A Methylidene Group in the Phosphonic Acid Analogue of Phenylalanine Reverses the Enantiopreference of Binding to Phenylalanine Ammonia-Lyases

Article abstract of DOI:10.1002/adsc.201700428

Aromatic amino acid ammonia-lyases and aromatic amino acid 2,3-aminomutases contain the post-translationally formed prosthetic 3,5-dihydro-4-methylidene-5H-imidazol-5-one (MIO) group. MIO enzymes catalyze the stereoselective synthesis of α- or β-amino acid enantiomers, making these chemical processes environmentally friendly and affordable. Characterization of novel inhibitors enables structural understanding of enzyme mechanism and recognizes promising herbicide candidates as well. The present study found that both enantiomers of the aminophosphonic acid analogue of the natural substrate phenylalanine and a novel derivative bearing a methylidene at the β-position inhibited phenylalanine ammonia-lyases (PAL), representing MIO enzymes. X-ray methods unambiguously determined the absolute configuration of all tested enantiomers during their synthesis. Enzyme kinetic measurements revealed the enantiomer of the methylidene-substituted substrate analogue as being a mirror image relation to the natural l-phenylalanine as the strongest inhibitor. Isothermal titration calorimetry (ITC) confirmed the binding constants and provided a detailed analysis of the thermodynamic driving forces of ligand binding. Molecular docking suggested that binding of the (R)- and (S)-enantiomers is possible by a mirror image packing. (Figure presented.).

Full text of DOI:10.1002/adsc.201700428

Title: Methylidene Group in Phosphonic Acid Analogue of
Phenylalanine Reverses the Enantiopreference of Binding to
Phenylalanine Ammonia-Lyases
Authors: Zsófia Bata, Renzhe Quian, Alexander Roller, Jeannie
Horak, László Csaba Bencze, Csaba Paizs, Friedrich
Hammerschmidt, Beáta G. Vértessy, and László Poppe
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: Adv. Synth. Catal. 10.1002/adsc.201700428
Link to VoR: http://dx.doi.org/10.1002/adsc.201700428

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
FULL PAPER
DOI: 10.1002/adsc.201((will be filled in by the editorial staff))
Methylidene Group in Phosphonic Acid Analogue of
Phenylalanine Reverses the Enantiopreference of Binding to
Phenylalanine Ammonia-Lyases
Zsófia Bata,a,b Renzhe Qian,c Alexander Roller,d Jeannie Horak,e László Csaba Bencze,f
Csaba Paizs,f Friedrich Hammerschmidt,c,* Beáta G. Vértessy,b,g,* László Poppea,f,*
a
Department of Organic Chemistry and Technology, Budapest University of Technology and Economics, Műegyetem
rkp. 3. H-1111, Budapest, Hungary
E-mail: poppe@mail.bme.hu
Institute of Enzymology, HAS-Research Center of Natural Sciences, Budapest, H-1117 Magyar tudósok krt. 2.
b
Budapest, Hungary
c
Institute of Organic Chemistry, University of Vienna, Währinger Str. 38. A-1090, Vienna, Austria
E-mail: friedrich.hammerschmidt@univie.ac.at
Institute of Inorganic Chemistry, University of Vienna, Währinger Str. 42. A-1090, Vienna, Austria
Institute of Pharmaceutical Sciences, Pharmaceutical (Bio-)Analysis, Eberhard-Karls-University Tübingen, Auf der
d
e
Morgensstelle 8, 72076 Tübingen, Germany
Biocatalysis and Biotransformation Research Centre, Faculty of Chemistry and Chemical Engineering, Babeș-Bolyai
f
University of Cluj-Napoca, Arany János Str. 11, RO-400028 Cluj-Napoca, Romania
Department of Applied Biotechnology and Food Science, Budapest University of Technology and Economics,
g
Műegyetem rkp. 3. H-1111, Budapest, Hungary
E-mail: vertessy@mail.bme.hu
Received: ((will be filled in by the editorial staff))
Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/adsc.201######.
Abstract. Aromatic amino acid ammonia-lyases and absolute configuration of all tested enantiomers during their
aromatic amino acid 2,3-aminomutases contain the post- synthesis. Enzyme kinetic measurements revealed the
translationally formed prosthetic 3,5-dihydro-4-methylidene- enantiomer of the methylidene substituted substrate
5H-imidazol-5-one (MIO) group. MIO-enzymes catalyze the analogue being mirror image relation to the natural L-
stereoselective synthesis of α- or β-amino acid enantiomers, phenylalanine as the strongest inhibitor. Isothermal titration
making these chemical processes environmentally friendly calorimetry (ITC) confirmed the binding constants and
and affordable. Characterization of novel inhibitors enables provided a detailed analysis of the thermodynamic driving
structural understanding of enzyme mechanism and forces of ligand binding. Molecular docking suggested that
recognize promising herbicide candidates as well. The binding of the (R)- and (S)-enantiomers is possible by a
present study found, that both enantiomers of the mirror image packing.
aminophosphonic acid analogue of the natural substrate
phenylalanine and a novel derivative bearing a methylidene
at the β-position inhibited phenylalanine ammonia-lyases
(PAL), representing MIO enzymes. X-ray methods
unambiguously determined the
Keywords: Amino acid; Bioinformatics; Calorimetry;
Enzyme inhibition; MIO enzyme; Aminophosphonic acid
Pharma Chemicals developed a method based on
PAL-catalyzed hydroamination of 2’-chlorocinnamic
acid for the production of (S)-2-indolinecarboxylic
acid on ton scale.[5]
Introduction
Phenylalanine ammonia-lyases catalyze the non-
oxidative ammonia elimination from L-phenylalanine
to yield (E)-cinnamic acid [(E)-CA].[1] They are most
commonly found in fungi and plants, where cinnamic
acid is the starting material for the biosynthesis of an
array of natural products ranging from flavonoids to
lignins.[2] Industrial applications make use of the
reverse reaction for the synthesis of unnatural amino
acids. In 1983, Genex Corporation patented a method
for the enzymatic production of L-phenylalanine, one
of the components of artificial sweetener dipeptide
aspartame.[3] Currently PALs are more widely used
for the synthesis of unnatural amino acids.[4] DSM
Related and structurally similar enzymes are L-
tyrosine (TAL)[6] and L-histidine ammonia-lyases
(HAL)[7] and L-tyrosine (TAM)[8] and L-
phenylalanine 2,3-amino-mutases (PAM).[9] These
enzymes all contain in their catalytic centers the 3,5-
dihydro-4-methylidene-5H-imidazol-5-one
(MIO)
electrophilic prosthetic group. This uncommon
cofactor is formed in autocatalytic way in a
posttranslational process from the adjacent amino
acids alanine-serine-glycine of the respective protein
by cyclisation and dehydration.[10] Despite of the
relatively low similarity between their sequences
1
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
(<30%), the tertiary and quaternary fold of all MIO
containing proteins is highly similar. Mutagenesis
studies showed that two tyrosines (TyrA and TyrB in
Scheme 1) are essential for catalysis in HAL,[11]
PAL,[12] and TAL.[13] These structural similarities
suggest that ammonia elimination proceeds by similar
mechanisms in all MIO enzymes.
