Cloning, expression analysis and functional characterization of squalene synthase (SQS) from tripterygium wilfordii

Article abstract of DOI:10.3390/molecules23020269

Celastrol is an active triterpenoid compound derived from Tripterygium wilfordii which is well-known as a traditional Chinese medicinal plant. Squalene synthase has a vital role in condensing two molecules of farnesyl diphosphate to form squalene, a key precursor of triterpenoid biosynthesis. In the present study, T. wilfordii squalene synthase (TwSQS) was cloned followed by prokaryotic expression and functional verification. The open reading frame cDNA of TwSQS was 1242 bp encoding 413 amino acids. Bioinformatic and phylogenetic analysis showed that TwSQS had high homology with other plant SQSs. To obtain soluble protein, the truncated TwSQS without the last 28 amino acids of the carboxy terminus was inductively expressed in Escherichia coli Transetta (DE3). The purified protein was detected by SDS-PAGE and Western blot analysis. Squalene was detected in the product of in vitro reactions by gas chromatograph-mass spectrometry, which meant that TwSQS did have catalytic activity. Organ-specific and inducible expression levels of TwSQS were detected by quantitative real-time PCR. The results indicated that TwSQS was highly expressed in roots, followed by the stems and leaves, and was significantly up-regulated upon MeJA treatment. The identification of TwSQS is important for further studies of celastrol biosynthesis in T. wilfordii.

Full text of DOI:10.3390/molecules23020269

molecules
Article
Cloning, Expression Analysis and Functional
Characterization of Squalene Synthase (SQS) from
Tripterygium wilfordii
Bin Zhang 1, Yan Liu 1, Mengmeng Chen 1, Juntao Feng 1,2, Zhiqing Ma 1,2, Xing Zhang 1,2,
*
and Chuanshu Zhu 1,2,
*
1
Research & Development Center of Biorational Pesticides, Northwest A & F University,
Yangling 712100, China; zhangbin1990@nwsuaf.edu.cn (B.Z.); liuyan0848@163.com (Y.L.);
cym135266@163.com (M.C.); fengjt67@hotmail.com (J.F.); zhiqingma@nwsuaf.edu.cn (Z.M.)
Biopesticide Technology and Engineering Center of Shaanxi Province, Yangling 712100, China
Correspondence: zhxing1952@gmail.com (X.Z.); zhchshjhch@nwsuaf.edu.cn (C.Z.);
Tel.: +86-029-8709-2122 (X.Z.)
2
*
Received: 4 January 2018; Accepted: 25 January 2018; Published: 29 January 2018
Abstract: Celastrol is an active triterpenoid compound derived from Tripterygium wilfordii which is
well-known as a traditional Chinese medicinal plant. Squalene synthase has a vital role in condensing
two molecules of farnesyl diphosphate to form squalene, a key precursor of triterpenoid biosynthesis.
In the present study, T. wilfordii squalene synthase (TwSQS) was cloned followed by prokaryotic
expression and functional verification. The open reading frame cDNA of TwSQS was 1242 bp
encoding 413 amino acids. Bioinformatic and phylogenetic analysis showed that TwSQS had high
homology with other plant SQSs. To obtain soluble protein, the truncated TwSQS without the last
28 amino acids of the carboxy terminus was inductively expressed in Escherichia coli Transetta (DE3).
The purified protein was detected by SDS-PAGE and Western blot analysis. Squalene was detected in
the product of in vitro reactions by gas chromatograph-mass spectrometry, which meant that TwSQS
did have catalytic activity. Organ-specific and inducible expression levels of TwSQS were detected by
quantitative real-time PCR. The results indicated that TwSQS was highly expressed in roots, followed
by the stems and leaves, and was significantly up-regulated upon MeJA treatment. The identification
of TwSQS is important for further studies of celastrol biosynthesis in T. wilfordii.
Keywords: Tripterygium wilfordii; squalene synthase; celastrol; prokaryotic expression; functional
characterization
1. Introduction
Tripterygium wilfordii (Celastraceae) is an important Chinese herbal medicine used for the treatment
o f inflammation [
and quinone-methide triterpenoid (QMTs) with varied pharmaceutical activities [
have already been isolated from Celastraceae, such as celastrol, maitenin, 22-hydroxytingenone and
pristimerin [ ]. They have similar chemical structures and biological activities. Celastrol is the first
active compound isolated from the root bark of T. wilfordii and also is one of the major active ingredients
of T. wilfordii [ ]. As a representative compound of QMTs, Celastrol has been demonstrated to have
promising activities including antioxidant [ ], anti-inflammatory [ ], immunomodulation [ ], and
anticancer activities [ ]. Celastrol has shown promise as an anti-inflammatory compound for arthritis,
lupus, amyotrophic lateral sclerosis, and Alzheimer’s disease [ ]. Recent studies have shown that
celastrol is a potential therapeutic agent for anti-obesity [ 10]. Celastrol has attracted increased interest
recently regarding its therapeutic mechanisms and clinical applications. Traditionally, celastrol is
1]. Active ingredients of T. wilfordii include sesquiterpenoid alkaloids, diterpenoid,
2]. Many QMTs
3
4
5
6
7
8
6
9
,
Molecules 2018, 23, 269; doi:10.3390/molecules23020269
www.mdpi.com/journal/molecules

