits
5
0
cancer cell growth. This SHP2-targeting PROTAC will be a
valuable tool for acute depletion of SHP2 in functional studies
and will be a starting point for further development of a SHP2-
targeting PROTAC therapeutic.
MATERIALS AND METHODS
Chemical Synthesis. The compounds reported herein were
synthesized as described below.
■
5
6.2% yield) as a yellow solid (Scheme 2).
To a solution of 4-amino-2,3-dichlorobenzoate (50.0 g, 227
2
-(2,6-Dioxopiperidin-3-yl)-4-hydroxyisoindoline-1,3-
dione (S1-1). A mixture of 3-aminopiperidine-2,6-dione (19.2 g,
16 mmol, 1.00 equiv), 4-hydroxyisobenzofuran-1,3-dione
21.0 g, 128 mmol, 1.10 equiv), and KOAc (34.3 g, 349
mmol, 3.00 equiv) in AcOH (200 mL) was stirred at 120 °C for
h. The reaction mixture was concentrated under reduced
mmol, 1.00 equiv) in THF (500 mL) was added LiAlH (18.0 g,
4
4
°
1
74 mmol, 2.09 equiv) at 0 °C, and the mixture was stirred at 0
C for 2 h. To the mixture were slowly added water (23 mL),
5% NaOH (23 mL), and MgSO (150 g) at 0 °C, and the
1
(
4
mixture was stirred at 10 °C for 15 min, filtered, and
concentrated under reduced pressure to give a residue. The
mixture was triturated with petroleum ether/EtOAc (6/1, 70
mL) at 15 °C for 12 h to give S2-1 (36.0 g, 75.9% yield, 92.1%
purity) as a light yellow solid.
3
pressure to remove the solvent. The residue was diluted with
water (250 mL), filtered, washed with water, and concentrated
under reduced pressure to give 2-(2,6-dioxopiperidin-3-yl)-4-
hydroxyisoindoline-1,3-dione (28.0 g, 101 mmol, 86.7% yield,
Methyl 2-(2,3-Dichloro-4-iodophenyl)acetate (S2-2). To a
9
8.8% purity) as a gray solid (Scheme 1).
solution of S2-1 (34.0 g, 177 mmol, 1.00 equiv) in H O (340
2
mL) and HCl (12 M, 340 mL, 23.0 equiv) was added dropwise a
Scheme 1
solution of NaNO (18.3 g, 265 mmol, 1.50 equiv) in water (34
2
mL) at 0 °C. The mixture was stirred at 0 °C for 30 min. Then a
solution of KI (146 g, 885 mmol, 5.00 equiv) in water (340 mL)
was added dropwise at 0 °C, and the resulting mixture was
stirred at 0 °C for 30 min. The mixture was extracted with
EtOAc (3 × 600 mL). The combined organic phase was washed
with brine and dried over anhydrous Na SO , filtered, and
2
4
concentrated under vacuum to give a residue. The residue was
purified by column chromatography (SiO , petroleum ether/
2
EtOAc from 100/1 to 20/1, R = 0.56) to give (2,3-dichloro-4-
f
iodophenyl)methanol (25.0 g, 46.6% yield) as a yellow solid.
To a solution of (2,3-dichloro-4-iodophenyl)methanol (26.0
g, 85.8 mmol, 1.00 equiv) in DCM (500 mL) and TEA (26.0 g,
257 mmol, 35.8 mL, 3.00 equiv) was added MsCl (13.2 g, 115
mmol, 8.95 mL, 1.35 equiv) at 0 °C. The mixture was stirred at 0
°C for 1 h. The mixture was washed with brine (3 × 300 mL)
and dried over anhydrous Na SO , filtered, and concentrated
2
-{[2-(2,6-Dioxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl]-
oxy}acetic Acid (intermediate 2). To a solution of 2-(2,6-
dioxopiperidin-3-yl)-4-hydroxyisoindoline-1,3-dione (28.0 g,
02 mmol, 1.00 equiv) in DMF (200 mL) were added tert-
1
2
4
butyl 2-bromoacetate (19.9 g, 102 mmol, 15.1 mL, 1.00 equiv),
KI (1.69 g, 10.2 mmol, 0.100 equiv), and K CO (21.2 g, 153
under vacuum to give the corresponding mesylate (31.0 g, 94.7%
yield) as a brown solid. To this material (31.0 g, 81.3 mmol, 1.00
equiv) in EtOH (620 mL) was added a solution of NaCN (6.04
g, 123 mmol, 1.51 equiv) in water (155 mL). The mixture was
stirred at 80 °C for 8 h. The mixture was concentrated under
vacuum to remove EtOH, diluted with water (150 mL), and
extracted with EtOAc (3 × 100 mL). The combined organic
phase was washed with brine (200 mL) and dried over
anhydrous Na SO , filtered, and concentrated under vacuum
2
3
mmol, 1.50 equiv). The mixture was stirred at 20 °C for 18 h.
The reaction mixture was diluted with water (250 mL) and
extracted with EtOAc (3 × 150 mL). The combined organic
layers were washed with saturated NaCl (200 mL), dried over
anhydrous Na SO , filtered, and concentrated under reduced
2
4
pressure to give a residue. The crude product was triturated with
MTBE (200 mL) at 10 °C for 3 h, and then the product was
2
4
2
594
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Scheme 2
to give 2-(2,3-dichloro-4-iodophenyl)acetonitrile (18.0 g, 70.9%
yield) as a light yellow solid.
To a solution of 2-(2,3-dichloro-4-iodophenyl)acetonitrile
1.52 equiv), and DIPEA (1.59 g, 12.3 mmol, 2.14 mL, 5.00
equiv) were taken up into a microwave tube in NMP (10 mL).
The sealed tube was heated at 150 °C for 2 h under microwave.
The mixture was diluted with water (30 mL) and extracted with
EtOAc (3 × 30 mL). The combined organic phase was washed
with brine (50 mL) and dried over anhydrous Na SO , filtered,
(
17.0 g, 54.5 mmol, 1.00 equiv) in MeOH (150 mL) was added
H SO (88.3 g, 900 mmol, 48.0 mL, 16.5 equiv) at 0 °C. The
2
4
mixture was stirred at 70 °C for 12 h. The reaction mixture was
concentrated under reduced pressure to remove MeOH. The
residue was diluted with water (150 mL) and extracted with
EtOAc (2 × 100 mL). The combined organic layers were
washed with brine (200 mL), dried over anhydrous Na SO ,
2
4
and concentrated under vacuum to give a residue. The residue
was purified by column chromatography (SiO , petroleum
2
ether/EtOAc from 10/1 to 1/1, R = 0.33) to give methyl 2-[4-
f
(3-amino-5-{4-[(tert-butoxycarbonyl)amino]-4-methylpiperi-
din-1-yl}pyrazin-2-yl)-2,3-dichlorophenyl]acetate (600 mg,
40.5% yield, 87.3% purity) as a yellow oil.
2
4
filtered, and concentrated under reduced pressure to give S2-2
(
15.0 g, 79.7% yield) as a light yellow solid.
Methyl 2-[4-(3-Amino-5-chloropyrazin-2-yl)-2,3-
dichlorophenyl]acetate (S2-3). A mixture of S2-2 (6.00 g,
7.3 mmol, 1.00 equiv), BPD (4.64 g, 18.2 mmol, 1.05 equiv),
To a solution of methyl 2-[4-(3-amino-5-{4-[(tert-
butoxycarbonyl)amino]-4-methylpiperidin-1-yl}pyrazin-2-yl)-
2,3-dichlorophenyl]acetate (600 mg, 998 μmol, 1.00 equiv) in
1
AcOK (8.54 g, 86.9 mmol, 5.00 equiv), and Pd(dppf)Cl (600
THF (1.5 mL) was added LiAlH (78.5 mg, 2.07 mmol, 2.07
2
4
mg, 920 μmol, 5.29 × 10− equiv) in 1,4-dioxane (60 mL) was
2
equiv). The mixture was stirred at 20 °C for 0.5 h. Next, 0.08 mL
of water and 0.08 mL of 10% aqueous NaOH were added to the
mixture at 0 °C, followed by the addition 0.24 mL of water and
stirred at 80 °C for 1 h under N . The mixture was filtered, and
2
the filtrate was concentrated under vacuum to give a residue.
The residue was purified by column chromatography (SiO2,
petroleum ether/EtOAc from 30/1 to 10/1, R = 0.54, I ) to give
3.00 g of MgSO . The mixture was stirred at 15 °C for 15 min
4
and filtered, and the filtrate was concentrated under vacuum to
give a residue. The residue was purified by column
f
2
methyl 2-[2,3-dichloro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaboro-
lan-2-yl)phenyl]acetate (5.50 g, crude) as a light yellow oil.
A mixture of 3-bromo-6-chloropyrazin-2-amine (1.00 g, 4.80
mmol, 1.00 equiv), methyl 2-[2,3-dichloro-4-(4,4,5,5-tetra-
methyl-1,3,2-dioxaborolan-2-yl)phenyl]acetate (4.97 g, 14.3
chromatography (SiO , petroleum ether/EtOAc from 10/1 to
2
1/1, R = 0.23) to give intermediate 1 (400 mg, 74.0% yield,
f
91.8% purity) as a yellow oil.
3,4-Dichloro-5-[(4-methoxybenzyl)oxy]benzaldehyde (S3-
1). To a solution of 4-methoxybenzyl alcohol (PMBOH, 30.5 g,
221 mmol, 27.5 mL, 1.20 equiv) in THF (450 mL) was added
NaH (10.3 g, 258 mmol, 60% purity, 1.40 equiv) at 25 °C. The
mixture was stirred at 25 °C for 0.5 h. Then 5-bromo-1,2-
dichloro-3-fluorobenzene (45.0 g, 184 mmol, 1.00 equiv) was
added, and the resulting mixture was stirred at 25 °C for 16 h.
The reaction was quenched with 600 mL of saturated aqueous
mmol, 3.00 equiv), Pd(dppf)Cl (175 mg, 239 μmol, 0.05
2
equiv), and K CO (663 mg, 4.80 mmol, 1.00 equiv) in 1,4-
2
3
dioxane (40 mL) was stirred at 110 °C for 2 h. The mixture was
filtered through a pad of Celite, and the filtrate was concentrated
under vacuum to give a residue. The residue was purified by
column chromatography (SiO , petroleum ether/EtOAc from
2
3
0/1 to 1/1, R = 0.23) to give S2-3 (900 mg, 51.3% yield, 94.8%
f
purity) as a yellow solid.
NH Cl, and the mixture extracted with EtOAc (3 × 500 mL).
4
tert-Butyl (1-{6-Amino-5-[2,3-dichloro-4-(2-hydroxyethyl)-
phenyl]pyrazin-2-yl}-4-methylpiperidin-4-yl)carbamate (in-
termediate 1). S2-3 (900 mg, 2.46 mmol, 1.00 equiv), tert-
butyl (4-methylpiperidin-4-yl)carbamate (800 mg, 3.73 mmol,
The combined organic phase was washed with 800 mL of brine
and dried over anhydrous Na SO , filtered, and concentrated
2
4
under vacuum to give a residue. The residue was purified by flash
silica gel chromatography (ISCO; 80.0 g SepaFlash Silica Flash
2
595
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Scheme 3
Column; eluent, 0% to 4% EtOAc/petroleum ether gradient) to
give 5-bromo-1,2-dichloro-3-[(4-methoxybenzyl)oxy]benzene
under vacuum to remove EtOH and extracted with EtOAc (3 ×
200 mL). The combined organic phase was washed with 300 mL
of brine and dried over anhydrous Na SO , filtered, and
(
60.0 g, 89.8% yield) as a white solid (Scheme 3).
To a solution of 5-bromo-1,2-dichloro-3-[(4-methoxy-
2
4
concentrated under vacuum to give a residue. The residue was
benzyl)oxy]benzene (59.0 g, 162 mmol, 1.00 equiv) in THF
600 mL) was added i-PrMgCl·LiCl (1.3 M, 250 mL, 2.00
purified by column chromatography (SiO , petroleum ether/
2
(
EtOAc from 20/1 to 3/1, R = 0.38) to give S3-2 (16.5 g, 54.1%
f
equiv) at 0 °C. The mixture was stirred at 25 °C for 2 h. Then
DMF (35.7 g, 488 mmol, 37.6 mL, 3.00 equiv) was added
dropwise, and the resulting mixture was stirred at 25 °C for 1 h.
The reaction was quenched with 500 mL of saturated aqueous
yield) as a white solid.