Three mechanisms have been proposed for the
enzymatic elimination of ammonia involving MIO
(Scheme 1).
The N-MIO intermediate mechanism suggests that
the amino group of the substrate forms a covalent
bond with the electrophilic MIO residue of the
enzyme, that generates a better leaving group
(Scheme 1A, N-MIO intermediate pathway)). Most
likely, ammonia elimination from the covalent
intermediate proceeds by a stepwise process via a
carbanion intermediate (E1cB mechanism).[14]
protonated amino group as NH3. At last, the release
of MIO restores the aromaticity.[15]
Recently, a single-step mechanism was proposed
for TAL. It assumes a single transition state (TS) for
the deamination without the formation of a covalent
bond between the substrate and the MIO group
(Scheme 1C).[16]
Although some questions remain open about the
mechanism of action of MIO-enzymes, kinetic
isotope studies,[17] crystallographic data[18] and
computation studies[19] support the N-MIO
mechanism.
PALs show high enantioselectivity in the catalysis
of their natural substrate L-phenylalanine and its
analogues, but are also capable of binding the D-
enantiomers. It was found that PAL could catalyze
ammonia elimination from L-phenylalanine more
than 4500 times faster than from
D-
phenylalanine.[Fehler! Textmarke nicht definiert.] Moreover, D-
phenylalanine was found to be a competitive
inhibitor,[1] suggesting that the D-enantiomer can also
be bound to PAL. A recent study, involving three
PALs suggested that PALs are able to catalyze the
formation of the D-enantiomers of substrates with an
electron-deficient aromatic moiety by a slower and
MIO-independent pathway.[20]
A wide range of aromatic compounds inhibit PALs.
The D-phenylalanine is a general inhibitor of PALs,
as a mirror image packing is possible. This was
suggested based on similarities in Ki value of D-Phe
and Km value of L-Phe.[21] Further kinetic studies
investigating protection and inhibition provided more
evidence on binding of the opposite enantiomers and
led to a model suggesting mirror image packing of
the substrate enantiomers.[22] Interestingly, inhibition
by SH group containing compounds seemed to be
species specific.[23] A wide variety of substrate
analogues were studied as inhibitors of PAL in vitro
and in vivo for potential herbicide use.[24] The largest
inhibitory effects were found with 2-aminoindan-2-
phosphonic acid (AIP) (Ki = 25 nM) and (S)-2-
aminooxy-3-phenylpropanoic acid (AOPP) (Ki
= 0.38 nM).[25]
Besides kinetics studies, numerous methods are
routinely used to determine the binding affinity of
small molecules to proteins. Uniquely among the
techniques to measure protein-small molecule
interactions, isothermal titration calorimetry (ITC)
stands out, as it directly provides quantitative
thermodynamic parameters (ΔH is directly measured,
Kd is calculated from the titration curve, then ΔG and
ΔS are estimated).[26] This method is becoming
widely appreciated in measuring the affinity of
potential drug candidates to their protein targets.[27]
In spite of the usefulness of ITC to assess binding
of small molecules to enzymes, to our knowledge, no
direct calorimetric measurements were performed for
any MIO enzymes.
Scheme 1. Three proposed mechanisms of PAL-catalyzed
conversion of L-phenylalanine to (E)-CA. The reaction
proceeds via covalent intermediates in A) and B) or
through a single-step transition state C).
As the abstraction of the non-acidic -proton was
considered to be difficult by an amino acid base, a
Friedel-Crafts (FC) type mechanism was proposed
(Scheme 1B). The -hydrogens of phenylalanine
could be acidified by the positive charge in the
forming σ-complex. Thus TyrA can deprotonate the -
position with concomitant elimination of the
Here we present detailed enzyme kinetic and
equilibrium binding studies with PAL from
Petroselinum crispum (PcPAL) using three racemic
aminophosphonic acids [(±)-4, (±)-5, (±)-6, in dashed
2
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
box] and enantiopure forms of two further ones [(R)-
2, (S)-2 and (R)-3, (S)-3, in solid box] (Figure 1).
(±)-3, (S)-(+)-3 and (R)-(-)-3 in 61%, 74% and 68%
yield, respectively.
Results and Discussion
Aminophosphonic acids (R)-2, (S)-2 and (±)-4 are
known inhibitors PAL,[24] and included in this study
for comparative reasons. In compounds 3 and 6 the β-
carbon bears instead of hydrogens moieties which can
accept attack from nucleophiles from the active site
(either the exocyclic methylidene of MIO or a
catalytic tyrosine). Phosphahomocysteine (5) has in
place of the phenyl ring an SH group which may
interact with the methylidene group of MIO and thus
inhibit PAL.
On top of the detailed study with PcPAL,
inhibitory behavior of the enantiopure inhibitors [(R)-
2, (S)-2 and (R)-3, (S)-3] was tested with another
PALs of eukaryotic and prokaryotic origin
[Rhodosporidium toruloides (RtPAL) and Anabaena
variabilis (AvPAL); respectively]. Evaluation of the
inhibitory properties to these three different PALs
offers general insight regarding the binding
stereochemistry and its perturbation by the addition
of the methylidene group.
To complete the kinetic studies, we also provide a
full thermodynamic analysis for these inhibitory
molecules to the wild type and a specifically designed
Y110F mutant of PcPAL. Modulation of the binding
compared to the wild-type protein especially in the
methylidene substituted analogues argues for a
specific interaction between the methylidene moiety
and Tyr110 of the mobile, catalytically relevant loop
(called Tyr loop). As ITC has never been applied for
MIO enzymes, the present study contributes to the
understanding of the thermodynamics of substrate
binding to PAL with significant novelty.
Figure 1. Structures of investigated compounds. Note, that
configuration of (R)-2 and (R)-3 corresponds to that of L-
phenylalanine [(S)-1] due to the higher CIP rank of
phosphonic acid moiety compared to carboxylate group.
The mixture of Boc-protected aminophosphonates
7 was converted to racemic 2-propenylphosphonates
(±)-8 in 92% yield using H2O2 (in combination with
Me2NH having beneficial effect on yield[29]). The
enantiomers of 8 were separated by preparative
HPLC on a chiral stationary phase (Chiralpak IC
column;
tR = 15.05 and 30.97 min, both enantiomerically pure).
Figure 2A shows the (S) absolute configuration of the
less polar (+)-8 as determined by single crystal X-ray
structure analysis.
Surprisingly, the (S)-(+)-3 enantiomer proved to be
a more potent inhibitor of this enzyme than the (R)-(-
)-enantiomer. This finding was contrary to our initial
expectation, as we assumed at first that (S)-(+)-3,
corresponding to D-Phe [(R)-1], would be less potent
inhibitor than (R)-(-)-3, corresponding to the natural
substrate L-Phe [(S)-1]. To disclose any ambiguity, a
urea derivative of the more polar enantiomer (-)-8
was prepared. Figure 2B shows the result of the
single crystal X-ray structure analysis revealing that
substituted urea (-)-9 had (R)-configuration. This data
corroborated the previous absolute configuration
assignment for (R)-(-)-3.
Finally, a detailed docking study on the molecular
background of the binding of the various compounds
to AvPAL corroborate these conclusions.