Molecules 2018, 23, 269
2 of 12
obtained by extraction from the root of T. wilfordii. However, T. wilfordii is not widely cultivated
and the content of celastrol in natural plants is far below demand. The chemical synthesis of this
compound is not an economical alternative because of its multistep reactions and low overall yield [11].
Tissue cultivation is a potential choice for the production of natural products, but up to now, only
the culture of T. wilfordii in a small-scale 10-L bioreactor has been reported [12]. Synthesis on an
industrial scale is still far away. Therefore, it is of interest to produce the compound through synthetic
biology strategies. However, the development of these strategies requires detailed understanding of
the celastrol biosynthetic pathway.
Squalene synthase (SQS, EC 2.5.1.21) is a membrane-associated enzyme that catalyzes the first
enzymatic step in sterols and triterpenoid biosynthesis [1]. It converts two molecules of farnesyl
diphosphate (FPP) into squalene, which is a precursor to both sterols and triterpenoid [13]. The SQS
enzyme is considered to be a pivotal enzyme in the regulation of triterpenoid biosynthesis. Thus,
the genes encoding the enzyme have been cloned from several organisms including fungi [14
,15],
bacteria [16], animals [17], and human beings [18 19]. Botanical squalene synthase enzymes have
,
also been identified in Arabidopsis thaliana [20], Magnolia officinalis [21], Salvia miltiorrhiza Bunge [22],
Panax ginseng [23], Panax notoginseng [24], and Glycine max [25]. The squalene synthases identified
from P. ginseng were able to convert yeast erg9 mutant cells to ergosterol prototrophy in spite of
sequence divergence to yeast [21]. Likewise, similar results have been reported in Glycine max.
The GmSQS1 was able to convert yeast sterol auxotrophy erg9 mutant to sterol prototrophy and
overexpression of GmSQS1 increased end product sterols in Arabidopsis seeds [23]. In addition, many
SQSs have been investigated subsequently followed by recombinant expression and preliminary
enzyme activity. These recombinant SQSs could synthesize squalene from FPP in the presence of
NADPH and Mg2+
[19,20,22]. Many studies have demonstrated that overexpression of SQS genes could
enhance the accumulation of triterpenoid and/or phytosterols compounds in Withania somnifera [26],
Panax ginseng [27], Eleutherococcus senticosus [28], Bupleurum falcatum [29] and Solanum chacoense [30].
According to these studies, we believe that TwSQS may play a pivotal role in celastrol biosynthesis.
However, the function of SQS is still unexplored in T. wilfordii. Here, we describe the prokaryotic
expression, functional characterization and expression analysis of a squalene synthase gene from
T. wilfordii and establish the foundation to study the celastrol biosynthetic pathway. In addition,
the tissue expression of TwSQS in T. wilfordii natural plants and the expression in T. wilfordii hairy root
induced by methyl jasmonate (MeJA) were investigated.
2. Results
2.1. Sequence Analysis of TwSQS
The open reading frame (ORF) cDNA of TwSQS was amplified by PCR using primers TwSQS-F
and TwSQS-R. The ORF cDNA of TwSQS was 1242 bp, which encodes a polypeptide of 413 amino
acids. The result of homologous domains search showed that TwSQS belonged to the superfamily
of isoprenoid biosynthesis class 1 enzymes and had specific hit with trans-isoprenyl diphosphate
synthase. The sequence comparison of TwSQS showed high identity to SQSs from other plants,
including Glycyrrhiza glabra (BAA13083.1, 88%), P. notoginseng (ABA29019.1, 86%), Glycyrrhiza uralensis
(ADG36719.1, 85%), Diospyros kaki (ACN69082.1), P. ginseng (ACV88718.1, 82%), Centella asiatica
(AAV58897.1, 82%), Artemisia annua (AAR20329.1, 81%), respectively. The SQS from fungi
Candida glabrata (BAB12207.1, 41%) was added into multiple sequence alignments as an outgroup.
Multiple sequence alignments indicated that TwSQS had six homologous signature regions (I–VI,
Figure 1) which were considered to be the binding, catalytic and regulatory sites of SQSs. Region II
and IV contained two aspartate-rich motifs (DXXXD) which were deemed to coordinate and facilitate
FPP binding by binding Mg2+
[31,32]. Even though region VI showed low sequence similarity among
the SQSs in alignment, they all had highly hydrophobic amino acid residues and performed the
similar functions of membrane targeting and anchoring [32]. The TMHMM result showed that

Molecules 2018, 23, 269
3 of 12
TwSQS has two transmembrane helices domains, containing residues 281–303 aa and 387–404 aa,
respectively. A neighbour-joining phylogenetic tree was established to investigate the relations based
on the sequences of TwSQS and other SQSs from different organisms (Figure 2). The phylogenetic tree
was divided into six main clusters: eudicots, monocots, gymnosperm, algae, animal, and fungi, and
TwSQS clustered within the eudicots corresponding to taxonomic classification. The result showed
that TwSQS was closely related to those from Glycyrrhiza glabra and Glycyrrhiza uralensis.
Figure 1. Sequence alignment of TwSQS with squalene synthases from other plants. The accession
numbers of the aligned sequences are as follows: AaSQS1, A. annua, AAR20329.1; DkSQS, Diospyros kaki,
ACN69082.1; CaSQS1, C. asiatica, AAV58897.1; GgSQS, G. glabra, BAA13083.1; PgSQS, P. ginseng,
ACV88718.1; GuSQS2, G. uralensis, ADG36719.1, PnSQS, P. notoginseng, ABA29019.1, and Candida
glabrata, BAB12207.1. The six conserved regions (I, II, III, IV, V, and VI) of squalene synthase are marked
by “ꢀ”, two aspartate-rich domains (DXXXD) that mediate binding of FPP are marked out by “**”.

