Targeting Influenza A Virus RNA Promoter

Article abstract of DOI:10.1111/cbdd.12534

The emergence of drug-resistant strains of influenza virus makes exploring new classes of inhibitors that target universally conserved viral targets a highly important goal. The influenza A viral genome is made up of eight single-stranded RNA-negative segments. The RNA promoter, consisting of the conserved sequences at the 3′ and 5′ end of each RNA genomic segment, is universally conserved among influenza A virus strains and in all segments. Previously, we reported on the identification and NMR structure of DPQ (6,7-dimethoxy-2-(1-piperazinyl)-4-quinazolinamine) (compound 1) in complex with the RNA promoter. Here, we report on additional screening and SAR studies with compound 1, including ex vivo anti-influenza activity assays, resulted in improved cellular activity against influenza A virus in the micromolar range.

Full text of DOI:10.1111/cbdd.12534

Chem Biol Drug Des 2015
Research Article
Targeting Influenza A Virus RNA Promoter
Angel Bottini1,2, Surya K. De1, Bainan Wu1,
Changyan Tang3, Gabriele Varani3 and
Maurizio Pellecchia1,*
neuraminidase inhibitors, oseltamivir phosphate (Tamiflu) (3),
and zanamivir (Relenza) (4), which abolish the release of new
virions from the host cell. Unfortunately, neuraminidase-
resistant strains are also emerging. In light of the rising
resistance of influenza virus strains to current anti-influenza
medications, finding other druggable targets that are as con-
served and less prone to the development of drug resistance
due to mutations is of critical importance (5,6).
1Infectious and Inflammatory Disease Center and Cancer
Center, Sanford Burnham Medical Research Institute,
10901 North Torrey Pines Road, La Jolla, CA 92037,
USA
2Sanford Burnham Graduate School of Biomedical
Sciences, 10901 North Torrey Pines Road, La Jolla, CA
92037, USA
The influenza A virus is a member of orthomyxoviridae
family and its genome consists of eight single-stranded
RNA-negative segments (7). The genome of influenza A
virus is organized into eight separated ribonucleoprotein
complexes (RNP complexes), where the hetero-trimeric
RNA-dependent RNA polymerase (RdRp) and multiple
copies of nucleoproteins bind to single-stranded viral RNA
(6). The RdRp is composed of three subunits, PA, PB1,
and PB2, arranged in a head to tail fashion (8). The RdRp
binds to the 30 and 50 ends of a viral RNA segment, trig-
gering both transcription initiation of complementary RNA
(cRNA) and replication of the viral genome (vRNA).
3Department of Chemistry, University of Washington,
Seattle, WA 98195-1700, USA
*Corresponding author: Maurizio Pellecchia,
mpellecchia@burnham.org
The emergence of drug-resistant strains of influenza
virus makes exploring new classes of inhibitors that tar-
get universally conserved viral targets a highly important
goal. The influenza A viral genome is made up of eight
single-stranded RNA-negative segments. The RNA pro-
moter, consisting of the conserved sequences at the 30
and 50 end of each RNA genomic segment, is universally
conserved among influenza A virus strains and in all
segments. Previously, we reported on the identification
and NMR structure of DPQ (6,7-dimethoxy-2-(1-piperaz-
inyl)-4-quinazolinamine) (compound 1) in complex with
the RNA promoter. Here, we report on additional
screening and SAR studies with compound 1, including
ex vivo anti-influenza activity assays, resulted in
improved cellular activity against influenza A virus in the
micromolar range.
The 13 nucleotides on the 50 terminus and 12 nucleotides
on the 30 terminus of each viral RNA segment are con-
served throughout various human influenza A virus strains
and come together to form a so-called panhandle-like
structure (7). Mutations in these conserved sequences
negatively affect viral replication efficiency (9). We will refer
to this region (13 nucleotides of the 50 terminus and 12
nucleotides the 30 terminus) of the viral RNA as the influ-
enza RNA promoter throughout this work. The structure of
this RNA promoter has been solved by solution NMR
spectroscopy using a designed RNA segment containing
all conserved nucleotides underlined in the following
sequence: 50- GAGUAGAAACAAGGCUUCGGCCUGCUU
UUGCU - 30 (10). We found that the RNA promoter adopts
an A-form helix with an interloop containing an AA-U motif
and a C-A mismatch pair. In addition, there was a
46 ꢀ 10° bend close to the initiation site of the viral RNA,
which has been postulated to be important for RNA poly-
merase recognition (7).
Key words: chemical biology, drug design, drug discovery
Received 21 November 2014, revised 8 January 2015 and
accepted for publication 23 January 2015
Influenza A viral infection poses great threat to public health
worldwide, affecting lives of thousands of individuals every
year. There are currently two classes of medications avail-
able to treat influenza. The first class includes amantadine
and rimantadine, both are M2 ion channel inhibitors (1) which
block the release of the viral genome into the cytoplasm and
the maturation of the viral proteins (2). However, H1N1 and
H3N2 influenza strains circulating in the North American
continent carry a S31N mutation of the M2 protein, which
renders them resistant to amantadine (http://www.cdc.gov/
flu/about/qa/antiviralresistance for 2013–2014 flu season)
(1). The second class of anti-influenza drugs includes
Armed with the knowledge of the RNA promoter structure
and encouraged by the fact that promoter sequences are
highly conserved and intolerant of mutations (7), we car-
ried out a small molecule screen against the RNA pro-
moter in the hope to find hits that possess anti-influenza
replication activity (10). A small molecule, 6,7-dimethoxy-2-
(1-piperazinyl)-4-quinazolinamine (DPQ, compound 1), was
ª 2015 John Wiley & Sons A/S. doi: 10.1111/cbdd.12534
1

Bottini et al.
identified in a NMR-based screen of 4279 compounds to
bind to influenza RNA promoter close to the AA-U inter-
ing ligand for the RdRp and that changes in its confirma-
tion, as induced by our compounds, are sufficient to
antagonize its function.
loop region (Figure 1A) (10). However, compound
1
showed only a modest anti-influenza activity in a cell-
based viral replication assay with an IC50 value of 549 lM
(Table 1) (10). Upon examination of the compound 1-RNA
promoter complex, we reported that the binding of com-
pound 1 straightened the bend at the A5-U29 base pair
and widened the major groove near base pairs G13-C22
and G14-C21 (numbering from the 50 end in the above-
listed RNA sequence) (10). We hypothesized that this
change in structure would interfere with the binding of
RdRp and subsequently the ability of the virus to replicate.