Methyl 2-[3,4-Dichloro-5-(4,4,5,5-tetramethyl-1,3,2-dioxa-
borolan-2-yl)phenyl]acetate (S3-3a). To a solution of 2-{3,4-
dichloro-5-[(4-methoxybenzyl)oxy]phenyl}acetonitrile (16.0 g,
49.6 mmol, 1.00 equiv) in MeOH (192 mL) was added H SO
NH Cl and extracted with EtOAc (3 × 400 mL). The combined
4
2
4
organic phase was washed with 500 mL of brine and dried over
(
117 g, 1.20 mol, 64.0 mL, 24.1 equiv) at 0 °C. The mixture was
anhydrous Na SO , filtered, and concentrated under vacuum to
2
4
stirred at 80 °C for 36 h. The mixture was poured into 600 mL of
give a residue. The residue was triturated with 150 mL of
petroleum ether at 25 °C for 8 h and then filtered to afford S3-1
saturated NaHCO and extracted with EtOAc (3 × 300 mL).
3
The combined organic phase was washed with 500 mL of brine
and dried over anhydrous Na SO , filtered, and concentrated
under vacuum to give a residue. The residue was purified by flash
silica gel chromatography (ISCO; 18.0 g SepaFlash Silica Flash
Column; eluent, 0% to 30% EtOAc/petroleum ether gradient; Rf
(
48.0 g, 94.6% yield) as a white solid.
2
2
4
-{3,4-Dichloro-5-[(4-methoxybenzyl)oxy]phenyl}-
acetonitrile (S3-2). To a solution of S3-1 (48.0 g, 154 mmol,
.00 equiv) in THF (500 mL) was added NaBH (11.6 g, 307
1
4
mmol, 2.00 equiv) at 0 °C, and the mixture was stirred at 15 °C
for 1 h. The reaction was quenched with 400 mL of water, and
the mixture extracted with EtOAc (3 × 300 mL). The combined
organic phase was washed with 500 mL of brine and dried over
anhydrous Na SO , filtered, and concentrated under vacuum to
=
0.23) to give methyl 2-(3,4-dichloro-5-hydroxyphenyl)acetate
(
9.30 g, 79.6% yield) as a white solid.
To a solution of methyl 2-(3,4-dichloro-5-hydroxyphenyl)-
acetate (8.20 g, 34.8 mmol, 1.00 equiv) in pyridine (50 mL) was
2
4
added Tf O (10.8 g, 38.3 mmol, 6.33 mL, 1.10 equiv) at 0 °C.
2
give {3,4-dichloro-5-[(4-methoxybenzyl)oxy]phenyl}methanol
The mixture was stirred at 20 °C for 1 h. The reaction mixture
was diluted with 150 mL of EtOAc and washed with 1 N HCl (2
(
46.0 g, 95.2% yield) as a light yellow solid.
To a solution of {3,4-dichloro-5-[(4-methoxybenzyl)oxy]-
×
100 mL). The organic phase was washed with brine (2 × 100
phenyl}methanol (46.0 g, 146 mmol, 1.00 equiv) in Et N (44.5
3
mL) and dried over anhydrous Na SO , filtered, and
g, 440 mmol, 61.3 mL, 3.00 equiv) and DCM (500 mL) was
added MsCl (23.7 g, 207 mmol, 16.0 mL, 1.41 equiv) at 0 °C.
Then the mixture was stirred at 0 °C for 1 h. The reaction
mixture was washed with brine (3 × 400 mL) and dried over
anhydrous Na SO , filtered, and concentrated under vacuum to
2
4
concentrated under vacuum to give the triflate (12.5 g, crude)
as a yellow oil. To a solution of the triflate (12.5 g, 34.0 mmol,
1
.00 equiv) in 1,4-dioxane (130 mL) were added bis-
pinacolato)diboron (BPD, 8.65 g, 34.0 mmol, 1.00 equiv),
Pd(dppf)Cl (2.50 g, 3.42 mmol, 0.10 equiv), and KOAc (10.0
g, 102 mmol, 3.00 equiv) under N . The mixture was stirred at
(
2
4
give the corresponding mesylate (37.0 g, 64.3% yield) as a yellow
oil. To a solution of the mesylate (37.0 g, 94.5 mmol, 1.00 equiv)
in EtOH (740 mL) was added a solution of NaCN (8.59 g, 175
mmol, 1.85 equiv) in water (185 mL) at 25 °C. The mixture was
stirred at 80 °C for 8 h. The reaction mixture was concentrated
2
2
100 °C for 2 h. The mixture was filtered through a pad of Celite,
and the filtrate was concentrated under vacuum to give a residue.
The residue was purified by column chromatography (SiO2,
2
596
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Scheme 4
petroleum ether/EtOAc from 20/1 to 4/1, R = 0.54) to give S3-
245 mmol, 1.00 equiv) in DCM (200 mL) was added Br (43.1
f
2
3
a (15.0 g, crude) as a yellow oil.
Methyl 2-[3-(3-Amino-5-chloropyrazin-2-yl)-4,5-
g, 270 mmol, 13.9 mL, 1.10 equiv) over 30 min at 0 °C. The
mixture was warmed to 15 °C for 16 h. The mixture was washed
with 10% aqueous Na SO (240 mL) and then washed with
dichlorophenyl]acetate (S3-4a). To a solution of S3-3a (14.9
2
3
g, 43.1 mmol, 1.50 equiv) in 1,4-dioxane (160 mL) were added
brine (120 mL). The combined water phase was washed with
DCM (150 mL). The combined organic phase was dried over
anhydrous Na SO , filtered, and concentrated under reduced
3
-bromo-6-chloropyrazin-2-amine (6.00 g, 28.7 mmol, 1.00
equiv), Pd(dppf)Cl (2.11 g, 2.88 mmol, 0.10 equiv), and K PO
2
3
4
2
4
(
13.0 g, 61.2 mmol, 2.13 equiv) under N . The mixture was
pressure to give a residue. The residue was purified by column
2
stirred at 110 °C for 2 h. The reaction mixture was filtered
through a pad of Celite, and the filtrate was concentrated under
vacuum to give a residue. The residue was purified by column
chromatography (SiO , petroleum ether/EtOAc from 100/1 to
2
0/1) to give 4-bromo-2,3-dichlorophenol (25.7 g, 106 mmol,
43.3% yield, 100% purity) as an off-white solid.
chromatography (SiO , petroleum ether/EtOAc from 15/1 to
To a solution of 4-bromo-2,3-dichlorophenol (4.00 g, 16.5
mmol, 1.00 equiv), BPD (5.46 g, 21.5 mmol, 2.53 mL, 1.30
equiv), and AcOK (4.87 g, 49.6 mmol, 3.00 equiv) in 1,4-
2
1
/1; TLC, 2/1 petroleum ether/EtOAc, R = 0.45) to give S3-4a
9.00 g, 90.2% yield) as a yellow solid.
f
(
tert-Butyl (1-{6-Amino-5-[2,3-dichloro-5-(2-hydroxyethyl)-
dioxane (40.0 mL) was added Pd(dppf)Cl ·DCM (1.08 g, 1.32
2
phenyl]pyrazin-2-yl}-4-methylpiperidin-4-yl)carbamate (in-
termediate 3). To a solution of S3-4 (1.20 g, 3.46 mmol, 1.00
equiv) in NMP (10 mL) were added tert-butyl (4-methylpiper-
idin-4-yl)carbamate (840 mg, 3.92 mmol, 1.13 equiv) and
DIPEA (2.24 g, 17.3 mmol, 3.02 mL, 5.00 equiv). The
mmol, 0.08 equiv) under N . The mixture was stirred at 90 °C
2
for 15 h. The reaction mixture was filtered; the residue was
washed with EtOAc (4 × 100 mL), and the filtrate was
concentrated. The residue was purified by column chromatog-
raphy (SiO , petroleum ether/EtOAc from 100/1 to 10/1; TLC,
2
suspension was degassed and purged with N three times and
stirred at 150 °C for 2 h under microwave. The reaction mixture
was diluted with 100 mL of water and extracted with EtOAc (3 ×
5/1 petroleum ether/EtOAc, R = 0.49) to give S3-3b (2.50 g,
8.10 mmol, 49.0% yield, 93.6% purity) as a white solid.
2
f
4-(3-Amino-5-chloropyrazin-2-yl)-2,3-dichlorophenol (S3-
4b). The following reactions were performed twice. To a
solution of 3-bromo-6-chloropyrazin-2-amine (731 mg, 3.51
mmol, 1.00 equiv) and S3-3b (1.30 g, 4.21 mmol, 1.20 equiv) in
water (2.00 mL) and 1,4-dioxane (8.00 mL) were added K PO
6
×
0 mL). The combined organic phase was washed with brine (3
100 mL) and dried over anhydrous Na SO , filtered, and
2
4
concentrated under vacuum to give a residue. The residue was
purified by flash silica gel chromatography (ISCO; 12.0 g
SepaFlash Silica Flash Column; eluent, 0% to 50% EtOAc/
3
4
(2.61 g, 12.3 mmol, 3.50 equiv) and Pd(dppf)Cl (128 mg, 175
2
μmol, 0.05 equiv). The reaction mixture was stirred at 110 °C for
1.5 h. The reaction mixture was filtered and concentrated under
reduced pressure to give a residue. The residue was diluted with
water (10.0 mL) and extracted with EtAcO (2 × 10.0 mL). The
combined organic layers were washed with brine (20.0 mL),
dried over anhydrous Na SO , filtered, and concentrated under
f
2
4
4
,5-dichlorophenyl]acetate (2.50 g, 4.77 mmol, 1.00 equiv) in
reduced pressure to give a residue. The two batches were
combined for purification by prep-HPLC (neutral condition) to
give S3-4b (1.03 g, 3.51 mmol, 78.5% yield, 99.0% purity) as a
yellow solid.
THF (30 mL) was added LiAlH (181 mg, 4.77 mmol, 1.00
equiv) at 0 °C, and the mixture was stirred at 0 °C for 0.5 h. The
reaction was quenched with 0.15 mL of water, 0.15 mL of 15%
4
NaOH, and 0.3 mL of water at 0 °C. Next, 2.00 g of MgSO was
tert-Butyl {1-[6-Amino-5-(2,3-dichloro-4-hydroxyphenyl)-
pyrazin-2-yl]-4-methylpiperidin-4-yl}carbamate (intermedi-
ate 4). S3-4b (1.03 g, 3.51 mmol, 1.00 equiv), tert-butyl (4-
methylpiperidin-4-yl)carbamate (1.13 g, 5.26 mmol, 1.50
equiv), and DIPEA (2.27 g, 17.6 mmol, 3.06 mL, 5.00 equiv)
were taken up into a microwave tube in NMP (10.0 mL). The
sealed tube was heated at 150 °C for 2 h under microwave. The
mixture was partitioned between water (20.0 mL) and EtOAc
4
added. The mixture was stirred at 25 °C for 30 min and then
filtered through a pad of Celite, and the filtrate was concentrated
under vacuum to give a residue. The residue was purified by
reversed-phase HPLC (0.1% formic acid condition) to give
intermediate 3 (650 mg, 27.4% yield) as a yellow foam.
2
,3-Dichloro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-
yl)phenol (S3-3b). To a solution of 2,3-dichlorophenol (40.0 g,
2
597
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
(
20.0 mL). The water phase was separated and washed with
intermediate 5 (450 mg, 888 μmol, 49.6% yield, 92.4% purity) as
a yellow oil.
EtOAc (4 × 20.0 mL). The combined organic phase was washed
with brine (10.0 mL), dried over anhydrous Na SO , filtered,
and concentrated under reduced pressure to give a residue. The
residue was purified by prep-HPLC (neutral condition) to give
intermediate 4 (700 mg, 1.39 mmol, 39.7% yield, 93.3% purity)
as a brown solid.
Synthesis of S9-1c. To a solution of intermediate 1 (100 mg,
184 μmol, 1.00 equiv) in THF (1.5 mL) was added NaH (15.0
mg, 375 μmol, 60% purity, 2.03 equiv) at 0 °C, followed by the
addition of 14-azido-3,6,9,12-tetraoxatetradecyl 4-methylbenze-
nesulfonate (100 mg, 239 μmol, 1.30 equiv). The mixture was
stirred at 60 °C for 3 h. The reaction was quenched with water (2
mL), and the mixture extracted with EtOAc (3 × 2 mL). The
combined organic phase was concentrated under vacuum to give
a residue. The residue was purified by prep-TLC (10/1
dichloromethane/methanol; TLC, 10/1 dichloromethane/
2
4
(
2,3-Dichloro-5-methoxyphenyl)boronic acid (S4-1). To a
solution of 1-bromo-2,3-dichloro-5-methoxybenzene (5.00 g,
9.2 mmol, 1.00 equiv) in THF (100 mL) was added dropwise i-
1
PrMgCl·LiCl (1.30 M, 23.9 mL, 1.62 equiv) at 0 °C under N2.
