Synthesis, gene-silencing activity and nuclease resistance of 3′-3′-linked double short hairpin RNA

Article abstract of DOI:10.1016/j.bmc.2010.10.001

To improve the nuclease resistance of siRNA while reducing its induction of an innate immune response and maintaining its biological activity for possible therapeutic application, we designed and synthesized a series of double short hairpin RNAs (dshRNAs)

Full text of DOI:10.1016/j.bmc.2010.10.001

Bioorganic & Medicinal Chemistry 18 (2010) 8277–8283
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Synthesis, gene-silencing activity and nuclease resistance of 30–30-linked
double short hairpin RNA
Hirofumi Masuda a, , Naoki Watanabe a, Haruna Naruoka a, Seigo Nagata a, Kazuchika Takagaki a,
⇑
Takeshi Wada b, Junichi Yano a
a Discovery Research Laboratories, Nippon Shinyaku Co., Ltd, 3-14-1 Sakura, Tsukuba, Ibaraki 305-0003, Japan
b Department of Medical Genome Sciences, Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8562, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
To improve the nuclease resistance of siRNA while reducing its induction of an innate immune response
and maintaining its biological activity for possible therapeutic application, we designed and synthesized
a series of double short hairpin RNAs (dshRNAs). Each dshRNA consisted of two identical short hairpin
RNAs (shRNAs) linked at their 30 ends by glycerol. The dshRNAs were synthesized on a glycerol-deriva-
tized solid support from amidites with 2-cyanoethoxymethyl (CEM) as the 20-hydroxyl protecting group.
Synthesis was carried out in a single run on a DNA/RNA synthesizer, without the need for enzymatic liga-
tion. The dshRNAs showed structure-dependent gene-silencing activity at the protein level, and dshRNAs
in which the 30 end of the two sense regions were linked showed especially high activity. Inclusion of 20-
O-methyluridine residues in the loop region was associated with 1.6- to 2.4-fold lower induction of inter-
Received 17 August 2010
Revised 30 September 2010
Accepted 1 October 2010
Available online 2 November 2010
Keywords:
30–30-Linked double short hairpin RNA
Gene-silencing activity
Nuclease resistance
feron-a than was siRNA, without loss of gene-silencing activity. dshRNA also showed higher exonuclease
Innate immune response
resistance than siRNA or canonical shRNA. Our studies provide a new approach to gene silencing based on
the concept of linking the 30 end of the sense regions of two shRNA molecules to form a double shRNA.
Ó 2010 Elsevier Ltd. All rights reserved.
1. Introduction
nuclease resistance. For example, siRNA incorporating deoxyribo-
nucleotides or phosphorothioate linkages,5 20-O-methyl nucleo-
In RNA interference (RNAi), the translation or transcription of
mRNA is suppressed by small double-stranded RNA (dsRNA). In
mammalian cells, dsRNA 21–23 base pairs (bp) in length known
as small interfering RNA (siRNA) is produced by the cleavage of
long dsRNA by the endoribonuclease Dicer.1 The siRNA is loaded
into the RNA-induced silencing complex (RISC), where the duplex
is unwound and the antisense strand hybridizes with the comple-
mentary mRNA sequence, leading to cleavage of the target mRNA
by the effector complex. Because siRNA can suppress protein
expression in a sequence-specific manner, it is expected to have
therapeutic application as a new class of drug with a high specificity
for its molecular target, and such applications are under active
investigation. siRNA therapy is under development for age-related
macular degeneration, respiratory syncytial virus infection, and
hepatitis B, among other diseases.2
tides,6 or locked nucleic acid nucleotides,7,8 has been prepared
for this purpose. However, it is better to avoid excessive chemical
modification of siRNA because it tends to reduce gene-silencing
activity.9 The major serum nuclease is a 30–50 exonuclease,10 to
which the 30-overhang region of siRNA is especially susceptible.
Chemical modification of the 30 end of oligonucleotides, particu-
larly siRNA,11–13 is important to provide resistance to 30–50 exonuc-
leases. A duplex structure of RNA also contributes to a relatively
high resistance to single-strand-specific exonucleases and
endonucleases.14,15
With these considerations in mind, we set out to synthesize
RNA with greater nuclease resistance and more-potent gene-
silencing activity than siRNA. We wanted these improvements to
be, as far as possible, inherent in the molecular design of the
RNA rather than the modification of its constituent nucleotides
or the sugar-phosphate backbone. We hypothesized that a double
short hairpin RNA (dshRNA) consisting of two identical short hair-
pin RNA (shRNA) molecules linked through their 30 ends would be
particularly resistant to 30–50 exonucleases because there would be
no free 30 end for such nucleases to act on. However, Dicer prefer-
entially cleaves RNA structures with 30 overhangs or open duplex
termini.16,17 We wanted to know whether our dshRNA, which lacks
both of these features, could be processed in the cell and show tar-
geted gene-silencing activity.
However, there are major obstacles to the practical therapeutic
use of siRNA, including degradation by nucleases (particularly serum
nucleases) and the risk of off-target effects or an innate immune
response. Chemical modification of oligonucleotides is one of a
number of methods that have been used to solve these problems.3,4
Several kinds of chemical modification have been used to increase
⇑
Corresponding author. Tel.: +81 29 850 6242; fax: +81 29 850 6217.