Methods and Materials
Compound 1 analogues synthesis (compounds
3–16)
General
Unless otherwise indicated, all anhydrous solvents were
commercially obtained and stored in Sure/Seal bottles
under nitrogen. All other reagents and solvents were pur-
chased as the highest grade available and used without
further purification. Thin-layer chromatography (TLC) analy-
sis of reaction mixtures was performed using Merck silica
gel 60 F254 TLC plates (Sigma-Aldrich, Milwaukee, WI,
USA) and visualized using ultraviolet light. NMR spectra
were recorded on JEOL 400 MHz instruments. Chemical
shifts (d) are reported in parts per million (ppm) referenced
to 1H (Me4Si at 0.00). Coupling constants (J) are reported
in Hz throughout. Mass spectral data were acquired on
Shimadzu LCMS-2010EV (Shimadzu Scientific Instru-
ments, Inc., Columbia, MD, USA) for low resolution, and
on an Agilent ESI-TOF (Agilent Technologies, Santa Clara,
CA, USA) for either high or low resolution; or Bruker Da-
tonics Autoflex II MALDI TOF/TOF (Bruker Daltonics, Inc.,
Billerica, MA, USA). Purity of all compounds was obtained
in a HPLC Breeze from Waters Co. (Waters Corporation,
Milford, MA, USA) using an Atlantis T3 3-lm
4.6 9 150 mm reverse-phase column. The eluant was a
linear gradient with a flow rate of 1 mL/min from 95% A
and 5% B to 5% A and 95% B in 15 min followed by
5 min at 100% B (Solvent A: H2O with 0.1% TFA; Solvent
B: acetonitrile with 0.1% TFA). The compounds were
detected at k=254 nm. Purity of key compounds was
established by HPLC and/or elemental analysis as
performed on a PerkinElmer series II-2400 (Perkin-Elmer,
When studying the complex between compound 1 and
the RNA promoter more closely, we found that the inter-
action is mainly mediated by contacts involving the meth-
oxy groups on compound 1 and the bases of adenosine
12 and cytosine 22 (Figure 1A) (10). Moreover, the primary
amine of compound 1, likely protonated under physiologi-
cal conditions, is located across from the phosphate
backbone, presumably stabilizing the binding via electro-
static interactions (Figure 1B). However, the secondary
amine on the piperazine seems to be pointing away from
the target and is not making significant contacts with the
RNA promoter. Based on these observations, we hypoth-
esized that modifying and/or extending the secondary
amine on the piperazine could result in analogues with
improved affinity and/or pharmacological properties (Fig-
ure 1B). Our studies resulted in improved compound 1
derivatives with cellular activity against influenza A virus in
the micromolar range.
In a parallel approach, we also tested a combinatorial pep-
tide library against the RNA promoter by NMR, in an
attempt to identify possible peptide binding motifs that may
recapitulate the recognition by the RdRp. However, no suit-
able peptide sequences were identified, corroborating the
hypothesis that the RNA promoter functions as an anchor-
A
B
Figure 1: Influenza RNA promoter in complex with compound 1. (A) Detail of the interactions between compound 1 and the RNA
promoter from the NMR structure of the complex (PDB ID 2LWK) (10). The RNA helix is shown as a green ribbon, and the nucleoside
atoms and compound 1 are shown as balls and sticks. The yellow dotted lines indicated hydrogen bonds between the adenine 12 H61/
H62 hydrogens and 6-methoxy oxygen atom of compound 1, and between cytosine 22 H41/H42 hydrogens and the 7-methoxy oxygen
of compound 1. (B) The RNA promoter was depicted in surface representation and color-coded according to cavity depth (blue indicates
the most outer surface and yellow indicated a deeper cavity relative to the surface). Compound 1 binds in the major groove of the RNA
helix and the amine on the piperazine ring extents toward the cavity but does not interact significantly with the RNA.
2
Chem Biol Drug Des 2015

Influenza RNA Antagonists
Table 1: Summary of IC50, CC50, IC50/CC50, and Kd values of compounds
ID
1
Structure
IC50 (lM)
CC50 (lM)
>1000a
IC50/CC50
Kd (lM)
549a
<0.55
61.45
NH
N
N
N
O
O
N
O
O
NH2
H
N
NH2
N
N
N
H
3
>250b
>250b
>250
>250
>250
>250
>250
>250
>250
>250
16.4
>1.00
>1.00
>1.00
<0.16
<0.14
<0.18
>1.00
<0.14
>1.00
>15.24
131.9
N
O
O
O
N
NH2
O
NH2
N
N
N
O
O
4
>250
+
N
NH2
O
S
N
N
N
N
N
N
N
N
O
N
O
O
5
>250
+
N
NH2
O
N
N
N
N
N
N
N
N
O
O
6
39.67 ꢀ 6.49
33.89 ꢀ 23.2
44.18 ꢀ 11.28
>250
114.2
158.5
44.35
+
N
NH2
O
N
O
O
7
N
NH2
O
N
O
O
8
N
NH2
O
O
H
N
O
O
9
N
NH2
O
N
O
O
10
11
12
34.18 ꢀ 17.23
127.2
N
NH2
O
N
O
O
O
>250
+
N
NH2
O
N
O
O
>250
+
N
NH2
Chem Biol Drug Des 2015
3

Bottini et al.
Table 1: continued
ID
Structure
IC50 (lM)
CC50 (lM)
>250
IC50/CC50
Kd (lM)
O
O
13
54.06 ꢀ 9.5
<0.22
331.6
O
O
N
N
N
N
N
O
O
N
NH2
N
O
O
14
15
16
17
27.88 ꢀ 10.2
16.77 ꢀ 3.99
107.55 ꢀ 49.09
126 ꢀ 24.65
78.23
66.97
>250
0.36
0.25
+
N
NH2
O
O
S
N
N
N
O
O
221.1
320.7
149.9
N
NH2
N
N
N
N
N
O
O
<0.43
<0.50
N
NH2
O
N
O
O
>250
N
NH2
aValues were determined and reported in published paper (10).
bDue to compound solubility properties, the IC50 and CC50 values were determined with serial titration concentrations ranging from
250 lM to 38 nM.
+ indicates that the analogue binds to the influenza RNA promoter and results in decreased intensities of imino protons of U26 and G13
yet the Kd value was not determined.