Synthesis of α-Aminophosphonic Acids 2-6
As we aimed for racemic α-aminophosphonic acids
and in some cases also their pure enantiomers with ee
≥99% (Figure S8-S19), we opted first for the
preparation of the racemates. The enantiomers were
obtained by HPLC separation on a chiral stationary
phase. First, syntheses of aminophosphonic acids (±)-
2, (±)-4, (±)-5 and (±)-6 and the key intermediate (±)-
7 for the preparation of the phosphaphenylalanine
analogue (±)-3 were performed [see Supplementary
Information (SI)]. For the sake of clarity, only the
final steps of the synthesis of (±)-, (R)- and (S)-3 are
given in Scheme 2. Since the use of refluxing 6 M
HCl caused extensive decomposition of the labile α-
amino-2-propenylphosphonate, full deprotection of
the racemate and both enantiomers of 8 had to be
performed with TMSBr/allyl-TMS[28] at 55 °C for
18 h. By crystallization of the α-aminophosphonic
acids from water/i-PrOH gave colorless crystals of
Steady State Inhibition Studies with PcPAL
Initial reaction rates for deamination of L-Phe [(S)-1]
catalyzed by PcPAL were determined by UV
spectrometry detecting the formation of the (E)-CA
product at 290 nm.
Initial reaction rates (v0) as a function of the
substrate concentration determined the Michaelis
constant (Km) and the turnover number (kcat) of the
enzyme. Kinetic measurements in the presence of
inhibitors determined the inhibition constants (Ki).
The mechanism of inhibition could be determined by
comparing the fit of experimental data to different
3
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
inhibition models. Competitive, uncompetitive and
non-competitive inhibition models are most
commonly found, hence we tested these models in
our experiments. We note that structure of the tested
compounds suggests similar binding as the substrate,
potentially resulting in competitive inhibition.
suggested that the methylidene group had a
significant effect on binding of the (S)-enantiomers.
In contrast, the inhibition constants of (R)-3 and (R)-2
are similar.
The phenylglycine analogue (±)-4 was a weak
competitive inhibitor of PcPAL. Competitive
inhibition model with Ki = 41.5 µM, described best
the measured initial reaction rates (v0). The almost
one order of magnitude difference compared to
previous data [24c] is considerable, nonetheless (±)-4
was the weakest one amongst the effective PAL
inhibitors. The aromatic binding pocket of PcPAL
suited to accommodate a benzyl moiety seems to be
too large for the smaller phenyl ring of (±)-4, hence
the hydrophobic interactions with the aromatic
binding region of the active site pocket are less
pronounced.
In contrast to the preliminary expectations, (±)-5
and (±)-6 showed no measurable inhibition with
PcPAL up to 1 mM concentration. This is surprising
as Pseudomonas putida HAL (sequence identity to
PcPAL: 21%) was irreversibly inhibited by L-
homocysteine at 9 mM concentration after incubation
for 120 min in the presence of oxygen.[30] Initial
velocities of the (E)-CA formation with PcPAL were
identical when the reaction was started with the
addition of PcPAL to the test in the presence or in the
absence of (±)-5 or (±)-6 or the enzyme was
preincubated with (±)-5 for 60 min prior to activity
measurement. In case of (±)-6, the sterically
demanding cyclopropyl substituent at the β-carbon
atom presumably hindered the binding to PcPAL.
This hypothesis was later supported by molecular
docking.
Scheme 2. Preparation of α-aminophosphonic acids
(R)-(+)-3 and (S)-(‒)-3 with absolute configuration
assignment by X-ray method. Reaction conditions: a)
Me2NH, H2O2; b) TMSBr, allylTMS; c) H2O; d) HCl,
dioxane; e) 4-BrC6H4NCO, pyridine.
As expected, compound (R)-2 – the phosphonic
acid analogue of the L-Phe [(S)-1] – was one order of
magnitude stronger inhibitor than the opposite
enantiomer (S)-2 (Table 1). In close agreement with
data from the literature,[24] the competitive inhibition
model with Ki = 0.66 µM fitted best to the
experimental data for (R)-2. The Ki = 4.28 µM value
for (S)-2 was also in agreement with the previous
results on inhibition of PAL from maize.[24] The
enantiomers of aminophosphonic acids 2 and 3 were
purified to ≥99.6% ee values (Figure S17-S19), hence
inhibition by contaminating opposite enantiomers
could be ruled out.
Interestingly, introduction of a single methylidene
group at the C2-position of phosphonic acid analogue
2 resulting in a novel inhibitor 3 reversed the
enantiopreference of inhibition of PcPAL. In fact,
(S)-3 was one order of magnitude stronger inhibitor
than (R)-3. The inhibition constant of (S)-3 (Ki
= 0.04 µM) with PcPAL was only slightly higher
than that of AIP – the most potent aminophosphonic
Figure 2. Absolute configuration of (A) (S)-8 and (B) (R)-
9 determined by X-ray crystallography. Ellipsoid plot (left)
and stick (right) representations are shown.
PAL
inhibitor
(Ki = 0.025 µM).2[25] The fact that (S)-3 was two
orders of magnitude stronger inhibitor than (S)-2,
4
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
Slow Binding Inhibition of PcPAL by the
Phosphonic Acid Inhibitors (R)-2 and (S)-3
According to the first mechanism represented by
Eq. 2, binding of the inhibitor may be a slow process,
hence vz is independent of the inhibitor concentration.
According to another slow binding mechanism
represented by Eq. 3, an EI complex forms rapidly,
which subsequently undergoes changes to form the
strongly bound (EI)* complex. Due to the first fast
step in the second mechanism, vz depends on the
inhibitor concentration.
Figure 2B shows the first 30 s of the progress
curves of the product formation from L-Phe catalyzed
by PcPAL in absence and in presence of (S)-3. It was
clearly visible that even the early slope of the curves
depended on the inhibition concentrations, and the
fitted parameters confirmed this observation. This
favored the two-step slow binding mechanism
described by Eq. 3, where after an initial fast binding
process a slow change took place.
Addition of (S)-3 to the PcPAL-catalyzed reaction
resulted in nonlinear progress curves, as shown on
Figure 2A, corresponding to a change in the
enzymatic activity in a time dependent manner. The
nonlinear rate curves observed on the steady-state
time scale due to transient kinetics suggested slow
binding mechanism for the inhibitors.[31]
Table 1. Apparent inhibition constants and binding
equilibrium constants of the aminophosphonic acids 2-6.
[b]
Inh.
Type of
inh.[a]
Ki
[µM]
Ki_lit
[µM]
Kd,ITC
[µM]
(R)-2 SB-Comp.
(S)-2 Comp.
(R)-3 Comp.
(S)-3 SB-Comp.
(±)-4 Comp.
(±)-5 No inh.
0.66 ± 0.11 1.5[24a][c]
2.7
4.28 ± 0.11 11.6[24a][c] 5.2
0.64 ± 0.02
0.04 ± 0.01
41.5 ± 5.6
>1000
1.1
0.04
n.d.
n.d.
n.d.
6.5[24c]
(±)-6 No inh.
>1000
[a]
Best fitting inhibition model to the experimental data.