The mixture was stirred at 0 °C for 1 h. Then trimethyl borate
(
9.95 g, 95.8 mmol, 10.8 mL, 5.00 equiv) was added at 0 °C, and
methanol, R = 0.55) to give tert-butyl (1-{6-amino-5-[4-(17-
f
the mixture stirred for 1 h. Next, HCl (1.00 M, 51.5 mL, 2.69
equiv) was added, and the mixture stirred at 0 °C for 1 h. The
organic phase was separated, filtered, and concentrated under
reduced pressure to give a residue S4-1 (4.90 g, 17.9 mmol,
azido-3,6,9,12,15-pentaoxaheptadecyl)-2,3-dichlorophenyl]-
pyrazin-2-yl}-4-methylpiperidin-4-yl)carbamate (50.0 mg,
34.0% yield, 93.4% purity) as a yellow oil (Scheme 5).
9
3.6% yield, 80.8% purity) as a white solid (Scheme 4).
-(3-Amino-5-chloropyrazin-2-yl)-4,5-dichlorophenol (S4-
). To a mixture of S4-1 (2.00 g, 7.32 mmol, 1.20 equiv), 3-
Scheme 5
3
2
bromo-6-chloropyrazin-2-amine (1.27 g, 6.10 mmol, 1.00
equiv), Pd(PPh ) (564 mg, 488 μmol, 0.080 equiv), and
3
4
Na CO (1.29 g, 12.20 mmol, 2.00 equiv) in toluene (10.0 mL)
2
3
were added water (2.00 mL) and EtOH (4.00 mL). Then the
mixture was degassed and purged with N three times. The
2
mixture was stirred at 100 °C for 16 h under a N atmosphere.
2
The reaction mixture was partitioned between ethyl acetate (100
mL) and water (80.0 mL). The water phase was separated and
washed with ethyl acetate (3 × 100 mL). The combined organic
phase was washed with brine (2 × 60.0 mL), dried over
anhydrous Na SO , filtered, and concentrated under reduced
To a solution of tert-butyl (1-{6-amino-5-[4-(17-azido-
3
2
1
(
°
,6,9,12,15-pentaoxaheptadecyl)-2,3-dichlorophenyl]pyrazin-
-yl}-4-methylpiperidin-4-yl)carbamate (40.0 mg, 50.3 μmol,
.00 equiv) in THF (1 mL) and water (0.3 mL) was added PPh3
13.2 mg, 50.3 μmol, 1.00 equiv). The mixture was stirred at 60
C for 3 h. The mixture was diluted with 5 mL of EtOAc and
washed with 5 mL of brine. The organic phase was concentrated
under vacuum to give a residue. The residue was purified by
prep-TLC (10/1 dichloromethane/methanol; TLC, 10/1
2
4
pressure to give a residue. The residue was purified by column
chromatography (SiO , petroleum ether/EtOAc from 20/1 to
2
3
/1; TLC, 3/1 petroleum ether/EtOAc, R = 0.62) to give 6-
f
chloro-3-(2,3-dichloro-5-methoxyphenyl)pyrazin-2-amine
(
1.70 g, 5.24 mmol, 86.0% yield, 93.9% purity) as a yellow solid.
To a solution of 6-chloro-3-(2,3-dichloro-5-methoxyphenyl)-
pyrazin-2-amine (1.70 g, 5.24 mmol, 1.00 equiv) in DCM (85.0
dichloromethane/methanol, R = 0.11) to give tert-butyl (1-
f
mL) was added dropwise BBr (1 M, 10.5 mL, 2.00 equiv) at
3
{
2
6-amino-5-[4-(17-amino-3,6,9,12,15-pentaoxaheptadecyl)-
,3-dichlorophenyl]pyrazin-2-yl}-4-methylpiperidin-4-yl)-
carbamate (25.0 mg, 69.3% yield) as a yellow oil.
−
78 °C over 1 h. After the addition, the resulting mixture was
stirred at 40 °C for 21 h. The mixture was poured into ice/water
150 mL) and washed with DCM (3 × 100 mL). The combined
(
A mixture of tert-butyl (1-{6-amino-5-[4-(17-amino-
organic phase was washed with brine (100 mL), dried over
3
2
1
,6,9,12,15-pentaoxaheptadecyl)-2,3-dichlorophenyl]pyrazin-
-yl}-4-methylpiperidin-4-yl)carbamate (25.0 mg, 34.9 μmol,
.00 equiv), intermediate 2 (19.3 mg, 52.4 μmol, 1.50 equiv),
HATU (19.9 mg, 52.4 μmol, 1.50 equiv), and DIPEA (13.5 mg,
04 μmol, 18.2 μL, 3.00 equiv) in DMF (1 mL) was stirred at 25
C for 0.5 h. The mixture was acidified to pH ∼6 with 1 M HCl
and purified by prep-HPLC [column, Phenomenex Synergi C18
50 μm × 25 μm × 10 μm; mobile phase, water (0.05% HCl)/
acetonitrile; B%, 48% to 68%, 10 min] and lyophilized to give
tert-butyl (1-{6-amino-5-[2,3-dichloro-4-(1-{[2-(2,6-dioxopi-
peridin-3-yl)-1,3-dioxoisoindolin-4-yl]oxy}-2-oxo-6,9,12,15,18-
pentaoxa-3-azaicosan-20-yl)phenyl}pyrazin-2-yl}-4-methylpi-
peridin-4-yl)carbamate (15.0 mg, 41.6% yield) as a yellow solid.
A mixture of tert-butyl (1-{6-amino-5-[2,3-dichloro-4-(1-{[2-
(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl]oxy}-2-oxo-
6,9,12,15,18-pentaoxa-3-azaicosan-20-yl)phenyl]pyrazin-2-yl}-
4-methylpiperidin-4-yl)carbamate (15.0 mg, 14.5 μmol, 1.00
equiv) in HCl-1,4-dioxane (4 M, 0.2 mL, 54.9 equiv) and EtOAc
(0.2 mL) was stirred at 20 °C for 0.5 h. The mixture was
concentrated under vacuum to give a residue. The residue was
anhydrous Na SO , filtered, and concentrated under reduced
2
4
pressure to give a residue. The residue was purified by prep-
HPLC (TFA condition) to give S4-2 (370 mg, 1.19 mmol,
2
2.7% yield, 93.5% purity) as a yellow solid.
tert-Butyl {1-[6-Amino-5-(2,3-dichloro-5-hydroxyphenyl)-
1
°
pyrazin-2-yl]-4-methylpiperidin-4-yl}carbamate (intermedi-
ate 5). S4-2 (520 mg, 1.79 mmol, 1.00 equiv), tert-butyl (4-
methylpiperidin-4-yl)carbamate (575 mg, 2.68 mmol, 1.50
equiv), and DIPEA (1.16 g, 8.95 mmol, 1.56 mL, 5.00 equiv)
were taken up into a microwave tube in NMP (5.00 mL). The
sealed tube was heated at 150 °C for 2 h under microwave. The
combined mixture was partitioned between water (20.0 mL)
and EtOAc (20.0 mL). The water phase was separated and
washed with EtOAc (4 × 20.0 mL). The combined organic
phase was washed with brine (3 × 10.0 mL), dried over
anhydrous Na SO , filtered, and concentrated under reduced
1
2
4
pressure to give a residue. The residue was purified by column
chromatography (SiO , petroleum ether/EtOAc from 10/1 to
2
1
/1; TLC, 1/1 petroleum ether/EtOAc, R = 0.40) to give
f
2
598
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
purified by prep-HPLC [column, Phenomenex Synergi C18 150
μm × 25 μm × 10 μm; mobile phase, water (0.05% HCl)/
acetonitrile; B%, 22% to 42%, 9.5 min] and lyophilized to give
S9-1c (2.89 mg, 20.3% yield, 95.3% purity) as a yellow solid.
Synthesis of S9-2c. The following reactions were performed
three times. To a solution of intermediate 3 (50.0 mg, 100 μmol,
EtOAc (2.00 mL). The water phase was separated and washed
with EtOAc (2 × 2.00 mL). The combined organic phase was
washed with brine (2 × 2.00 mL), dried over anhydrous Na SO ,
2
4
filtered, and concentrated under reduced pressure to give a
residue. The residue was purified by prep-HPLC [neutral
condition; column, Waters Xbridge 150 mm × 25 mm × 5 μm;
mobile phase, water (10 mM NH HCO )/acetonitrile; B%, 40%
1
.00 equiv) in THF (1 mL) was added NaH (8.06 mg, 201 μmol,
0% purity, 2.00 equiv) at 0 °C, and the mixture was stirred at 40
4
3
6
to 70%, 10 min] to give tert-butyl [1-(6-amino-5-{4-[(17-azido-
3,6,9,12,15-pentaoxaheptadecyl)oxy]-2,3-dichlorophenyl}-
pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate (66.0 mg, 87.1
μmol, 43.7% yield) as a yellow oil.
To a solution of tert-butyl [1-(6-amino-5-{4-[(17-azido-
3,6,9,12,15-pentaoxaheptadecyl)oxy]-2,3-dichlorophenyl}-
pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate (66.0 mg, 87.1
μmol, 1.00 equiv) in THF (1.00 mL) was added 10% Pd/C
°
C for 1 h. 14-Azido-3,6,9,12-tetraoxatetradecyl 4-methylben-
zenesulfonate (45.1 mg, 120 μmol, 1.20 equiv) was added to the
reaction mixture at 0 °C. The resulting mixture was stirred at 55
°
C for 1 h. The reaction was quenched with 10 mL of saturated
NH Cl. The three reaction batches were combined, and the
4
resulting mixture was extracted with EtOAc (3 × 10 mL). The
combined organic phase was washed with 30 mL of brine and
dried over Na SO , filtered, and concentrated under vacuum to
(7.00 mg, 87.1 μmol, 1.00 equiv) under N . The suspension was
2
4
2
give a residue. The residue was purified by reversed-phase
HPLC (0.1% FA condition) to give tert-butyl (1-{6-amino-5-[5-
degassed under vacuum and purged with H several times. The
2
mixture was stirred under H (15 psi) at 15 °C for 2 h. The
2
(
17-azido-3,6,9,12,15-pentaoxaheptadecyl)-2,3-dichloro-
mixture was filtered, and the filtrate was concentrated under
reduced pressure to afford tert-butyl [1-(6-amino-5-{4-[(17-
amino-3,6,9,12,15-pentaoxaheptadecyl)oxy]-2,3-
dichlorophenyl}pyrazin-2-yl)-4-methylpiperidin-4-yl]-
carbamate (63.0 mg, 86.1 μmol, 98.9% yield) as a brown oil,
which was used without further purification.
phenyl]pyrazin-2-yl}-4-methylpiperidin-4-yl)carbamate (60.0
mg, 75.0% purity) as a yellow oil.
A mixture of tert-butyl (1-{6-amino-5-[5-(17-azido-
,6,9,12,15-pentaoxaheptadecyl)-2,3-dichlorophenyl]pyrazin-
-yl}-4-methylpiperidin-4-yl)carbamate (58.0 mg, 78.2 μmol,
3
2
1
.00 equiv) and PPh resin (61.2 mg, 234 μmol, 3.00 equiv) in
To a solution of tert-butyl [1-(6-amino-5-{4-[(17-amino-
3,6,9,12,15-pentaoxaheptadecyl)oxy]-2,3-dichlorophenyl}-
pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate (63.0 mg, 86.1
μmol, 1.00 equiv) and intermediate 2 (49.3 mg, 129 μmol, 1.50
equiv, HCl) in DMF (1.00 mL) were added HATU (39.3 mg,
103 μmol, 1.20 equiv) and DIPEA (50.1 mg, 387 μmol, 67.5 μL,
4.50 equiv). Then the mixture was stirred at 15 °C for 13 h. The
residue was purified by prep-HPLC [neutral condition; column,
Waters Xbridge 150 mm × 25 mm × 5 μm; mobile phase, water
(10 mM NH HCO )/acetonitrile; B%, 32% to 62%, 10 min] to
3
THF (1 mL) and water (0.3 mL) was stirred at 50 °C for 4 h.