E-mail address: h.toyoshima@po.nippon-shinyaku.co.jp (H. Masuda).
0968-0896/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2010.10.001

8278
H. Masuda et al. / Bioorg. Med. Chem. 18 (2010) 8277–8283
Figure 1. Strategy for solid-phase synthesis of dshRNA. (i) DMTr protection of glycerol. DMTrCl (2.1 equiv) in tetrahydrofuran/pyridine (1:1 [v/v]), rt, 1.5 h. (ii) Attachment of
succinyl linker to glycerol. Succinic anhydride (3.0 equiv) and N,N-dimethyl-4-aminopyridine (0.4 equiv) in pyridine, 35 °C, 3 h. (iii) Attachment of glycerol to long-chain
alkylamine CPG solid support through succinyl linker. N,N-Dimethyl-4-aminopyridine (0.5 equiv), water-soluble carbodiimide (7 equiv), and CPG (0.1 equiv) in pyridine, rt,
three days. (iv) Oligonucleotide synthesis on DNA/RNA synthesizer (X, nucleotide in duplex region; Y, nucleotide in loop region). (v) Cleavage from solid support and
deprotection.
Recognition of siRNA or dsRNA by Toll-like receptors (TLRs) in-
duces an innate immune response.18 Although our main purpose in
designing dshRNA was to improve nuclease resistance without
nucleoside modification, we also wished to include structural fea-
tures that would prevent its recognition by TLRs.
In the present study, we synthesized a series of dshRNA mole-
cules in which two identical shRNA elements were linked through
their 30 ends by glycerol and evaluated their gene-silencing activity
at the protein level. Activity was observed, and the highest activity
was obtained when the 30 ends of the antisense sequences were far
apart. Compared to typical siRNA, dshRNA also showed higher exo-
nuclease resistance and, when 20-O-methyluridine residues were
included in the loops, lower immunostimulatory activity.
series of dshRNAs. Each dshRNA was synthesized in a single run
on a DNA/RNA synthesizer without the need for enzymatic liga-
tion. Although 30–30-linked single-stranded DNA oligomers with
no duplex regions have been synthesized as immunomers with en-
hanced immunostimulatory activity,22 our study provides the first
reported example of 30–30-linked shRNAs. Synthesis was carried
out on a solid support derivatized with glycerol (Fig. 1), and the fi-
nal products (Figs. 2 and 4) were identified by electrospray ioniza-
tion (ESI) mass spectrometry. The dshRNAs were all targeted to the
same mRNA sequence corresponding to a part of the antiapoptotic
protein B-cell lymphoma 2 (Bcl-2).23
2.2. Structure and gene-silencing activity
We tested the gene-silencing activity of our dshRNAs by mea-
suring their suppression of Bcl-2 protein production in A431 cells.
First, we measured the gene-silencing activity of dsh1–5 at concen-
trations of 3 and 10 nM (Fig. 3). The positive control was B717, an
siRNA with known Bcl-2-suppressing activity.23
At 10 nM, weak suppression of Bcl-2 was observed with dsh2, in
which the 30 end of the core 19-nt antisense sequence was directly
attached to the glycerol linker. However, when the 30 end of the
core 19-nt antisense sequence was separated from the glycerol
2. Results and discussion
2.1. Synthesis
We have previously developed a new methodology for the syn-
thesis of RNA from amidites with a 2-cyanoethoxymethyl (CEM)
20-O-protecting group.19,20 The new method allows efficient syn-
thesis of RNA oligomers up to at least 170 nucleotides in length.21
In the present study, we used the CEM method to synthesize a
Figure 2. Sequences and structures of synthetic dshRNAs (first series; dsh1–5). dsh1: 22-bp duplex, 2-nt single-stranded link between duplex and glycerol, attachment of
shRNA to glycerol through antisense region. dsh2: 22-bp duplex, attachment to glycerol through antisense region. dsh3: 22-bp duplex, attachment to glycerol through sense
region. dsh4: 19-bp duplex, 2-nt single-stranded link between duplex and glycerol, attachment to glycerol through antisense region. dsh5: 22-bp duplex, 4-nt single-stranded
link between duplex and glycerol, attachment to glycerol through antisense region.

H. Masuda et al. / Bioorg. Med. Chem. 18 (2010) 8277–8283
8279
to the loop region (dsh3) or to glycerol (dsh2). In siRNAs, the integ-
rity of the 50 end, but not the 30 end, of the antisense sequence is
important for the initiation of RNAi.24–26 For example, siRNAs con-
jugated to peptides through the 30 end of the antisense sequence
show potent gene-silencing activity.27 In contrast, our results with
dshRNA show that direct linking of the 30 ends of the two antisense
sequences through glycerol reduced the activity of the antisense se-
quences, whereas similarly linking the 30 ends of the two sense se-
quences preserved the activity of the antisense sequences. These
results suggest that whichever sequence is directly linked to
glycerol cannot participate in RNAi-mediated gene silencing, so
that proper design of dshRNAs may help decrease off-target effects
of the sense sequence. To investigate possible differences among
fragments of dsh1–5 obtained after processing by Dicer, we treated
these dshRNAs with purified recombinant Dicer. However, no frag-
ments were observed under conditions under which the corre-
sponding shRNA, with its 2-nt 30 overhang, was completely
digested (data not shown). This may be due to the absence of both
a 30 overhang and an open duplex terminal structure on dshRNAs,
either of which is necessary for efficient cleavage of dsRNAs by
Dicer.17,28
Figure 3. Suppression of Bcl-2 gene expression by dsh1–5. Western blot analysis of
the expression of Bcl-2 protein in A431 cells 72 h after transfection with dshRNA
complexed with LIC-101. Actin was used as an internal control. Luciferase GL3
siRNA was used as the negative control and B717 siRNA as the positive control. GL3
sense strand, 50-CUUACGCUGAGUACUUCGAdTdT-30; antisense strand, 50-UCGAA-
GUACUCAGCGUAAG-30. B717 sense strand, 50-GUGAAGUCAACAUGCCUGCdTdT-30;
antisense strand, 50-GCAGGCAUGUUGACUUCACdTdT-30.
