Synthesis and anti-inflammatory effects of novel emodin derivatives bearing azole moieties

Article abstract of DOI:10.1002/ardp.201900264

Twelve azole derivatives of emodin were designed to possess anti-inflammatory activity and synthesized via a two-step sequence composed of the Williamson ether reaction and N-alkylation. The anti-inflammatory properties of these compounds were evaluated in RAW264.7 cells by measuring lipopolysaccharide (LPS)-induced nitric oxide (NO) production. The introduction of imidazole and four carbons into the scaffold of emodin led to the discovery of the potent compound 7e, which showed the best inhibition of NO production among twelve analogs. In our experiential setting, the IC₅₀ of compound 7e in NO production is 1.35 μM, which is lower than that of indomethacin. Mechanically, compound 7e effectively inhibited the protein and messenger RNA expressions of cyclooxygenase-2 and inducible NO synthase, as well as that of the proinflammatory cytokine interleukin-6, and the cytokines interleukin-1β and tumor necrosis factor-α in the LPS-stimulated RAW 264.7 macrophages. Compound 7e exerted inhibitory effects on the nuclear factor κB pathway by reducing the LPS-induced phosphorylation of the inhibitor of NF-κB and the nuclear translation of p-p65. These results suggest the potential of compound 7e in improving inflammatory conditions and diseases.

Full text of DOI:10.1002/ardp.201900264

Received: 9 September 2019
Revised: 18 November 2019
Accepted: 8 December 2019
|
|
DOI: 10.1002/ardp.201900264
F U L L P A P E R
Synthesis and anti‐inflammatory effects of novel emodin
derivatives bearing azole moieties
Xiaokang Zhu1
|
Qifang Chen1
|
Yujin Yang2
|
Xixi Ai1
|
Si Chen1
|
Yang Song1
1Key Laboratory of Luminescence and
Real‐Time Analytical Chemistry (Southwest
University), Ministry of Education, College
of Pharmaceutical Sciences, Southwest
University, Chongqing, China
Abstract
Twelve azole derivatives of emodin were designed to possess anti‐inflammatory activity
and synthesized via a two‐step sequence composed of the Williamson ether reaction and
N‐alkylation. The anti‐inflammatory properties of these compounds were evaluated in
RAW264.7 cells by measuring lipopolysaccharide (LPS)‐induced nitric oxide (NO)
production. The introduction of imidazole and four carbons into the scaffold of emodin
led to the discovery of the potent compound 7e, which showed the best inhibition of NO
production among twelve analogs. In our experiential setting, the IC50 of compound 7e in
NO production is 1.35 µM, which is lower than that of indomethacin. Mechanically,
compound 7e effectively inhibited the protein and messenger RNA expressions of
cyclooxygenase‐2 and inducible NO synthase, as well as that of the proinflammatory
cytokine interleukin‐6, and the cytokines interleukin‐1β and tumor necrosis factor‐α in the
LPS‐stimulated RAW 264.7 macrophages. Compound 7e exerted inhibitory effects on the
nuclear factor κB pathway by reducing the LPS‐induced phosphorylation of the inhibitor of
NF‐κB and the nuclear translation of p‐p65. These results suggest the potential of
compound 7e in improving inflammatory conditions and diseases.
2Research and Development Center,
Chongqing Huapont Pharmaceutical Co. Ltd.,
Chongqing, China
Correspondence
Xiaokang Zhu and Yang Song, Key Laboratory
of Luminescence and Real‐Time Analytical
Chemistry (Southwest University), Ministry
of Education, College of Pharmaceutical
Sciences, Southwest University, 400716
Chongqing, China.
Email: zxk@swu.edu.cn (X. Z.) and
songyangwenrong@hotmail.com (Y. S.)
Funding information
National Natural Science Foundation of China,
Grant/Award Number: 21602180; National
Experimental Teaching Demonstration Center
of Pharmaceutical Sciences,
Grant/Award Number: YX2017‐CXZD‐05
K E Y W O R D S
anti‐inflammatory activity, emodin derivatives, lipopolysaccharide, NF‐κB pathway
|
1
INTRODUCTION
There is continued interest in the synthesis of new emodin
derivatives with improved biological activity and reduced toxicity. Wang
Emodin is an anthraquinone derivative that was originally
isolated from the traditional Chinese herbs Polygonum cuspidatum
and Rheum rhaponticum, which have been used in China as a
purging drug for thousands of years. Previous studies have shown
et al. synthesized a series of novel quaternary ammonium salts of emodin
(compound 1) with better in vitro anticancer activities than emodin.[5,6]
Koerner et al.[7] designed a series of emodin derivatives (compound 2)
which may act as ATP‐citrate lyase inhibitors. A structure–activity
relationship (SAR) study indicated that the two OH groups adjacent to
the 9‐carbonyl group may be critical for on‐target activity. For instance,
Wu et al.[8] developed a series of novel 1,4‐pentadien‐3‐one derivatives
(compounds 3 and 4) bearing an emodin moiety with protective activity
against the tobacco mosaic virus. Another group showed a series of
emodin derivatives bearing polyamine side chains (compound 2) as
effective inhibitors of potent p‐glycoprotein.[9] We previously reported
that the introduction of an alkyl substituent on the anthraquinone ring of
emodin could improve the lipophilicity and enhance the antibacterial and
hypoglycemic activities of these compounds.[10,11] Figure 1 shows some
structures of emodin derivatives which have been investigated.
that emodin possesses
a wide spectrum of pharmacological
properties, such as antimicrobial, anti‐inflammatory, antioxidant,
and anticancer activities.[1] The majority of existing studies have
focused on the anti‐inflammatory properties of this com-
pound.[2–4] For instance, Li et al.[3] demonstrated that emodin
attenuated titanium particle‐induced osteolysis and osteoclasto-
genesis through the suppression of the nuclear factor‐κB (NF‐κB)
signal pathway. In addition, Liang et al.[4] showed that emodin
attenuated lipopolysaccharide (LPS)‐induced apoptosis and in-
flammation through the inhibition of the Notch and NF‐κB
pathway.
|
Arch Pharm Chem Life Sci. 2019;e1900264.
wileyonlinelibrary.com/journal/ardp © 2019 Deutsche Pharmazeutische Gesellschaft
1 of 12
https://doi.org/10.1002/ardp.201900264

2 of 12
ZHU ET AL.
|
FIGURE 1 Emodin derivatives with improved biocompatibility and activities
NF‐κB signal plays a crucial role in inflammation and immune
responses.[12] The NF‐κB dimers are sequestered in the cytoplasm by a
family of inhibitors, IκB, which mask the nuclear localization signals of
NF‐κB proteins and keep them sequestered in an inactive state in the
cytoplasm.[13] Activation of NF‐κB by nuclear translocation plays a role in
inflammation through the induction of transcription of several proin-
flammatory genes.[14] Thus, dysregulated NF‐κB/IκB signaling contributes
to the pathogenic processes of various inflammatory diseases, such as
rheumatoid arthritis, inflammatory bowel disease, multiple sclerosis,
atherosclerosis, systemic lupus erythematosus, type I diabetes, chronic
obstructive, pulmonary disease, and asthma.[15] Therefore, it is of great
value to design and synthesize novel chemical entities, which are able to
block the NF‐κB signaling pathway.[16–19]
with emodin nucleus using the hybrid approach and expected to gain
improved bioavailability, and additive or synergistic actions in anti‐
inflammatory activity.[22] The synthesized compounds were in vitro
assayed for anti‐inflammatory activity by measuring LPS‐induced NO
production. Meanwhile, the selected compound was assayed for the
inhibition of the inflammatory cytokines and the detailed molecular
mechanism was discussed.
|
2
RESULTS AND DISCUSSION
Chemistry
|
2.1
Azole‐based compounds possess good anti‐inflammatory activity
with improved safety profiles.[20,21] We designed a series of novel
emodin azole derivatives by merging the triazole/imidazole scaffold
The synthesis of compounds 6a–f and 7a–f is described in Scheme 1.
Emodin was treated with dibromoalkanes that possessed two to six
carbons, tetrabutylammonium bromide (TBAB), and K2CO3 in
SCHEME 1 Synthetic route of emodin azole derivatives. Reagents and conditions: (i) TBAB, K2CO3, DMF, 6 hr, 75°C, 48–65%;
(ii) DMSO, K2CO3, 8 hr, r.t. 16–45%; (iii) NaH, THF, 3 hr, 75°C, 20–50%. DMF, dimethylformamide; DMSO, dimethyl sulfoxide;
TBAB, tetra‐n‐butylammonium bromide; THF, tetrahydrofuran