The reaction mixture was filtered, and the filtrate was
concentrated under vacuum to give tert-butyl (1-{6-amino-5-
[
5-(17-amino-3,6,9,12,15-pentaoxaheptadecyl)-2,3-dichloro-
phenyl]pyrazin-2-yl}-4-methylpiperidin-4-yl)carbamate (60.0
mg, crude) as a yellow oil.
A mixture of tert-butyl (1-{6-amino-5-[5-(17-amino-
3
2
1
,6,9,12,15-pentaoxaheptadecyl)-2,3-dichlorophenyl]pyrazin-
-yl}-4-methylpiperidin-4-yl)carbamate (60.0 mg, 83.8 μmol,
.00 equiv), intermediate 2 (42.0 mg, 126 μmol, 1.51 equiv),
4
3
give tert-butyl [1-(6-amino-5-{2,3-dichloro-4-[(1-{[2-(2,6-di-
oxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl]oxy}-2-oxo-
6,9,12,15,18-pentaoxa-3-azaicosan-20-yl)oxy]phenyl}pyrazin-
2-yl)-4-methylpiperidin-4-yl]carbamate (77.0 mg, 73.6 μmol,
85.5% yield) as a yellow solid.
EDCI (28.0 mg, 146 μmol, 1.74 equiv), HOBt (21.0 mg, 155
μmol, 1.85 equiv), and DIPEA (43.0 mg, 332 μmol, 3.97 equiv)
in DMF (1 mL) was stirred at 25 °C for 1 h. The reaction
mixture was neutralized with 1 M HCl (in DMF) and purified by
prep-HPLC [column, Phenomenex Synergi C18 150 μm × 25
μm × 10 μm; mobile phase, water (0.05% HCl)/acetonitrile; B
To a solution of compound tert-butyl [1-(6-amino-5-{2,3-
dichloro-4-[(1-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindo-
lin-4-yl]oxy}-2-oxo-6,9,12,15,18-pentaoxa-3-azaicosan-20-yl)-
oxy]phenyl}pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate
(77.0 mg, 73.6 μmol, 1.00 equiv) in EtOAc (0.700 mL) was
added HCl/EtOAc (4 M, 184 μL, 10.0 equiv), and then the
mixture was stirred at 15 °C for 2 h. The mixture was
concentrated under reduced pressure to give a residue. The
residue was purified by prep-HPLC [HCl condition; column,
Phenomenex Synergi C18 150 mm × 30 mm × 4 μm; mobile
phase, water (0.05% HCl)/acetonitrile; B%, 6% to 36%, 10 min]
to give S9-3c (29.5 mg, 29.5 μmol, 40.1% yield, 98.2% purity,
HCl) as a yellow solid.
%, 43% to 63%, 8 min] to give tert-butyl (1-{6-amino-5-[2,3-
dichloro-5-(1-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindo-
lin-4-yl]oxy}-2-oxo-6,9,12,15,18-pentaoxa-3-azaicosan-20-yl)-
phenyl]pyrazin-2-yl}-4-methylpiperidin-4-yl)carbamate (45.0
mg, 52.1% yield) as a yellow solid.
A mixture of tert-butyl (1-{6-amino-5-[2,3-dichloro-5-(1-{[2-
2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl]oxy}-2-oxo-
(
6
4
,9,12,15,18-pentaoxa-3-azaicosan-20-yl)phenyl]pyrazin-2-yl}-
-methylpiperidin-4-yl)carbamate (45.0 mg, 43.6 μmol, 1.00
equiv) in MeOH (0.5 mL) and HCl-1,4-dioxane (4 M, 0.5 mL,
5.7 equiv) was stirred at 25 °C for 0.5 h. The mixture was
4
concentrated under vacuum to give a residue. The residue was
purified by prep-HPLC [column, Phenomenex Synergi C18 150
μm × 25 μm × 10 μm; mobile phase, water (0.05% HCl)/
acetonitrile; B%, 19% to 39%, 6.5 min] to give S9-2c (32.08 mg,
Synthesis of S9-4c. To a solution of intermediate 5 (100 mg,
197 μmol, 1.00 equiv) and 17-azido-3,6,9,12,15-pentaoxahepta-
decyl 4-methylbenzenesulfonate (122 mg, 237 μmol, 1.20
equiv) in DMF (1.00 mL) was added K CO (54.5 mg, 395
2
3
7
7.2% yield, 97.8% purity) as a yellow solid.
μmol, 2.00 equiv). The mixture was stirred at 60 °C for 3 h. The
reaction mixture was partitioned between water (2.00 mL) and
EtOAc (2.00 mL). The water phase was separated and washed
with ethyl acetate (2 × 2.00 mL). The combined organic phase
was washed with brine (2 × 2.00 mL), dried over anhydrous
Na SO , filtered, and concentrated under reduced pressure to
Synthesis of S9-3c. To a solution of intermediate 4 (100 mg,
99 μmol, 1.00 equiv) and 17-azido-3,6,9,12,15-pentaoxahepta-
1
decyl 4-methylbenzenesulfonate (123 mg, 239 μmol, 1.20
equiv) in DMF (0.500 mL) was added K CO (55.1 mg, 398
2
3
μmol, 2.00 equiv). The mixture was stirred at 60 °C for 3 h. The
reaction mixture was partitioned between water (2.00 mL) and
2
4
give a residue. The residue was purified by prep-HPLC [neutral
2
599
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Scheme 6
condition; column, Waters Xbridge 150 mm × 25 mm × 5 μm;
h. The reaction mixture was filtered and concentrated under
reduced pressure to give a residue. The residue was purified by
prep-HPLC [HCl condition; column, Phenomenex Synergi C18
150 μm × 25 μm × 10 μm; mobile phase, water (0.05% HCl)/
acetonitrile; B%, 23% to 43%, 11 min]. S9-4c (33.6 mg, 33.9
μmol, 46.1% yield, 99.1% purity, HCl) was obtained as a yellow
solid.
mobile phase, water (10 mM NH HCO )/acetonitrile; B%, 44%
4
3
to 74%, 10 min]. The product tert-butyl [1-(6-amino-5-{5-[(17-
azido-3,6,9,12,15-pentaoxaheptadecyl)oxy]-2,3-dichloro-
phenyl}pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate (79.0
mg, 104 μmol, 52.9% yield) was obtained as a yellow oil.
To a solution of tert-butyl [1-(6-amino-5-{5-[(17-azido-
3
,6,9,12,15-pentaoxaheptadecyl)oxy]-2,3-dichlorophenyl}-
tert-Butyl {(3S,4S)-8-[5-(2,3-Dichloro-4-hydroxyphenyl)-3-
(hydroxymethyl)-6-methylpyrazin-2-yl]-3-methyl-2-oxa-8-
azaspiro[4.5]decan-4-yl}carbamate (intermediate X). The
pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate (79.0 mg, 104
μmol, 1.00 equiv) in THF (1.00 mL) was added 10% Pd/C
18
(8.00 mg, 10.4 μmol, 0.100 equiv) under N . The suspension
mixture of previously reported tert-butyl N-{(3S,4S)-8-[5-
bromo-3-(hydroxymethyl)-6-methylpyrazin-2-yl]-3-methyl-2-
oxa-8-azaspiro[4.5]decan-4-yl}carbamate (480 mg, 1.02 mmol,
1.00 equiv), 2,3-dichloro-4-(4,4,5,5-tetramethyl-1,3,2-dioxabor-
olan-2-yl)phenol (359 mg, 1.24 mmol, 1.22 equiv), K CO (432
2
was degassed under vacuum and purged with H several times.
The mixture was stirred under H (15 psi) at 15 °C for 3 h. The
2
2
reaction mixture was filtered and concentrated under reduced
pressure to give the product tert-butyl [1-(6-amino-5-{5-[(17-
amino-3,6,9,12,15-pentaoxaheptadecyl)oxy]-2,3-dichloro-
phenyl}pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate (80.0
mg, 93.9 μmol, 90.1% yield, 85.9% purity) as a yellow oil.
To a solution of tert-butyl [1-(6-amino-5-{5-[(17-amino-
2
3
mg, 3.13 mmol, 3.07 equiv), and Pd(dppf)Cl (97 mg, 0.132
2
mmol, 0.13 equiv) in EtOH (12 mL) and water (2.4 mL) was
stirred for 3 h at 80 °C under a nitrogen atmosphere. The
mixture was allowed to cool to room temperature. The reaction
was quenched by the addition of water (30 mL). The resulting
mixture was extracted with DCM (3 × 30 mL). The combined
organic layers were washed with brine (30 mL) and dried over
anhydrous Na SO . After filtration, the filtrate was concentrated
3
,6,9,12,15-pentaoxaheptadecyl)oxy]-2,3-dichlorophenyl}-
pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate (80.0 mg, 93.9
μmol, 1.00 equiv) and intermediate 2 (53.8 mg, 141 μmol, 1.50
equiv, HCl) in DMF (1.00 mL) were added HATU (42.9 mg,
2
4
1
13 μmol, 1.20 equiv) and DIPEA (54.6 mg, 423 μmol, 73.6 μL,
under reduced pressure. The residue was purified by silica gel
column chromatography and eluted with DCM/MeOH (9/1)
to afford tert-butyl N-{(3S,4S)-8-[5-(2,3-dichloro-4-hydroxy-
phenyl)-3-(hydroxymethyl)-6-methylpyrazin-2-yl]-3-methyl-2-
oxa-8-azaspiro[4.5]decan-4-yl}carbamate (intermediate X, 400
mg, 60%) as a brown solid (Scheme 6).
4
.50 equiv). The mixture was stirred at 15 °C for 16 h. The
residue was purified by prep-HPLC [neutral condition; column,
Phenomenex luna C18 150 mm × 25 mm × 10 μm; mobile
phase, water (10 mM NH HCO )/acetonitrile; B%, 32% to
4
3
6
2%, 10 min]. The product tert-butyl [1-(6-amino-5-{2,3-
dichloro-5-[(1-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindo-
lin-4-yl]oxy}-2-oxo-6,9,12,15,18-pentaoxa-3-azaicosan-20-yl)-
oxy]phenyl}pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate
General Synthesis of S6-2 (exemplified for n = 1). To a
stirred mixture of intermediate 2 (6.50 g, 19.56 mmol, 1.00
equiv) and TSTU (8.8 g, 29.34 mmol, 1.50 equiv) in DMF (65
mL) was added DIPEA (5.0 g, 39.12 mmol, 2.00 equiv)
dropwise at 0 °C under a nitrogen atmosphere. The resulting
mixture was stirred overnight at room temperature. The reaction
was quenched with water/ice at room temperature. The
resulting mixture was extracted with EtOAc (3 × 100 mL).
The combined organic layers were washed with brine (100 mL)
and dried over anhydrous Na SO . After filtration, the filtrate
(
77.0 mg, 73.6 μmol, 78.4% yield) was obtained as a yellow solid.
To a solution of tert-butyl [1-(6-amino-5-{2,3-dichloro-5-[(1-
[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindolin-4-yl]oxy}-2-
{
oxo-6,9,12,15,18-pentaoxa-3-azaicosan-20-yl)oxy]phenyl}-
pyrazin-2-yl)-4-methylpiperidin-4-yl]carbamate (77.0 mg, 73.6
μmol, 1.00 equiv) in EtOAc (1.00 mL) was added HCl/EtOAc
(4 M, 184 μL, 10.0 equiv). The mixture was stirred at 15 °C for 2
2
4
2
600
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
was concentrated under reduced pressure. This resulted in 2,5-
dioxopyrrolidin-1-yl 2-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoi-
soindol-4-yl]oxy}acetate (4.0 g, 38%) as a white solid.
collected fraction was lyophilized to afford R1-1c (21 mg, 56%)
as a white solid.