linker by two (dsh1) or four (dsh5) uridine residues, strong activity
was observed at 10 nM. Therefore, a number of nucleotides inter-
vening between the 30 end of the core antisense sequence and
the linker was required for strong activity. When the duplex region
of dsh1 was shortened by 3 bp to give dsh4, no activity was ob-
served at 3 nM, although moderate activity was observed at
10 nM, so that a duplex of more than 19 bp was required for strong
activity. When the shRNA elements were linked through their
sense instead of their antisense sequences, as in dsh3, Bcl-2 was al-
most completely suppressed at only 3 nM. This activity was even
higher than that of the positive-control siRNA, B717.
To further explore the relationship between the structure of
dshRNAs and their gene-silencing activity, we synthesized a series
Because dshRNAs contain twice the number of mole equivalents
of the antisense sequence per molecule as the corresponding siRNA
available for participation in gene silencing, we judged that, among
dsh1–5, only dsh3 showed gene-silencing activity comparable to
that of siRNA. dsh3 has the same 22-bp stem duplex as dsh2. The
main difference between the highly active dsh3 and the inactive
dsh2 is whether the 30 end of the antisense sequence is attached
Figure 5. Suppression of Bcl-2 gene expression by dsh2, dsh3, and dsh6–10.
dshRNAs were diluted twofold relative to siRNA. See the legend to Fig. 3 for further
details.
Figure 4. Sequences and structures of synthetic dshRNAs (second series; dsh6–10). In all these dshRNAs, attachment of shRNA to glycerol is through the sense region. dsh6:
22-bp duplex, 2-nt single-stranded link between duplex and glycerol. dsh7: 24-bp duplex. dsh8: 22-bp duplex, 3-nt 50 tails. dsh9: 22-bp duplex, 1,3-dihydroxypropyl
phosphate spacer (w) between duplex and glycerol. dsh10: 22-bp duplex, loop contains 20-O-methyluridine (U).

8280
H. Masuda et al. / Bioorg. Med. Chem. 18 (2010) 8277–8283
of dshRNAs based on dsh3 with modifications to the loop or 50 ends
and including a conserved 22-bp duplex (dsh6–10; Fig. 4), and
tested their activity (Fig. 5). In these experiments, the dshRNAs were
diluted twofold relative to the siRNA B717 to allow for the fact that
they have twice as many antisense sequences per molecule. dsh8,
which is identical to dsh3 except for a 3-nt uridine tail at the 50
end of the antisense region of each 22-bp duplex, showed weaker
activity than dsh3. This demonstrates that activity is sensitive to
the structure around the 50 end of the antisense region of the duplex,
and that even a short extension of the 50 end can reduce activity. In
contrast, dsh6, which is identical to dsh3 except for a 2-nt extension
at the 30 end of the sense region of the duplex, showed almost the
same potency as dsh3. The insertion of a 1,3-dihydroxypropyl phos-
phate spacer between the 30 end of each sense region and the
glycerol linker of dsh3 to give dsh9 did not affect the activity, show-
ing that activity was not sensitive to the distance of the duplexes
from theglycerol linker. Thisis also consistentwith thesimilar activ-
ity observed for dsh1 (2-nt single-stranded link) and dsh5 (4-nt sin-
gle-stranded link). In contrast, dsh7, whose duplex is 2 bp longer
than that of dsh3, showed no detectable activity, indicating that
the length of the stem duplexes strongly affects the potency.
In designing dsh10 with 20-O-methylated loop residues to sup-
press the innate immune response, we assumed that two natural
nucleotides would be needed to form an overhang at the 30 end
of the 19-nt antisense sequence after enzymatic processing in
the cell for high silencing activity of the antisense sequences.
Therefore, we designed the dshRNA to include two natural nucleo-
tides at the 30 end of the 19-nt antisense sequence and four 20-O-
methyluridines as the loop components. dsh10 was fully active,
so that activity was not affected by loop size or the nature of the
loop components. Dicer is known to cleave long dsRNA or shRNA
into 21–23-bp dsRNA, and it is unable to cleave dsRNA or shRNA
stems less than 19 bp in length.29 The fact that we observed strong
activity only at a duplex length of 22 nt is consistent with the inter-
pretation that the gene-silencing activity of dshRNA was mediated
by the RNAi pathway. This is because the effective duplex length
for RNAi is around 21–23 nt, with activity falling off for shorter
or longer duplexes, as observed in our experiments. Although we
did not observe dshRNA cleavage in vitro by purified Dicer, it is
probable that, in cells, the action of another nuclease on the sin-
gle-stranded part of the dshRNAs produced a 30 overhang or an
open duplex terminal structure, allowing subsequent cleavage by
Dicer. We hope to directly investigate the mechanism of dshRNA
processing in cells in a future study.