ZHU ET AL.
3 of 12
|
FIGURE 2 The tautomer and resonance
2
structures of triazole
H
1
N
N
R
N
N
N
N
N
Base
3
N
NH
N
N
N
N
N
N
4
5
R
R
R
R
A
B
C
dimethylformamide (DMF). The corresponding bromo‐substituted com-
pounds 5a–d were afforded in the 48–68% yield. In the preparation of
5a–d, both the reaction temperature and the ratio of emodin to
dibromoalkane are critical parameters. When the ratio of emodin to
dibromoalkane was more than 1:1.2, the desired monobromoalkane‐
substituted emodin was obtained, due to the different activities of the
three hydroxyl groups within emodin. The other two hydroxyl groups are
inert due to the conformation of the intramolecular hydrogen bond.
TBAB was required to transfer K2CO3 from the aqueous phase to the
organic phase in the ether solution.
target compounds (6a–f and 7a–f), together with emodin and
indomethacin as controls, were evaluated for their inhibition
efficiency of NO production in LPS‐stimulated RAW 264.7
macrophages (Table 1). A cell‐counting kit‐8 assay was performed
to rule out the possibility that the inhibition of inflammatory
response was caused by their cytotoxicity. RAW 264.7 macro-
phages were treated with individual compounds at 20 µM, with or
without LPS, for 24 hr, and the results indicated imperceptible
cytotoxicity. Preliminary screening showed that the majority of
emodin derivatives exhibited stronger inhibitory activities
against LPS‐induced NO production in RAW 264.7 macrophages
as well as emodin. Among them, compound 7e (IC50 = 1.35 µM)
showed better activity than both emodin (IC50 = 4.80 µM) and the
positive control indomethacin (IC50 = 12.6 µM).
Compounds 5a–d were then treated with a variety of substituent
triazoles, in the presence of K2CO3 and (dimethyl sulfoxide) DMSO, to
afford compounds 6a–f (16–50% yield). Alternatively, the treatment of
5a–d with a variety of imidazoles and benzimidazoles, in the presence of
NaH in tetrahydrofuran (THF), provided the target compounds 7a–f
(20–50% yield). In the preparation of the 6a–f, emodin in DMSO was
dropped into the triazole derivatives with K2CO3 in DMSO at room
temperature. In the presence of the base, there are two tautomer and
three resonance structures of triazole (Figure 2).[23,24] The resonance
structures A and C are dynamically stable, existing at low temperature in
weak alkali conditions. As imidazole has a lower acidity than triazole, the
strong base NaH was needed in the preparation of the 7a–f.
SAR analysis revealed that the emodin ring plays an important role in
the inhibition of NO production because IC50 values of 9a (>20 µM) for
NO inhibition was bigger than that of other emodin azole derivatives. The
NO inhibition increased in the compounds with imidazole substitute
(7d–f) compared with a triazole, indicating that the imidazole moiety is
crucial. Surprisingly, compound 7a–c with a benzene ring on the azole as
a substitution group showed no contribution to NO inhibition, compared
with compound 7d–f. The length of the alkyl chain between the two
heterocyclic moieties plays an important role in the inhibition of NO
production in vitro. The values of IC50 of NO inhibition of different
compounds are listed in Table 1. NO inhibition differs with different
carbon alkyl chain linkers in the emodin azole derivatives. In general, the
emodin azole derivatives with four‐carbon alkyl chain linkers, such as
compounds 6b, 7b, and 7e, showed the strongest inhibitory activities,
with compound 7e having the best potential. Almost all the emodin azole
derivatives have better NO inhibition than indomethacin. For this reason,
compound 7e was selected as a candidate for further studies on the
mechanism of anti‐inflammatory activity.
The synthesis of 1‐(4‐phenoxybutyl)‐1H‐imidazole 9a, which
could be compared to emodin imidazole was also accomplished, as
shown in Scheme 2. To the best of our knowledge, compounds 6a–f
and 7a–f have not been reported before. The molecular structures of
all new compounds were characterized by 1H NMR (nuclear magnetic
resonance), 13C NMR, and high‐resolution mass spectrometry.
|
2.2
Evaluation of anti‐inflammatory activity
|
2.2.1
Inhibition of NO production in
LPS‐stimulated macrophages
|
2.2.2
Compound 7e inhibits the induction of iNOS
LPS‐induced excessive NO generation occurs at different stages
of inflammatory conditions.[25] Therefore, pharmacological inter-
ference with NO production presents promising strategies for
therapeutic intervention in inflammatory disorders. Hence, 12
and COX‐2
Next, we explored the molecular mechanism of compound 7e in
NO inhibition and anti‐inflammatory activity. In the activated
SCHEME 2 Synthetic route of 1‐(4‐phenoxybutyl)‐1H‐imidazole. Reagents and conditions: (i) TBAB, K2CO3, DMF, 24 hr, 75°C, 47%; (ii) NaH,
THF, 1H‐imidazole, 3 hr, 60°C, 74%. DMF, dimethylformamide; TBAB, tetra‐n‐butylammonium bromide; THF, tetrahydrofuran

4 of 12
ZHU ET AL.
|
TABLE 1 Chemical structures of the target compounds and their
inhibition of NO production in lipopolysaccharide‐stimulated RAW
264.7 cells
TABLE 1 (Continued)
OH
O
OH
OH
O
OH
O
R
n
O
O
R
ClgPa Inhibition of NO (IC50 [µM])
n
Compound
7d
n
R
O
2
3.88
4.54
5.60
9.83
1.35
3.32
Compound
6a
n
R
ClgPa Inhibition of NO (IC50 [µM])
N
N
N
N
2
3.28
3.81
4.87
5.76
4.24
N
N
N
7e
7f
4
6
N
N
N
N
N
N
N
6b
6c
6d
4
6
4
2.24
9a
2.41
–
>20
5.58
Emodin
Indomethacin
4.80
–
12.61
aCalculated using ChemDraw ultra 8.0.
N
O
15.83
N
N
N
N
macrophages, the transcriptionally expressed inducible NO
synthase (iNOS) is responsible for the prolonged and profound
production of NO.[26] As the overproduction of NO is the result of
high levels of iNOS expression, we studied the ability of 7e and
indomethacin to modulate LPS‐induced iNOS expression.
Cyclooxygenase‐2 (COX‐2) is the predominant COX isoform
present at sites of inflammation and produces prostaglandins
that cause swelling and pain.[27] Both COX‐1 and COX‐2 are the
targets of nonsteroidal anti‐inflammatory drugs (NSAIDs),[28]
however, COX‐2 is readily inducible and seems to be more
important than COX‐1 in various pathological functions. Thus, we
examined the effect of 7e on iNOS and COX‐2 expression. After
plating and 24 hr of growth, RAW 264.7 macrophages were
treated with 7e or indomethacin, in the presence or absence of
1 µg/ml LPS, for 6 hr. The cell lysates were electrophoresed, and
the expression levels of iNOS and COX‐2 were detected with
specific antibodies. As shown in Figure 3, LPS increased the
expression of iNOS and COX‐2 compared with the control group
significantly (p < 0.001). However, this expression was markedly
attenuated in RAW 264.7 macrophages that were pretreated
with 7e. Correlating with NO measurement, indomethacin also
exhibited significant inhibition of iNOS expression.
6e
5
6
6.29
6.82
6.11
O
O
N
N
6f
11.08
N
N
N
N
7a
7b
7c
2
4
6
5.48
6.13
7.19
3.31
2.44
7.23
N
N
N
N
N
Similar patterns were observed for the effect of 7e on
LPS‐induced iNOS and COX‐2 mRNA (messenger RNA) expression.
After treatment with 7e or indomethacin at 2.5 μM for 1 hr and then
treatment with LPS for 6 hr, total RNA was prepared from RAW
264.7 cells and qPCR was performed for the iNOS and COX‐2 genes.
These findings indicate that treatment with 7e significantly attenu-
ated the LPS‐stimulated induction of iNOS and COX‐2 expression
through transcriptional inhibition.
(Continues)