1
NMR Spectroscopy. All H NMR spectra were recorded at
To a stirred mixture of 2,5-dioxopyrrolidin-1-yl 2-{[2-(2,6-
dioxopiperidin-3-yl)-1,3-dioxoisoindol-4-yl]oxy}acetate (2.00
g, 4.65 mmol, 1.00 equiv) and 2-{2-[2-(2-aminoethoxy)ethoxy]-
ethoxy}ethanol (0.90 g, 4.65 mmol, 1.00 equiv) in DMF (20
mL) was added DIEA (1.20 g, 9.27 mmol, 1.99 equiv) dropwise
at 0 °C under a nitrogen atmosphere. The resulting mixture was
stirred overnight at room temperature. The reaction mixture was
purified by reverse-phase flash chromatography [column, C18
silica gel; mobile phase, acetonitrile in water (0.1% formic acid),
600 MHz and 25 °C, and chemical shifts are represented on the
δ scale. Residual protium in the NMR solvent (MeOH-d , δ
4
3.31) was used to reference chemical shifts. Data are represented
as follows: assignment, chemical shift, integration, multiplicity
(s, singlet; d, doublet; t, triplet; m, multiplet), and coupling
1
3
constant in hertz. All C NMR spectra were recorded at 150
MHz and 25 °C, and chemical shifts are represented on the δ
scale. The carbon resonances of the NMR solvent (MeOH-d , δ
4
49.15) are used to reference chemical shifts. Full assignment of
0
% to 70% gradient in 10 min; detector, UV 254 nm] to give 2-
protons and carbons was completed on the basis of the following
1
1
{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-4-yl]oxy}-N-
(2-{2-[2-(2-hydroxyethoxy)ethoxy]ethoxy}ethyl)acetamide
(1.1 g, 46%) as a light yellow oil.
two-dimensional NMR spectroscopy experiments: H− H
1
13
correlation spectroscopy (COSY), H− C heteronuclear
single-quantum coherence non-uniform sampling (HSQC-
To a stirred mixture of 2-{[2-(2,6-dioxopiperidin-3-yl)-1,3-
1
13
NUS), and H− C heteronuclear multiple-bond connectivity
non-uniform sampling (HMBC-NUS) (Tables S2−S9 and
Figures S11−S50).
dioxoisoindol-4-yl]oxy}-N-(2-{2-[2-(2-hydroxyethoxy)-
ethoxy]ethoxy}ethyl)acetamide (1.60 g, 0.31 mmol, 1.00 equiv)
and TEA (0.96 g, 0.95 mmol, 3.0 equiv) in DMF (16 mL) was
added MsCl (0.55 g, 0.46 mmol, 1.51 equiv) dropwise at 0 °C.
The resulting mixture was stirred for 12 h at room temperature.
The residue was purified by reverse-phase flash chromatography
LC-MS. Samples were separated over a Kinetex C18 column
with water and 0.1% formic acid (A) and acetonitrile and 0.1%
formic acid (B) as mobile phases. After an initial equilibration
period of 3 min at 5% B, a linear gradient to 100% was run over
[
(
column, C18 silica gel; mobile phase, acetonitrile in water
0.1% formic acid), 0% to 70% gradient in 40 min; detector, UV
13 min. The LC stream was inline with an Agilent 6530 qTOF
instrument with standard parameters (Table S10 and Figures
S51−S57).
2
1
54 nm] to give 2-(2-{2-[2-(2-{[2-(2,6-dioxopiperidin-3-yl)-
,3-dioxoisoindol-4-yl]oxy}acetamido)ethoxy]ethoxy}ethoxy)-
Antibodies and Compounds. Antibodies used in this
study were obtained commercially from the following sources:
SHP2 (Bethyl, catalog no. A301-544A), phospho-Thr202/
Tyr204-Erk1/2 (CST, catalog no. 9101), Cereblon (CST,
catalog no. 71810), β-actin (Millipore-Sigma, catalog no.
A1978), β-tubulin (CST, catalog no. 2146), and GAPDH
ethylmethanesulfonate (S6-2n= 1, 840 mg, 45%) as a light
yellow oil.
General synthesis of R1-1c, R1-3c, and R1-5c
exemplified for R1-1c). To a stirred mixture of intermediate
(
X (100 mg, 0.18 mmol, 1.00 equiv) and S6-2n= 1 (106 mg, 0.18
mmol, 1.00 equiv) in acetone (10 mL) was added K CO (75
2
3
(
CST, catalog no. 5174). SHP099 and RMC-4550 were
mg, 0.54 mmol, 3.0 equiv) in portions at room temperature
under a nitrogen atmosphere. The resulting mixture was stirred
overnight at room temperature under a nitrogen atmosphere.
The resulting mixture was purified by reverse-phase flash
chromatography [column, C18 silica gel; mobile phase,
acetonitrile in water (0.1% formic acid), 10% to 80% gradient
in 30 min; detector, UV 254 nm]. The collected fraction was
lyophilized to afford tert-butyl N-[(3S,4S)-8-(5-{2,3-dichloro-4-
purchased from DC chemicals (catalog no. DC9737) and
ProbeChem Biochemicals (catalog no. PC-35116), respectively.
6
,8-Difluoro-4-methylumbelliferyl phosphate (DiFMUP, cata-
log no. D22065) and 6,8-difluoro-7-hydroxy-4-methylcoumarin
DiFMU, catalog no. D6566) were purchased from Life
(
Technologies.
Cell Culture. The MV-4-11 cell line was purchased from the
American Type Culture Collection (ATCC). The KYSE-520
and MOLM-13 cell lines were purchased from DSMZ
[
2-(2-{2-[2-(2-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoin-
dol-4-yl]oxy}acetamido)ethoxy]ethoxy}ethoxy)ethoxy]-
phenyl}-3-(hydroxymethyl)-6-methylpyrazin-2-yl)-3-methyl-2-
oxa-8-azaspiro[4.5]decan-4-yl]carbamate (84 mg, 22%) as a
white solid.
(
Braunschweig, Germany). Parental and CRBN knockout
MOLT4 cells were a gift from N. Gray (Dana-Farber Cancer
Institute). All cell lines were cultured in RPMI-1640 medium
containing 10% FBS and 1% penicillin/streptomycin at 37 °C
To a stirred mixture of tert-butyl N-[(3S,4S)-8-(5-{2,3-
dichloro-4-[2-(2-{2-[2-(2-{[2-(2,6-dioxopiperidin-3-yl)-1,3-di-
oxoisoindol-4-yl]oxy}acetamido)ethoxy]ethoxy}ethoxy)-
ethoxy]phenyl}-3-(hydroxymethyl)-6-methylpyrazin-2-yl)-3-
methyl-2-oxa-8-azaspiro[4.5]decan-4-yl]carbamate (40 mg,
with 5% CO2.
Immunoblotting Analysis. Cells were treated with
PROTAC compounds as indicated and lysed in RIPA lysis
buffer [25 mM Tris-HCl (pH 7.6), 150 mM NaCl, 1% Nonidet
P-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate,
and 2 mM EDTA] with protease inhibitors (cOmplete Mini,
Roche). Lysates were resolved on sodium dodecyl sulfate−
polyacrylamide gel electrophoresis gels (Novex Tris-Glycine,
ThermoFisher Scientific) and transferred to PVDF membranes
using the XCell II wet blotting system (ThermoFisher
Scientific). Membranes were blocked with 5% BSA diluted in
TBST (Tris-buffered saline and 0.1% Tween 20) buffer and
incubated with primary antibodies overnight. The blots were
rinsed three times for 10 min each in 15 mL of TBST buffer and
incubated with secondary antibodies diluted with 5% BSA for 1
h followed by three final washes. Specific protein bands were
0
.04 mmol, 1.00 equiv) in DCM (4 mL) was added TFA
(
0.80 mL) in portions at room temperature under a nitrogen
atmosphere. The resulting mixture was stirred for 3 h at room
temperature under a nitrogen atmosphere. The resulting
mixture was concentrated, and the residue was purified by
reverse-phase flash chromatography [column, C18 silica gel;
mobile phase, acetonitrile in water (0.1% formic acid), 10% to
5
0% gradient in 30 min; detector, UV 254 nm]. The crude
product (40 mg) was purified by prep-HPLC [column, Xselect
CSH OBD 30 mm × 150 mm × 5 μm; mobile phase A, water
(
0.1% formic acid); mobile phase B, acetonitrile; flow rate, 60
mL/min; gradient, 20% to 34% B in 7 min; 220 nm]. The
2
601
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Table 1
target
DUSP6 set A
forward primer sequence
reverse primer sequence
CAGCGACTGGAACGAGAATAC
AGCAGCGACTGGAACGAGAA
CTTCACCACCATGGAGGAGGC
CAACCGCGAGAAGATGACC
GAACTCGGCTTGGAACTTACT
TGTTGGACAGCGGACTACCAT
GGCATGGACTGTGGTCATGAG
AGCCTGGATAGCAACGTACA
2
6
DUSP6 set B
GAPDH
β-actin
detected using SuperSignal West Pico PLUS Chemiluminescent
Substrate (ThermoFisher Scientific).
supernatant was affinity-purified by Pierce glutathione agarose
(Thermo Fisher Scientific) and eluted with lysis buffer
containing 20 mM GSH. After GST tag cleavage with the
recombinant HRV 3C protease, the SHP2 protein was further
purified by a HiTrap Heparin HP column (GE Healthcare).
SHP2-containing fractions were pooled and finally polished over
a Superdex200 10/300 GL size exclusion column (GE
Healthcare) in a buffer containing 25 mM Tris 7.5, 100 mM
Measurement of the Inhibitory Activity of Com-
pounds using DiFMUP. The phosphatase activities of
SHP2-F285S and the isolated PTP domain were measured
using the fluorogenic small molecule substrate DiFMUP.
Compounds were dissolved in DMSO at a concentration of
1
0 mM, diluted 1/10 in assay buffer [60 mM Hepes (pH 7.2), 75
mM KCl, 75 mM NaCl, 1 mM EDTA, 0.05% Tween 20, and 2
mM DTT], and added to 96-well plates in a 3-fold dilution
NaCl, 2 mM MgCl , and 2 mM TCEP. The protein sample
2
concentration was determined on the basis of the UV
absorbance at 280 nm. Wild-type SHP2 protein was
concentrated to 18 mg/mL for crystallization. SHP2-F285S
and isolated PTP domain proteins were expressed and purified
(
concentration range from 200 mM to 3.3 nM) in triplicate. The
serially diluted compound was mixed with 0.5 nM SHP2-F285S
mutant or isolated PTP domain proteins and incubated at room
temperature for 1 h, after which 400 mM DiFMUP was added to
each well. One hour after the addition of DiFMUP, fluorescence
was measured on a SpectraMax M5 plate reader (Molecular
Devices) using excitation and emission wavelengths of 340 and
8
as described previously.
Crystallization and Structure Determination. The
hanging-drop vapor diffusion method was used for co-
crystallization of wild-type SHP2 in complex with RMC-4550.
Wild-type SHP2 was incubated with RMC-4550 at a molar ratio
of 1/2, and crystals were grown at 18 °C by mixing equal
volumes of the protein sample and reservoir solution [0.1 M
sodium chloride, 0.1 M Bis-Tris propane (pH 8.5), and 11%
PEG 1500]. Diffraction quality crystals were cryoprotected by
supplementing a reservoir solution with 20% glycerol and flash-
frozen in liquid nitrogen. X-ray diffraction data were collected at
Advanced Photon Source NE-CAT beamline 24 ID-E at 100 K
using a wavelength of 0.979 Å. The diffraction images from
4
50 nm, respectively, and the inhibitor dose−response curves
were analyzed using nonlinear regression curve fitting with
control-based normalization.
Cell Viability Analysis. MV-4-11 cells were seeded at a
density of 1000 cells/mL of medium in 10 cm plates in triplicate
and treated with 100 nM R1-5C, 100 nM R1-1C, and 100 nM
RMC-4550 or DMSO carrier. The cells were replenished with
compounds every 24 h and counted on days 1−9 using an
automated cell counter (Bio-Rad). KYSE-520 cells were plated
onto 96-well plates (500 cells per well) in 100 mL of medium
and treated with 100 nM R1-5C and 100 nM RMC-4550 or
DMSO carrier. The cells were replenished with compounds
every 24 h, and cell viability was assessed on days 1, 3, 5, 7, and 9
upon addition of 20 mL of CellTiter-Blue reagent (Promega) to
wells and measurement of the luminescent signal using a
GloMax discover microplate reader (Promega).
20
single crystals were processed and scaled using XDS. To obtain
phases, molecular replacement for both copies of SHP2 in the
unit cell was performed in Phenix with Phaser using chain B of a
SHP2 crystal structure [Protein Data Bank (PDB) entry 5EHR]
as the search model. Iterative model building was performed in
2
1
COOT. Reciprocal space refinement was performed in
phenix.refine, using reciprocal space optimization of xyz
coordinates, individual atomic B-factors, NCS restraints,
optimization for X-ray/stereochemistry weights, and optimiza-
TMT-Based LC-MS3 Proteomics. MV-4-11 cells (10 M)
were treated with DMSO carrier or 100 nM R1-5C, 100 nM R1-
2
2
3
C, 100 nM R1-1C, 100 nM RMC-4550, and 1 mM
tion for X-ray/ADP weights. The RMC-4550 ligand
23
pomalidomide in biological duplicate or singlicate for the
indicated time periods. MOLT4 cells (5 M) were treated with 1
mM R1-5C for 5 h in biological singlicate. Cells were then
harvested by centrifugation, and cell pellets snap-frozen in liquid
nitrogen. Sample preparation for TMT LC-MS3 mass
coordinate and restraint file were generated using eLBOW.