Figure 6. Induction of IFN-
mononuclear cells were treated for 24 h with dshRNA complexed with LIC-101 and
IFN- levels were measured by ELISA. Maltose solution (10%) was used as the
a by dshRNA and siRNA. Human peripheral blood
a
negative control and B717 siRNA as the positive control.
2.4. Nuclease resistance
We assessed the resistance of dsh3 to the 30–50 exonuclease
snake venom phosphodiesterase (SVPD). Before incubation with
SVPD, RNA samples were annealed to form the duplex structures.
After incubation, the percentage of intact full-length RNA remain-
ing was determined by high performance liquid chromatography
(HPLC). siRNA was completely digested after incubation for 2 h
(Fig. 7). shRNA, with a two-nucleotide 30 overhang, was digested
to the extent of 56% under the same conditions, while dsh3, which
is 30–30-linked through glycerol, was only digested to the extent of
16%. Thus, the rank order of SVPD resistance was
dshRNA > shRNA > siRNA, with dshRNA being the most resistant
of all the RNA structures tested.
3. Conclusion
We have synthesized a series of double short hairpin RNAs
(dshRNAs) consisting of two identical short-hairpin elements
linked by glycerol through their 30 ends. The dshRNAs were synthe-
sized from the CEM amidites entirely on a DNA/RNA synthesizer
without the need for enzymatic ligation. Some of the dshRNAs
showed gene-silencing activity as potent as that of siRNA with
the same antisense sequence, and activity was highly dependent
on the structure of the dshRNA. In particular, when the core
2.3. Induction of interferon-a (IFN-a)
We assessed the ability of dsh3 and dsh6–10 to induce an in-
nate immune response as measured by the production of IFN-
by human peripheral blood mononuclear cells (Fig. 6). dsh3 and
dsh6–9 showed 1.1- to 2.6-fold higher induction of IFN- than
did siRNA. In contrast, dsh10, which differs from dsh3 only in the
loop region, showed 1.6- to 2.4-fold lower induction of IFN- than
siRNA, and this lower induction of IFN- was achieved with no loss
of gene-silencing activity. The lower induction of IFN- is probably
a
a
a
a
a
attributable to the use of 20-O-methyluridine residues in the loop.
It has previously been shown that the inclusion of 20-O-methyluri-
dine residues in an siRNA sequence can suppress immune activa-
tion,30 but there are no reports of the suppression of cytokine
induction by the inclusion of 20-O-methyluridine residues in
shRNA. We initially thought that dshRNA would not be recognized
by TLRs31 because of the reversal of the direction of the double he-
lix within the molecule. However, our results suggest that dshRNA
is indeed recognized by TLRs, except when the loop is modified.
Modification of the loop region of shRNA may be a promising
general strategy for suppressing the induction of cytokines.
Figure 7. Digestion of siRNA, shRNA, and dshRNA by snake venom phosphodies-
terase. siRNA, B717; shRNA, 50- GUGAAGUCAACAUGCCUGCCCAACUUUCUGGGCA
GGCAUGUUGACUUCACUU-30; dshRNA, dsh3. Intact, full-length RNA remaining was
determined by reverse-phase HPLC.

H. Masuda et al. / Bioorg. Med. Chem. 18 (2010) 8277–8283
8281
effector duplex was identical, linking the 30 end of the two sense
regions with glycerol was associated with especially high gene-
silencing activity, whereas directly linking the 30 ends of the two
antisense regions with glycerol resulted in a total loss of activity.
dshRNA with 20-O-methyluridine residues in the loop showed low-
4.3.2. Preparation of 4-(1,3-bis(4,40-
dimethoxytriphenylmethyloxy)propan-2-yloxy)-4-oxobutanoic
acid (2)32
1,3-Bis(4,40-dimethoxytriphenylmethyloxy)propan-2-ol
(1 g)
was co-evaporated with pyridine and dried in vacuo for 0.5 h.
The residue was dissolved in pyridine (2 mL) and treated with
N,N-dimethylaminopyridine (70 mg; 0.4 equiv) and succinic anhy-
dride (430 mg; 3.0 equiv) for 3 h at 35 °C. After confirmation of the
disappearance of the starting material by TLC, MeOH (5 mL) was
added and the mixture was evaporated to dryness. The residue
was dissolved in ethyl acetate (20 mL) and washed with ice-cold
0.5 M KH2PO4 aq (20 mL), and the aqueous layer was again ex-
tracted with ethyl acetate (20 mL). The combined organic layers
were washed successively with ice-cold 0.5 M KH2PO4 aq
(2 ꢀ 20 mL), water, and brine, dried over MgSO4, and concentrated
to afford the crude product as a white foam (1.14 g; quant.). 1H
NMR (300 MHz, CDCl3, d): 2.65 (s, 4H); 3.25–3.30 (m, 4H); 3.75
(s, 12H); 5.26–5.29 (m, 1H); 6.73–7.36 (m, 26H). 13C NMR
(75 MHz, CDCl3, d): 28.9, 29.2, 55.1, 61.8, 72.5, 85.8, 113.0, 126.6,
127.7, 128.1, 130.0, 135.9, 144.8, 158.4, 171.5, 176.8.
er induction of IFN-a than did siRNA. dshRNA also showed higher
exonuclease resistance than siRNA or canonical shRNA. Our results
suggest a new approach to gene silencing based on the concept of
linking the 30 ends of the sense regions of two shRNA molecules to
form a double shRNA. Our designed dshRNAs may represent a new
class of therapeutic RNA with high gene-silencing activity and exo-
nuclease resistance yet low cytokine induction.