Waltham, MA, USA). Combustion analysis was performed
by NuMega Resonance Labs, San Diego, CA, USA.
6,7-dimethoxy-2-(4-(methylsulfonyl)piperazin-1-yl)
quinazolin-4-amine (5)
Yield: 69%; H NMR (400 MHz, DMSO-d6) d 2.92 (s, 3 H),
1
3.26–3.30 (m, 4 H), 3.83 (s, 3 H), 3.88 (s, 3 H), 3.91–3.95
(m, 4 H), 7.30 (s, 1 H), 7.69 (s, 1 H), 8.73 (br s, 1 H), 8.87
(br s, 1 H); MS (MALDI) m/z 368 (M+H)+, 390 (M+Na)+.
2-amino-N-(2-((2-(4-(4-amino-6,7-
dimethoxyquinazolin-2-yl)piperazin-1-yl)-2-
oxoethyl)amino)-2-oxoethyl)acetamide (3)
Yield: 35%; 1H NMR (400 MHz, DMSO-d6) d 3.60–3.66
(m, 4 H), 3.75–3.80 (m, 4 H), 3.82 (s, 2 H), 3.88 (s, 2 H),
4.05 (br s, 2 H), 7.19 (s, 1 H), 7.67 (s, 1 H), 7.99 (br s, 2
H, NH2), 8.14 (br s, 1 H), 8.62 (br s, 1 H, NH), 8.67 (br s,
2 H, NH2); MS (MALDI) m/z 461 (M+H)+, 483 (M+Na)+.
Synthesis of 1-(4-(4-amino-6,7-dimethoxyquinazolin-
2-yl)piperazin-1-yl)propan-1-one (6)
A mixture of 1 (62 mg, 0.21 mmol, 1 eqv), propionic acid
(16 mg, 0.21 mmol,
1
eqv), Oxyma pure (31 mg,
0.25 mmol, 1.2 eqv), N,N’-Diisopropylcarbodiimide (DIC,
32 mg, 0.25 mmol, 1.2 eqv), DIEA (40 mg, 0.31 mmol, 1.5
eqv) in DMF (2 mL) was stirred for 16 h at room tempera-
ture. After completion, DMF was removed in vacuo
followed by chromatographic purification using 5–10%
MeOH in CH2Cl2 to afford a pure product, 6 (43 mg, 60%).
5-amino-1-(4-(4-amino-6,7-dimethoxyquinazolin-2-
yl)piperazin-1-yl)pentan-1-one (4)
Yield: 41%; 1H NMR (400 MHz, DMSO-d6) d 1.52–1.56
(m, 4 H), 2.41–2.49 (m, 2 H), 2.78–2.81 (m, 2 H), 3.61–
3.64 (m, 4 H), 3.75–3.81 (m, 4 H), 3.83 (s, 3 H), 3.89 (s, 3
H), 7.21 (s, 1 H), 7.67 (s, 1 H), 7.72 (br s, 2 H, NH2), 8.69
(s, 1 H, NH), 8.82 (s, 1 H, NH); MS (MALDI) m/z 389
(M+H)+, 411 (M+Na)+.
1H NMR (400 MHz, DMSO-d6) d 0.96 (t, J = 7.2 Hz, 3 H),
2.33 (q, J = 6.8 Hz, 2 H), 3.59–3.62 (m, 4 H), 3.65–3.71
(m, 4 H), 3.74 (s, 3 H, OMe), 3.79 (s, 3 H, OMe),
4
Chem Biol Drug Des 2015

Influenza RNA Antagonists
6.76 (s, 1 H), 7.35 (br s, 2 H, NH2), 7.41 (s, 1 H); MS
(MALDI): m/z 346 (M+H)+, 368 (M+Na)+.
3.80 (s, 3 H), 6.81 (s, 1 H), 7.45 (s, 1 H), 7.55 (br s, 2 H,
NH2); MS (MALDI) m/z 452 (M+H)+, 474 (M+Na)+.
Similarly, compounds 7–16 were synthesized; character-
ization data were as follows:
(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)(tetrahydrofuran-2-yl)methanone (13)
Yield: 65%; 1H NMR (400 MHz, DMSO-d6) d 1.80–1.88
(m, 2 H), 1.96–2.10 (m, 2 H), 3.57–3.71 (m, 8 H), 3.72–
3.80 (m, 2 H), 3.83 (s, 3 H), 3.86 (s, 3 H), 4.72–4.76 (m, 1
H), 7.56 (br s, 2 H, NH2), 7.75 (s, 2 H); MS (MALDI) m/z
388 (M+H)+, 410 (M+Na)+.
1-(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)-2-methylpropan-1-one (7)
Yield: 67%; 1H NMR (400 MHz, DMSO-d6) d 0.97 (d,
J = 6.8 Hz, 6 H), 2.84–2.89 (m, 1 H), 3.59–3.63 (m, 4 H),
3.67–3.71 (m, 4 H), 3.73 (s, 3 H, OMe), 3.78 (s, 3 H,
OMe), 6.70 (s, 1 H), 7.14 (br s, 2 H, NH2), 7.37 (s, 1 H);
MS (MALDI): m/z 360 (M+H)+, 382 (M+Na)+.
(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)(furan-2-yl)methanone (14)
Yield: 61%; 1H NMR (400 MHz, DMSO-d6) d 3.42–3.55
(m, 4 H), 3.63–3.68 (m, 4 H), 3.83 (s, 3 H), 3.99 (s, 3 H),
6.67 (s, 1 H), 7.10 (t, J = 3.6 Hz, 1 H), 7.24 (s, 1H), 7.41
(s, 1 H), 7.35 (br s, 2 H, NH2), 7.43 (d, J = 3.8 Hz, 1 H);
MS (MALDI) m/z 384 (M+H)+, 406 (M+Na)+.
1-(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)butan-1-one (8)
Yield: 56%; 1H NMR (400 MHz, DMSO-d6) d 0.86 (t,
J = 7.2 Hz, 3 H), 2.30–2.34 (m, 2 H), 2.45 (t, J = 6.8 Hz, 2
H), 3.46–3.50 (m, 4 H), 3.56–3.61 (m, 4 H), 3.78 (s, 3 H,
OMe), 3.86 (s, 3 H, OMe), 6.90 (s, 1 H), 7.35 (br s, 2 H, NH2),
7.41 (s, 1 H); MS (MALDI) m/z 360 (M+H)+, 382 (M+Na)+.