Comp.: competitive; SB-Comp: competitive with slow
binding of the inhibitor; No inh.: no measurable inhibition.
[b]
Details of the ITC measurements are described in the
next section. n.d.: not determined. [c] Inhibition constants
measured using PAL from maize (sequence identity with
PcPAL: 77%).
This behavior may originate from different
mechanisms at molecular level: (i) if there is a
transition-state-mimicking intermediate, (ii) if the
inhibitor exists in multiple forms, and only one of
which may interact with the enzyme, (iii) if only a
rare form of the enzyme binds the inhibitor or (iv) if
after an initial fast binding, slow structural
rearrangements form a second inhibitory complex.[32]
In kinetic analysis of slow binding inhibitors, the
integrated rate equation for the product concentration
(P) was derived by Frieden (Eq. 1).[33]
푃 = 푣 −푣 (1 − 푒−휆 푡) + 푣푠푡 + 푑
(1)
푧
푠
1
휆
This integrated rate equation determines the
velocities at time zero (vz), the steady-state velocities
(vs) and the frequency constant of the exponential
phase (λ). Steady state velocities determine the
apparent inhibitory constants. The two simplest slow
binging inhibition mechanisms – shown as Eq. 2 and
Eq. 3 – can be distinguished by the velocities at time
zero as a function of the inhibitor concentration.
Figure 3. Production curves of (E)-cinnamic acid [(E)-CA]
formation from L-Phe [(S)-1] catalyzed by PcPAL in
presence of various amounts of enantiopure (S)-3. Panel A
depicts progress curves at various inhibitor concentrations
for 5 min (for clear visibility only every 20th data points are
plotted). The curve in blue with empty dots shows the
production of (E)-CA in an assay containing PcPAL
preincubated with (S)-3 (2 μM). Panel B shows the initial
part of the progress curves at various inhibitor
concentrations (for 0.3 min, for better visibility only
5
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
production curves at 10 μM and 50 μM inhibitor
concentrations are plotted).
analogy, it is likely that (S)-3 is a general, strong
MIO enzyme inhibitor.
Thermodynamics of Ligand Binding to PcPAL
Although ITC proved to be a powerful tool to
characterize binding behavior of small molecules to
enzymes, to our knowledge, no direct calorimetric
measurements were performed for any MIO enzymes.
During an ITC measurement, a concentrated protein
solution is titrated with small portions of the ligand
solution in a way that heat change is measurable for
each injection producing a curved thermogram[34]
(representative thermograms for each measured
systems are included in Figure S20-S26). At the
beginning of the titration, practically all molecules of
the ligand in the first injection aliquots bind to the
protein, thus ΔH of the binding could be determined.
As by addition of further portions of ligand,
saturation is reached, the released heat decreases. The
rate of decrease provides the association constant (Ka)
of the binding from which the binding and
dissociation constants and ΔG of the binding can be
calculated. The C parameter determining the
Several possibilities could account for this behavior.
One possibility may be that deprotonation of the
enzyme or the ligand after the fast binding enforces
the interactions further. A second possibility may be
that in the slow change step a nucleophilic part of the
ligand forms a Michael adduct with the methylidene
group of the MIO. Finally, TyrA of the mobile loop of
the enzyme may also attack the methylidene group of
the ligand. It is noteworthy, that the frequently used
AIP also showed slow binding characteristics with
PcPAL, however by the one-step slow binding
mechanism (Eq. 2).[25] The enantiopure (R)-2 also
showed slow binding behavior, but to a smaller extent
than (S)-3. Interestingly, (R)-3 was not a slow binding
inhibitor. Differences in the binding kinetics
indicated that although the inhibition constants were
almost similar [Ki = 0.64 µM for (R)-3 and Ki = 0.66
µM for (S)-2], the binding mechanism was perturbed
by the addition of the methylidene group at the C2
position.
-1
curvature (C = [E]×Kd ) is suggested to be between
Decrease in the product formation rate after the
slow binding step might happen due to an irreversible
covalent binding. However, the progress curves
determined after preincubation of PcPAL with (S)-3
suggested reversible binding. The blue progress curve
with empty circles shown in Figure 3A was obtained
in a reaction started with addition of L-Phe to the
assay after preincubation of PcPAL with (S)-3 for 5
min. Increase of activity to a steady state level
indicated reversible binding of (S)-3. Additionally,
variation of the preincubation time between 1–60 min
did not alter the progress curves indicating that the
fast binding step was completed within 1 min.
10–1000 for efficient determination of the
thermodynamic parameters. In the present titration
experiments of the non-reactive D-Phe [(S)-1], and
both enantiomers of the aminophosphonates 2 and 3
with wt-PcPAL sufficient heat was generated in all
cases, however in some cases weak binding of the
ligands limited the accurate determination of the
binding enthalpy (Figure 4). Due to precipitation, the
protein concentration was limited to 10 mg mL-1
(0.125 µM of monomers). Thus, accurate
determination of all thermodynamic parameters was
limited to compounds with specific dissociation
constant being less than 12.5 µM (corresponding to C
= 10). Although binding entropies could not be
determined reliably for C <10, ITC can still be used
for determining dissociation constants and free
energies of binding.[35]
Inhibition of AvPAL and RtPAL by 2 and 3
In order to ascertain that effect of the methylidene
group on the binding was not PcPAL specific, but the
enantiomers of 2 and 3 are general inhibitors of
PALs, two other PALs were tested. In general, MIO
enzymes from prokaryotic and eukaryotic sources
differ structurally. Although MIO enzymes of both
origins have tetrameric structures, eukaryotic MIO
enzymes contain an additional domain at their C
terminal end, rendering each monomeric chain longer
by approximately 200 amino acids. Thus, in addition
to a further PAL of eukaryotic origin (RtPAL, 34%
sequence identity to PcPAL), another PAL of
prokaryotic origin (AvPAL, 27% sequence identity to
PcPAL) was also tested with the enantiomers of
aminophosphonic acid 3.
Experiments demonstrated that enantiomers of
both 2 and 3 were general inhibitors of PALs. The
enantiopure (R)-2 and (S)-2, furthermore (R)-3 and
(S)-3 inhibited AvPAL and RtPAL in a similar degree
as PcPAL (Table S10-S11). Previous results showed,
that although AIP has a non-substituted aromatic
ring, it could efficiently inhibit TAL as well.[18a] By
Figure 4. Thermodynamic binding energies of D-Phe
[(S)-1], and each enantiomers of the aminophosphonates 2
and 3 with wt-PcPAL measured by ITC. Free energies for
binding (ΔG) were calculated from the measured Ka, using
6
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
the equation ΔG = -RT×lnKa. The enthalpy contributions
were obtained by fitting to the titration curves and
entropies were calculated by ΔG = ΔH-TΔS.
The active site of MIO enzymes is covered by a
sequence of loops, including the catalytically
essential TyrA residue within the most inner one of
them. The possible role of TyrA in the elimination
reaction is shown in Figure 1. It was shown that
mutation of TyrA (at position 110 in PcPAL) to
phenylalanine resulted in an inactive protein.[12] By
assuming that Y110F mutation has no effect on the
overall protein structure, the effect of the mutation on
the binding energy can be determined directly using
ITC. As the Y110F mutation lead to catalytically
inactive protein,[12] ITC measurements with this
mutant could provide additional details on ligand
binding thermodynamics to PcPAL.