4. Experimental
4.1. General methods
1H, 13C, and 31P NMR spectra were obtained on a Bruker DRX500
or DPX300 spectrometer, and chemical shifts are reported relative
to tetramethylsilane and referenced to the residual proton signal of
CDCl3 (7.25 ppm) for 1H NMR, CDCl3 (77.0 ppm) for 13C NMR, and
external 85% phosphoric acid for 31P NMR. UV spectra were mea-
sured with a Hitachi U-2810 double-beam spectrophotometer.
ESI mass spectra were recorded on a JEOL JMS-SX 102 mass spec-
trometer, and the calculated and observed masses of products
were equal within a tolerance of about 0.12%. Analytical HPLC
was performed on a Shimadzu system equipped with a Waters
4.3.3. Derivatization of CPG solid support (3)
The solid support was derivatized with glycerol as previously
described.32 Briefly, pyridine (9.8 mL) and triethylamine
(151 l
L) were added to a mixture of 4-(1,3-bis(4,40-dimethoxytri-
phenylmethyloxy)propan-2-yloxy)-4-oxobutanoic acid (710 mg),
N,N-dimethyl-4-aminopyridine (54 mg), 1-ethyl-3-(3-dimethylami-
nopropyl)carbodiimide hydrochloride (water-soluble carbodiimide;
1.19 g), and CPG solid support, and the mixture was shaken at
room temperature for three days. After filtration, the solid support
was washed successively with pyridine, MeOH, and CH2Cl2, and
dried in vacuo for 1 h. The solid support was transferred to a vial
containing capping solution (Ac2O, 1.0 mL; 2,6-lutidine, 1.4 mL;
tetrahydrofuran, 20 mL) and shaken for 2 h, then filtered, washed
successively with pyridine, MeOH, and CH2Cl2, and dried in vacuo
for 2 h. The loading was estimated by the absorbance of the trityl
XTerra (MS C18, 2.5
2.5
performed with Wako silica gel C-200, and thin-layer chromatog-
raphy (TLC) was carried out on Merck silica gel 60 F254 TLC alumi-
num sheets.
l
m, 4.6 mm ꢀ 50 mm) or XBridge (C18,
l
m, 4.6 mm ꢀ 50 mm) column. Column chromatography was
4.2. Materials
Reagents and solvents were purchased from commercial
suppliers. Long-chain alkylamine controlled-pore-glass (CPG)
beads (pore size, 1000 Å or 2000 Å) were from 3Prime (Aston, PA,
USA), anhydrous solvents were from Kanto Kagaku (Tokyo, Japan),
and snake venom phosphodiesterase was from Worthington
Biochemical (Lakewood, NJ, USA).
cation at 503 nm (e
, 76,000 Mꢁ1 cmꢁ1).
4.4. Synthesis of spacer
4.4.1. Preparation of 3-(4,40-
dimethoxytriphenylmethyloxy)propan-1-ol33
1,3-Propanediol (3 g) was co-evaporated with pyridine and
dried in vacuo for 0.5 h. The residue was dissolved in a mixture
of pyridine (80 mL) and tetrahydrofuran (100 mL), after which
4,40-dimethoxytriphenylmethyl chloride (3 ꢀ 0.35 equiv) was
added in three portions at a rate of one portion every hour. MeOH
(20 mL) was added and the mixture was stirred for 5 min and
evaporated to dryness at 35 °C. The residue was dissolved in ethyl
acetate (100 mL) and washed with ice-cold NaHCO3 aq. The aque-
ous layer was re-extracted with ethyl acetate (100 mL) and the
combined organic layers were washed with water and brine, dried
over Na2SO4, and concentrated. The residue was chromatographed
on silica gel (hexane:ethyl acetate:pyridine, 80:20:0.1 [v/v/v] and
then hexane:ethyl acetate:acetone:pyridine, 66:17:17:0.1 [v/v/v/
v]) to give a yellow oil (7.8 g, 52% yield). 1H NMR (300 MHz, CDCl3,
d): 1.81–1.89 (m, 2H); 3.25–3.29 (m, 2H); 3.74–3.78 (m, 2H); 3.79
(s, 6H); 6.81–7.68 (m, 13H).
4.3. Preparation of derivatized solid support
4.3.1. Preparation of 1,3-bis(4,40-
dimethoxytriphenylmethyloxy)propan-2-ol (1)32
1,2,3-Propanetriol (1 g) was co-evaporated with pyridine twice
and dried in vacuo for 0.5 h. The residue was dissolved in pyri-
dine:tetrahydrofuran (80 mL; 1:1 [v/v]), then molecular sieves 4A
(1 g) was added and the mixture was stirred for 5 min. 4,40-
Dimethoxytriphenylmethyl chloride (2.1 equiv) was added in three
equal portions at a rate of one portion every 0.5 h. MeOH (5 mL)
was added and the mixture was stirred for 5 min and filtered.