ZHU ET AL.
5 of 12
|
FIGURE 3 Effects of 7e and indomethacin on LPS‐induced iNOS and COX‐2 protein (a) and mRNA (b) expression in RAW 264.7
macrophages. β‐Actin was used as an internal control for Western blot analysis and reverse‐transcription polymerase chain reaction assay.
(a) Western blot analysis for the COX‐2 and iNOS protein levels in LPS‐induced RAW 264.7 macrophages; densitometry analyses are presented
as the relative ratios of iNOS/control and COX‐2/control. (b) Effects of 7e and indomethacin on LPS‐induced iNOS and COX‐2 mRNA
expression. The mRNA levels (2−ΔCt) of each gene were determined by quantitative real‐time PCR. The bar graphs show the mean SEM of
three independent experiments. The bar graphs show the mean SEM of three independent experiments: ###p < 0.001 for the LPS group
compared with the control group; ***p < 0.001 compared with the LPS group. COX‐2, cyclooxygenase‐2; iNOS, inducible NO synthase; LPS,
lipopolysaccharide; mRNA, messenger RNA; SEM, standard error of the means
|
|
2.2.3
Compound 7e inhibits the release
2.2.4
Compound 7e inhibits NF‐κB activity
of inflammatory cytokines
The activation of the NF‐κB signaling pathway will release the
cytokine and lead to the overproduction of NO and iNOS, hence, the
inhibition of NF‐κB in RAW 264.7 cells stimulated by LPS was
examined. IκB plays a crucial role in the regulation of NF‐κB
activation, as the release of activated NF‐κB is mediated by the
phosphorylation and degradation of IκB. As shown in Figure 5a, LPS
stimulation caused an increase in the inhibitor of NF‐κB (IκBα)
phosphorylation. Compound 7e and indomethacin significantly
decrease the IκBα phosphorylation. Activated NF‐κB can enter the
nucleus and initiate transcription, and the cytokine will be released.
To prove whether the anti‐inflammatory activity of compound 7e is
through inhibition of the NF‐κB signaling pathway, we examined the
effect of 7e and indomethacin on the nuclear translocation of NF‐κB
induced by LPS. In Figure 5b, nuclear NF‐κB increased obviously in
RAW 264.7 cells after LPS stimulation for 6 hr, whereas pretreat-
ment with 7e blocked the LPS‐induced nuclear translocation of NF‐
κB. Moreover, immunostaining was performed to confirm the effect
of compound 7e on NF‐κB cellular distribution in RAW264.7
macrophages. We found that 7e and indomethacin inhibited the
Interleukin‐6 (IL‐6), IL‐1β, and tumor necrosis factor‐α (TNF‐α)
are early‐secreted proinflammatory cytokines. Elevated levels in
the expression of these cytokines are observed in a variety of
acute and chronic inflammatory diseases. We determined the
effects of 7e and indomethacin IL‐6, IL‐1β, and TNF‐α in LPS‐
stimulated cells. RAW 264.7 cells were incubated with 7e or
indomethacin for 1 hr and then treated with LPS (1 µg/ml) for
6 hr. The cell lysates were electrophoresed, and the expression
levels of IL‐6, IL‐1β, and TNF‐α were detected with specific
antibodies. As shown in Figure 4, the protein levels of IL‐6, IL‐1β,
and TNF‐α were significantly downregulated in the presence of
7e after stimulation with LPS (1 µg/ml) with a concentration of
2.5 mM. The protein levels and mRNA level of TNF‐α, IL‐1β, and
IL‐6 were increased after being incubated with LPS compared
with the vehicle group, whereas the increase of IL‐1β and TNF‐α,
IL‐6 level was inhibited by 7e and indomethacin pretreatment.
Similar results were obtained using the enzyme‐linked immuno-
sorbent assay (ELISA) kit of the proinflammatory cytokines.

6 of 12
ZHU ET AL.
|
FIGURE 4 Effects of 7e and indomethacin on LPS‐induced IL‐6, IL‐1β, and TNF‐α protein expression in RAW 264.7 macrophages.
(a) Western blot analysis for the IL‐6, IL‐1β, and TNF‐α in LPS‐induced RAW 264.7 macrophages. Densitometry analyses are presented as the
relative ratios of IL‐6, IL‐1β, and TNF‐α to control. (b) Effects of 7e and indomethacin on LPS‐induced IL‐6, IL‐1β, and TNF‐α mRNA expression.
The mRNA levels (2−ΔCt) of each gene were determined by quantitative real‐time polymerase chain reaction. The bar graphs show the
mean SEM of three independent experiments. C, Effects of 7e and indomethacin on LPS‐induced IL‐6, IL‐1β, and TNF‐α expression for
enzyme‐linked immunosorbent assay. The bar graphs show the mean SEM of three independent experiments: ###p < 0.001 for the LPS group
compared with the control group; ***p < 0.001 compared with the LPS group. IL, interleukin; LPS, lipopolysaccharide; mRNA, messenger RNA;
SEM, standard error of the means, TNF‐α, tumor necrosis factor‐α
LPS‐induced nuclear distribution of p‐p65 in RAW 264.7 cells in
Figure 5c, which indicates that the compound 7e can suppress the
inflammatory activity by inhibiting the NF‐κB signaling pathway.
the LPS‐induced activation of NF‐κB. It can be deduced that 7e inhibited
LPS‐induced expression of inflammatory mediators in RAW 264.7 cells
through the blockage of NF‐κB pathways. The results obtained in this
study may lead to a better understanding of SARs and chemical
modifications that enhance the bioactivity of emodin, with the aim of
improving its anti‐inflammatory activity.
|
3
CONCLUSION
In conclusion, 12 emodin derivatives were designed, synthesized and
evaluated for anti‐inflammatory activity. Biological studies showed that
these derivatives detected anti‐inflammatory activity by the inhibition
of the production of NO stimulated by LPS in RAW 264.7 cells. SAR
studies indicated that the anthraquinone ring is essential to the anti‐
inflammatory activity. Imidazole is a better substitute group than
triazole with regard to the inhibition of NO release. Furthermore, the
length of the carbon chain influenced the inhibition of NO release. For
instance, compound 6b with four‐carbon alkyl chain linkers showed
stronger inhibitory activities than 6a and 6c. Compound 7e exhibited
the greatest inhibition of NO release. Mechanically, compound 7e
inhibits iNOS and COX‐2 expression at the protein level and mRNA
level. In the study, we also demonstrated that 7e decreases the
expression of inflammatory cytokines IL‐6, IL‐1β, and TNF‐α and inhibits
|
4
EXPERIMENTAL
Chemistry
|
4.1
|
4.1.1
General
Melting points were recorded using a digital melting point meter (Tianjin,
China) and are uncorrected. 1H NMR spectra were determined at 400/
600 MHz using a Bruker AM‐400/600 spectrophotometer using tetra-
methylsilane as an internal reference and 13C NMR spectra were
determined at 100/125 MHz using
a Bruker 100/125 MHz NMR
spectrometer. Mass spectra were measured by the electrospray
ionization (ESI) method on an Agilent 6510 Q‐TOF mass spectrometer.