(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)(thiophen-2-yl)methanone (15)
1
Yield: 60%; H NMR (400 MHz, DMSO-d6) d 3.45–3.56 (m,
1-(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)-3-hydroxypropan-1-one (9)
Yield: 61%; 1H NMR (400 MHz, DMSO-d6) d 2.54 (br s, 1
H), 3.45–3.57 (m, 4 H), 3.65 (q, J = 5.5 Hz, 2 H), 3.67–
3.75 (m, 4 H), 3.79 (s, 3 H), 3.82 (s, 3 H), 4.55 (t, J = 6.2
H, 2 H), 6.80 (br s, 2 H, NH2), 7.47 (s, 2 H); MS (MALDI)
m/z 362 (M+H)+, 384 (M+Na)+.
4 H), 3.67–3.70 (m, 4 H), 3.76 (s, 3 H), 3.79 (s, 3 H), 6.75 (s,
1 H), 7.11 (t, J = 3.8 Hz, 1 H), 7.30 (br s, 2 H, NH2), 7.41 (s,
1 H), 7.43 (d, J = 3.8 Hz, 1 H), 7.72 (d, J = 3.8 Hz, 1 H);
MS (MALDI) m/z 400 (M+H)+, 422 (M+Na)+.
(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)(phenyl)methanone (16)
Yield: 59%; 1H NMR (400 MHz, DMSO-d6) d 3.39–3.45
(m, 4 H), 3.62–3.72 (m, 4 H), 3.77 9s, 3 H), 3.88 (s, 3 H),
6.73 (s, 1 H), 7.17 (br s, 2H, NH2), 7.42 (s, 1 H), 7.43–
7.48 (m, 5 H); MS (MALDI) m/z 394 (M+H)+, 416 (M+Na)+.
(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)(cyclopropyl)methanone (10)
Yield: 59%; 1H NMR (400 MHz, DMSO-d6) d 0.70–0.72
(m, 4 H), 1.91–2.01 (m, 1 H), 3.41–3.54 (m, 4 H), 3.65–
3.71 (m 4 H), 3.74 (s, 3 H), 3.79 (s, 3 H), 6.76 (s, 1 H),
7.30 (br s, 2 H, NH2), 7.41 (s, 1 H); MS (MALDI) m/z 358
(M+H)+, 380 (M+Na)+.
Binding assays and Kd determinations using NMR
spectroscopy
Compound stocks (in DMSO-d6) were diluted in binding
buffer (10 mM potassium phosphate, 150 mM NaCl, pH 6.0)
and added to a solution of either 30 or 50 lM influenza
RNA promoter at the indicated final concentrations (Fig-
ure S1). Initial binding was assessed by observing the peak
intensities of the imino protons of U26, G13, and G24. The
reduction in peak intensity of U26 and G13 was measured,
and the values were used to calculate Kd values using
GRAPHPAD PRISM 6 (GraphPad Software, Inc., La Jolla, CA,
USA). The chemical shift displacement at the ribose region
at peak ~5.714 ppm corresponding to the H10 of adenosine
12(10) was also monitored to confirm binding of the com-
pounds and for Kd determinations. Increasing concentra-
tions of compounds 1, 3, 6, 7, 8, 10, 13, 15, 16, and 17
were titrated into 50 lM influenza RNA at the concentra-
tions of 10, 20, 40, 60, 80, 100, 200, and 370 lM in buffer
composed of 10 mM potassium phosphate, 50 mM NaCl,
1-(4-(4-amino-6,7-dimethoxyquinazolin-2-yl)
piperazin-1-yl)-2-methoxypropan-1-one (11)
Yield: 52%; 1H NMR (400 MHz, DMSO-d6) d 1.20 (d,
J = 4.5 Hz, 3 H, Me), 3.16 (s, 3 H), 3.38–3.45 (m, 4 H),
3.58–3.69 (m, 4 H), 3.78 (s, 3 H), 3.79 (s, 3 H), 4.20–4.24
(m, 1 H), 6.69 (s, 1 H), 7.10 (br s, 2 H, NH2), 7.37 (s, 1 H);
MS (MALDI) m/z 384 (M+H)+, 406 (M+Na)+.
(1r,3R,5S)-adamantan-1-yl(4-(4-amino-6,7-
dimethoxyquinazolin-2-yl)piperazin-1-yl)
methanone (12)
Yield: 52%; 1H NMR (400 MHz, DMSO-d6) d 1.21 (t,
J = 7.6 H, 2 H), 1.60–1.67 (m, 6 H), 1.86–1.96 (m, 7 H),
3.41–3.48 (m, 4 H), 3.62–3.66 (m, 4 H), 3.75 (s, 3 H),
Chem Biol Drug Des 2015
5

Bottini et al.
(pH = 6.0). NMR spectra were obtained on 600 MHz Bruker
Avance spectrometer equipped with TCI cryoprobe. The
NMR data were processed and analyzed using TOPSPIN2.1
(Bruker Biospin, MA). The Kd values were calculated with
GRAPHPAD PRISM 6.
(PerkinElmer), and the CC50 values were plotted using
GRAPHPAD PRISM 6.
WSN-Ren luciferase assay to measure viral
replication
To assess the ability of selected compounds to inhibit viral
replication, we adopted a WSN-Ren luciferase assay (13).
The coding sequence of Renilla luciferase was engineered
in A/WSN/33 influenza virus in the place of hemagglutinin
(HA), and a complementary MDCK cell line expressing HA
(MDCK-HA) was used to allow multiple cycles of replica-
tion. In a white 96-well plate, 25 000 MDCK-HA cells were
seeded and compounds and control (oseltamivir phos-
phate) were serial diluted (3x) and then added to treat the
cells at the final concentration ranging from 250 lM to
38 nM. Renilla luciferase substrate (Promega Corporation,
Madison, WI, USA) was added following manufacturer’s
protocol after 4 h of compound treatment and then
incubated overnight. Fluorescence signal was read at
24 h post-infection using VictorTM X5, 2030 multilabel
reader (PerkinElmer). The IC50 values were calculated with
GRAPHPAD PRISM 6.
Peptide library screening and guanidine- and
amidino-containing compounds screening
A combinatorial tetra-peptide library consisted of 19 natu-
ral amino acids excluding cysteine was obtained (Pepscan,
Zuidersluisweg, the Netherlands). The tetra-peptide library
was assembled in a positional scanning format (11,12).