Molecules 2018, 23, 269
4 of 12
Figure 2. Phylogenetic analysis of TwSQS with other SQSs from diverse organisms constructed
by the neighbor-joining method based on 1000 bootstrap replicates. The accession numbers of
the aligned sequences are as follows: NtSQS, Nicotiana tabacum, AAB08578.1; WsSQS, W. somnifera,
ADC95435.1; SlSQS, Solanum lycopersicum, NP 001234716.2; StSQS, Solanum tuberosum, BAA82093.1;
PtSQS, Psammosilene tunicoides, ABQ96265.1; AtSQS1, Arabidopsis thaliana, AEE86403.1; CbSQS,
Chlorophytum borivilianum, AFN61199.1; DzSQS, Dioscorea zingiberensis, AGN32410.1; OsSQS, Oryza
sativa Japonica Group, BAA22557.1; DcSQS, Dendrobium catenatum, AGI56082.1; ZmSQS, Zea mays,
BAA22558.1; PmSQS, Pinus massoniana, AHI96421.1; TcSQS, Taxus cuspidate, ABI14439.1; ApSQS,
Auxenochlorella protothecoides, KFM22694.1; BpSQS, Bathycoccus prasinos, CCO17009.1; RnSQS, Rattus
norvegicus, AAA42179.1; HsSQS, Homo sapiens, AAB33404.1; FfSQS, Fusarium fujikuroi, ABX64425.2;
ScSQS, Saccharomyces cerevisiae, AAA34597.1.
2.2. Purification and Identification of Recombinant Protein
To understand the catalytic function of TwSQS, it was essential to yield a certain amount of soluble
protein. It was reported that removal of the C-terminal hydrophobic region could enhance the soluble
expression of recombinant SQS [21]. Therefore, the truncated TwSQS without the last 28 amino acids of
the C-terminal was inserted into vector pET-30a. The recombinant expression plasmid pET-30a-TwSQS
was extracted and transformed into E. coli Transetta (DE3) to produce recombinant protein containing
a His-tag at the N-terminus. The pET-30a empty vector was transformed into E. coli Transetta (DE3)
and served as a control. After induced expression, extraction and purification, the crude protein and
purified recombinant protein were analyzed by SDS-PAGE and Western blotting.
SDS-PAGE analysis showed that TwSQS was successfully expressed in the supernatant of lysates,
with a molecular weight of around 49.41 kDa (Figure 3a). The corresponding protein band was
also found at the same position (about 49.41 kDa) in the purified protein. Western blot detection
showed that the TwSQS could specifically combine with anti-His-tag antibodies (Figure 3b). Two
single immunoreactive bands were detected from the crude and purified protein of pET-30a-TwSQS
bacteria. No such band was found in the crude protein of the control strain. These results indicated
that the recombinant protein was successfully expressed and purified.

Molecules 2018, 23, 269
5 of 12
Figure 3. Identification of recombinant TwSQS protein. (a) SDS-PAGE detection of recombinant
TwSQS protein expressed in E. coli Transetta (DE3); ( ) Western Blot assay of the recombinant TwSQS
b
protein expressed in E. coli Transetta (DE3). M: protein marker. Lane 1: purified protein of induced
pET30a-TwSQS bacteria; Lane 2: supernatant of induced pET30a-TwSQS bacteria; Lane 3: supernatant
of induced pET30a bacteria.
2.3. Functional Characterization of the TwSQS
To verify the function of TwSQS, the conversion activity from FPP to squalene was assayed using
the purified protein with the cofactor NADPH and Mg2+. The crude protein of the control strain was
used as a control. The catalytic products were analyzed by GC-MS (Figure 4). The peak at 20.3 min in
the GC profile of TwSQS reaction products (Figure 4B) corresponded to that observed in a standard
squalene sample (Figure 4A), but no such peak was detected in the control (Figure 4C). Moreover, the
mass spectrum characteristic peaks (m/z = 69, 81) of the 20.3-min peak of TwSQS (Figure 4E) were
consistent with those of standard squalene (Figure 4D), while no corresponding mass fragments was
observed in the control. These results illustrate that TwSQS encodes a functional squalene synthase,
converting two molecules of FPP to squalene.
Figure 4. GC–MS analysis of squalene in the catalytic products of TwSQS. (
standard squalene; ( ) GC detection of the reaction products of TwSQS; ( ) Control (crude protein
) The mass spectrum of standard squalene; ( ) MS analysis of the catalytic
A) GC detection of the
B
C
of the control strain); (
D
E
products of TwSQS.

Molecules 2018, 23, 269
6 of 12
2.4. Expression Analysis of TwSQS
In order to study the expression pattern of TwSQS, we measured the TwSQS expression level in
different tissues of T. wilfordii including roots, stems and leaves. The transcript levels of TwSQS were
observed in these three tissues of T. wilfordii (Figure 5a). The expression level of TwSQS in stems was
regarded as a control while the TwSQS expression in leaves and roots was evaluated compared with
the stems. There were significant differences among the expression levels of the three tissues using
Duncan’s multiple range test at p < 0.05 in SPSS (IBM, Armonk, NY, USA). The expression level of
TwSQS was significantly higher than that of stems and leaves (Figure 5a).
Figure 5. Expression analysis of TwSQS. (a) Expression analysis of TwSQS in different tissues of
T. wilfordii; ( ) Expression levels of TwSQS in hairy roots after MeJA treatment. Data are means
(n = 3). Letters on plots indicate significant difference according to Duncan’s multiple range test at
p < 0.05. Me JA: methyl jasmonate-treated group; CK: untreated control group.
b
±
SEM
In our previous studies, we found that 100
content of secondary metabolites and the expression level of related genes in Tripterygium wilfordii [12
In order to determine the expression profile of TwSQS under MeJA, qRT-PCR analysis was performed.
The result showed the TwSQS expression levels were significantly enhanced by 100 M MeJA treatment
µM MeJA treatment could significantly increase the
,33].
µ
in the hairy root cultures (Figure 5b). The TwSQS expression level before induction was regarded as a
control and the TwSQS expression in other times of induction were calculated compared with the 0 h.
After induced by MeJA, the levels of TwSQS expression raised rapidly at first, peaked at 6 h, and then
gradually decreased. During the same period, there were no significant differences in the untreated
control groups. The result indicated that MeJA can induce the expression of TwSQS.
3. Discussion
Celastrol is a representative molecule of quinone-methide triterpenoids which are deemed as
the chemotaxonomic markers of Celastraceae [3]. Because of its important medicinal activity, many
studies have focused on the identification of some specific enzymes involved in celastrol biosynthesis
from the MVA pathway. Squalene synthase catalyzes two molecules of farnesyl diphosphate to form
squalene, a key precursor of triterpenoid biosynthesis. Given its importance in terpenoid biosynthesis,
SQSs were studied as key enzymes in sterol and triterpenoid biosynthesis. However, few literature
studies have described the role of TwSQS in the biosynthetic pathway of celastrol in T. wilfordii. In the
present study, we attempted to dissect the molecular biology of the celastrol biosynthetic pathway in
T. wilfordii by cloning and characterizing TwSQS. In the present study, we cloned a squalene synthase
gene that was involved in celastrol biosynthesis from T. wilfordii, which also was the first reported
SQS of Celastraceae. Sequence alignment analysis of TwSQS with other plant SQS sequences showed