ZHU ET AL.
7 of 12
|
FIGURE 5 Effects of 7e and indomethacin on LPS‐induced NF‐κB signaling pathway. (a) The protein level of NF‐κB and phospho‐IκBα were analyzed
by Western blot analysis, Densitometry analyses are presented as the relative ratios of NF‐κB/control and p‐IκBα/control. (b) The nuclear part and the
cytoplasm part of NF‐κB were detected by Western blot analysis. Lamin B was used as a loading control in the nuclear part. However, β‐actin was used
as a loading control in the cytoplasm. (c) Nuclear localization of NF‐κB of RAW264.7 cells was assayed by immunostaining with p‐p65 (Green), and
counterstained with DAPI (blue), the images were obtained by confocal microscopy. The bar graphs show the mean SEM of three independent
experiments: ###p < 0.001 for the LPS group compared with the control group; ***p < 0.001 compared with the LPS group. DAPI, 4′,6‐diamidino‐2‐
phenylindole; IκBα, inhibitor of NF‐κB; LPS, lipopolysaccharide; NF‐κB, nuclear factor‐κB; SEM, standard error of the means
The InChI codes of the investigated compounds together with
some biological activity data are provided as Supporting Information.
6 hr. Distilled water was added to the mixture and it was put in
a refrigerator overnight. The precipitate was filtered and washed
with 5% K2CO3 solution to give 5a–d as an orange solid. The crude
product was purified with silica gel column, eluted with petroleum
ether/CH2Cl2 (1:1 v/v) as eluent to afford the proposed compound.
|
4.1.2
General procedures for the
preparation of 5a–d
3‐(2‐Bromoethoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione (5a)
Orange solid, yield 50%; melting point (m.p.) 165.9–166.7°C; 1H NMR
(400 MHz, CDCl3): δ 12.30 (s, 1H), 12.08 (s, 1H), 7.64 (s, 1H), 7.38
(s, 1H), 7.09 (s, 1H), 6.70 (s, 1H), 4.45–4.41 (t, 2H), 3.71–3.67 (t, 2H),
To a solution of emodin (270 mg, 1 mmol), K2CO3 (166 mg, 1.2 mmol)
and TBAB (322 mg, 1 mmol) in DMF (22 ml) was added dropwise
dibromoalkane (1.2 mmol), and the mixture was heated to 75°C for

8 of 12
ZHU ET AL.
|
and 2.46 (s, 3H); 13C NMR (100 MHz, CDCl3) δ 190.8, 181.7, 166.0,
164.8, 162.6, 148.6, 135.4, 133.1, 124.6, 121.3, 113.6, 110.7, 108.0,
107.6, 70.1, 28.3, and 22.2; high‐resolution electrospray ionization
mass spectrometry (ESI‐HRMS) [M+H]+ m/z calculated for
C17H14BrO5 377.0019, found 377.0021.
and eluted with petroleum ether/dichloromethane (v/v) as eluent to
afford the proposed compound.
3‐(2‐(4H‐1,2,4‐Triazol‐4‐yl)ethoxy)‐1,8‐
dihydroxy‐6‐methylanthracene‐9,10‐dione (6a)
3‐(2‐Bromoethoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5a) was treated with 1,2,4‐trizole according to the general
procedure to give the desired product 6a as an orange solid, yield
16%; m.p. 145.9–146.7°C, 1H NMR (600 MHz, CDCl3): δ 12.26
(s, 1H), 12.24 (s, 1H), 8.24 (s, 1H), 7.99 (s, 1H), 7.62 (s, 1H), 7.32
(d, J = 12 Hz, 1H), 7.08 (s, 1H), 6.64 (d, J = 12 Hz, 1H), 4.64 (t, J = 6 Hz,
2H), 4.48 (t, J = 12 Hz, 2H), and 2.45 (s, 3H); 13C NMR (125 MHz,
CDCl3) δ 189.5, 178.1, 166.0, 165.0, 162.6, 159.8, 148.7, 140.5,
134.5, 127.1, 124.6, 121.4, 111.2, 110.9, 107.8, 107.5, 66.2, 48.9, and
22.1; ESI‐HRMS [M+H]+ m/z calculated for C19H16N3O5 366.1084,
found 366.1082.
3‐(4‐Bromobutoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐
dione (5b)
Orange solid, yield 65%; m.p. 136.6–137.2°C; 1H NMR (400 MHz,
CDCl3): δ 12.29 (s, 1H), 12.11 (s, 1H), 7.62 (s, 1H), 7.33 (s, 1H), 7.06
(s, 1H), 6.65 (s, 1H), 4.14–4.12 (t, 2H), 3.52–3.49 (t, 2H), 2.44 (s, 3H),
and 2.11–1.99 (m, 4H); 13C NMR (100 MHz, CDCl3): δ 190.7, 181.9,
166.6, 166.1, 162.6, 148.4, 135.2, 133.1, 124.5, 121.3, 113.6, 110.2,
108.4, 107.2, 67.8, 33.0, 29.7, 27.0, and 22.1; ESI‐HRMS [M+H]+ m/z
calculated for C19H18BrO5 405.0332, found 405.0333.
3‐(5‐Bromopentyloxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐
dione (5c)
3‐(4‐(4H‐1,2,4‐Triazol‐4‐yl)butoxy)‐1,8‐
Orange solid, yield 68%; m.p121.7–122.9°C; 1H NMR (400 MHz,
CDCl3): δ 12.30 (s, 1H), 12.10 (s, 1H), 7.64 (s, 1H), 7.38 (s, 1H), 7.11
(s, 1H), 6.70 (s, 1H), 4.15–4.12 (t, 2H), 3.68–3.60 (t, 2H), 2.46 (s, 3H),
2.12–1.99 (m, 4H), and 1.62–1.60 (m, 2H); 13C NMR (100 MHz,
CDCl3): δ 190.7, 181.9, 166.9, 166.1, 162.5, 148.4, 136.2, 133.2,
124.5, 121.2, 113.6, 110.2, 108.6, 107.1, 68.0, 33.3, 32.3, 29.1, 24.7,
and 22.1; ESI‐HRMS [M+H]+ m/z calculated for C20H20BrO5
419.0489, found 419.0491.
dihydroxy‐6‐methylanthracene‐9,10‐dione (6b)
3‐(4‐Bromo‐butoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5b) was treated with 1,2,4‐trizole according to the general
procedure to give the desired product 6b as an orange solid, yield
38%, m.p. 144.4–144.9°C; 1H NMR (400 MHz, CDCl3): δ 12.30
(s, 1H), 12.10 (s, 1H), 8.12 (s, 1H), 7.97 (s, 1H), 7.63 (s, 1H), 7.34
(d, J = 1.6 Hz, 1H), 7.08 (s, 1H), 6.66 (d, J = 2.8 Hz, 1H), 4.31–4.27
(t, J = 12 Hz, 2H), 4.14–4.11 (t, J = 10 Hz, 2H), 2.45 (s, 3H), 2.17–2.10
(m, 2 H), and 1.98–1.83 (m, 2H); 13C NMR (100 MHz, CDCl3): δ 190.5,
181.0, 166.0, 165.2, 162.5, 155.4, 148.4, 135.3, 130.2, 127.5, 121.2,
115.7, 110.5, 108.5, 107.5, 67.6, 49.7, 29.6, 25.4, and 22.1; ESI‐HRMS
[M+H]+ m/z calculated for C21H20N3O5 394.1397, found 394.1400.
3‐(6‐Bromohexyloxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐
dione (5d)
Orange solid, yield 48%; m.p. 111.5–112.4°C; 1H NMR (300 MHz,
CDCl3): δ 12.32 (s, 1H), 12.14 (s, 1H), 7.64 (s, 1H), 7.36 (s, 1H), 7.09
(s, 1H), 6.67 (s, 1H), 4.12–4.08 (t, 2H), 3.46–3.41 (t, 2H), 2.46 (s, 3H),
1.91–1.86 (t, 4H), and 1.58–1.56 (m, 4H); 13C NMR (100 MHz,
CDCl3): δ 190.7, 181.9, 166.7, 166.1, 162.4, 148.5, 136.2, 133.2,
124.4, 121.3, 113.6, 110.1, 108.6, 107.2, 68.1, 33.1, 32.3, 31.8, 29.5,
24.7, and 22.3; ESI‐HRMS [M+H]+ m/z calculated for C21H22BrO5
433.0645, found 433.0642.
3‐(6‐(4H‐1,2,4‐Triazol‐4‐yl)hexyloxy)‐1,8‐
dihydroxy‐6‐methylanthracene‐9,10‐dione (6c)
3‐(6‐Bromo‐hexyloxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5d) was treated with 1,2,4‐trizole according to the general
procedure to give the desired product 6c as an orange solid, yield
25%, m.p.136.2–137.1°C; 1H NMR (600 MHz, CDCl3): δ 12.31 (s, 1H),
12.13 (s, 1H), 8.09 (s, 1H), 7.96 (s, 1H), 7.63 (s, 1H), 7.35 (d, J = 6 Hz,
1H), 7.09 (s, 1H), 6.66 (d, J = 6 Hz, 1H), 4.22 (t, J = 18 Hz, 2H), 4.10
(t, J = 18 Hz, 2H), 2.45 (s, 3H), 1.93–1.97 (m, 2H), 1.80–1.85 (m, 2H),
1.50–1.58 (m, 2H), and 1.33–1.40 (m, 2H); 13C NMR (125 MHz,
CDCl3) δ 190.7, 182.0, 165.9, 165.2, 162.51, 151.4, 148.4, 135.3,
133.2, 124.5, 121.2, 113.7, 110.2, 108.5, 107.1, 68.6, 49.7, 29.6, 28.6,
26.2, 25.4, and 22.1; ESI‐HRMS [M+H]+ m/z calculated for
C23H24N3O5 422.1710, found 422.1715.
|
4.1.3
General procedures for the preparation
of 6a–f
A DMSO (35 ml) solution of 1,2,4‐triazole or benzotriazol‐1‐ol
(6 mmol) was slowly added to K2CO3 (1.1 g, 8 mmol) in DMSO
(35 ml) and stirred for 1 hr at 50°C. After it cooled to room
temperature, the solution of 5a–d (5 mmol) was added dropwise to
the above solution. The mixture was stirred for 8 hr at room
temperature, and a yellow solution was obtained. The solvent was
quenched with 20 ml water. Then, the solution was extracted with
CH2Cl2 (5 × 20 ml), and the combined extracting solution was
washed with water and then dried with anhydrous Na2SO4. After
evaporating CH2Cl2 under vacuum, an orange crude product was
obtained. Then, the product was purified with silica gel column
3‐(4‐(1H‐Benzo[d][1,2,3]triazol‐1‐yloxy)butoxy)‐1,8‐
dihydroxy‐6‐methylanthracene‐9,10‐dione (6d)
3‐(4‐Bromo‐butoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5b) was treated with 1H‐benzo[d][1,2,3]triazol‐1‐ol according to the
general procedure to give the desired product 6d as an orange solid,
yield 45%, m.p. 146.3–147.5°C; 1H NMR (400 MHz, CDCl3): δ 12.30
(s, 1H), 12.11 (s, 1H), 8.05–8.03 (d, J = 8.4 Hz, 1H), 7.63–7.61