The filtrate was evaporated to dryness at 35 °C and the residue
was dissolved in ethyl acetate (100 mL) and washed with ice-cold
NaHCO3 aq. After re-extraction of the aqueous layer with ethyl ace-
tate (100 mL), the organic layers were combined, washed with
water and brine, dried over Na2SO4, and concentrated. The residue
was chromatographed on silica gel (hexane:ethyl acetate:triethyl-
amine, 80:20:0.5 [v/v/v], followed by hexane:ethyl acetate:ace-
tone:triethylamine, 66:17:17:0.5 [v/v/v/v]) to give a pale yellow
foam (7.3 g, 96% yield). 1H NMR (300 MHz, CDCl3, d): 2.3 (d, 1H);
3.20–3.35 (m, 4H); 3.75 (s, 12H); 3.88–3.95 (m, 1H); 6.73–7.40
(m, 26H). 13C NMR (75 MHz, CDCl3, d): 55.1, 64.2, 70.2, 85.9,
113.0, 126.7, 127.7, 128.1, 130.0, 135.9, 136.0, 144.8, 158.4.
4.4.2. Preparation of 3-(4,40-dimethoxytriphenylmethyloxy)-
propyl 2-cyanoethyl N,N-diisopropylphosphoramidite33
3-(4,40-Dimethoxytriphenylmethyloxy)propan-1-ol (2 g) was
co-evaporated with dry acetonitrile. After having being dried in
vacuo for 0.5 h, the residue was dissolved in dry acetonitrile
(21 mL), then treated with diisopropylamine tetrazolide (0.9 g;

8282
H. Masuda et al. / Bioorg. Med. Chem. 18 (2010) 8277–8283
1.0 equiv) and bis(N,N-diisopropyl)cyanoethoxyphosphite (1.75 g;
1.1 equiv) for 2.5 h at 40 °C. After confirmation of the disappear-
ance of the starting material by TLC, the mixture was evaporated
to dryness and the phosphoramidite was dissolved in CH2Cl2. The
mixture was transferred directly to the top of a silica gel column
(hexane:ethyl acetate:pyridine, 17:83:0.1 [v/v/v]) and chromato-
graphed to give the product as an oil (2.8 g, 91% yield). 1H NMR
(300 MHz, CDCl3, d): 1.10–1.21 (m, 12H), 1.85–1.95 (m, 2H);
2.52–2.57 (m, 2H); 3.14–3.18 (m, 2H); 3.49–3.82 (m, 6H); 3.76 (s,
6H); 6.79–7.44 (m, 13H). 13C NMR (75 MHz, CDCl3, d): 14.2, 20.2,
20.3, 21.0, 24.5, 24.6, 31.8, 31.9, 42.8, 43.0, 55.2, 58.2, 58.4, 60.1,
60.4, 60.7, 60.9, 85.8, 112.9, 117.6, 126.6, 127.7, 128.2, 130.0,
136.5, 145.2, 158.3. 31P NMR (202 MHz, CDCl3, d): 149.4.
(Dako, Glostrup, Denmark). b-Actin was detected with a goat poly-
clonal anti-actin antibody (Santa Cruz Biotechnology, Santa Cruz,
CA, USA) and horseradish-peroxidase-labeled anti-goat IgG (Dako).
Immunoreactive bands were visualized with the ECL Plus Western
blotting detection system (GE Healthcare, Piscataway, NJ, USA) and
analyzed with the ChemiDoc imaging system (Bio-Rad, Hercules,
CA, USA).
4.8. Determination of IFN-a in human peripheral blood
mononuclear cells (PBMCs)
Fresh human blood samples taken from three people were
mixed and Heparin Sodium Injection (Ajinomoto, Tokyo, Japan;
1 mL for every 10 mL of blood) and an equal volume of phos-
phate-buffered saline were added. The diluted blood was gently
layered onto Ficoll-Paque™ PLUS (GE Healthcare; 3 mL for every
10 mL of diluted blood), care being taken not to disturb the inter-
face. After centrifugation at 400g for 30 min at room temperature,
the PBMCs, which were located at the interface between the Ficoll-
Paque and the plasma, were collected, washed twice with phos-
phate-buffered saline, and resuspended in RPMI 1640 medium
containing 10% fetal bovine serum, 100 U/mL penicillin, and
4.5. Synthesis of dshRNA
We synthesized a series of dshRNAs on an Applied Biosystems
Expedite Model 8909 nucleic acid synthesizer from CEM amidites
prepared as previously described.19,20 The two shRNA elements
of the dshRNA were built up simultaneously on either end of the
glycerol molecule attached to the solid support (Fig. 1). 20-O-
Methyluridine residues were incorporated by the use of commer-
cially available 20-O-methyluridine amidites. Base deprotection
and cleavage from the solid support were accomplished in a single
step by treatment with 28% ammonia solution and EtOH (3:1 [v/v])
at 40 °C for 3 h and the CEM protecting group was then removed by
treatment with 0.67 M tetrabutylammonium fluoride in DMSO
containing 0.67% nitromethane at room temperature for 5–7 h.