Molecules 2018, 23, 269
7 of 12
that six highly homologous domains were present in the TwSQS, which were very important for
the catalytic/functional activity of SQS [34 35]. SQS genes from Arabidopsis thaliana, tobacco, human
,
and yeast all have a single predicted transmembrane helix found in the C-terminal hydrophobic
sequences identified by the TMHMM program. Interestingly, TwSQS not only have a transmembrane
helix in domain VI, but also have an additional transmembrane helix near domain V. This second
transmembrane helix was also reported in SQS from G. glabra, G. uralensis, P. ginseng and P. notoginseng,
similar to T. wilfordii. The neighbor-joining phylogenetic tree also showed that TwSQS was very similar
to those from G. glabra and G. uralensis.
Domain VI has highly hydrophobic amino acid residues, which is consistent with a membrane
anchoring function. It were reported that deletion of the C-terminal membrane-anchoring could
enhance the soluble expression of recombinant SQS [21]. This also was confirmed in our study.
The soluble protein of TwSQS containing the putative full-length cDNA also was not obtained in
this study (data not shown). In contrast, the soluble protein was observed in the supernatant of
E. coli by removing the 28 amino acids of the C-terminal. In vitro enzyme reactions demonstrated
that TwSQS could catalyze the reaction of FPP form to squalene under the coordination of Mg2+
and NADPH. Somewhat similar results were also reported in M. officinalis SQS [21], S. miltiorrhiza
SQS2 [22], P. notoginseng SQS [24], tobacco SQS [31], and W. somnifera SQS [14]. In addition, the
recombinant AtSQS2 which was deemed to be a non-functional SQS, was unable to synthesize squalene
from FPP in the presence of NADPH and either Mg2+ or Mn2+
[18]. These reports indicated that
TwSQS encodes a functional squalene synthase. Results of qRT-PCR analyses of TwSQS expression
demonstrated that TwSQS has tissue-specific expression with highest expression in roots followed
by leaves and stems (Figure 5a). Some studies found that the tissue expression pattern of SQS varies
greatly in different plants. Similar patterns of gene expression were found in S. miltiorrhiza [22],
Euphorbia pekinensis [36], Taxus cuspidata [32], while some different expression patterns were found
in B. platyphylla [37], W. somnifera [38], and Euphorbia tirucalli [39]. In addition, several studies have
reported that the MeJA could upregulates the expression of SQS [21,36]. Therefore, we investigated
the expression of TwSQS under MeJA treatment. The expression level of TwSQS rapidly increased
after MeJA treatment and peaked at 6 h with an eight-fold increase compared with that of the control
group (Figure 5b). It is reported that celastrol mainly accumulates in the root of T. wilfordii and MeJA
treatment could significantly increase the content of celastrol [40]. Our results, thus, provide an
additional evidence that TwSQS is positively involved in celastrol biosynthesis. Further work is to
regulate the isoprenoid biosynthesis through the overexpression and MeJA induction of the TwSQS
gene so as to enhance the production of celastrol in T. wilfordii.
4. Materials and Methods
4.1. Plant Material
The different fresh tissues of T. wilfordii were collected from the plants grown in the greenhouse
of Northwest A & F University, China. The hairy root cultures were established as described
previously [41]. The hairy root of T. wilfordii were cultured in 250 mL Erlenmeyer flasks containing
100 mL of Murashige-Skoog liquid medium, 30 g/L sucrose. Each flask was inoculated with 1 g fresh
weight of roots and maintained in darkness at 26 ◦C. The hairy roots were elicited with 100
µM MeJA
after 25 days of cultivation. The roots were harvested at 0, 1, 3, 6, 9, 12, 24 h after MeJA treatment.
◦
All the materials were rapidly frozen using liquid nitrogen and then kept at
and chemical detection.
−
80 C for RNA isolation
4.2. Total RNA Extraction and cDNA Synthesis
Total RNA was extracted from 100 mg of T. wilfordii roots using the plant total RNA extraction
kit (TIANGEN Biotech Co., Ltd., Beijing, China). The RNA quality and concentration were measured
by gel electrophoresis (1% agarose) and spectrophotometer analysis. The total RNA was reverse