In the final cycles of model building, NCS restraints were
removed during refinement and overall model quality was
24
assessed using MolProbity. All crystallographic data process-
ing, refinement, and analysis software was compiled and
19
25
spectrometry was performed as described previously.
supported by the SBGrid Consortium.
Expression and Purification of Wild-Type SHP2,
F285S-SHP2, and the Isolated PTP Domain. Human wild-
type SHP2 (amino acids 1−525, UniProtKB Q06124) was
inserted into a modified pGEX6P1 vector with an N-terminal
GST tag, followed by a PreScission cleavage site. Recombinant
GST-SHP2 protein was overexpressed in Escherichia coli BL21
Real-Time Quantitative Polymerase Chain Reaction
(qPCR). One million cells were treated with R1-5C at 200 nM or
DMSO for 2 or 16 h. Cells were harvested after treatment in
TRIzol (Thermo Fisher), and RNA was purified by phenol/
chloroform extraction using MaXtract high-density tubes
(Qiagen). RNA was treated with Turbo DNase (Thermo
Fisher) for 30 min at 37 °C and then re-extracted with
chloroform isoamyl alcohol using MaXtract high-density tubes;
1 μg of RNA for each sample was used to make cDNA using the
iScript cDNA synthesis kit (Bio-Rad). qPCR was performed
using PowerUp SYBR Green Master Mix (Thermo Fisher) in a
10 μL total reaction volume with 0.25 μM forward and reverse
(
DE3) cells induced by 0.2 mM isopropyl 1-thio-D-galactopyr-
anoside (IPTG) at 16 °C overnight. Cells were harvested by
centrifugation, resuspended in lysis buffer [25 mM Tris 7.5, 150
mM NaCl, 2 mM MgCl , 2 mM TCEP, and an EDTA-free
2
protease inhibitor cocktail tablet (cOmplete, Roche)], and lysed
by sonication. After centrifugation, recombinant GST-SHP2 in
2
602
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Figure 1. Structure of SHP2 protein in complex with RMC-4550. (A) Chemical structure of RMC-4550 and X-ray crystal structure of SHP2 in
complex with RMC-4550 (PDB entry 7RCT). Surface representation of SHP2 in complex with RMC-4550 bound in the central tunnel formed at the
interface of the N-SH2 (green), C-SH2 (blue), and PTP (wheat) domains. (B) Chemical structures of RMC-4550-based PROTAC candidates R1-1C,
R1-3C, and R1-5C.
primers, with two technical replicates per experiment. Primer
sequences are listed in Table 1. Expression was normalized to
the average of GAPDH and β-actin expression. Significant
differences were identified using Welch’s t test in PRISM 9.0.2.
no evidence of SHP2 degradation for any of the compounds, as
judged by a Western blot (Figure S2A).
Because none of these first-generation compounds resulted in
SHP2 degradation, we determined whether the conjugation of
pomalidomide to the SHP099 warhead affected the inhibitory
potency of the parent SHP099 compound. We compared the
inhibitory activity of SHP099 with the various SHP099-
pomalidomide conjugates in enzymatic assays with purified
protein, using the fluorogenic substrate DiFMUP and the weakly
active SHP2 mutant F285S. Upon titration of SHP099, the
F285S enzyme showed a dose-dependent inhibition of
phosphatase activity with a half-maximal inhibitory concen-
RESULTS
■
The CRBN E3 ligase ligands (pomalidomide, lenalidomide, and
thalidomide, collectively termed IMiDs) have been successfully
employed in the design of a wide range of PROTACs to degrade
2
7−30
various proteins.
To develop an effective SHP2 PROTAC,
therefore, we first designed a series of compounds designed to
tether SHP099 to the IMiD pomalidomide.
3
1
tration (IC ) of 62 nM, similar to our previous findings for its
To guide the sites for attachment of the linker to the SHP099
warhead, we relied on the X-ray structure of the SHP2-SHP099
complex (PDB entry 5EHR), which shows that there is an exit
path for the linker when coupled at either of two positions on the
dichloro-substituted aromatic ring (Figure S1A). Two different
linker strategies were therefore employed, using either aliphatic
or ether attachments to the SHP099 warhead (Figure S1B−E).
We tested whether any of these compounds catalyzed
degradation of SHP2 in the MV4;11 acute myeloid leukemia
cell line. When MV4;11 cells were treated with these
compounds at doses ranging from 0.01 to 50 μM, there was
50
4
IC , and similar to the K values for wild-type SHP2. In
50
D
contrast, the inhibitory profiles of the SHP099-IMiD conjugates
are right-shifted, with IC50 values ranging from 0.5 to 3.7 μM
(
Figure S2B), indicating that the coupling of the linker to the
warhead reduces the inhibitory potency between roughly 10-
and 100-fold, depending on the site of attachment and the
nature of the linkage. In fact, simply installing a PEG chain on
SHP099 caused a 10-fold decrease in inhibitory activity in vitro
and in cells (Figure S3A−C). Together, these findings revealed
that coupling the linker to the warhead results in a minimum
2
603
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Figure 2. SHP2 degradation induced by RMC-4550-based PROTACs. (A) Inhibition of SHP2-F285S- or PTP-mediated DIFMUP
dephosphorylation by R1-1C, R1-3C, R1-5C, and RMC-4550. MV4;11 cells were treated with increasing doses of (B) R1-3C or (C) R1-1C or
(
C) R1-5C for 24 h and subjected to Western blotting using SHP2, GAPDH, and β-actin antibodies. Quantification of band intensities on the gels is
shown below the blots.
∼
10-fold reduction in potency and suggested that an active
PROTAC would require a more potent warhead to offset this
= 1.5 nM). As expected, this compound displayed no inhibitory
activity toward the free catalytic domain (PTP).
We treated MV4;11 cells with increasing doses of R1-3C or
with DMSO carrier as a control for 24 h and measured SHP2
protein levels by Western blotting. We observed a dose-
dependent decrease in SHP2 levels with maximal degradation at
consequence of linker coupling.
RMC-4550 is an allosteric inhibitor of SHP2 (Figure 1A) with
a potency that is 50-fold higher than that of SHP099 in vitro.
12
To determine whether a similar exit path for the linker exists for
RMC-4550 bound to SHP2, we determined the structure of
RMC-4550 bound to wild-type SHP2 by X-ray crystallography
to 1.8 Å resolution (Figure 1A and Table S1). The structure
shows that the dichlorophenyl ring of RMC-4550 adopts a pose
virtually identical to that of SHP099 when bound, exposing the
same tethering sites to solvent for the design of PROTAC
compounds (Figure S4A,B).
Because S9-3C is the most potent of all SHP099-IMiD
conjugates, we substituted SHP099 with RMC-4550 in this
design to create R1-3C (Figure 1B). Upon titration of R1-3C,
the SHP2 mutant F285S showed a dose-dependent inhibition of
phosphatase activity with an IC50 of 14 nM (Figure 2A), a
roughly 10-fold reduction compared to that of RMC-4550 (IC50
100 nM (Figure 2B). The loss of activity observed at higher R1-
3
C concentrations (1, 10, and 50 μM), termed a hook effect, is a
signature trait of PROTACs. The increase in the amount of
SHP2 protein upon treatment of MV4;11 cells with high
concentrations of R1-3C is consistent with the hook effect, in
which SHP2 and CRBN are bound to different PROTAC
molecules. It may be that allosteric inhibition of SHP2 extends
its half-life, that inhibition of CRBN generally affects protein
turnover, or that a combination of these two mechanisms
contribute.
Because the length of the linker plays a key role in the potency
32−35
of PROTACs,
we varied the linker lengths between RMC-
4550 and pomalidomide to search for a PROTAC with higher
potency. Extension of the linker with two additional PEG units
2
604
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Figure 3. Cell-based evaluation of R1-5C. (A) Time course of SHP2 degradation by R1-5C (100 nM) in MV4;11 cells. Immunoblotting with SHP2
and β-actin antibodies. (B) CRBN− and parental MOLT4 cells were treated with increasing doses of R1-5C for 24 h and subjected to Western
blotting using SHP2, CRBN, and β-actin antibodies. Quantification of band intensities on the gels is shown below the blots.
/−
(
R1-5C in Figures 1B, 2C, and S5A) resulted in a PROTAC with
greater potency, whereas shortening the linker by two PEG units
R1-1C in Figures 1B and 2C) caused complete loss of
exhibits a striking specificity for degradation of SHP2, which is
evident within 4 h (Figure 4). At 16 h, many of the secondary
effects of SHP2 depletion recapitulate the consequence of
allosteric inhibition (proteins labeled in blue in panels C and D
of Figure 4 highlighted with yellow dots in Figure S6), providing
further evidence of the SHP2 specificity of the R1-5C PROTAC.
By comparison, R1-3C, which has a shorter linker, resulted in
more moderate SHP2 depletion at 16 h (Figure S7A), and R1-
1C did not induce SHP2 degradation even at 16 h, as anticipated
(Figure S7B). Pomalidomide-induced degradation of classical
IMiD targets (IKZF1 and ZFP91) serves as a positive control
and validates the authenticity of the proteomics experiment
(Figures 4E and S7C). Quantitative proteomics of MOLT4 cells
treated with R1-5C compared to the DMSO control after 5 h
also showed that SHP2 is the only protein with a significantly
reduced abundance in MOLT4 cells (Figure S8).
(
PROTAC activity.
To determine the kinetics of R1-5C-mediated degradation of
SHP2 in MV4;11 cells, we assessed the abundance of SHP2
protein at a series of time points after addition of the compound.
SHP2 levels are substantially reduced within 6 h of R1-5C
treatment, reaching maximal depletion after 16 h (Figure 3A).
SHP2 remains depleted at 24 h; however, it reaccumulates to
pretreatment levels by 48 h (Figure S5B), consistent with
cellular half-lives observed for other PROTACs. The increase
in the amount of SHP2 protein 4−6 days after the initial
PROTAC treatment likely results from induction of new SHP2
synthesis as a compensatory cellular response to SHP2
depletion.
27
We confirmed the dependence of SHP2 depletion on the
CRBN E3 ligase by comparing the degradation activity of our
PROTAC compounds in parental MOLT4 and CRBN
To assess the time-dependent recovery of the abundance of
SHP2 protein, we treated MV4;11 cells with 100 nM R1-5C for
24 h, washed out the compound, and lysed cells at various time
points after washout for immunoblotting. The abundance of
SHP2 protein recovered to basal (DMSO-treated) levels 24 h
after washout (Figure S9).
−
/−
knockout cells. Whereas PROTAC treatment decreased the
abundance of SHP2 protein in MOLT4 parental cells,
PROTAC-dependent degradation of SHP2 was not detectable
−
/−
in CRBN
cells, confirming the CRBN requirement for
We also examined whether R1-5C affects MAPK signaling.
We treated KYSE-520 cells with R1-5C or DMSO carrier and
monitored the levels of the DUSP6 transcript, a commonly used
pharmacodynamic marker for MAPK pathway activity down-
PROTAC activity (Figures 3B and S5C).
We then performed time-resolved quantitative proteomics to
further evaluate the selectivity of these compounds for SHP2
and to determine the kinetics of SHP2 degradation in MV4;11
cells. The cells were treated with R1-5C (100 nM for 2, 4, 8, or
4
stream of SHP2. Cells treated with R1-5C showed significant
downregulation of the amounts of DUSP6 mRNA (Figures 5A
and S10). Suppression of the abundance of the DUSP6
transcript is observed both after treatment for 2 and 16 h; the
reduction at the late time point reports on the effect of SHP2
degradation on the amounts of DUSP6 mRNA, whereas the
reduction at the 2 h time point indicates that allosteric inhibition
16 h), R1-3C (100 nM for 4 or 16 h), R1-1C (100 nM for 4 or
16 h), RMC-4550 (100 nM for 16 h), pomalidomide (1 μM for
5 h), or a vehicle control (DMSO), and the abundance of
protein was measured quantiatively using 16-plex tandem mass
19
tag (TMT) isobaric labels, as described previously. R1-5C
2
605
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Figure 4. Proteomics analysis showing selective SHP2 degradation by R1-5C. (A−D) Scatter plots displaying the relative fold change in the abundance
of SHP2 following treatment of MV4;11 cells with 100 nM R1-5C for (A) 4 h, (B) 8 h, or (C) 16 h or (D) 100 nM RMC-4550. SHP2/PTPN11 is
colored red. Hits colored blue in panels C and D indicate changes in the abundance of proteins at the 16 h time point due to secondary effects (such as
transcriptional responses) of SHP2 degradation or inhibition. (E) Heat map of the changes in the abundance of protein in MV4;11 cells comparing
treatment with 100 nM R1-1C (4 and 16 h), 100 nM R1-3C (4 and 16 h), 100 nM R1-5C (2, 4, 8, and 16 h), 100 nM RMC-4550 (16 h), and 1 μM
pomalidomide (5 h). The heat map colors are scaled with red indicating a decrease in the abundance of protein (−2 log FC) and blue indicating an
2
increase (2 log FC).