After quenching of the deprotection reaction with Tris–HCl buffer,
pH 7.5, crude dshRNA was obtained by EtOH precipitation. The
dshRNA was purified by reverse-phase HPLC on an XTerra column
at 60 °C or an XBridge column at 80 °C in the 4,40-dimethoxytrityl
(DMTr)-off mode to give dsh1–10. dshRNA concentrations were
determined by measuring the absorbance at 260 nm in 1 M Tris–
HCl buffer, pH 7.5, containing 7 M urea at 90 °C to reduce the ef-
fects of secondary structure. The extinction coefficient of each
dshRNA was separately calculated by the nearest-neighbor approx-
imation method.34
100 lg/mL streptomycin. The cells were seeded in 48-well plates
at a density of 6 ꢀ 105 cells per well, and after incubation for 4 h
at 37 °C in 5% CO2 the cells were transfected with dshRNA com-
plexed with LIC-101. Twenty-four hours after transfection, the cul-
ture supernatant was collected and IFN-a was determined with the
Human Interferon Alpha enzyme-linked immunosorbent assay
(ELISA) Kit (PBL Biomedical Laboratories, Piscataway, NJ, USA)
according to the manufacturer’s protocol.
4.9. Digestion with snake venom phosphodiesterase (SVPD)
Each 14-lL RNA sample (10 lM) was diluted with 56 lL of
50 mM Tris–HCl buffer, pH 8.0, and the diluted sample was heated
at 99 °C for 2 min and cooled slowly to room temperature to allow
annealing to take place. SVPD (2
lL; 22.4 U) was added to give a to-
tal volume of 72 L, the mixture was incubated at 37 °C, and 10-lL
l
samples were taken at 0, 0.5, 1, 1.5, 2, and 24 h. After inactivation
of the enzyme by heating at 99 °C for 1 min, samples were ana-
lyzed by reverse-phase HPLC.
4.6. Calculated and observed masses of dshRNA
dsh1: calculated, 33349.5; observed, 33351.6. dsh2: calculated,
32124.8; observed, 32125.8. dsh3: calculated, 33349.5; observed,
33349.6. dsh4: calculated, 29477.2; observed, 29478.4. dsh5: cal-
culated, 34574.1; observed, 34576.5. dsh6: calculated, 34574.2;
observed, 34576.5. dsh7: calculated, 35891.0; observed, 35894.5.
dsh8: calculated, 34574.2; observed, 34577.6. dsh9: calculated,
33625.7; observed, 33629.5. dsh10: calculated, 32195.0; observed,
32198.0.
Acknowledgments
This research was supported in part by a grant from the New
Energy and Industrial Technology Development Organization
(NEDO) of Japan for its Functional RNA Project. Funding to pay
the Open Access publication charges for this article was provided
by Nippon Shinyaku Co., Ltd. We thank Dr. Gerald E. Smyth, Dis-
covery Research Laboratories, Nippon Shinyaku Co., Ltd, for helpful
discussions and suggestions during the preparation of the
manuscript.
4.7. Western blotting
A431 cells were seeded at a density of 3 ꢀ 105 cells per 6-cm
dish in Dulbecco’s modified Eagle’s medium supplemented with
10% fetal bovine serum at 37 °C in 5% CO2. The next day, the med-
ium was changed and the cells were transfected with dshRNA com-
plexed with the cationic liposome LIC-101 as previously
described.23 Seventy-two hours after transfection, protein was
extracted from the transfected cells with lysis buffer (50 mM
Tris–HCl, pH 7.5, containing 150 mM NaCl, 1% Nonidet P-40, and
protease inhibitor cocktail [Roche, Basel, Switzerland]). Cell extract
References and notes
1. Elbashir, S. M.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T. Nature 2001, 411,
494.
2. Castanotto, D.; Rossi, J. J. Nature 2009, 457, 426.
3. Bramsen, J. B.; Laursen, M. B.; Damgaard, C. K.; Lena, S. W.; Babu, B. R.; Wengel,
J.; Kjems, J. Nucleic Acids Res. 2007, 35, 5886.
4. Schlee, M.; Hornung, V.; Hartmann, G. Mol. Ther. 2006, 14, 463.
5. Braasch, D. A.; Paroo, Z.; Constantinescu, A.; Ren, G.; Öz, O. K.; Mason, R. P.;
Corey, D. R. Bioorg. Med. Chem. Lett. 2004, 14, 1139.
6. Kraynack, B. A.; Baker, B. F. RNA 2006, 12, 163.
containing 15 lg of protein was resolved by electrophoresis on a
7. Elmén, J.; Thonberg, H.; Ljungberg, K.; Frieden, M.; Westergaard, M.; Xu, Y.;
Wahren, B.; Liang, Z.; Ørum, H.; Koch, T.; Wahlestedt, C. Nucleic Acids Res. 2005,
33, 439.