Molecules 2018, 23, 269
8 of 12
transcribed into cDNA template using Takara PrimeScript
™
1st strand cDNA synthesis kit (TaKaRa
Biotechnology, Dalian, China).
4.3. Cloning and Bioinformatics Analyses of TwSQS
The ORF cDNA of TwSQS was cloned using the specific primers TwSQS-F and TwSQS-R (Table 1)
which was designed according to the sequence from reported squalene synthase of T. wilfordii
(KR401220.1). The PCR products of TwSQS were detected, purified and cloned into the pClone007
Blunt Simple Vector (Tsingke Biotech Co., Beijing, China) followed by sequencing.
Table 1. Primers used in this study.
0
0
Primer Name
Primer Sequence 5 →3
SQS-F
SQS-R
ATGGGGAGTTTGTGGACGA
ACTCGGGGGCTGACATCC
SQS-TF
SQS-TR
SQS-QF
SQS-QR
EF1α-F
EF1α-R
CGGGATCCATGGGGAGTTTGTGGACGA
CGAGCTCATGACTCGCCATTAACTATGCC
GCGCTGCGAGATCCAGCCAT
TGCAGTGAGACCACGCCTCAT
CCAAGGGTGAAAGCAAGGAGAGC
CACTGGTGGTTTTGAGGCTGGTATCT
The sequences similarities search of deduced amino acid sequence was performed through
NCBI BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_
TYPE=BlastSearch&BLAST_SPEC=MicrobialGenomes&LINK_LOC=blasttab&LAST_PAGE=blastn).
Sequence conserved domains were detected using the tool of Conserved Domains Search
(http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Protein Transmembrane Helical domains
were analysed by TRMHMM software programs (http://www.cbs.dtu.dk/services/TMHMM-2.0/).
Sequence multiple alignment was performed using the software of DNAMAN 8.0 (Lynnon Biosoft,
Quebec, QC, Canada). Phylogenetic analysis was established using the Neighbor-Joining method
by MEGA 6.06 (Biodesign Institute, Tempe, AZ, USA). The confidence values of the branches were
evaluated by bootstrap analysis with 1000 replicates.
4.4. Expression of Recombinant Protein
Squalene synthase is a membrane bound enzyme that has two transmembrane helices at the
carboxy-terminal region. The second transmembrane helices is not located in the conserved domains.
The C-terminal has highly hydrophobic amino acid residues, which is consistent with a membrane
anchoring function. It was reported that removal of the C-terminal hydrophobic region could
enhance the soluble expression of recombinant SQS [31]. It may be because removal of the C-terminal
hydrophobic region could enhance the water-solubility of recombinant SQS and reduce the ability of
SQS to be targeted to the membrane. So the carboxy-terminal truncated TwSQS was amplified using
the designed site primers TwSQS-TF (BamHI) and TwSQS-TR (SacI) (Table 1).
The PCR product and the expression vector pET-30a were separately double-digested with BamHI
and SacI, and ligated by T4 ligase. The recombinant vector, pET-30a-TwSQS, was verified by sequencing.
pET-30a-TwSQS was transformed into competent E. coli Transetta (DE3) to produce recombinant protein
◦
that containing a His-tag at N-terminus. The transformed bacteria was grown to A600 = 0.6 at 37 C in
LB medium. Expression of TwSQS was induced with 0.8 mM Isopropyl
β
-D-1-thiogalactopyranoside
(IPTG) at 28 ◦C. After culturing for 6 h, the cells were collected by centrifuging at 6000
×
g for 10 min,
and then washed 3 times with 0.05 M Tris–HCl (pH 7.5). The cells were resuspended in extraction
buffer (50 mM Tris–HCl, pH 7.5, 10% glycerol, and 5 mM DTT) and lysed by sonication. The crude
enzyme solution was harvested after centrifugation at 12,000× g at 4 ◦C for 30 min.

Molecules 2018, 23, 269
9 of 12
4.5. Purification of Expressed TwSQS and Western Blot Analysis
The crude enzyme solution was subjected to His-Tag purification using a Ni-NTA agarose gravity
column (TransGen Biotech, Beijing, China) [42]. Ni-NTA agarose was equilibrated with balance buffer
(10 mM imidazole, 50 mM Tris–HCl, pH 7.5, 50 mM NaH2PO4, and 0.3 M NaCl). The crude enzyme
solution was added to the column and then washed with balance buffer.
The desired protein was eluted from Ni-NTA resin with increasing imidazole concentration
(50–200 mM) in elution buffer. The eluted fractions were analyzed on a 10% SDS-PAGE gel and stained
by Coomassie Blue R250 solution. The imidazole of purified protein was removed by centrifugal
ultrafiltration (Amicon Ultra 10 kDa, Millipore, Burlington, MA, USA).
The recombinant protein was verified via Western blot analysis. Protein bands were transferred
onto nitrocellulose membrane from SDS-PAGE gel. The membrane was blocked with 5% (w/v)
skimmed milk in TBST (triethanolamine buffered saline adding 0.05% Tween 20) for 2 h, and then
incubated with HRP Conjugated Anti His-Tag Mouse Monoclonal Antibody (1:3000, CWBIO, Beijing,
◦
China) at 4 C overnight. After washing five times with TBST (5 min each time), the blots were revealed
with a diaminobenzidine (DAB) kit (Solarbio, Beijing, China).
4.6. In Vitro Enzyme Reaction
The enzyme reaction of the recombinant protein TwSQS was conducted as follows. The purified
protein incubated at 30 ◦C with 50
µM FPP triammonium salt (Sigma–Aldrich, St. Louis, MO, USA),
50 mM Tris–HCl (pH 7.5), 25 mM MgCl2, 1 mM DTT, 2% Glycine and 3 mM NADPH in a total reaction
volume of 300 µL. After 8 h, the reaction product was extracted four times with 400 µL n-hexane and
then analyzed by GC-MS. The GC-MS detection was performed on GCMS-QP2010 Ultra (Shimadzu,
Kyoto, Japan) using the method described as Rong et al. [22].
4.7. Expression Analysis
Total RNA from different tissues and hairy roots treated by MeJA was extracted separately
using the plant total RNA extraction kit (TIANGEN Biotech Co., Ltd., Beijing, China), and reversely
transcribed into cDNA using the Prime Script
The qRT-PCR analysis was performed using the SYBR Premix Ex Taq (TaKaRa) on a CFX96
PCR system (Bio-Rad, Hercules, CA, USA). Elongation factor 1 (EF1 ) was used as a reference gene
for gene expression normalization [43]. Primers used for expression analysis of TwSQS (TwSQS-qF
and TwSQS-qR) and EF1 (Ef -F and Ef -R) were given in Table 1. Each analysis included three
™
RT reagent kit with gDNA Eraser (TaKaRa).
™
Real-time
α
α
α
α
α
independent experiments and two biological replicates. The relative amounts of TwSQS were quantified
by using 2−∆∆Ct method [44].
5. Conclusions
We have successfully cloned and characterized a squalene synthase gene, which is involved
in celastrol biosynthesis in the medicinal plant T. wilfordii. The recombinant TwSQS protein was
expressed in E. coli and purified. After determination of squalene by GC-MS, we verified that the
TwSQS encodes a functional squalene synthase. Furthermore, the expression profile of the SQS gene in
different tissues and methyl jasmonate treatments were determined. The results indicate that TwSQS
is positively involved in celastrol biosynthesis. The present study is helpful to understand celastrol
in T. wilfordii at the molecular level. Further studies on TwSQS would be useful for understanding
celastrol biosynthesis and would provide molecular resources for the biotechnological improvement
of this important medicinal plant.
Acknowledgments: This work is supported by the National Natural Science Foundation of China (Grant
No. 31272110) and the Natural Science Foundation of Shaanxi Province (2016JM3036).
Author Contributions: Bin Zhang, Chuanshu Zhu and Xing Zhang conceived and designed the experiments;
Bin Zhang and Yan Liu performed the experiments and analyzed the data; Mengmeng Chen contributed reagents