The Y110F mutation in PcPAL weakened the
binding for all investigated molecules (Table 2, and
Table S12-S18). Comparison of the binding
characteristics of several compounds to wt-PcPAL
and Y110F-PcPAL revealed (Table 3) small
contribution of Tyr110 to the binding (smaller than
required for a weak hydrogen bond, <0.8 kcal mol-1).
The effect of Y110F on the binding of (E)-CA served
as control. The planar orientation of the β-hydrogen
on (E)-CA, and its position in the crystal structure[18b]
suggest that there is no direct interaction between
Tyr110 and the (E)-CA product. Thus, differences in
the binding properties of (E)-CA to the two PcPAL
variants quantified the maximum perturbation caused
by Y110F mutation in the binding of substrates with
no direct interaction with Y110. Hence, effects with
ΔΔG <0.6 kcal mol-1 could be due to small
perturbation of the structure and/or natural
uncertainty of the experiments. Thus, we can only
state, that Y110F mutation influences significantly
the binding of (R)-2, (R)-3 and (S)-3.
Comparison of the inhibition constants of both
enantiomers of the aminophosphonates 2 and 3 with
the binding affinity measured by ITC revealed that K
values determined by the two methods were in
agreement (Table 1). Reasons of differences could be
the different protein concentration for kinetics and for
ITC, or the slight difference in the pH (8.8 for
kinetics and 8.0 for ITC).
Binding of either enantiomer of aminophosphonic
acids 2 and 3 was enthalpy driven (Figure 4, Table
S12-S18). Enthalpy contributions of the binding
process derives from hydrophobic interactions,
hydrophilic interactions and salt bridges between the
ligand and the protein. The non-significant binding
enthalpy difference between (R)-2 and (R)-3 (-
0.4 kcal mol-1), revealed that the methylidene group
had negligible effect on the binding affinity of the
aminophosphonates with (R) configuration. On the
other hand, presence of the methylidene group at C2
position increased the binding enthalpy of the (S)-
enantiomer of 3 by 3.1 kcal mol-1 compared to that of
(S)-2. This effect is in the range of the formation of
an additional hydrogen bond between the protein and
the ligand.
Solvent displacement contributes favorably to the
entropy of binding. On the other hand, if an initially
less ordered region – like a loop – adopts a more rigid
conformation, the entropy of the system decreases.
Thus, in such instance the overall binding free energy
becomes less negative. The lowest entropy
contributions were determined for the slow binding
inhibitors (R)-2 and (S)-3 (-1.2 kcal mol-1 and
-0.6 kcal mol-1, respectively). Somewhat larger
entropy contribution to the binding was observed for
(S)-2 and (R)-3 (-1.7 kcal mol-1 and -2.1 kcal mol-1,
respectively). As all of these compounds occupy the
same binding pocket, the solvent entropy
contributions should be equivalent for their binding.
The smaller entropy contribution with the slow
binding inhibitors (R)-2 and (S)-3 is therefore likely
due to a larger reduction of the entropy of the system
by more constraining the flexibility of protein loop(s).
Shift in the equilibrium binding constants
demonstrated that Tyr110 is directly involved in
binding of the enantiomeric forms of 3. The
perturbations in the binding free energies
[ΔΔG = 2.1 kcal mol-1 for (R)-3 and 0.9 kcal mol-1 for
(S)-3] were in the range of a weak hydrogen bond. It
is also possible that the hydroxyl group of Tyr110
forms a Michael adduct with the methylidene group
of 3, whose formation might be slow, accounting for
the slow binding behavior of (S)-3.
Table 2. Equilibrium binding constants and binding free
energy perturbation measured by ITC for the enantiomers
of substrate (1), for aminophosphonic acid inhibitors 2 and
3, and for (E)-cinnamic acid with wild type PcPAL and its
Y110F mutant.
A
dissociation constant of 12.6 µM was
determined for D-phenylalanine [(R)-1]. This value
was in the same order of magnitude as Km of L-
phenylalanine [(S)-1]. This argued that the same set
of molecular interactions were involved in binding of
L- and D-phenylalanine to PcPAL. This was in full
agreement with the early model suggesting mirror
image packing of the substrate enantiomers within
PAL,[22] and directly proved that D-phenylalanine
[(R)-1] could bind to the active site in a non-reactive
conformation.
Ligand
PcPAL_wt PcPAL_Y110F
ΔΔG
Kd [µM]
Kd [µM]
[kcal mol-1][a]
(R)-1
(S)-1
(R)-2
(S)-2
(R)-3
(S)-3
(E)-CA
12.6
n.a.
29.1
23.0
-0.5
n.a.
-0.7
-0.1
-2.1
-0.9
-0.6
2.7
8.9
5.2
6.2
1.1
0.04
6.5
35.3
0.17
16.6
Perturbation of Ligand Binding to PcPAL by the
Y110F Mutation
7
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
[a]
Differences in the binding free energies show the
binding. Values below -7 usually agrees with
acceptable binding.
contribution of the hydroxyl group of Tyr110 to the
binding energies. ΔΔG = ΔGwt – ΔGY110F
.
GScores could differentiate between binding and
non-binding compounds. Non-inhibiting compounds
5 and 6 docked frequently to the protein surface
outside of the active site. Even if they docked within
the active site, their GScores were poor (the best
GScores inside the active site were -6.2 for 5, and -
4.2 for 6). In contrast, inhibiting compounds 2, 3 and
4 docked mostly within the active site (Figure 5), and
their GScores predicted strong binding (lowest
GScores were -8.5 for 2, -9.8 for 3 and -8.6 for 4). D-
Phe and L-Phe [(R)-1 and (S)-1, respectively] and the
product [(E)-CA] docked exclusively inside the
active site, with good docking scores (GScores were -
11.2 for (S)-1, -5.9 for (R)-1, and -8.3 for (E)-CA).
The absence of the salt bridge between the carboxyl
group of (S)-1 and Arg317 of the protein resulted in
the poor docking score. GScores were -9.1 for (S)-1, -
10.5 for (R)-1, when docked to structure where Tyr78
(Tyr110 equivalent in AvPAL) was modelled in the
deprotonated form (Ligand 1 was docked in the
zwitterionic form). The carboxyl group of both
enantiomers of phenylalanine (1) formed a salt bridge
with Arg317, resulting in significantly better docking
scores, and indicating the importance of protonation
pattern during docking.
The similarity of equilibrium binding constants of
the enantiomers of phenylalanine, (R)-1 and (S)-1
(Kd = 29.1 µM for D-Phe and 23.0 µM for L-Phe,
respectively) to the Y110F-PcPAL mutant provided
direct evidence for their mirror image packing within
PcPAL.
Tyr110 - an essential residue in catalysis - lies in a
mobile loop region that plays an important role in
modulation of substrate binding and product
release.[19] Unfortunately, this loop was found in an
inactive “loop-out” conformation within the only
currently available crystal structure of PcPAL[36]
containing a dithiothreitol covalently bound to MIO.