ZHU ET AL.
9 of 12
|
(d, J = 9.6 Hz, 2H), 7.56–7.25 (t, J = 6.8 Hz, 1H), 7.43–7.39
(d, J = 8.4 Hz, 1H), 7.36–7.35 (d, J = 2.8 Hz, 1H), 7.08 (s, 1H), 6.68
(d, J = 2.8 Hz, 1H), 4.68–4.65 (t, J = 6 Hz, 2H), 4.23–4.21 (t, J = 6 Hz,
2H), 2.45 (s, 3H), 2.19–2.13 (m, 2H), and 2.13–2.09 (m, 2H); 13C NMR
(100 MHz, CDCl3): δ 190.7, 181.8, 166.7, 166.2, 162.6, 148.5, 143.6,
136.2, 130.2, 128.1, 125.4, 124.7, 124.6, 121.3, 120.4, 113.7, 110.3,
108.6, 108.4, 107.2, 80.2, 68.2, 25.4, 24.9, and 22.1; ESI‐HRMS
[M+H]+ m/z calculated for C25H22N3O6 460.1503, found 460.1440.
was extracted with CH2Cl2 (5 × 20 ml), and the combined extracting
solution was washed with water and then dried with anhydrous
Na2SO4. After evaporating CH2Cl2 under vacuum, an orange crude
product was obtained. The crude product was filtered and washed
with THF. Then, the product was purified with silica gel column,
eluted with CH2Cl2/MeOH (150:1 v/v) as eluent to afford the
proposed compound.
3‐(2‐(1H‐Benzo[d]imidazol‐1‐yl)ethoxy)‐1,8‐
3‐(5‐(1H‐Benzo[d][1,2,3]triazol‐1‐yloxy)pentalogy)‐1,8‐
dihydroxy‐6‐methylanthracene‐9,10‐dione (7a)
dihydroxy‐6‐methylanthracene‐9,10‐dione (6e)
3‐(2‐Bromoethoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5a) was treated with benzimidazole according to the general
procedure to give the desired product 7a as an orange solid, yield
48%, m.p. 219.1–220.0°C; 1H NMR (600 MHz, CDCl3): δ 12.27
(s, 1H), 12.05 (s, 1H), 8.05 (s, 1H), 7.85 (d, J = 6.0 Hz, 1H), 7.65 (s, 1H),
7.51 (d, J = 12.0 Hz, 1H), 7.39 (t, J = 12 Hz, 1H), 7.35 (s, 1H), 7.34
(s, 1H), 7.11 (s, 1H), 6.66 (s, 1H), 4.67 (t, J = 6 Hz, 2H), 4.46
(t, J = 12 Hz, 2H), and 2.47 (s, 3H); 13C NMR (125 MHz, CDCl3):
δ 200.8, 198.9, 181.1, 165.1, 164.7, 162.8, 148.7, 144.1, 143.2, 135.7,
133.8, 133.1, 124.9, 123.2, 122.5, 121.5, 120.8, 113.4, 110.9, 109.2,
107.7, 67.0, 43.7, and 22.4; ESI‐HRMS [M+H]+ m/z calculated for
C24H19N2O5 415.1288, found 415.1294.
3‐(5‐Bromopentyloxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5c) was treated with 1H‐benzo[d][1,2,3]triazol‐1‐ol according to the
general procedure to give the desired product 6e as an orange solid,
yield 40%, m.p. 130.1–131.8°C; 1H NMR (400 MHz, CDCl3): δ 12.28
(s, 1H), 12.10 (s, 1H), 8.03–8.01 (d, J = 8.4 Hz, 1H), 7.61–7.58
(d, J = 9.6 Hz, 2H), 7.55–7.51 (t, J = 8.4 Hz, 1H), 7.42–7.38 (t, J = 8 Hz,
1H), 7.34 (d, J = 2.4 Hz, 1H), 7.07 (s, 1H), 6.66 (d, J = 2.4 Hz, 1H),
4.62–4.59 (t, J = 6.4 Hz, 2H), 4.16–4.13 (t, J = 6 Hz, 2H), 2.44 (s, 3H),
2.01–1.92 (m, 4H), and 1.83–1.76 (m, 2H); 13C NMR (100 MHz,
CDCl3): δ 190.7, 181.9, 166.8, 166.2, 162.6, 148.4, 143.6, 136.2, 130.2,
128.0, 127.3, 124.6, 124.4, 121.3, 120.3, 113.7, 110.2, 108.7, 108.5,
107.2, 80.2, 68.2, 28.6, 27.8, 22.4, and 22.1; ESI‐HRMS [M+H]+ m/z
calculated for C26H24N3O6 474.1660, found 474.1652.
3‐(4‐(1H‐Benzo[d]imidazol‐1‐yl) butoxy)‐1,8‐
dihydroxy‐6‐methylanthracene‐9,10‐dione (7b)
3‐(6‐(1H‐Benzo[d][1,2,3]triazol‐1‐yloxy)hexyloxy)‐1,8‐
3‐(4‐Bromobutoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5b) was treated with benzimidazole according to the general
procedure to give the desired product 7b as an orange solid, yield
38%, m.p. 220.1–221.3°C; 1H NMR (600 MHz, CDCl3): δ 12.29
(s, 1H), 12.09 (s, 1H), 7.93 (s, 1H), 7.83 (d, J = 6 Hz, 1H), 7.63 (s, 1H),
7.43 (d, J = 6 Hz, 1H), 7.33–7.28 (m, 3H), 7.08 (s, 1H), 6.64 (d, J = 6 Hz,
1H), 4.32 (t, J = 6 Hz, 2H), 4.12 (t, J = 12 Hz, 2H), 2.45 (s, 3H), 2.12
(m, 2H), and 1.85 (m, 2H); 13C NMR (125 MHz, CDCl3): δ 190.9,
181.9, 165.5, 165.0, 162.7, 148.5, 144.1, 142.9, 135.3, 133.7, 133.2,
124.5, 123.0, 122.2, 121.4, 120.6, 113.8, 110.4, 109.5, 108.3, 107.2,
67.8, 44.7, 26.7, 26.3, and 22.1; ESI‐HRMS [M+H]+ m/z calculated for
dihydroxy‐6‐methylanthracene‐9,10‐dione (6f)
3‐(6‐Bromohexyloxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione (5d)
was treated with 1H‐benzo[d][1,2,3]triazol‐1‐ol according to the general
procedure to give the desired product 6f as an orange solid, yield 30%,
m.p. 141.7–142.4°C; 1H NMR (400 MHz, CDCl3): δ 12.30 (s, 1H), 12.13
(s, 1H), 8.04–8.02 (d, J = 8.4 Hz, 1H), 7.63–7.62 (d, J = 1.2 Hz, 1H),
7.60–7.57 (d, J = 8.4 Hz, 1H), 7.54–7.51 (t, J = 6.8 Hz, 1H), 7.42–7.38
(t, J = 8 Hz, 1H), 7.36–7.35 (d, J = 2.8 Hz, 1H), 7.08 (s, 1H), 6.67
(d, J = 2.8 Hz, 1H), 4.60–4.57 (t, J = 6.4 Hz, 2H), 4.14–4.11 (t, J = 6 Hz,
2H), 2.45 (s, 3H), 1.95–1.88 (m, 4H), and 1.67–1.59 (m, 4H). 13C NMR
(100 MHz, CDCl3): δ 190.7, 181.9, 166.7, 166.1, 162.5, 148.4, 143.7,
136.2, 130.2, 128.0, 127.4, 124.6, 124.5, 121.2, 120.3, 113.7, 110.2,
108.6, 108.4, 107.2, 80.7, 68.2, 28.7, 28.0, 26.7, 26.4, and 22.1; ESI‐HRMS
[M+H]+ m/z calculated for C27H26N3O6 488.1816, found 488.1812.
C26H23N2O5 443.1601, found 443.1604.
3‐(6‐(1H‐Benzo[d]imidazol‐1‐yl)hexyloxy)‐1,8‐
dihydroxy‐6‐methylanthracene‐9,10‐dione (7c)
3‐(6‐Bromohexyloxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5d) was treated with benzimidazole according to the general
procedure to give the desired product 7c as an orange solid, yield
35%, m.p. 223.4–224.5°C; 1H NMR (600 MHz, CDCl3): δ 12.30
(s, 1H), 12.12 (s, 1H), 7.91 (s, 1H), 7.82 (d, J = 6 Hz, 1H), 7.63 (s, 1H),
7.42 (d, J = 6 Hz, 1H), 7.34–7.28 (m, 3H), 7.09 (s, 1H), 6.64 (d, J = 6 Hz,
1H), 4.20 (t, J = 12 Hz, 2H), 4.08 (t, J = 12 Hz, 2H), 2.45 (s, 3H),
1.97–1.92 (m, 2H), 1.83–1.79 (m, 2H), 1.53–1.51 (m, 2H), and
1.45–1.40 (m, 2H); 13C NMR (125 MHz, CDCl3): δ 190.6, 181.9,
165.78, 165.0, 162.5, 148.4, 143.9, 143.0, 135.2, 133.8, 133.0, 124.2,
122.9, 122.2, 121.2, 120.6, 113.5, 110.0, 109.6, 108.5, 107.1, 68.8,
45.0, 29.8, 28.7, 26.5, 25.4, and 21.8; ESI‐HRMS [M+H]+ m/z
calculated for C28H27N2O5 471.1914, found 471.1910.
|
4.1.4
General procedures for the preparation
of 7a–f
An anhydrous THF (1 ml) solution of benzimidazole or imidazole
(1 mmol) was slowly added to a suspension of oil‐free sodium hydride
(120 mg, 5 mmol) in anhydrous THF (2–3 ml) under N2 at room
temperature. When there was no gas released, an anhydrous THF
(8–10 ml) solution of 5a–d (1.5 mmol) was added dropwise to the
above solution. The mixture was stirred for 3 hr at 75°C and a purple
solution was obtained. The solvent was quenched with 15 ml
saturated ammonium chloride aqueous solution. Then, the solution