Molecules 2018, 23, 269
10 of 12
and materials; Juntao Feng and Zhiqing Ma assisted in prepared the manuscript; Chuanshu Zhu and Xing Zhang
supervised the whole experiment and provided technical guidance. Bin Zhang wrote the paper. All authors have
read and approved the final manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
Abe, I.; Rohmer, M.; Prestwich, G.D. Enzymatic cyclization of squalene and oxidosqualene to sterols and
triterpenes. Chem. Rev. 1993, 93, 2189–2206. [CrossRef]
Brinker, A.M.; Ma, J.; Lipsky, P.E.; Raskin, I. Medicinal chemistry and pharmacology of genus Tripterygium
(Celastraceae). Phytochemistry 2007, 68, 732–766. [CrossRef] [PubMed]
Brüning, R.; Wagner, H. Übersicht über die celastraceen-inhaltsstoffe: Chemie, chemotaxonomie, biosynthese,
pharmakologie. Phytochemistry 1978, 17, 1821–1858. [CrossRef]
Chou, T.; Mei, P. Study on Chinese herb Lei Gong, Teng Tripterygium wilfordii Hook f. I: The coloring
substance and the sugars. Chin. J. Physiol. 1936, 10, 529–534.
Wang, C.; Shi, C.; Yang, X.; Yang, M.; Sun, H.; Wang, C. Celastrol suppresses obesity process via increasing
antioxidant capacity and improving lipid metabolism. Eur. J. Pharmacol. 2014, 744, 52–58. [CrossRef]
[PubMed]
6.
7.
8.
9.
Sethi, G.; Ahn, K.S.; Pandey, M.K.; Aggarwal, B.B. Celastrol, a novel triterpene, potentiates TNF-induced
apoptosis and suppresses invasion of tumor cells by inhibiting NF-κB–regulated gene products and
TAK1-mediated NF-κB activation. Blood 2007, 109, 2727–2735. [PubMed]
Youn, G.S.; Kwon, D.-J.; Ju, S.M.; Rhim, H.; Bae, Y.S.; Choi, S.Y.; Park, J. Celastrol ameliorates HIV-1
Tat-induced inflammatory responses via NF-kappaB and AP-1 inhibition and heme oxygenase-1 induction
in astrocytes. Toxicol. Appl. Pharmacol. 2014, 280, 42–52. [CrossRef] [PubMed]
Yang, H.; Chen, D.; Cui, Q.C.; Yuan, X.; Dou, Q.P. Celastrol, a triterpene extracted from the Chinese “Thunder
of God Vine” is a potent proteasome inhibitor and suppresses human prostate cancer growth in nude mice.
Cancer Res. 2006, 66, 4758–4765. [CrossRef] [PubMed]
Liu, J.; Lee, J.; Hernandez, M.A.S.; Mazitschek, R.; Ozcan, U. Treatment of obesity with celastrol. Cell 2015
,
161, 999–1011. [CrossRef] [PubMed]
10. Ma, X.; Xu, L.; Alberobello, A.T.; Gavrilova, O.; Bagattin, A.; Skarulis, M.; Liu, J.; Finkel, T.; Mueller, E.
Celastrol protects against obesity and metabolic dysfunction through activation of a HSF1-PGC1
α
transcriptional axis. Cell Metab. 2015, 22, 695–708. [CrossRef] [PubMed]
11. Camelio, A.M.; Johnson, T.C.; Siegel, D. Total Synthesis of Celastrol, Development of a Platform to Access
Celastroid Natural Products. J. Am. Chem. Soc. 2015, 137, 11864–11867. [CrossRef] [PubMed]
12. Miao, G.; Zhu, C.; Yang, Y.; Feng, M.; Ma, Z.; Feng, J.; Zhang, X. Elicitation and in situ adsorption enhanced
secondary metabolites production of Tripterygium wilfordii Hook. f. adventitious root fragment liquid
cultures in shake flask and a modified bubble column bioreactor. Bioprocess Biosyst. Eng. 2014, 37, 641–650.
[CrossRef] [PubMed]
13. Haralampidis, K.; Trojanowska, M.; Osbourn, A.E. Biosynthesis of triterpenoid saponins in plants. In History
and Trends in Bioprocessing and Biotransformation; Springer: Berlin, Germany, 2002; pp. 31–49.
14. Gupta, N.; Sharma, P.; Kumar, R.S.; Vishwakarma, R.K.; Khan, B. Functional characterization and differential
expression studies of squalene synthase from Withania somnifera. Mol. Biol. Rep. 2012, 39, 8803–8812.
[CrossRef] [PubMed]
15. Zhao, M.W.; Liang, W.Q.; Zhang, D.B.; Wang, N.; Wang, C.G.; Pan, Y.J. Cloning and characterization of
squalene synthase (SQS) gene from Ganoderma lucidum. J. Microbiol. Biotechnol. 2007, 17, 1106–1112. [PubMed]
16. Lee, S.; Poulter, C.D. Cloning, solubilization, and characterization of squalene synthase from
Thermosynechococcus elongatus BP-1. J. Bacteriol. 2008, 190, 3808–3816. [CrossRef] [PubMed]
17. Mckenzie, T.L.; Jiang, G.J.; Straubhaar, J.R.; Conrad, D.G.; Shechter, I. Molecular-cloning, expression, and
characterization of the cDNA for the rat hepatic squalene synthase. J. Biol. Chem. 1992, 267, 21368–21374.
[PubMed]
18. Robinson, G.W.; Tsay, Y.H.; Kienzle, B.K.; Smithmonroy, C.A.; Bishop, R.W. Conservation between human
and fungal squalene synthetases—similarities in structure, function, and regulation. Mol. Cell. Biol. 1993, 13,
2706–2717. [CrossRef] [PubMed]