Presumably, a strong interaction of a bound ligand
with Tyr110 can lead to stabilization of the loop and
thus enhance crystallization in catalytically relevant
conformation. Our attempts to crystallize PcPAL in
an apo form were unsuccessful, likely due to the high
mobility of these loops. However, the presence of the
strongest binding inhibitor (S)-3 enhanced
crystallization of PcPAL, and produced well
diffracting crystals. Analysis of the diffraction data is
underway; these results will be published in the near
future.
Docking of Compounds 1-6 to AvPAL
Molecular docking can contribute to the
understanding of binding of various inhibitors within
the PAL active site and can provide data on possible
distances between the MIO prosthetic group and
various parts of the ligands. The ITC results with the
Y110F mutant indicated that Tyr110 (Tyr78 in
AvPAL) could play an important role not only in the
catalysis but also in binding of the enantiomeric
forms of 3. As the only crystal structure of PcPAL
(PDB code: 1W27)[36] contained the critical Tyr-loop
in an inactive conformation, it was essential to find a
proper structural model with a catalytically capable
“loop-in” conformation of this essential loop.
Fortunately, a crystal structure determined for
unliganded AvPAL (PDB code: 3CZO)[37] had the
Tyr-loop in a catalytically relevant conformation. As
the aminophosphonic acid enantiomers 2 and 3
inhibited AvPAL similarly to PcPAL (see Section 9
in SI), the active site of AvPAL (with the MIO from
chain A) was selected as model site for docking
studies.
Glide algorithm docked all compounds represented
on Figure 1 to the structure of AvPAL.[38] Docking
score of Glide (GScore) is an empirical scoring
function used for the ranking of the ligand binding
conformations (poses). It was developed to
approximate the ligand binding free energy and
binding affinity prediction. Its numerous terms
include force field contributions and other terms
accounting for interactions known to influence ligand
Figure 5. Ligand binding within PALs. Docking results
(within apo AvPAL, in grey) are compared to ligands
bound to crystal structures (in green). Panel A shows (E)-
CA within a complexed structure of AvPAL (PDB code
3NZ4,[9] in green) overlaid with (E)-CA (in magenta)
docked into apo AvPAL (PDB code 3CZO, in grey). Panel
B depicts the poses of (R)-2 (cyan) and (S)-2 (yellow) with
the best docking scores within AvPAL (in grey). Panel C
shows the poses of (R)-3 (cyan) and (S)-3 (yellow) with the
best docking scores AvPAL (in grey). Panel D shows the
binding of AIP within a homologous protein structure
(PDB code 2O7E,[18a] in green).
8
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
Although compound (S)-3 is a weaker inhibitor
than L-AOPP, a non-aminophosphonic acid type
transition-state-mimicking compound being the
strongest inhibitor of PALs, but it is also less
sensitive and less reactive. Therefore, (S)-3 may have
high potential in ligand binding and structural studies
of MIO-enzymes. The usefulness of (S)-3 in
structural studies was indicated by the formation of
well diffracting crystals of PcPAL in the presence of
the strongest binding inhibitor, while trials to
crystallize PcPAL in its apo form were unsuccessful.
Moreover, similarly to AIP, both enantiomers of 3
could be further investigated as promising potential
herbicide candidates.
Docking poses found for the aminophosphonic
acids 2 and 3 revealed poses with phosphonic acid
function of the ligands forming three hydrogen bonds
within the carboxylate binding part of the active site
within AvPAL. Q311(B), R317(B) and N347(A)
located at the carboxylate binding region of the active
site are conserved in all known PALs, and also in
many other MIO enzymes as well.[19] Panels B, C and
D in Figure 5 show hydrogen bonding of the
phosphonic acid functional group of various
inhibitors. Apparently, the larger flexibility of the
enantiomers of aminophosphonates 2 and 3 allow
their mode of binding (Figure 5B,C; respectively) to
similar to that of cinnamic acid [(E)-CA, Figure 5A]
with hydrogen bonding distance to the conserved
carboxylate binding residues Q311, R317 and N347.
In contrast, the constrained structure of AIP enforced
a different mode of binding with less interactions to
the carboxylate binding residues within a TAL
structure (Figure 5D).
Experimental Section
General
All chemicals used for the biochemical measurements were
purchased from Sigma-Aldrich and Merck. Details of the
syntheses of aminophosphonic acids (±)-2, (±)-4, (±)-5 and
(±)-6 and the key intermediate (±)-7 for the preparation of
Docking found no significant differences for the
different enantiomers of 2 and 3, and could not
account for the direct effect of the methylidene group
on the binding free energies. This suggest that these
differences are due to differences in the protonation
state patterns and/or induced fitting effects of the
protein structure.
the
phosphaphenylalanine
analogue
(±)-3
and
characterization of the compounds are included as
Supplementary Information (SI). CCDC-1537722, CCDC-
1537723, CCDC-1537725, and CCDC-1537829 contain
the supplementary crystallographic data for this paper.
These data can be obtained free of charge from The
Cambridge
Crystallographic
Data
Centre
via
www.ccdc.cam.ac.uk/data_request/cif.
Protein Production and Purification
Conclusion
PcPAL (Uniprot code: P24481) was produced by
heterologous expression in E. coli-Rosetta, and was
purified with Ni-affinity chromatography, as described by
Dima et al.[39] Y110F mutant of PcPAL was created by site
directed mutagenesis following the protocol described by
Naismith and Liu[40] using the forward primer: CTGACTC
CTTCGGAGTAACTACTGGATTCGGAGCCACT and
Synthesis of, and enzyme kinetic and calorimetric
studies
with
racemic
and
enantiopure
aminophosphonic acids 2-6 as specific inhibitors of
phenylalanine ammonia-lyase and further MIO-
enzymes provided significant insights into the details
of ligand binding to PAL. Here we propose that for
MIO-enzymes having synthetic importance even on
industrial scale, compound (S)-3 may act as general
inhibitor with comparable inhibition to the less
reverse
primer:
GTTACTCCGAAGGAGTCAGTTCCCTT
GTTCATGGATCC. Mutagenesis was verified by
sequencing using T7-for, CAGAACATTACTCCCTGCTT
G and T7-rev, TTGACGTATCCAGAAACAAGG primers.
Both primers and sequencing were performed at the
Sequencing Service of Genomed (Debrecen, Hungary).
The length of the insert required the use of four primers to
cover the whole transcribed DNA region. Protein
production and purification followed the same protocol as
used for PcPAL.[39]
substrate
like
AIP
being
the
strongest
aminophosphonic acid type inhibitor for MIO-
enzymes so far. This compound binds by an
interesting slow binding mechanism, that may be due
to Michael adduct formation with Tyr110 and/or to
the sequential to stabilization of Tyr-loop.
AvPAL (Uniprot code: Q3M5Z3; with two surface
cysteines mutated to serine, C503S, C565S) and RtPAL
(Uniprot sequence code: P11544) were produced and
purified using a similar procedure as described for PcPAL.
Our study indicated for the first time that
isothermal titration calorimetry (ITC), could provide
valuable information for ligand binding to PAL and
further MIO-enzymes, as well. With the aid of
suitable point mutations – such as the Y110F
mutation in PcPAL – ITC was capable of estimating
the contribution of an individual residue and thus
provided significant contribution to the understanding
of ligand binding. By ITC with the catalytically
inactive Y110F-PcPAL, we could directly prove that
the non-reactive D-phenylalanine (R)-1 binds to
PcPAL almost as strong as the natural substrate L-
phenylalanine (S)-1.