10 of 12
ZHU ET AL.
|
3‐(2‐(1H‐Imidazol‐1‐yl)ethoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐
9,10‐dione (7d)
n‐hexane as eluent to obtain 8a as a yellow oil. Yield 47%, 1H NMR
(400 MHz, CDCl3): δ 7.30 (t, 2H), 6.95 (t, J = 7.3 Hz, 1H), 6.91 (t, 2H),
4.00 (t, J = 6.0 Hz, 2H), 3.50 (t, J = 6.6 Hz, 2H), 2.06 (m, 2H), and1.95
(m, 2H); ESI‐HRMS [M+H]+ m/z calculated for C10H13BrO 229.0228,
found 229.0233.
3‐(2‐Bromoethoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5a) was treated with imidazole according to the general procedure
to give the desired product 7d as an orange solid, yield 50%, m.p.
151.2–152.8°C; 1H NMR (600 MHz, CDCl3): δ 12.26 (s, 1H), 12.04 (s,
1H), 7.63 (s, 1H), 7.61 (s, 1H), 7.33 (d, J = 2.4 Hz, 1H), 7.10
(s, 1H), 7.08 (s, 1H), 7.06 (s, 1H), 6.65 (d, J = 1.8 Hz, 1H), 4.41–4.40
(t, J = 4.2 Hz, 2H), 4.36–4.34 (t, J = 4.2 Hz, 2H), and 2.45 (s, 3H); 13C
NMR (125 MHZ, CDCl3): δ 190.9, 181.7, 165.0, 164.6, 162.6, 148.7,
137.5, 135.5, 133.1, 130.0, 124.6, 121.4, 119.3, 113.6, 111.0, 107.8,
107.5, 67.9, 46.1, and 22.2; ESI‐HRMS [M+H]+ m/z calculated for
C20H17N2O5 365.1132, found 365.1124.
|
4.1.6
Procedures for the preparation of 9a
An anhydrous THF (2 ml) solution of imidazole (102 mg, 1.5 mmol)
was slowly added to a suspension of oil‐free sodium hydride (200 mg,
8.3 mmol) in anhydrous THF (2 ml) under N2 at room temperature for
30 min. When there was no gas released, an anhydrous THF (10 ml)
solution of 8a (229 mg, 1 mmol) was added dropwise to the above
solution. The mixture was stirred for 3 hr at 60°C. The solvent was
quenched with 15 ml saturated ammonium chloride aqueous solu-
tion. Then, the solution was extracted with CH2Cl2 (5 × 20 ml), and
the combined extracting solution was washed with water, and then
dried with anhydrous MgSO4. After evaporating CH2Cl2 under
vacuum, the crude product was obtained. Then, the crude product
was purified with a silica gel column, eluted with CH2Cl2/MeOH
(100:1 v/v) as eluent to afford the proposed compound 9a as a yellow
oil. Yield 74%, 1H NMR (600 MHz, CDCl3): δ 7.49 (s, 1H), 7.28
(t, J = 7.5 Hz, 2H), 7.06 (s, 1H), 6.95 (d, J = 7.3 Hz, 1H), 6.93
(d, J = 3.6 Hz, 1H), 6.88 (d, J = 8.0 Hz, 2H), 4.02 (t, J = 7.1 Hz, 2H),
3.97 (t, J = 6.0 Hz, 2H), 1.99 (m, 2H), and 1.78 (m, 2H). ESI‐HRMS
[M+H]+ m/z calculated for C13H17N2 217.1341, found 217.1343.
3‐(4‐(1H‐Imidazol‐1‐yl)butoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐
9,10‐dione (7e)
3‐(4‐Bromoethoxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione (5b)
was treated with imidazole according to the general procedure to give
the desired product 7e as an orange solid, yield 38%, m.p.
142.7–143.9°C; 1H NMR (600 MHz, CDCl3): δ 12.26 (s, 1H), 12.25
(s, 1H), 7.59 (s, 1H), 7.55 (s, 1H), 7.29 (d, J = 1.8 Hz, 1H), 7.10 (s, 1H),
7.06 (s, 1H), 6.96 (s, 1H), 6.62 (d, J = 2.4 Hz, 1H), 4.10–4.08 (t, J = 5.4 Hz,
2H), 4.07–4.05 (t, J = 7.2 Hz, 2H), 2.44 (s, 3H), 2.04–2.00 (m, 2 H), and
1.86–1.81 (m, 2H); 13C NMR (125 MHz, CDCl3) δ 190.7, 181.9, 165.6,
165.1, 162.5, 148.5, 137.1, 135.3, 133.2, 129.6, 124.5, 121.3, 118.7,
113.6, 110.4, 108.2, 107.2, 68.0, 46.7, 27.8, 26.0, and 22.1; ESI‐HRMS
[M+H]+ m/z calculated for C22H21N2O5 393.1450, found 393.1447.
3‐(6‐(1H‐Imidazol‐1‐yl)hexyloxy)‐1,8‐
|
dihydroxy‐6‐methylanthracene‐9,10‐dione (7f)
4.2
Biochemical assays
Cell culture
3‐(6‐Bromohexyloxy)‐1,8‐dihydroxy‐6‐methylanthracene‐9,10‐dione
(5d) was treated with imidazole according to the general procedure
to give the desired product 7f as an orange solid, yield 20%, m.p.
130.8–143.6°C; 1H NMR (600 MHz, CDCl3): δ 12.30 (s, 1H), 12.12
(s, 1H), 7.63 (s, 1H), 7.50 (s, 1H), 7.34 (s, 1H), 7.08 (s, 1H), 7.07 (s, 1H),
6.92 (s, 1H), 6.65 (s, 1H), 4.09–4.07 (t, J = 6.6 Hz, 2H), 3.97–3.95
(t, J = 7.2 Hz, 2H), 2.45 (s, 3H), 1.86–1.80 (m, 4H), 1.55–1.50 (m, 2H),
and 1.41–1.36 (m, 2H); 13C NMR (125 MHz, CDCl3): δ 190.8, 182.1,
166.0, 165.2, 162.5, 148.4, 137.1, 135.3, 133.3, 129.4, 124.5, 121.3,
118.8, 113.7, 110.2, 108.5, 107.2, 68.6, 47.0, 31.0, 28.7, 26.3, 25.5,
and 22.1; ESI‐HRMS [M+H]+ m/z calculated for C24H25N2O5
421.1758, found 421.1754.
|
4.2.1
RAW 264.7 (murine macrophage) cells were purchased from Nanjing
Keygen Biotech. Co., Ltd. (Nanjing, China). The cells were maintained
in a humidified atmosphere with 5% CO2 at 37°C. The medium for
cell lines was RPMI‐1640, supplemented with 10% fetal bovine
serum (Hangzhou Sijiqing Biological Engineering Materials Co. Ltd.),
100 IU/ml penicillin, and 100 μg/ml streptomycin (Amresco, Solon,
OH). Differentiation was carried out 24 hr after the cells were
seeded by adding 50 ng/ml nerve growth factor for 8 days.
|
4.2.2
Nitrite measurement
|
4.1.5
Procedures for the preparation of 8a
RAW 264.7 mouse macrophages were plated in 96‐well plates at
5 × 103/well in triplicate. On the next day, the cells were pretreated
with the vehicle, indomethacin or emodin derivatives (0–20 μM dose
range) for 1 hr. After a 1‐hr treatment, the cells were treated with
LPS (1 μg/ml) for 24 hr. NO concentration in the medium was
determined using a Griess reagent kit (Beyotime, China). Control
cells were cultured with equal amounts of DMSO (always <0.1% in
the culture). Indomethacin was the positive control.
To a solution of phenol (94 mg, 1 mmol), and K2CO3 (207 mg,
1.5 mmol) in DMF (2 ml) was added dropwise dibromoalkane
(215 mg, 1 mmol) in DMF (8 ml), and the mixture was heated to
75°C for 24 hr and quenched with water (20 ml). The mixture was
treated with water and extracted with diethyl ether (20 ml × 3). The
combined organic layers were dried over MgSO4 and concentrated.
The crude product was purified with a silica gel column, eluted with