Molecules 2018, 23, 269
11 of 12
19. Summers, C.; Karst, F.; Charles, A.D. Cloning, expression and characterization of the cDNA-encoding human
hepatic squalene synthase, and its relationship to phytoene synthase. Gene 1993, 136, 185–192. [CrossRef]
20. Busquets, A.; Keim, V.; Closa, M.; Del Arco, A.; Boronat, A.; Arró, M.; Ferrer, A. Arabidopsis thaliana contains
a single gene encoding squalene synthase. Plant Mol. Biol. 2008, 67, 25–36. [CrossRef] [PubMed]
21. Zha, L.; Liu, S.; Su, P.; Yuan, Y.; Huang, L. Cloning, prokaryotic expression and functional analysis of
squalene synthase (SQS) in Magnolia officinalis. Protein Expr. Purif. 2016, 120, 28–34. [CrossRef] [PubMed]
22. Rong, Q.; Jiang, D.; Chen, Y.; Shen, Y.; Yuan, Q.; Lin, H.; Zha, L.; Zhang, Y.; Huang, L. Molecular cloning and
functional analysis of squalene synthase 2 (SQS2) in Salvia miltiorrhiza Bunge. Front. Plant Sci. 2016, 7, 1274.
[CrossRef] [PubMed]
23. Kim, T.-D.; Han, J.-Y.; Huh, G.H.; Choi, Y.-E. Expression and functional characterization of three squalene
synthase genes associated with saponin biosynthesis in Panax ginseng. Plant Cell Physiol. 2010, 52, 125–137.
[CrossRef] [PubMed]
24. Jiang, D.; Rong, Q.; Chen, Y.; Yuan, Q.; Shen, Y.; Guo, J.; Yang, Y.; Zha, L.; Wu, H.; Huang, L. Molecular
cloning and functional analysis of squalene synthase (SS) in Panax notoginseng. Int. J. Biol. Macromol. 2017
95, 658–666. [CrossRef] [PubMed]
,
25. Nguyen, H.T.; Neelakadan, A.K.; Quach, T.N.; Valliyodan, B.; Kumar, R.; Zhang, Z.; Nguyen, H.T. Molecular
characterization of Glycine max squalene synthase genes in seed phytosterol biosynthesis. Plant Physiol.
Biochem. 2013, 73, 23–32. [CrossRef] [PubMed]
26. Patel, N.; Patel, P.; Kendurkar, S.V.; Thulasiram, H.V.; Khan, B.M. Overexpression of squalene synthase
in Withania somnifera leads to enhanced withanolide biosynthesis. Plant Cell Tissue Organ Cult. 2015, 122,
409–420. [CrossRef]
27. Lee, M.-H.; Jeong, J.-H.; Seo, J.-W.; Shin, C.-G.; Kim, Y.-S.; In, J.-G.; Yang, D.-C.; Yi, J.-S.; Choi, Y.-E. Enhanced
triterpene and phytosterol biosynthesis in Panax ginseng overexpressing squalene synthase gene. Plant Cell
Physiol. 2004, 45, 976–984. [CrossRef] [PubMed]
28. Seo, J.-W.; Jeong, J.-H.; Shin, C.-G.; Lo, S.-C.; Han, S.-S.; Yu, K.-W.; Harada, E.; Han, J.-Y.; Choi, Y.-E.
Overexpression of squalene synthase in Eleutherococcus senticosus increases phytosterol and triterpene
accumulation. Phytochemistry 2005, 66, 869–877. [CrossRef] [PubMed]
29. Kim, Y.S.; Cho, J.H.; Park, S.; Han, J.-Y.; Back, K.; Choi, Y.-E. Gene regulation patterns in triterpene
biosynthetic pathway driven by overexpression of squalene synthase and methyl jasmonate elicitation
in Bupleurum falcatum. Planta 2011, 233, 343–355. [CrossRef] [PubMed]
30. Ginzberg, I.; Thippeswamy, M.; Fogelman, E.; Demirel, U.; Mweetwa, A.M.; Tokuhisa, J.; Veilleux, R.E.
Induction of potato steroidal glycoalkaloid biosynthetic pathway by overexpression of cDNA encoding
primary metabolism HMG-CoA reductase and squalene synthase. Planta 2012, 235, 1341–1353. [CrossRef]
[PubMed]
31. Devarenne, T.P.; Shin, D.H.; Back, K.; Yin, S.H.; Chappell, J. Molecular characterization of tobacco squalene
synthase and regulation in response to fungal elicitor. Arch. Biochem. Biophys. 1998, 349, 205–215. [CrossRef]
[PubMed]
32. Huang, Z.S.; Jiang, K.J.; Pi, Y.; Hou, R.; Liao, Z.H.; Cao, Y.; Han, X.; Wang, Q.; Sun, X.F.; Tang, K.X. Molecular
cloning and characterization of the yew gene encoding squalene synthase from Taxus cuspidata. J. Biochem.
Mol. Biol. 2007, 40, 625–635. [CrossRef] [PubMed]
33. Zhang, J.; Huo, Y.-B.; Liu, Y.; Feng, J.-T.; Ma, Z.-Q.; Zhu, C.-S.; Zhang, X. Differential expressed analysis of
Tripterygium wilfordii unigenes involved in terpenoid backbone biosynthesis. J. Asian Nat. Prod. Res. 2017, 19,
823–832. [CrossRef] [PubMed]
34. Gu, P.D.; Ishii, Y.; Spencer, T.A.; Shechter, I. Function-structure studies and identification of three enzyme
domains involved in the catalytic activity in rat hepatic squalene synthase. J. Biol. Chem. 1998, 273,
12515–12525. [CrossRef] [PubMed]
35. Pandit, J.; Danley, D.E.; Schulte, G.K.; Mazzalupo, S.; Pauly, T.A.; Hayward, C.M.; Hamanaka, E.S.;
Thompson, J.F.; Harwood, H.J. Crystal structure of human squalene synthase—A key enzyme in cholesterol
biosynthesis. J. Biol. Chem. 2000, 275, 30610–30617. [CrossRef] [PubMed]
36. Zheng, Z.; Cao, X.; Li, C.; Chen, Y.; Yuan, B.; Xu, Y.; Jiang, J. Molecular cloning and expression analysis of
a squalene synthase gene from a medicinal plant, Euphorbia pekinensis Rupr. Acta Physiol. Plant. 2013, 35,
3007–3014. [CrossRef]