Kinetic Assays
Initial reaction velocities of the PAL-catalyzed reaction of
L-phenylalanine [(S)-1] were determined in 100 mM TRIS,
pH 8.8 at 30 °C, using 0.01 mg mL-1 PcPAL by measuring
the (E)-cinnamic acid formation at 290 nm in a UV/Vis
spectrophotometer (Specord 200; Analytic Jena AG, Jena,
Germany). Extinction coefficient for (E)-cinnamic acid
was determined by 7-point calibration using solution (E)-
CA solutions in 100 mM TRIS (pH 8.8 at 30 °C). To
determine the Michaelis constant and the turnover number,
initial velocities were measured at nine substrate
concentrations between 75 µM and 10 mM. Inhibition
constants for the amino phosphonic acids 2 and 3 were
determined by measuring the initial product formation
9
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
rates at the same substrate concentration in the presence of
the inhibitor. When the regression coefficient of the linear
fit (R2) was lower than 0.999, in the slow binding
experiments with (S)-3 and (R)-2, the combination of a
linear and an exponential equation was fit to describe the
production curves. Steady state velocities were used for
determining the inhibition constant values. All
measurements were performed twice.
Non-inhibited kinetic parameters were obtained by
fitting the Michaelis-Menten equation to all data points
using the nls (non-linear least squares) fit in program R[41]
(with keeping all settings at their default values). The
mechanism of inhibition was determined by fitting the
competitive, non-competitive and uncompetitive inhibition
models to the measured data. The lowest value of the
residuals indicated the best fitting model, and thus the
mechanism of the inhibition. Visual comparison of the
fitted curves to the experimental data confirmed in all
cases the choice of mechanism.
Financial support for project NEMSyB, ID P37_273, Cod
MySMIS 103413 [funded by the Romanian Ministry for European
Funds, through the National Authority for Scientific Research
and Innovation (ANCSI) and co-funded by the European
Regional Development Fund, Competitiveness Operational
Program 2014-2020 (POC), Priority axis 1, Action 1.1] is
gratefully acknowledged. LCB thanks for the financial support
from the Swiss National Science Foundation (PROMYS grant).
LP, BGV and CP thank the support from COST Action CM1303
(SysBiocat). ZB thanks the UMN supercomputing institute for
granting access to their resources for the computational studies,
during the Fulbright Visiting Student Researcher period.
FH thanks Susanne Felsinger for recording NMR spectra, Elena
Macoratti for performing HPLC separations and Johannes
Theiner for combustion analyses. We would like to acknowledge
Klaudia Kovács and Lilla Vida for their contributions of the
preliminary inhibition studies, and Gergely Nagy for his advices
on the evaluation of ITC thermograms.
Isothermal Titration Calorimetry
References
ITC measurements were performed in a microcalorimeter
(MicroCal 200; GE Healthcare, Chicago, USA). Protein
solutions (~100 µM monomer units of PcPAL) were
titrated with 5 times more concentrated ligand solutions
using 20-25 injections. Initial delay, and time between two
injections was set to 180 s. Binding was measured at 30 °C
in TRIS (50 mM, pH 8.0, containing 1 mM of tris(2-
carboxyethyl)-phosphine, TCEP).
[1] D. S. Hodgins, J. Biol. Chem. 1971, 246, 2977–2985.
[2] M. Petersen, J. Hans, U. Matern in Annual Plant
Reviews: Biochemistry of Plant Secondary Metabolism,
2nd ed., Vol. 40 (Ed.: M. Wink), Wiley-Blackwell,
Oxford, 2010, pp. 182–257.
Titration curves were analyzed using the software and
methods described by Brautigam et al.[42] Thermograms
were integrated using NITPIC.[43] Binding thermodynamic
data was determined by fitting the A+B heteroassociation
model in SEDPHAT.[44] Confidence intervals for ΔH, Kd
and the stoichiometry of the binding were calculated at p
values corresponding to one σ level. The confidence
interval of Kd determined the one for ΔG, while the
minimal and maximal differences between the ΔH and ΔG
confidence intervals yielded the one for –TΔS. Data was
plotted using GUSSI.[45]
[3] Genex Corporation. US Pat. 4584269 A. 1986
[4] L. Poppe, C. Paizs, K. Kovács, F. D. Irimie, B. G.
Vértessy, Meth. Mol. Biol., 2012, 794, 3–19.
[5] B. de Lange, D. J. Hyett, P. J. D. Maas, D. Mink, F. B.
J. van Assema, N. Sereinig, A. H. M. de Vries, J. G. de
Vries, ChemCatChem, 2011, 3, 289–292.
[6] J. A. Kyndt, T. E. Meyer, M. A. Cusanovich, J. J. Van
Beeumen, FEBS Lett. 2002, 512, 240–244.
Molecular Docking
[7] a) L. Givot, T. A. Smith, R. H. Abeles, J. Biol. Chem.
1969, 244, 6341–6353; b) R. B. Wickner, J. Biol. Chem.
1969, 244, 6550–6552.
Docking was carried out in the crystal structure of AvPAL
(PDB code: 3CZO), having a catalytically active closed
conformation with intact Tyr-loop. Binding of L- and D-
phenylalanine [(S)-1 and (R)-1, respectively], the
aminophosphonic acid inhibitors [(S)-2, (R)-2, (S)-3, and
(R)-3] as well as (E)-cinnamic acid to the active site was
modeled by molecular docking.
Prior to docking, hydrogens were added to the structure
of AvPAL, and their positions were optimized using the
Protein Preparation Wizard in Maestro.[46] Protonation
states of the amino acid residues at pH 8.8 were set on the
basis of pKa estimation by ProPka.[47]
[8] a) S. D. Christenson, W. Liu, M. D. Toney, B. Shen, J.
Am. Chem. Soc. 2003, 125, 6062–6063; b) C. V.
Christianson, T. J. Montavon, S. G. Van Lanen, B.
Shen, S. D. Bruner, Biochemistry 2007, 46, 7205–7214.
[9] L. Feng, U. Wanninayake, S. Strom, J. Geiger, K. D.
Walker, Biochemistry 2011, 50, 2919–2930.
Docking was carried out using a rigid protein model
with a flexible ligand, by extra precision docking in
Glide.[38] The center of mass of the ligand was restricted to
a 20×20×20 Å box centered on the midpoint between the
MIO residue and Tyr78 of the tyrosine loop. The entire
ligand was restricted to a larger 40×40×40 Å box centered
at the same midpoint. The van der Waals (vdW) radii of
the hydrophobic residues (partial charge less than 0.2)
were scaled down to 80%. This reduced vdW radii of the
hydrophobic residues approximated a small degree of
enzyme flexibility. The vdW radii of the ligands were not
scaled. For other docking settings the default values were
kept. Ligand poses that encountered steric clashes, defined
as a sum of Coulomb and vdW interactions energies
>10 kcal mol-1, were discarded. Duplicate poses, defined
by an RMS deviation less than 1.0 Å or by a maximum
atomic displacement less than 1.5 Å from existing poses,
were also discarded.