The samples are grouped into mixtures where one amino
acid is fixed at a certain position, while the other three
positions contain all possible combinations for the 19
amino acids. For example, a mixture of OXXX, where O is
one of the 19 natural amino and X represents a combina-
tion of all 19 amino acids, contains 6,859 samples
(1 9 19 9 19x19 = 6,859). The library contains 19 mix-
tures of OXXX, 19 mixtures of XOXX, 19 mixtures of XXOX,
and 19 mixtures XXXO and thus allows reasonable number
of NMR experiments (19 + 19 + 19 + 19 = 76). Each mix-
ture was prepared at 100 mM stock in DMSO-d6. The
influenza RNA promoter was dissolved in buffer composed
of 150 mM potassium phosphate, 150 mM NaCl, 0.1 mM
MgCl2 at pH 6.4 for screening. A final concentration of
2 mM (10 lL of 100 mM DMSO stock) of each mixture
was added to 10 lM of RNA. NMR spectra were collected
using 600 MHz Bruker Avance with TCI cryoprobe and
analyzed with TOPSPIN2.1 (Bruker Biospin). Both peak inten-
sity of imino proton of U26 and the chemical shift dis-
placement for H10 ribose peak of adenosine 12 at
approximately 5.714 ppm were monitored for compound-
bound RNA. However, none of the mixtures caused a sig-
nificant perturbation of the NMR signal.
Viral replication assay using Real-time PCR to
measure viral mRNA level
MDCK cells were plated in 96-well plate at 25 000 cell/
well and incubated at 37 °C overnight. Cells were treated
separately with 50 lM of oseltamivir phosphate, 50 lM of
compounds 7, 8, and 10, and DMSO as control and then
infected with wild-type influenza virus (A/Puerto Rico/8/
1935) at MOI = 0.2. Infected cells were harvested after
24 h post-infection with one PBS wash, and the cells were
lysed with RA1 buffer (RA1 with 1% b–mercaptoethanol)
following the Macherey-Nagel manufacture’s protocol in
96-well format for RNA extraction. The purified total RNA
was then reverse-transcribed using iScriptTM cDNA Synthe-
sis Kit from Bio-Rad (Bio-Rad Corporation, Hercules, CA,
USA) (Catalog #170-8891). Real-time PCR is then used to
measure the mRNA production of viral nucleoprotein (A/
PR8/34 nucleoprotein) and cellular b-actin in the infected
cells for standardization.
Guanidino and amidino compounds 18–24 were commer-
cially available (Table S1). Compound stocks (in DMSO-d6)
were diluted in buffer (10 mM potassium phosphate,
150 mM NaCl, pH 6.0) and added to a solution containing
50 lM influenza RNA promoter at final concentration of
25 lM. We monitored the decrease in peak intensities of
imino protons of U26, G13, and G24 for binding. The
chemical shift perturbations at the H10 of adenosine 12 at
~5.714 ppm were also monitored.
Results
We previously suggested that the influenza RNA promoter
represents a novel and highly conserved druggable target
to combat influenza infections (13) and we identified com-
pound 1 (Figure 1A) as an influenza RNA promoter binding
small molecule. Using solution NMR spectroscopy, we
reported that the interactions between compound 1 and
the viral RNA promoter are mediated by the methoxy
groups of compound 1, forming hydrogen bonds with
adenine 12 and cytosine 22 of the RNA (Figure 1A), and
by electrostatic interactions between the phosphate
backbone and the primary amine, likely protonated at
ATPliteTM assay for cytotoxicity assessment
Cytotoxicity assays were carried out using the ATPliteTM
assay kit (PerkinElmer) following the manufacturer’s proto-
col. In short, in a white flat-bottom 96-well plate, 25 000
MDCK cells were seeded and compounds and control
(oseltamivir phosphate) were serial diluted (3x) and added
to the well with final concentrations ranging from 250 lM
to 38 nM. After a 24-h incubation period, 10 lL of ATPlite
solution was added to each well. The fluorescence reading
was recorded using VictorTM X5, 2030 multilabel reader
6
Chem Biol Drug Des 2015

Influenza RNA Antagonists
physiological pH, in the compound. Moreover, the binding
of compound 1 to the viral RNA caused a straightening of
the bend close to the AA-U motif in the interloop, which
has been suggested to important for RdRp recognition
(10). As a consequence, the compound-bound RNA pro-
moter maintains an A-form helical structure, which pre-
sumably is not a good substrate for the RdRp.
toxic to MDCK-HA cells. Compound 14 showed CC50
value of 78.23 lM, compound 15 showed CC50 value of
66.97 lM, and compound 12 was determined to be the
most toxic among this set of analogues with CC50 value of
16.4 lM (Table 1). All the remaining compounds did not
show significant cytotoxicity when tested up to 250 lM.
We next examined whether the remaining compounds
affected influenza viral replication using the WSN-Ren lucif-
erase assay. WSN-Ren luciferase assay was established
using a modified influenza virus (A/WSN/33) encoding Re-
nilla luciferase in the place of hemagglutinin (HA) and a
complementary MDCK cell line expressing HA (MDCK-HA)
(13). We previously reported that compound 1 is active in
this assay with an IC50 of 549 lM (10). By comparing
compound-treated to DMSO-treated cells, we found that
six compounds (3, 4, 5, 9, 11, and 12) did not possess
significant anti-influenza activity in this cell-based assay.
The IC50 values were determined for the remaining active
compounds. Compounds 6, 7, 8, 10, 13, 14, 15, 16, and
17 displayed improved antiviral activity compared to com-
pound 1. Compounds 16 and 17 were the least potent yet
still had IC50 values of 107.55 ꢀ 49.09 lM and
126.0 ꢀ 24.65 lM, respectively, roughly fourfold more
potent than compound 1 (Table 1). Compounds 6, 7, 8,
10, 13, and 14 displayed IC50 values within a close range
(between 25 and 55 lM). Compound 15 had the lowest
IC50 value of 16.77 ꢀ 3.99 lM (Table 1); however, it was
toxic to cells at the upper concentrations tested, which
might have skewed the IC50 curve. To more accurately
represent the potency of the active compounds, we there-
fore report the ratio between the IC50 value and CC50
value for each compound in Table 1. The ideal compound
would display high inhibitory activity and low cytotoxicity,
resulting in a low IC50/CC50 ratio. Compounds 7 and 10
were therefore the best performers, displaying IC50/CC50
ratios <0.14, while compounds 6 and 8 also performed
well with an IC50/CC50 ratio <0.18 (Table 1).