2
2
606
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Key features required for the degradative activity of our
designed compound include the warhead coupling site, the
linker chemistry, and the linker length. The high degree of
selectivity of R1-5C for SHP2 has been documented in this
study using stringent whole proteome analysis in two different
cell lines, MV4;11 (Figure 4) and MOLT4 (Figure S8). In both
of these lines, SHP2 (gene name PTPN11) is the only protein
that shows a statistically significant reduction in abundance at
time points from 4 to 8 h, before secondary effects of SHP2
inhibition can be observed. By comparison, the selectivity of
other reported SHP2-targeting PROTACS has not yet been
36,37
assessed using whole proteomic studies.
Whereas some IMiD-dependent PROTACs can induce
detectable degradation of target proteins within 0.5 h, treatment
with R1-5C for several hours is required before significant
depletion of SHP2 is observed in either cell line. Although the
origin of the slower onset of SHP2 degradation is not clear, the
other recently reported, SHP2-targeting PROTACs also exhibit
similar degradation kinetics based on Western blot analysis,
36
independent of whether degradation is mediated by VHL or
37
CRBN.
R1-5C and related compounds are poised to serve as useful
tools for the investigation of the physiological roles of SHP2. An
important question to be addressed in future work is whether
R1-5C can be optimized to power degradation of oncogenic,
mutant forms of SHP2. Such SHP2 PROTACs would then
extend compound efficacy beyond RTK- and ERK-dependent
cancers that harbor wild-type SHP2 to cancers with mutant
SHP2 and to patients with human genetic disorders like Noonan
and LEOPARD syndromes.
ASSOCIATED CONTENT
sı Supporting Information
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acs.biochem.1c00377.
■
*
Figures S1−S57 and Tables S1−S10 (PDF)
Accession Codes
Diffraction data and refined coordinates for the SHP2-
RMC4550 complex have been deposited as Protein Data Bank
entry 7RCT. UNIPROT accession IDs for proteins SHP2,
Q06124; ERK1, P27361; ERK2, P28482; PD-1, Q15116;
CRBN, Q96SW2; β-actin, P60709; β-tubulin, P07437;
GAPDH, P04406; DUSP6, Q16828; IKZF1, Q13422; ZFP91,
Q96JP5; VHL, P40337.
Figure 5. R1-5C inhibits MAPK signaling and suppresses cancer cell
growth. (A) Downregulation of DUSP6 transcript levels in KYSE-520
cells after treatment for 2 and 16 h with 200 nM R1-5C or DMSO
carrier. DUSP6 mRNA was quantified by RT-qPCR using primer set B.
(B and C) Cells were treated with 100 nM R1-5C, 100 nM RMC-4550,
or DMSO carrier in triplicate, and cell numbers were assessed at the
indicated time points by automated cell counting (for MV4;11 cells) or
the CellTiter-Blue assay (for KYSE-520 cells).
AUTHOR INFORMATION
■
Corresponding Author
Stephen C. Blacklow − Department of Biological Chemistry
and Molecular Pharmacology, Harvard Medical School,
Boston, Massachusetts 02115, United States; Department of
Cancer Biology, Dana-Farber Cancer Institute, Boston,
Massachusetts 02215, United States; orcid.org/0000-
of SHP2 by the RMC-4550 warhead is ongoing prior to SHP2
depletion. The inhibition of cancer cells by R1-5C was also
assessed in a cell proliferation assay, which showed that R1-5C
significantly inhibits KYSE-520 and MV4;11 cell growth, with an
inhibitory effect comparable to that of RMC-4550 (Figure
0002-6904-1981; Email: Stephen_blacklow@
5
B,C).
hms.harvard.edu
DISCUSSION
■
Authors
We report here the design and evaluation of R1-5C, a potent and
highly selective SHP2 PROTAC featuring an SHP2 allosteric
site-binding warhead and the CRBN-targeting IMiD pomalido-
mide. R1-5C expands the range of PROTACs targeting SHP2,
which currently include a VHL-targeting PROTAC and the
Novartis clinical candidate TNO155 coupled to thalidomide.
Vidyasiri Vemulapalli − Department of Biological Chemistry
and Molecular Pharmacology, Harvard Medical School,
Boston, Massachusetts 02115, United States; Department of
Cancer Biology, Dana-Farber Cancer Institute, Boston,
Massachusetts 02215, United States; orcid.org/0000-
0002-3368-4766
36
37
2
607
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
Katherine A. Donovan − Department of Cancer Biology, Dana-
Farber Cancer Institute, Boston, Massachusetts 02215, United
States; orcid.org/0000-0002-8539-5106
Tom C. M. Seegar − Department of Molecular Genetics,
Biochemistry and Microbiology, University of Cincinnati
College of Medicine, Cincinnati, Ohio 45267, United States
Julia M. Rogers − Department of Biological Chemistry and
Molecular Pharmacology, Harvard Medical School, Boston,
Massachusetts 02115, United States
Munhyung Bae − Department of Biological Chemistry and
Molecular Pharmacology, Harvard Medical School, Boston,
Massachusetts 02115, United States
Ryan J. Lumpkin − Department of Cancer Biology, Dana-
Farber Cancer Institute, Boston, Massachusetts 02215, United
States
Ruili Cao − Department of Biological Chemistry and Molecular
Pharmacology, Harvard Medical School, Boston,
Massachusetts 02115, United States
Matthew T. Henke − Department of Biological Chemistry and
Molecular Pharmacology, Harvard Medical School, Boston,
Massachusetts 02115, United States
plastic syndromes and acute myeloid leukemia. Nat. Genet. 2003, 34,
1
(
48−150.
3) Darian, E.; Guvench, O.; Yu, B.; Qu, C. K.; MacKerell, A. D., Jr.
Structural mechanism associated with domain opening in gain-of-
function mutations in SHP2 phosphatase. Proteins: Struct., Funct., Genet.
2
(
011, 79, 1573−1588.
4) Chen, Y. N.; LaMarche, M. J.; Chan, H. M.; Fekkes, P.; Garcia-
Fortanet, J.; Acker, M. G.; Antonakos, B.; Chen, C. H.; Chen, Z.;
Cooke, V. G.; Dobson, J. R.; Deng, Z.; Fei, F.; Firestone, B.; Fodor, M.;
Fridrich, C.; Gao, H.; Grunenfelder, D.; Hao, H. X.; Jacob, J.; Ho, S.;
Hsiao, K.; Kang, Z. B.; Karki, R.; Kato, M.; Larrow, J.; La Bonte, L. R.;
Lenoir, F.; Liu, G.; Liu, S.; Majumdar, D.; Meyer, M. J.; Palermo, M.;
Perez, L.; Pu, M.; Price, E.; Quinn, C.; Shakya, S.; Shultz, M. D.; Slisz, J.;
Venkatesan, K.; Wang, P.; Warmuth, M.; Williams, S.; Yang, G.; Yuan,
J.; Zhang, J. H.; Zhu, P.; Ramsey, T.; Keen, N. J.; Sellers, W. R.; Stams,
T.; Fortin, P. D. Allosteric inhibition of SHP2 phosphatase inhibits
cancers driven by receptor tyrosine kinases. Nature 2016, 535, 148−
1
(
52.
5) Okazaki, T.; Maeda, A.; Nishimura, H.; Kurosaki, T.; Honjo, T.
PD-1 immunoreceptor inhibits B cell receptor-mediated signaling by
recruiting src homology 2-domain-containing tyrosine phosphatase 2 to
phosphotyrosine. Proc. Natl. Acad. Sci. U. S. A. 2001, 98, 13866−13871.
(6) Zhao, M.; Guo, W.; Wu, Y.; Yang, C.; Zhong, L.; Deng, G.; Zhu,
Y.; Liu, W.; Gu, Y.; Lu, Y.; Kong, L.; Meng, X.; Xu, Q.; Sun, Y. SHP2
inhibition triggers anti-tumor immunity and synergizes with PD-1
blockade. Acta Pharm. Sin. B 2019, 9, 304−315.
Soumya S. Ray − RA Capital, Boston, Massachusetts 02116,
United States
Eric S. Fischer − Department of Biological Chemistry and
Molecular Pharmacology, Harvard Medical School, Boston,
Massachusetts 02115, United States; Department of Cancer
Biology, Dana-Farber Cancer Institute, Boston, Massachusetts
(7) Liu, C.; Lu, H.; Wang, H.; Loo, A.; Zhang, X.; Yang, G.; Kowal, C.;
Delach, S.; Wang, Y.; Goldoni, S.; Hastings, W. D.; Wong, K.; Gao, H.;
Meyer, M. J.; Moody, S. E.; LaMarche, M. J.; Engelman, J. A.; Williams,
J. A.; Hammerman, P. S.; Abrams, T. J.; Mohseni, M.; Caponigro, G.;
Hao, H. X. Combinations with Allosteric SHP2 Inhibitor TNO155 to
Block Receptor Tyrosine Kinase Signaling. Clin. Cancer Res. 2021, 27,
0
2215, United States; orcid.org/0000-0001-7337-6306
Gregory D. Cuny − Department of Pharmacological and
Pharmaceutical Sciences, University of Houston, Houston,
Texas 77204, United States; orcid.org/0000-0002-3188-
3
(
42−354.
8) LaRochelle, J. R.; Fodor, M.; Xu, X.; Durzynska, I.; Fan, L.; Stams,
4
748
T.; Chan, H. M.; LaMarche, M. J.; Chopra, R.; Wang, P.; Fortin, P. D.;
Acker, M. G.; Blacklow, S. C. Structural and Functional Consequences
of Three Cancer-Associated Mutations of the Oncogenic Phosphatase
SHP2. Biochemistry 2016, 55, 2269−2277.
Complete contact information is available at:
https://pubs.acs.org/10.1021/acs.biochem.1c00377
(
9) Tsutsumi, R.; Ran, H.; Neel, B. G. Off-target inhibition by active
site-targeting SHP2 inhibitors. FEBS Open Bio 2018, 8, 1405−1411.
10) Yuan, X.; Bu, H.; Zhou, J.; Yang, C. Y.; Zhang, H. Recent
Funding
This work was supported by The Quadrangle Fund for
Advancing and Seeding Translational Research at Harvard
Medical School (S.C.B.) and National Institutes of Health Grant
R35 CA220340 (S.C.B.).
(
Advances of SHP2 Inhibitors in Cancer Therapy: Current Develop-
ment and Clinical Application. J. Med. Chem. 2020, 63, 11368−11396.
(11) Garcia Fortanet, J.; Chen, C. H.; Chen, Y. N.; Chen, Z.; Deng, Z.;
Firestone, B.; Fekkes, P.; Fodor, M.; Fortin, P. D.; Fridrich, C.;
Grunenfelder, D.; Ho, S.; Kang, Z. B.; Karki, R.; Kato, M.; Keen, N.;
LaBonte, L. R.; Larrow, J.; Lenoir, F.; Liu, G.; Liu, S.; Lombardo, F.;
Majumdar, D.; Meyer, M. J.; Palermo, M.; Perez, L.; Pu, M.; Ramsey,
T.; Sellers, W. R.; Shultz, M. D.; Stams, T.; Towler, C.; Wang, P.;
Williams, S. L.; Zhang, J. H.; LaMarche, M. J. Allosteric Inhibition of
SHP2: Identification of a Potent, Selective, and Orally Efficacious
Phosphatase Inhibitor. J. Med. Chem. 2016, 59, 7773−7782.
Notes
The authors declare the following competing financial
interest(s): S.C.B. is a member of the SAB of Erasca, Inc., is
an advisor to MPM Capital, and is a consultant on unrelated
projects for IFM, Odyssey Therapeutics, Scorpion Therapeutics,
and Ayala Therapeutics. S.R. is an entrepreneur in residence at
RA Capital.