Molecules 2018, 23, 269
12 of 12
37. Zhang, M.; Wang, S.; Yin, J.; Li, C.; Zhan, Y.; Xiao, J.; Liang, T.; Li, X. Molecular cloning and promoter analysis
of squalene synthase and squalene epoxidase genes from Betula platyphylla. Protoplasma 2016, 253, 1347–1363.
[CrossRef] [PubMed]
38. Bhat, W.W.; Lattoo, S.K.; Razdan, S.; Dhar, N.; Rana, S.; Dhar, R.S.; Khan, S.; Vishwakarma, R.A. Molecular
cloning, bacterial expression and promoter analysis of squalene synthase from Withania somnifera (L.) Dunal.
Gene 2012, 499, 25–36. [CrossRef] [PubMed]
39. Uchida, H.; Yamashita, H.; Kajikawa, M.; Ohyama, K.; Nakayachi, O.; Sugiyama, R.; Yamato, K.T.;
Muranaka, T.; Fukuzawa, H.; Takemura, M.; et al. Cloning and characterization of a squalene synthase gene
from a petroleum plant, Euphorbia tirucalli L. Planta 2009, 229, 1243–1252. [CrossRef] [PubMed]
40. Liu, Y.-J.; Zhao, Y.-J.; Su, P.; Zhang, M.; Tong, Y.-R.; Hu, T.-Y.; Huang, L.-Q.; Gao, W. The MVA pathway genes
expressions and accumulation of celastrol in Tripterygium wilfordii suspension cells in response to methyl
jasmonate treatment. J. Asian Nat. Prod. Res. 2016, 18, 619–628. [CrossRef] [PubMed]
41. Zhu, C.S.; Miao, G.P.; Guo, J.; Huo, Y.B.; Zhang, X.; Xie, J.H.; Feng, J.T. Establishment of Tripterygium wilfordii
Hook. f. hairy root culture and optimization of its culture conditions for the production of triptolide and
wilforine. J. Microbiol. Biotechnol. 2014, 24, 823–834. [CrossRef] [PubMed]
42. Li, Y.Q.; Liu, J.W.; Lu, M.; Ma, Z.Q.; Cai, C.L.; Wang, Y.H.; Zhang, X. Bacterial expression and kinetic analysis
of carboxylesterase 001D from Helicoverpa armigera. Int. J. Mol. Sci. 2016, 17, 493. [CrossRef] [PubMed]
43. Miao, G.P.; Li, W.; Zhang, B.; Zhang, Z.F.; Ma, Z.Q.; Feng, J.T.; Zhang, X.; Zhu, C.S. Identification of
genes involved in the biosynthesis of Tripterygium wilfordii Hook. f. secondary metabolites by suppression
subtractive hybridization. Plant Mol. Biol. Rep. 2015, 33, 756–769. [CrossRef]
44. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [CrossRef] [PubMed]
Sample Availability: Samples of Tripterygium wilfordii are available from the authors.
©
2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).