We also noticed that in the compound-RNA complex, the
piperazine of compound 1 is oriented toward the cavity of
the major groove of the RNA helix (Figure 1B). We there-
fore hypothesized that we might improve the compound
binding potency and/or pharmacological properties by
modifying the secondary piperazinyl amine.
We assembled a total of 15 analogues of compound 1
(namely compounds 3–16, that were synthesized in house,
and compound 17 that was purchased from Asinex), all
carrying modifications on the secondary amine of the
piperazine (Table 1). Compounds 6–16 were synthesized
using one-step coupling using different starting materials
(Figure 2). Compound 3 was synthesized using Boc-Gly-
Gly-Gly-OH with oxyma pure, DIC, DIEA, and DMF at
room temperature for 18 h followed by deprotection of
Boc group with 50% TFA in dichloromethane at room tem-
perature for 3 h (Figure S2). Compounds 4 and 5 were
synthesized as detailed in Figure S2.
We first assessed whether the compounds were able to
bind to the RNA promoter using 1D 1H NMR as we reported
previously (10). This primary binding assay confirmed that
compounds 3–17 were all able to interact with the promoter
(Figure S1). All compounds seemed to bind to the RNA pro-
moter in a fashion similar to compound 1, causing line
broadenings of the imino protons of U26, G13, and G24. In
addition, some compounds (3, 4, 5, 7, 9, 11, and 14) also
caused line broadening of the imino protons of U27 as
compound 1 did (Figure S1), again indicating that they likely
bind to the RNA in a similar fashion as compound 1.
Using careful titrations, Kd values were determined by
NMR spectroscopy for compounds 1, 3, 6, 7, 8, 10, 13,
15, 16, and 17. We previously estimated the Kd value for
compound 1 monitoring the peak intensity of the imino
protons of U26, G13, and G24, resulting in a Kd value of
We then tested compound 3–17 for cytotoxicity and
ex vivo anti-influenza replication activities. Compound cyto-
toxicity was assessed using ATPliteTM assay (PerkinElmer)
in MDCK-HA cells. Three compounds were found to be
Figure 2: Synthesis of 4-amino-6,7-dimethoxy-2-(piperazin-1-yl)quinazoline derivatives (compounds 6–16). Compounds 6–16 were
synthesized from commercially available compound 1 using standard coupling conditions (EDC, oxyma pure, DIEA in DMF incubated at rt
for 15 h) with different starting materials as detailed in Figure 2. (6) R = Et; (7) R
= i-Pr; (8) R = Pr; (9) R = 2-Hydroxyethyl; (10)
R = cyclopropyl; (11) R = 1-methoxyethyl; (12) R = 1-adamantyl; (13) R = tetrahydrofuran; (14) R = Furan; (15) R = thiophene; (16)
R = phenyl.
Chem Biol Drug Des 2015
7

Bottini et al.
A
B
C
D
E
F
Figure 3: NMR-based Kd determination for compounds 1, 8, and 10. (A), (B), and (C) reports 1D 1H NMR spectra in the ribose region of the
influenza RNA promoter (50 lM) titrated with 0, 10, 20, 40, 60, 80, 100, 200, and 370 lM of compounds 1, 8, and 10, respectively. Chemical
shift perturbations at 5.714 ppm (red arrow, corresponding to the H10 of adenosine 12) were monitored and the displacement of distance (d
ppm) used to calculate the Kd values in GraphPad PRISM 6 shown in (D), (E), and (F) for compounds 1, 8, and 10, respectively.
50.5 ꢀ 9 lM (10). However, using peak intensity is not an
accurate approach as the binding is likely in the intermedi-
ate exchange with respect to the time scale related to the
chemical shift perturbations at the imino protons. There-
fore, we monitored chemical shift perturbations in the
ribose region upon compound binding, as a fast exchange
regime is observed within the RNA ribose protons upon
complex formation. From that, we calculated Kd values
using the chemical shift titration of the ribose peak at
5.714 ppm (corresponding to the H10 of A12) for com-
pound 1 that led to a Kd value of 61.45 lM (Figure 3A and
D), close to the previously published value (Table 1).
Except for compound 8, which displayed a Kd value of
44.35 lM (Figure 3B and E), all the other tested com-
pounds had Kd values above 100 lM. As mentioned
above, in a Renilla luciferase reporter assay (13,14), the
A
B
Figure 4: Viral replication assay measured by RT-PCR (A) MDCK-HA cells were treated with control or compounds at 50 lM and then
were infected with WSN-Ren luciferase virus in the same condition as the WSN-Ren luciferase assay. The mRNA level of WSN
nucleoprotein was measured and standardized against b-actin. The fold expression indicated that compounds 7, 8, and 10 at 50 lM
showed similar inhibitory effect as oseltamivir phosphate at the same concentration, while compound 1 did not showed significant
inhibitory activity at 50 lM. The p value is <0.0001 analyzed by one-way ANOVA test. (B) MDCK cells were treated with controls (oseltamivir
phosphate or DMSO) or compound and then infected with wild-type influenza A/PR/8/35 virus at MOI= 0.2. Influenza A/PR8 nucleoprotein
mRNA was measured and standardized against beta-actin mRNA level. The fold expressed is shown in log10 scale. Oseltamivir
phosphate at 25 lM and compound 10 at 50 lM and 5 lM showed inhibitory effects as the mRNA levels were reduced compared to
DMSO-treated cells. The p value was analyzed with one-way ANOVA analysis to be p = 0.0111.
8
Chem Biol Drug Des 2015

Influenza RNA Antagonists
most potent compounds are 7, 8, and 10 with Kd values
of 158.5 lM, 44.4 lM, and 127.2 lM, respectively, for bind-
ing to the RNA promoter (Figure 3B–F) and IC50 values of
33.9 lM, 44.2 lM, and 34.2 lM, respectively (Table 1).
Even though compounds 7 and 10 had Kd values slightly
weaker (>100 lM) compared to compound 1 (61.45 lM),
their IC50 values (33.9 and 34.2 lM) were much improved
from 549 lM of compound 1. Compound 8 possesses
both an improved Kd value at 44.4 lM and an improved
IC50 value of 44.2 lM compared to compound 1 (Table 1).
screened this library by 1D proton NMR monitoring both
imino and ribose regions (imino protons of U26 and G13
and the H10 of A12 at ~5.72 ppm, respectively) (10). How-
ever, no clear hits emerged, indicating that there might not
be a linear epitope that appreciably binds to the influenza
RNA promoter. This result further corroborates the hypoth-
esis that viral RdRp might recognize the overall shape of
the RNA helical structure that would function as a ligand
itself for the binding (19).