ZHU ET AL.
11 of 12
|
|
4.2.3
Detection of cytokine levels in cultured
TABLE 2 Real‐time PCR primer pairs
supernatants
Gene
Description
Primer sequence
COX‐2
F
R
F
R
F
R
F
R
F
R
TGAGCAACTATTCCAAACCAGC
GCACGTAGTCTTCGATCACTATC
GTTCTCAGCCCAACAATACAAGA
GTGGACGGGTCGATGTCAC
Treated cells were seeded into six‐well plates. The expression levels
of inflammatory cytokines, IL‐1β, IL‐6, and TNF‐α, were measured in
the supernatant using ELISA kits according to the manufacturer’s
protocol. The standards and samples were added to the wells. And
then, a horseradish peroxidase‐labeled antibody was added for
60 min at 37°C. After washing five times, the substrate was added to
the wells at 37°C for 15 min and the samples were then washed
another five times. Finally, the wells were treated with a stop
solution. The optical density values were determined by 450 nm.
iNOS
IL‐6
TAGTCCTTCCTACCCCAATTTCC
TTGGTCCTTAGCCACTCCTTC
GAAATGCCACCTTTTGACATGG
TGGATGCTCTCATCAGGACAG
CAGGCGGTGCCTATGTCTC
IL‐1β
TNF‐α
CGATCACCCCGAAGTTCAGTAG
Abbreviations: COX‐2, cyclooxygenase‐2; IL‐6, interleukin‐6; IL‐1β,
interleukin‐1β; iNOS, inducible NO synthase; PCR, polymerase chain
reaction; TNF‐α, tumor necrosis factor‐α.
|
4.2.4
Protein extraction and Western blot analysis
Proteins were prepared with RIPA lysis buffer overnight at −20°C. A
bicinchoninic acid assay kit (Dingguo Biotechnology Co. Ltd., Beijing,
China) was used to determine the total protein concentration.
Proteins were separated by sodium dodecyl sulfate polyacrylamide
gel electrophoresis and transferred onto a nitrocellulose membrane.
The membranes were blocked by 5% nonfat dry milk for 2 hr and
then incubated with the appropriate primary antibodies at 4°C
overnight followed by incubation with the secondary antibody for an
additional 1 hr at room temperature. Immunoreactivity was detected
using BeyoECL Star (Beyotime Biotechnology, Shanghai, China). The
expression levels of proteins were quantified with the ImageJ soft-
ware (National Institutes of Health, MD).
and stored at −80°C. Nucleic proteins were fractioned using a
nucleoprotein extraction kit, according to the manufacturer’s
instructions. Pellets were resuspended in a nuclear extraction buffer
and incubated for 20 min on ice, after centrifugation at 12,000 rpm
for 10 min, and the supernatant was kept as the nuclear extract and
stored at −80°C until used.
|
4.2.7
Immunofluorescence staining
RAW 264.7 cells were seeded onto confocal plates and pretreated
with 7e and indomethacin for 1 hr, and then treated with LPS
(1 μg/ml) for 6 hr. After being washed three times with phosphate‐
buffered saline (PBS), the cells were fixed and ruptured with 4%
paraformaldehyde containing 3% sucrose for 20 min. Nonfat milk
(5%) in PBS was used to block cells, and primary antibodies were
added to these cells overnight at 4°C; then, the cells were
incubated with Alexa Fluor 488 (1:200 dilution) for 2 hr at room
temperature. Besides this, the nuclei were stained with DAPI
(4′,6‐diamidino‐2‐phenylindole; 5 μg/ml) for 5 min. After being
washed five times with PBS, the cells were analyzed using a
confocal microscope (N‐SIM E, Nikon).
|
4.2.5
Reverse‐transcription quantitative PCR
(RT‐qPCR) assay
High‐pure total RNA was extracted using an RNA Purification Kit
(BioTek, China) following the manufacturer’s protocol, and was then
reverse‐transcribed into complementary DNA (cDNA) with an All‐in‐
One cDNA Synthesis SuperMix (Bimake). Expression levels of COX‐2,
IL‐1β, TNF‐α, and iNOS mRNA were evaluated in triplicate by
RT‐qPCR using a 2× SYBR Green qPCR Master Mix (Bimake). Gene‐
specific primers were purchased from Sangon Biotech Co. Ltd.
(Shanghai, China) and are listed in Table 2. Data from three
independent experiments were analyzed, and the 2−ΔΔC method
t
was used for quantification of gene expression. β‐Actin was used as a
ACKNOWLEDGMENTS
house keeping gene.
This project was supported by the National Natural Science
Foundation of China (21602180) and the National Experimental
Teaching Demonstration Center of Pharmaceutical Sciences
(YX2017‐CXZD‐05).
|
4.2.6
Cytoplasm and nucleus protein extraction
Cell lysates were added to cytoplasm extraction buffer containing
phosphatase inhibitors, phenylmethylsulfonyl fluoride and dithio-
threitol, then vortexed vigorously for 15 s. After incubation for
10 min on ice, the cell lysates were centrifuged at 12,000 rpm for
10 min and the cytoplasmic fraction supernatants were transferred
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.