(12) Nichols, R. J.; Haderk, F.; Stahlhut, C.; Schulze, C. J.; Hemmati,
ACKNOWLEDGMENTS
The authors thank Jon Aster and members of the Blacklow
laboratory for helpful discussions.
G.; Wildes, D.; Tzitzilonis, C.; Mordec, K.; Marquez, A.; Romero, J.;
Hsieh, T.; Zaman, A.; Olivas, V.; McCoach, C.; Blakely, C. M.; Wang,
Z.; Kiss, G.; Koltun, E. S.; Gill, A. L.; Singh, M.; Goldsmith, M. A.;
Smith, J. A. M.; Bivona, T. G. RAS nucleotide cycling underlies the
SHP2 phosphatase dependence of mutant BRAF-, NF1- and RAS-
driven cancers. Nat. Cell Biol. 2018, 20, 1064−1073.
(13) LaMarche, M. J.; Acker, M.; Argintaru, A.; Bauer, D.; Boisclair, J.;
Chan, H.; Chen, C. H.; Chen, Y. N.; Chen, Z.; Deng, Z.; Dore, M.;
Dunstan, D.; Fan, J.; Fekkes, P.; Firestone, B.; Fodor, M.; Garcia-
Fortanet, J.; Fortin, P. D.; Fridrich, C.; Giraldes, J.; Glick, M.;
Grunenfelder, D.; Hao, H. X.; Hentemann, M.; Ho, S.; Jouk, A.; Kang,
Z. B.; Karki, R.; Kato, M.; Keen, N.; Koenig, R.; LaBonte, L. R.; Larrow,
J.; Liu, G.; Liu, S.; Majumdar, D.; Mathieu, S.; Meyer, M. J.; Mohseni,
M.; Ntaganda, R.; Palermo, M.; Perez, L.; Pu, M.; Ramsey, T.; Reilly, J.;
Sarver, P.; Sellers, W. R.; Sendzik, M.; Shultz, M. D.; Slisz, J.; Slocum,
K.; Smith, T.; Spence, S.; Stams, T.; Straub, C.; Tamez, V., Jr.; Toure, B.
■
REFERENCES
■
(
1) Bentires-Alj, M.; Paez, J. G.; David, F. S.; Keilhack, H.; Halmos, B.;
Naoki, K.; Maris, J. M.; Richardson, A.; Bardelli, A.; Sugarbaker, D. J.;
Richards, W. G.; Du, J.; Girard, L.; Minna, J. D.; Loh, M. L.; Fisher, D.
E.; Velculescu, V. E.; Vogelstein, B.; Meyerson, M.; Sellers, W. R.; Neel,
B. G. Activating mutations of the noonan syndrome-associated SHP2/
PTPN11 gene in human solid tumors and adult acute myelogenous
leukemia. Cancer Res. 2004, 64, 8816−8820.
2) Tartaglia, M.; Niemeyer, C. M.; Fragale, A.; Song, X.; Buechner, J.;
Jung, A.; Hahlen, K.; Hasle, H.; Licht, J. D.; Gelb, B. D. Somatic
mutations in PTPN11 in juvenile myelomonocytic leukemia, myelodys-
(
2
608
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609

Biochemistry
pubs.acs.org/biochemistry
Article
B.; Towler, C.; Wang, P.; Wang, H.; Williams, S. L.; Yang, F.; Yu, B.;
Zhang, J. H.; Zhu, S. Identification of TNO155, an Allosteric SHP2
Inhibitor for the Treatment of Cancer. J. Med. Chem. 2020, 63, 13578−
first-in-class CDK2 selective degrader for AML differentiation therapy.
Nat. Chem. Biol. 2021, 17, 567.
(30) Zhang, F.; Wu, Z.; Chen, P.; Zhang, J.; Wang, T.; Zhou, J.; Zhang,
H. Discovery of a new class of PROTAC BRD4 degraders based on a
dihydroquinazolinone derivative and lenalidomide/pomalidomide.
Bioorg. Med. Chem. 2020, 28, 115228.
(31) LaRochelle, J. R.; Fodor, M.; Vemulapalli, V.; Mohseni, M.;
Wang, P.; Stams, T.; LaMarche, M. J.; Chopra, R.; Acker, M. G.;
Blacklow, S. C. Structural reorganization of SHP2 by oncogenic
mutations and implications for oncoprotein resistance to allosteric
inhibition. Nat. Commun. 2018, 9, 4508.
1
3594.
14) Ma, C.; Gao, P.; Hu, S.; Xu, Z.; Han, H.; Wu, X.; Kang, D. Novel
heterocyclic derivatives useful as SHP2 inhibitors. WO 2018172984,
018.
15) Ou, S. I.; Koczywas, M.; Ulahannan, S.; Janne, P.; Pacheco, J.;
(
2
(
Burris, H.; McCoach, C.; Wang, J. S.; Gordon, M.; Haura, E.; Riess, J.
W.; Zhu, V.; Ng, K.; Eckhardt, S. G.; Capasso, A.; Dua, R.; Chen, A.;
Wang, Z.; Hayes, J.; Nichols, R.; Bivona, T. The SHP2 Inhibitor RMC-
4
630 in Patients with KRAS-Mutant Non-Small Cell Lung Cancer:
(32) Zhang, D.; Baek, S. H.; Ho, A.; Kim, K. Degradation of target
protein in living cells by small-molecule proteolysis inducer. Bioorg.
Med. Chem. Lett. 2004, 14, 645−648.
Preliminary Evaluation of a First-in-Man Phase 1 Clinical Trial. Sixth
AACR-IASLC International Joint Conference: Lung Cancer Transla-
tional Science from the Bench to the Clinic, January 11−14, 2020, San
Diego, CA; Poster A12.
(33) Zorba, A.; Nguyen, C.; Xu, Y.; Starr, J.; Borzilleri, K.; Smith, J.;
Zhu, H.; Farley, K. A.; Ding, W.; Schiemer, J.; Feng, X.; Chang, J. S.;
Uccello, D. P.; Young, J. A.; Garcia-Irrizary, C. N.; Czabaniuk, L.;
Schuff, B.; Oliver, R.; Montgomery, J.; Hayward, M. M.; Coe, J.; Chen,
J.; Niosi, M.; Luthra, S.; Shah, J. C.; El-Kattan, A.; Qiu, X.; West, G. M.;
Noe, M. C.; Shanmugasundaram, V.; Gilbert, A. M.; Brown, M. F.;
Calabrese, M. F. Delineating the role of cooperativity in the design of
potent PROTACs for BTK. Proc. Natl. Acad. Sci. U. S. A. 2018, 115,
E7285−E7292.
(
16) Albrecht, B. K.; Giordanetto, F.; Greisman, J. B.; Maragakis, P.;
Taylor, A. M.; Walters, P. SHP2 Phosphatase inhibitors and methods of
use thereof. WO 2018057884, 2018.
(
17) Lu, H.; Liu, C.; Huynh, H.; Le, T. B. U.; LaMarche, M. J.;
Mohseni, M.; Engelman, J. A.; Hammerman, P. S.; Caponigro, G.; Hao,
H. X. Resistance to allosteric SHP2 inhibition in FGFR-driven cancers
through rapid feedback activation of FGFR. Oncotarget 2020, 11, 265−
(34) Wang, B.; Wu, S.; Liu, J.; Yang, K.; Xie, H.; Tang, W.
281.
Development of selective small molecule MDM2 degraders based on
(
18) Aay, N.; Buckl, A.; Gill, A.; Jogalekar, A.; Kiss, G.; Koltun, E. S.;
nutlin. Eur. J. Med. Chem. 2019, 176, 476−491.
Mellem, K.; Semko, C.; Won, W. 2,5-Disubstituted 3-Methyl Pyrazines
and 2,5,6-Trisubstituted 3-Methyl Pyrazines as Allosteric Shp2 Inhibitors;
Revolution Medicines Inc., 2019.
(35) Li, Y.; Yang, J.; Aguilar, A.; McEachern, D.; Przybranowski, S.;
Liu, L.; Yang, C. Y.; Wang, M.; Han, X.; Wang, S. Discovery of MD-224
as a First-in-Class, Highly Potent, and Efficacious Proteolysis Targeting
Chimera Murine Double Minute 2 Degrader Capable of Achieving
Complete and Durable Tumor Regression. J. Med. Chem. 2019, 62,
(
19) Donovan, K. A.; An, J.; Nowak, R. P.; Yuan, J. C.; Fink, E. C.;
Berry, B. C.; Ebert, B. L.; Fischer, E. S. Thalidomide promotes
degradation of SALL4, a transcription factor implicated in Duane
Radial Ray syndrome. eLife 2018, 7, e38430.
4
(
48−466.
36) Wang, M.; Lu, J.; Wang, M.; Yang, C. Y.; Wang, S. Discovery of
(
20) Kabsch, W. Xds. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010,
6, 125−132.
21) Emsley, P.; Cowtan, K. Coot: model-building tools for molecular
graphics. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2004, 60, 2126−
132.
22) Afonine, P. V.; Grosse-Kunstleve, R. W.; Echols, N.; Headd, J. J.;
SHP2-D26 as a First, Potent, and Effective PROTAC Degrader of
6
(
SHP2 Protein. J. Med. Chem. 2020, 63, 7510−7528.
(37) Yang, X.; Wang, Z.; Pei, Y.; Song, N.; Xu, L.; Feng, B.; Wang, H.;
Luo, X.; Hu, X.; Qiu, X.; Feng, H.; Yang, Y.; Zhou, Y.; Li, J.; Zhou, B.
Discovery of thalidomide-based PROTAC small molecules as the
highly efficient SHP2 degraders. Eur. J. Med. Chem. 2021, 218, 113341.
2
(
Moriarty, N. W.; Mustyakimov, M.; Terwilliger, T. C.; Urzhumtsev, A.;
Zwart, P. H.; Adams, P. D. Towards automated crystallographic
structure refinement with phenix.refine. Acta Crystallogr., Sect. D: Biol.
Crystallogr. 2012, 68, 352−367.
(
23) Moriarty, N. W.; Grosse-Kunstleve, R. W.; Adams, P. D.
electronic Ligand Builder and Optimization Workbench (eLBOW): a
tool for ligand coordinate and restraint generation. Acta Crystallogr.,
Sect. D: Biol. Crystallogr. 2009, 65, 1074−1080.
(24) Chen, V. B.; Arendall, W. B., 3rd; Headd, J. J.; Keedy, D. A.;
Immormino, R. M.; Kapral, G. J.; Murray, L. W.; Richardson, J. S.;
Richardson, D. C. MolProbity: all-atom structure validation for
macromolecular crystallography. Acta Crystallogr., Sect. D: Biol.
Crystallogr. 2010, 66, 12−21.
(25) Morin, A.; Eisenbraun, B.; Key, J.; Sanschagrin, P. C.; Timony,
M. A.; Ottaviano, M.; Sliz, P. Collaboration gets the most out of
software. eLife 2013, 2, No. e01456.
(26) Lin, K. M.; Lin, S. J.; Lin, J. H.; Lin, P. Y.; Teng, P. L.; Wu, H. E.;
Yeh, T. H.; Wang, Y. P.; Chen, M. R.; Tsai, C. H. Dysregulation of Dual-
Specificity Phosphatases by Epstein-Barr Virus LMP1 and Its Impact on
Lymphoblastoid Cell Line Survival. J. Virol. 2020, 94, e01837-19.
(27) Winter, G. E.; Buckley, D. L.; Paulk, J.; Roberts, J. M.; Souza, A.;
Dhe-Paganon, S.; Bradner, J. E. DRUG DEVELOPMENT. Phthali-
mide conjugation as a strategy for in vivo target protein degradation.
Science 2015, 348, 1376−1381.
(28) Vannam, R.; Sayilgan, J.; Ojeda, S.; Karakyriakou, B.; Hu, E.;
Kreuzer, J.; Morris, R.; Herrera Lopez, X. I.; Rai, S.; Haas, W.;
Lawrence, M.; Ott, C. J. Targeted degradation of the enhancer lysine
acetyltransferases CBP and p300. Cell Chem. Biol. 2021, 28, 503.
(29) Wang, L.; Shao, X.; Zhong, T.; Wu, Y.; Xu, A.; Sun, X.; Gao, H.;
Liu, Y.; Lan, T.; Tong, Y.; Tao, X.; Du, W.; Wang, W.; Chen, Y.; Li, T.;
Meng, X.; Deng, H.; Yang, B.; He, Q.; Ying, M.; Rao, Y. Discovery of a
2
609
https://doi.org/10.1021/acs.biochem.1c00377
Biochemistry 2021, 60, 2593−2609