[10] T. F. Schwede, J. Rétey, G. E. Schulz, Biochemistry
1999, 38, 5355–5361.
[11] D. Röther, L. Poppe, S. Viergutz, B. Langer, J. Rétey,
Eur. J. Biochem. 2001, 268, 6011–6019.
[12] D. Röther, L. Poppe, G. Morlock, S. Viergutz, J.
Rétey, Eur. J. Biochem. 2002, 269, 3065–3075.
[13] A. C. Schroeder, S. Kumaran, L. M. Hicks, R. E.
Cahoon, C. Halls, O. Yu, J. M. Jez, Phytochem. 2008,
69, 1496–1506.
[14] J. D. Hermes, P. M. Weiss, W. W. Cleland,
Biochemistry 1985, 24, 2959–2967.
[15] a) B. Schuster, J. Rétey, Proc. Natl. Acad. Sci. USA
1995, 92, 8433-8437; b) L. Poppe, J. Retey, Angew.
Chem. Int. Ed. 2005, 44, 3668–3688.
Acknowledgements
10
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
[16] G. P. Pinto, A. J. M. Ribeiro, M. J. Ramos, P. A.
Fernandes, M. Toscano, N. Russo, Arch. Biochem.
Biophys. 2015, 582, 107–115.
[34] M. W. Freyer, E. A. Lewis, Meth. Cell. Biol. 2008, 84,
79–113.
[35] W. B. Ternbull, A. H. Daranas, J. Am. Chem. Soc.,
2003, 125(48), 14859–14866.
[17] N. D. Ratnayake, U. Wanninayake, J. H. Geiger, K. D.
Walker, J. Am. Chem. Soc. 2011, 133, 8531–8533.
[36] H. Ritter, G. E. Schulz, Plant Cell 2004, 16, 3426–
[18] a) G. V. Louie, M. E. Bowman, M. C. Moffitt, T. J.
Baiga, B. S. Moore, J. P. Noel, Chem. Biol., 2006, 12,
1327–1338; b) G. G. Wybenga, W. Szymanski, B. Wu,
B. L. Feringa, D. B. Janssen, B. W. Dijkstra,
3436.
[37] L. Wang, A. Gamez, H. Archer, E. E. Abola, C. N.
Sarkissian, P. Fitzpartick, D. Wendt, Y. Zhang, M.
Vellard, J. Bliesath, S. M. Bell, J. F. Lemontt, C. R.
Scriver, R. C. Stevens, J. Mol. Biol., 2008, 380(4),
623–635.
Biochemistry, 2014, 53(19), 3187–3198.
[19] S. Pilbák, Ö. Farkas, L. Poppe, Chem. Eur. J. 2012,
18, 7793–7802.
[38] a) R. A Friesner, R. B. Murphy, M. P. Repasky, L. L.
Frye, J. R. Greenwood, T. A. Halgren, P. C.
Sanschagrin, D. T. Mainz, J. Med. Chem., 2006, 49,
6177–6196; b) Schrödinger Release 2015-3: Glide,
Schrödinger, LLC, New York, NY, 2015.
[20] S. L. Lovelock, R. C. Lloyd, N. J. Turner, Angew.
Chem. Int. Ed. 2014, 53, 4652–4656.
[21] E. A. Havir, K. R. Hanson, Biochemistry, 1968, 7(5),
1904–1914.
[39] N. A. Dima, A. Filip, L. C. Bencze, M. Oláh, P.
Sátorhelyi, B. G. Vértessy, L. Poppe, C. Paizs. Stud.
Univ. Babes-Bolyai, Ser. Chem., 2016, 61(2), 21–34.
[22] K. R. Hanson, Arch. Biochem. Biophys. 1981, 211(2),
575-588.
[23] M. J. MacDonald, G. B. D’Cunha, Biochem. Cell Biol.
2007, 85, 273–282.
[40] H. Liu, J. H. Naismith, BMC Biotechnol., 2008, 8,
91–101.
[24] a) B. Laber, H.-H. Kiltz, N. Amrhein, Z. Naturforsch
1986, 41C, 33–39; b) J. Zoń, N. Amrhein, Liebigs Ann.
Chem. 1992, 625–628. c) J. Zon, N. Amrhein, R.
Gancarz, Phytochemistry 2002, 59, 9–21.
[41] R Core Team (2016). R: A language and environment
for statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. URL https://www.R-
project.org/.
[25] C. Appert, J. Zon, N. Amrhein, Phytochemistry 2003,
62, 415–422.
[42] C. A. Brautigam, H. Zhao, C. Vargas, S. Keller, P.
Schuck. Nature Protocols, 2016, 11, 882–894.
[26] E. A. Lewis, K. P. Muphy in Protein-Ligand
Interactions, 1st ed., (Ed.: G. U. Nienhaus), Humana
Press Inc., Totowa, New Jersey, 2005 pp. 1–15.
[43] a) S. Keller, C. Vargas, H. Zhao, G. Piszczek, C. A.
Brautigam, P. Schuck, Anal. Chem., 2012, 11, 5066–
5073; b) T. H. Scheuermann, C. A. Brautigam,
Methods, 2015, 76, 87–98.
[27] J. E. Ladbury, G. Klebe, E. Freire. Nat. Rev. Drug
Discov. 2010, 9, 23–27.
[44] J. C. D. Houtman, P. H. Brown, B. Bowden, H.
Yamagushi, E. Appella, L. E. Samelson, P. Schuck,
Prot. Sci., 2007, 16, 30–42.
[28] H. J. Reich, S. Wollowitz, J. E. Trend, F. Chow, D. F.
Wendelborn, J. Org. Chem. 1978, 43, 1698–1705.
[45] C. A. Brautigam, Meth. Enzymol., 2015, 562, 109–133.
[29] F. Hammerschmidt, Liebigs Ann. Chem. 1991, 469–
475.
[46] Schrödinger Release 2015-3: Maestro, Schrödinger,
LLC, New York, NY, 2016.
[30] C. B. Klee, Biochemistry 1974, 13, 4501–4507.
[47] M. H. M. Olsson, C. R. Sondergaard, M. Rostkowski,
J. H. Jensen, J. Chem. Theory Comput. 2011, 7, 525–
537.
[31] J. F. Morrison, Trends Biochem. Sci., 1982, 7, 102–
105.
[32] A. Baici, Proc. 5th Beilstein ESCEC Symposium, 2011,
5, 55–73.
[33] C. Frieden, J. Biol. Chem. 1970, 245, 5788–5799.
11
This article is protected by copyright. All rights reserved.

10.1002/adsc.201700428
Advanced Synthesis & Catalysis
FULL PAPER
Methylidene Group in Phosphonic Acid Analogue
of Phenylalanine Reverses the Enantiopreference of
Binding to Phenylalanine Ammonia-Lyases
Adv. Synth. Catal. Year, Volume, Page – Page
Zsófia Bata, Renzhe Qian, Alexander Roller,
Jeannie Horak, László Csaba Bencze, Csaba Paizs,
Friedrich Hammerschmidt,* Beáta G. Vértessy,*
László Poppe*
12
This article is protected by copyright. All rights reserved.