12 of 12
ZHU ET AL.
|
ORCID
Yang Song
[18] T. Morwick, A. Berry, J. Brickwood, M. Cardozo, K. Catron, M.
DeTuri, J. Emeigh, C. Homon, M. Hrapchak, S. Jacober, S. Jakes, P.
Kaplita, T. A. Kelly, J. Ksiazek, M. Liuzzi, R. Magolda, C. Mao, D.
Marshall, D. McNeil, A. Prokopowicz, C. Sarko, E. Scouten, C.
Sledziona, S. Sun, J. Watrous, J. P. Wu, C. L. Cywin, J. Med. Chem.
2006, 49, 2898.
http://orcid.org/0000-0001-7716-9216
[19] H. Takahashi, M. Shinoyama, T. Komine, M. Nagao, M. Suzuki, H.
Tsuchida, K. Katsuyama, Bioorg. Med. Chem. Lett. 2011, 21,
1758.
REFERENCES
[1] X. Dong, J. Fu, X. Yin, S. Cao, X. Li, L. Lin, J. Ni, J. Ni, Phytother. Res.
2016, 30, 1207.
[20] H. Karaca gençer, U. Acar Çevik, B. Kaya Çavuşoğlu, B. N. Sağlık, S.
Levent, Ö. Atlı, S. Ilgın, Y. Özkay, Z. A. Kaplancıklı, J. Enzyme Inhib.
Med. Chem. 2017, 32, 732.
[2] Q. H. Ding, C. Y. Ye, E. M. Chen, W. Zhang, X. H. Wang, Int.
Immunopharmacol. 2018, 61, 222.
[21] M. N. Kumbar, R. R. Kamble, J. P. Dasappa, P. K. Bayannavar, H. A.
Khamees, M. Mahendra, S. D. Joshi, S. Dodamani, V. P. Rasal, S.
Jalalpure, J. Mol. Struct. 2018, 1160, 63.
[3] J. Li, Y. Li, X. Peng, B. Li, X. Yuan, Y. Chen, Mol. Immunol. 2018, 96, 8.
[4] Z. Liang, C. Ren, Biomed. Pharmacother. 2018, 103, 897.
[5] Y. Zheng, L. Zhu, L. Fan, W. Zhao, J. Wang, X. Hao, Y. Zhu, X. Hu, Y.
Yuan, J. Shao, W. Wang, Eur. J. Med. Chem. 2017, 125, 902.
[6] X. Yang, W. Zhao, X. Hu, X. Hao, F. Hong, J. Wang, L. Xiang, Y. Zhu, Y.
Yuan, R. J. Y. Ho, W. Wang, J. Shao, Chem. Biol. Drug Des. 2015, 86, 1451.
[7] S. K. Koerner, J. Hanai, S. Bai, F. E. Jernigan, M. Oki, C. Komaba, E.
Shuto, V. P. Sukhatme, L. Sun, Eur. J. Med. Chem. 2017, 126, 920.
[8] J. Wu, Y. Y. Zhu, Y. H. Zhao, W. L. Shan, D. Y. Hu, J. X. Chen, D. Y. Liu,
X. Y. Li, S. Yang, Chin. Chem. Lett. 2016, 27, 948.
[22] M. Hasan, R. K. Leak, R. E. Stratford, D. P. Zlotos, P. A. Witt‐Enderby,
Pharmacol. Res. Perspect. 2018, 6, e00417.
[23] A. R. Katritzky, S. Rachwal, Chem. Rev. 2010, 110, 1564.
[24] L. Jin, C. H. Zhou, Acta Crystallogr. E 2010, 66, O1264.
[25] J. C. Stoclet, B. Muller, R. Andriantsitohaina, A. Kleschyov,
Biochemistry 1998, 63, 826.
[26] K. Chang, S. J. Lee, I. Cheong, T. R. Billiar, H. T. Chung, J. A. Han, Y. G.
Kwon, K. S. Ha, Y. M. Kim, Exp. Mol. Med. 2004, 36, 311.
[27] J. A. Mitchell, T. W. Evans, Inflamm. Res. 1998, 47, S88.
[28] J. A. Mitchell, T. D. Warner, Nat. Rev. Drug Discov. 2006, 5, 75.
[9] J. Wang, Y. Gan, S. Li, T. Luo, Y. Zhang, J. Zhao, Med. Chem. Res. 2014,
23, 2106.
[10] X. Zhu, X. Ye, L. Song, Y. Luo, Q. Tang, Y. Jin, X. Li, Med. Chem. Res.
2013, 22, 2228.
[11] X. Zhu, X. Ye, L. Yuan, Y. Ding, B. Zhang, X. Li, Med. Chem. Res. 2012,
21, 421.
SUPPORTING INFORMATION
[12] M. Park, J. Hong, Cells 2016, 5, 15.
Additional supporting information may be found online in the
Supporting Information section.
[13] M. Karin, Y. Ben‐Neriah, Annu. Rev. Immunol. 2000, 18, 621.
[14] A. Oeckinghaus, S. Ghosh, Cold Spring Harb. Perspect. Biol. 2009, 1,
a000034.
[15] T. Liu, L. Zhang, D. Joo, S. C. Sun, Signal Transduct. Target Ther. 2017,
2, e17023.
How to cite this article: Zhu X, Chen Q, Yang Y, Ai X, Chen S,
Song Y. Synthesis and anti‐inflammatory effects of novel
emodin derivatives bearing azole moieties. Arch Pharm Chem
Life Sci. 2019;e1900264.
[16] T. Murata, M. Shimada, S. Sakakibara, T. Yoshino, T. Masuda, T.
Shintani, H. Sato, Y. Koriyama, K. Fukushima, N. Nunami, M.
Yamauchi, K. Fuchikami, H. Komura, A. Watanabe, K. B. Ziegelbauer,
K. B. Bacon, T. B. Lowinger, Bioorg. Med. Chem. Lett. 2004, 14, 4019.
[17] T. Murata, M. Shimada, H. Kadono, S. Sakakibara, T. Yoshino, T.
Masuda, M. Shimazaki, T. Shintani, K. Fuchikami, K. B. Bacon, K. B.
Ziegelbauer, T. B. Lowinger, Bioorg. Med. Chem. Lett. 2004, 14, 4013.
https://doi.org/10.1002/ardp.201900264