Taking advantage of the highly sensitive NMR-based bind-
ing assay, we assembled a small library of compounds all
containing basic residues such as guanidine or amidino,
given that such functional groups are often favored in
nucleic acid binding compounds (Table S1) (20). We
proceeded to test these compounds in 1D proton NMR in
the same fashion as described for compounds 1–17 and
found that compounds 20 and 23 caused significant line
broadening at the imino protons of G13 and chemical shift
perturbations in the ribose peak at 5.714 ppm, indicating
binding to influenza RNA promoter (Table S1). However,
other guanidine- or amidino-containing compounds did
not show appreciable binding to the RNA promoter, indi-
cating that the binding of compounds 20 and 23 may be
specific and not merely driven by electrostatic interactions.
Unfortunately, both compounds were found to be cyto-
toxic (CC50 values of 6.8 and 20.2 lM, respectively) and
therefore unsuitable for further evaluation and optimization.
To further confirm the anti-influenza activity of com-
pounds 7, 8, and 10 in an orthogonal cell-based assay,
we measured the nucleoprotein mRNA levels of cells
infected with influenza A virus in the presence or absence
of compounds. In the WSN-Ren assay conditions, MDCK-
HA cells were treated with 50 lM of compounds 7, 8, or
10, using oseltamivir phosphate and compound 1 at the
same concentrations as controls (Figure 4A). Compounds
7 and 10 at 50 lM caused a significant inhibition of viral
mRNA production, similar to that of oseltamivir, with p-val-
ues of 0.003 and 0.0052, respectively, in unpaired t-test
against DMSO control (Figure 4A). Compound 8 was
slightly less active but still significant in reducing viral RNA
levels compared to DMSO (p-value = 0.05) (Figure 4A).
Compound 10 also demonstrated significant dose-depen-
dent inhibitory activity (one-way ANOVA test p value of
0.0111) in a parallel system where wild-type MDCK cells
and wild-type influenza A/PR8/35 were used to measure
viral nucleoprotein mRNA production levels (Figure 4B).
These results further substantiated our interest in com-
pound 1 as a starting point for the development of novel
RNA promoter binding antagonists. We reported that com-
Discussion and Conclusions
pound 1, albeit binding the RNA promoter with a
Kd = 61.45 lM, was not particularly effective in inhibiting
viral replication, exhibiting only a modest IC50 = 549 lM
using a luciferase-based assay (10). Accordingly, when
tested in an orthogonal viral replication assay measuring
nucleoprotein mRNA level using qPCR, compound 1 was
not effective at 50 lM (Figure 4A). Based on the NMR
structure of compound 1 in complex with the RNA pro-
moter, we observed that the interactions were mediated
primarily by the methoxy groups of compound 1, and its
primary amine (Figure 1A), suggesting that the secondary
amine on the piperazine ring could be used to improve the
binding affinity and/or the pharmacological properties of
the compound. Compounds 3, 6, 7, 8, 10, and 17 had Kd
values that are similar to compound 1 (Table 1). However,
even though the biding affinity of the compound analogues
might not have improved significantly compared to com-
pound 1, most of the compounds exerted dramatically
improved inhibitory activities in ex vivo assays. For all the
compounds that demonstrated inhibitory activities (com-
pounds 6, 7, 8, 10, 13, 14, 15, 16, and 17), the IC50 val-
ues were roughly ten-fold better compared to IC50 of
549 lM of compound 1 (Table 1). For example, compound
8 had IC50 value average at 44.18 lM and had an
improved affinity with a Kd = 44.35 lM (Figure S3). More-
over, when using the IC50/CC50 ratio to evaluate the
The need for new anti-influenza therapy is pressing as
drug-resistant strains of the virus emerge (15). We have
previously reported that the highly conserved RNA pro-
moter sequence on the 30 and 50 ends of each viral geno-
mic segment is a novel druggable candidate (7,9). Here,
we aimed first to identify the amino acid motif binding
directly to the RNA promoter employing the HTS by NMR
technique (16). Influenza RNA promoter is bound by a het-
ero-trimeric RNA-dependent RNA polymerase (RdRp),
where PB1 subunit makes direct contact with the RNA
promoter (17). Nevertheless, it was only vaguely reported
that both the C- and N-termini of PB1 are required for
RNA binding with very little information on where the inter-
action occurs or any sequence or structural requirements
for the interaction (18). We screened a combinatorial pep-
tide library via 1D proton NMR using our recently devel-
oped HTS by NMR method (16). A tetra-peptide library
was assembled in positional scanning mixtures, where one
position was systematically fixed as one natural amino acid
(except for cysteine), while the other three positions carry
all the possible combinations of natural amino acid (except
for cysteine). The arrangement of combinatorial library
would allow the identification of peptide binding sequence
and the interaction location of a specific target. We
Chem Biol Drug Des 2015
9

Bottini et al.
potency of this compound series, compounds 7, 8, and
10 were identified to be the inhibitors with the largest cel-
lular therapeutic window (IC50/CC50 ratio) in this series.
Even though compounds 3, 4, 5, 9, 11, and 12 did not
inhibit viral replication in cellular assay, they all bound to
the influenza RNA promoter (Table 1). Similar to com-
pound 1, these molecules might not exhibit cellular anti-
influenza activity, perhaps due to premature degradation,
limited cell permeability, binding to other targets, etc. In
this regard, recent work clearly suggests that direct inhibi-
tion of RdRp targeting PB1–PA interactions with small
molecules can be a viable target for inhibition of viral repli-
cation in both influenza A and B viruses (21–23). While we
cannot rule out that our compounds may also directly
affect RdRp in a similar fashion, our molecules do not
share any structural features that resemble the reported
chemical inhibitors of PB1–PA interactions (21–23). None-
theless, this point needs to be experimentally verified in
follow-up studies.
4. Boivin G. (2013) Detection and management of antiviral
resistance for influenza viruses. Influenza Other Respir
Viruses;7(Suppl 3):18–23.
5. Boltz D.A., Aldridge J.R. Jr, Webster R.G., Govorkova
E.A. (2010) Drugs in development for influenza.
Drugs;70:1349–1362.
6. Shi F., Xie Y., Shi L., Xu W. (2013) Viral RNA polymer-
ase: a promising antiviral target for influenza A virus.