8. Abdur Rahman, S. M.; Sato, H.; Tsuda, N.; Haitani, S.; Narukawa, K.; Imanishi, T.;
Obika, S. Bioorg. Med. Chem. 2010, 18, 3474.
sodium dodecyl sulfate 5–20% polyacrylamide gradient gel and
transferred to polyvinylidene fluoride membrane filters (Millipore,
Billerica, MA, USA). Bcl-2 was detected with a mouse anti-Bcl-2
antibody and horseradish-peroxidase-labeled anti-mouse IgG

H. Masuda et al. / Bioorg. Med. Chem. 18 (2010) 8277–8283
8283
9. Bramsen, J. B.; Laursen, M. B.; Nielsen, A. F.; Hansen, T. B.; Bus, C.; Langkjær, N.;
Babu, B. R.; Højland, T.; Abramov, M.; Van Aerschot, A.; Odadzic, D.; Smicius, R.;
Haas, J.; Andree, C.; Barman, J.; Wenska, M.; Srivastava, P.; Zhou, C.;
Honcharenko, D.; Hess, S.; Müller, E.; Bobkov, G. V.; Mikhailov, S. N.; Fava, E.;
Meyer, T. F.; Chattopadhyaya, J.; Zerial, M.; Engels, J. W.; Herdewijn, P.; Wengel,
J.; Kjems, J. Nucleic Acids Res. 2009, 37, 2867.
21. Nagata, S.; Hamasaki, T.; Uetake, K.; Masuda, H.; Takagaki, K.; Oka, N.; Wada,
T.; Ohgi, T.; Yano, J. Nucleic Acids Res. 2010. doi:10.1093/nar/gkq638.
22. Yu, D.; Kandimalla, E. R.; Bhagat, L.; Tang, J.-Y.; Cong, Y.; Tang, J.; Agrawal, S.
Nucleic Acids Res. 2002, 30, 4460.
23. Yano, J.; Hirabayashi, K.; Nakagawa, S.; Yamaguchi, T.; Nogawa, M.; Kashimori,
I.; Naito, H.; Kitagawa, H.; Ishiyama, K.; Ohgi, T.; Irimura, T. Clin. Cancer Res.
2004, 10, 7721.
10. Eder, P. S.; DeVine, R. J.; Dagle, J. M.; Walder, J. A. Antisense Res. Dev. 1991, 1,
141.
24. Chiu, Y. L.; Rana, T. M. RNA 2003, 9, 1034.
11. Ueno, Y.; Watanabe, Y.; Shibata, A.; Yoshikawa, K.; Takano, T.; Kohara, M.;
Kitade, Y. Bioorg. Med. Chem. 2009, 17, 1974.
12. Manoharan, M. Curr. Opin. Chem. Biol. 2004, 8, 570.
13. Ueno, Y.; Inoue, T.; Yoshida, M.; Yoshikawa, K.; Shibata, A.; Kitamura, Y.;
Kitade, Y. Bioorg. Med. Chem. Lett. 2008, 18, 5194.
25. Khvorova, A.; Reynolds, A.; Jayasena, S. D. Cell 2003, 115, 209.
26. Schwarz, D. S.; Hutvágner, G.; Du, T.; Xu, Z.; Aronin, N.; Zamore, P. D. Cell 2003,
115, 199.
27. Chiu, Y.-L.; Ali, A.; Chu, C.-Y.; Cao, H.; Rana, T. M. Chem. Biol. 2004, 11,
1165.
14. Cox, R. A.; Kanagalingam, K. Biochem. J. 1967, 103, 431.
15. Varani, G. Annu. Rev. Biophys. Biomol. Struct. 1995, 24, 379.
16. Vermeulen, A.; Behlen, L.; Reynolds, A.; Wolfson, A.; Marshall, W. S.; Karpilow,
J.; Khvorova, A. RNA 2005, 11, 674.
28. Siolas, D.; Lerner, C.; Burchard, J.; Ge, W.; Linsley, P. S.; Paddison, P. J.; Hannon,
G. J.; Cleary, M. A. Nat. Biotechnol. 2005, 23, 227.
29. Zhang, H.; Kolb, F. A.; Jaskiewicz, L.; Westhof, E.; Filipowicz, W. Cell 2004, 118,
57.
17. Zhang, H.; Kolb, F. A.; Brondani, V.; Billy, E.; Filipowicz, W. EMBO J. 2002, 21,
5875.
18. Robbins, M.; Judge, A.; MacLachlan, I. Oligonucleotides 2009, 19, 89.
19. Ohgi, T.; Masutomi, Y.; Ishiyama, K.; Kitagawa, H.; Shiba, Y.; Yano, J. Org. Lett.
2005, 7, 3477.
30. Judge, A. D.; Bola, G.; Lee, A. C.; MacLachlan, I. Mol. Ther. 2006, 13, 494.
31. Choe, J.; Kelker, M. S.; Wilson, I. A. Science 2005, 309, 581.
32. De Napoli, L.; Di Fabio, G.; Messere, A.; Montesarchio, D.; Musumeci, D.;
Piccialli, G. Tetrahedron 1999, 55, 9899.
33. Bannwarth, W.; Dorn, A.; Iaiza, P.; Pannekouke, X. Helv. Chim. Acta 1994, 77,
182.
20. Shiba, Y.; Masuda, H.; Watanabe, N.; Ego, T.; Takagaki, K.; Ishiyama, K.; Ohgi, T.;
Yano, J. Nucleic Acids Res. 2007, 35, 3287.
34. Puglisi, J. D.; Tinoco, I., Jr. Methods Enzymol. 1989, 180, 304.