Curr Med Chem;20:3923–3934.
7. Bae S.H., Cheong H.K., Lee J.H., Cheong C., Kaino-
sho M., Choi B.S. (2001) Structural features of an influ-
enza virus promoter and their implications for viral RNA
synthesis. Proc Natl Acad Sci USA;98:10602–10607.
8. Fodor E. (2013) The RNA polymerase of influenza a
virus: mechanisms of viral transcription and replication.
Acta Virol;57:113–122.
9. Park C.J., Bae S.H., Lee M.K., Varani G., Choi B.S.
(2003) Solution structure of the influenza A virus cRNA
promoter: implications for differential recognition of viral
promoter structures by RNA-dependent RNA polymer-
ase. Nucleic Acids Res;31:2824–2832.
10. Lee M.K., Bottini A., Kim M., Bardaro M.F. Jr,
Zhang Z., Pellecchia M., Choi B.S., Varani G. (2014) A
novel small-molecule binds to the influenza A virus
RNA promoter and inhibits viral replication. Chem
Commun;50:368–370.
11. Houghten R.A., Pinilla C., Blondelle S.E., Appel J.R.,
Dooley C.T., Cuervo J.H. (1991) Generation and use of
synthetic peptide combinatorial libraries for basic
research and drug discovery. Nature;354:84–86.
12. Dooley C.T., Houghten R.A. (1993) The use of posi-
tional scanning synthetic peptide combinatorial libraries
for the rapid determination of opioid receptor ligands.
Life Sci;52:1509–1517.
13. Bottini A., De S.K., Baaten B.J., Wu B., Barile E.,
Soonthornvacharin S., Stebbins J.L., Bradley L.M.,
Chanda S.K., Pellecchia M. (2012) Identification of
small molecules that interfere with H1N1 influenza A
viral replication. ChemMedChem;7:2227–2235.
14. Konig R., Stertz S., Zhou Y., Inoue A., Hoffmann H.H.,
Bhattacharyya S., Alamares J.G. et al. (2010) Human host
factors required for influenza virus replication.
Nature;463:813–817.
In conclusion, our preliminary attempts to identify novel
pharmacological tools binding to the RNA promoter of
influenza A virus culminated in the identification of small
molecules that possess inhibitory activity against influenza
viral replication in both luciferase-based cellular assay and
RT-PCR, with compounds 7, 8, and 10 in particular dis-
playing IC50/CC50 ratios <0.18 and activity in the tens of
lM in both binding and cell-based assays. These studies
further validated the influenza RNA promoter as possible
novel druggable target against influenza A viral infections.
Acknowledgments
We thank Mr. Stephen Soonthornvacharin for helping with
the viral replication assay. Financial support is from grants
NIH grant AI098091 (MP) and NIH 9RO1 GM 110569-06
(GV).
Conflict of Interest
The authors declare no financial/commercial conflict of
interests.
15. Hurt A.C. (2014) The epidemiology and spread of drug
resistant human influenza viruses. Curr Opin
Virol;8C:22–29.
References
16. Wu B., Zhang Z., Noberini R., Barile E., Giulianotti M.,
Pinilla C., Houghten R.A., Pasquale E.B., Pellecchia M.
(2013) HTS by NMR of combinatorial libraries: a frag-
ment-based approach to ligand discovery. Chem
Biol;20:19–33.
1. Sharma M., Li C., Busath D.D., Zhou H.X., Cross T.A.
(2011) Drug sensitivity, drug-resistant mutations, and
structures of three conductance domains of viral po-
rins. Biochim Biophys Acta;1808:538–546.
2. De Clercq E. (2006) Antiviral agents active against influ-
enza A viruses. Nat Rev Drug Discovery;5:1015–1025.
3. Yoneda M., Okayama A., Kitahori Y. (2014) Oseltamivir-
resistant seasonal A(H1N1) and A(H1N1)pdm09 influ-
enza viruses from the 2007/2008 to 2012/2013 season
in Nara Prefecture, Japan. Jpn J Infect Dis;67:385–388.
17. Biswas S.K., Nayak D.P. (1994) Mutational analysis of
the conserved motifs of influenza A virus polymerase
basic protein 1. J Virol;68:1819–1826.
18. Gonzalez S., Ortin J. (1999) Distinct regions of influ-
enza virus PB1 polymerase subunit recognize vRNA
and cRNA templates. EMBO J;18:3767–3775.
10
Chem Biol Drug Des 2015

Influenza RNA Antagonists
19. Chen Y., Varani G. (2005) Protein families and RNA
recognition. FEBS J;272:2088–2097.
molecular modeling, and biological evaluation of ben-
zofurazan derivatives as viral RNA polymerase inhibi-
tors. ChemMedChem;9:129–150.
20. Parkesh R., Childs-Disney J.L., Nakamori M., Kumar
A., Wang E., Wang T., Tran T., Housman D., Thornton
C.A., Disney M.D. (2012) Design of a bioactive small
molecule that targets the myotonic dystrophy type 1
RNA via an RNA motif-ligand database and chemical
similarity searching. J Am Chem Soc;134:4731–4742.
21. Muratore G., Goracci L., Mercorelli B., Foeglein A., Di-
gard P., Cruciani G., Palu` G., Loregian A. (2012) Small
molecule inhibitors of influenza A and B viruses that
act by disrupting subunit interactions of the viral poly-
merase. Proc Natl Acad Sci USA;109:6247–6252.
22. Lepri S., Nannetti G., Muratore G., Cruciani G., Ruzzi-
coni R., Mercorelli B., Palu` G., Loregian A., Goracci L.
(2014) Optimization of small-molecule inhibitors of influ-
enza virus polymerase: from thiophene-3-carboxamide
to polyamido scaffolds. J Med Chem;57:4337–4350.
23. Pagano M., Castagnolo D., Bernardini M., Fallacara
A.L., Laurenzana I., Deodato D., Kessler U., Pilger B.,
Stergiou L., Strunze S., Tintori C., Botta M. (2014) The
fight against the influenza A virus H1N1: synthesis,
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Figure S1 NMR spectra of influenza RNA promoter at
the imino region in presence of various test compounds.
Figure S2 Synthesis of compounds 3, 4 and 5.
Figure S3 WSN-Ren luciferase assay was used to
determine IC50 values.
Table S1 Chemical structure and binding affinities for
compounds 18–24 to the influenza A virus RNA promoter.
Chem Biol Drug Des 2015
11